#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SCNN1D	6339	broad.mit.edu	37	1	1222560	1222560	+	Nonsense_Mutation	SNP	C	C	A	rs542767253		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:1222560C>A	ENST00000338555.2	+	6	1843	c.699C>A	c.(697-699)taC>taA	p.Y233*	SCNN1D_ENST00000325425.8_Nonsense_Mutation_p.Y299*|SCNN1D_ENST00000379116.5_Nonsense_Mutation_p.Y397*|SCNN1D_ENST00000400928.3_Nonsense_Mutation_p.Y233*			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	233					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)	p.Y233*(1)|p.Y397*(1)		lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	AGGACTGGTACCACTTCCACT	0.642																																							uc001adu.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(697-699)TAC>TAA		sodium channel, nonvoltage-gated 1, delta							45.0	38.0	40.0					1																	1222560		2193	4288	6481	SO:0001587	stop_gained	6339							g.chr1:1222560C>A	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.699C>A	1.37:g.1222560C>A	ENSP00000339504:p.Tyr233*		Somatic				SCNN1D_uc001adt.1_Nonsense_Mutation_p.Y397*|SCNN1D_uc001adw.2_Nonsense_Mutation_p.Y299*|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Nonsense_Mutation_p.Y233*	p.Y233*	NM_002978	NP_002969	WXS	Illumina HiSeq	Unspecified				Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	8	1323	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)						A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Nonsense_Mutation	SNP	ENST00000338555.2	37	c.699C>A		.	.	.	.	.	.	.	.	.	.	C	45	11.706701	0.99593	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928;ENST00000379099	.	.	.	4.4	2.48	0.30137	.	0.000000	0.25894	U	0.027601	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3109	0.26473	0.0:0.6163:0.0:0.3837	.	.	.	.	X	264;397;233;299;233;24	.	ENSP00000321594:Y299X	Y	+	3	2	SCNN1D	1212423	0.087000	0.21565	0.508000	0.27688	0.020000	0.10135	0.891000	0.28309	0.287000	0.22375	0.313000	0.20887	TAC		0.642	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	NM_002978		7	29	1	0	0.00198382	0.001984	0.00210617	7	29				
MAD2L2	10459	broad.mit.edu	37	1	11740467	11740467	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:11740467G>T	ENST00000235310.3	-	5	1030	c.102C>A	c.(100-102)cgC>cgA	p.R34R	MAD2L2_ENST00000376667.3_Silent_p.R34R|MAD2L2_ENST00000376669.5_Silent_p.R34R|MAD2L2_ENST00000376672.1_Silent_p.R34R|MAD2L2_ENST00000376692.4_Silent_p.R34R			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	34	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with REV1 and REV3L and homodimerization.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.R34R(2)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTAGACCTCGCGCACGTAGA	0.627								DNA polymerases (catalytic subunits)																															uc001asp.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(100-102)CGC>CGA	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	MAD2 homolog							116.0	118.0	117.0					1																	11740467		2203	4300	6503	SO:0001819	synonymous_variant	10459				cell division|DNA damage response, signal transduction resulting in transcription|double-strand break repair|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of mitotic anaphase-promoting complex activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription, DNA-dependent|regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleoplasm|spindle|zeta DNA polymerase complex	JUN kinase binding	g.chr1:11740467G>T	AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.102C>A	1.37:g.11740467G>T			Somatic				MAD2L2_uc009vnc.2_Silent_p.R34R|MAD2L2_uc001asq.3_Silent_p.R34R	p.R34R	NM_006341	NP_006332	WXS	Illumina HiSeq	Unspecified	Q9UI95	MD2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	290	-	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	34			Mediates interaction with REV1 and REV3L and homodimerization.|HORMA.		B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Silent	SNP	ENST00000235310.3	37	c.102C>A	CCDS134.1																																																																																				0.627	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006344.2	NM_006341		15	184	1	0	2.35188e-11	0.006122	2.89185e-11	15	184				
RCC2	55920	broad.mit.edu	37	1	17755624	17755624	+	Silent	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:17755624T>A	ENST00000375436.4	-	3	544	c.357A>T	c.(355-357)cgA>cgT	p.R119R	RCC2_ENST00000375433.3_Silent_p.R119R	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	119					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.R119R(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		GCACTTCTTTTCGACCAATCA	0.443																																							uc001bal.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(355-357)CGA>CGT		regulator of chromosome condensation 2							147.0	122.0	130.0					1																	17755624		2203	4300	6503	SO:0001819	synonymous_variant	55920				cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle		g.chr1:17755624T>A		CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.357A>T	1.37:g.17755624T>A			Somatic				RCC2_uc001bam.2_Silent_p.R119R	p.R119R	NM_001136204	NP_001129676	WXS	Illumina HiSeq	Unspecified	Q9P258	RCC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	2	404	-		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	119			RCC1 1.		Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	37	c.357A>T	CCDS181.1																																																																																				0.443	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715		14	109	0	0	0	0.00499	0	14	109				
KIF17	57576	broad.mit.edu	37	1	21014237	21014237	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:21014237C>T	ENST00000247986.2	-	8	1892	c.1582G>A	c.(1582-1584)Gaa>Aaa	p.E528K	KIF17_ENST00000490034.1_Intron|KIF17_ENST00000400463.3_Missense_Mutation_p.E528K|KIF17_ENST00000375044.1_Missense_Mutation_p.E428K			Q9P2E2	KIF17_HUMAN	kinesin family member 17	528					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.E528K(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TTGGAGGGTTCCACCTTGGGC	0.562																																							uc001bdr.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1582-1584)GAA>AAA		kinesin family member 17 isoform a							70.0	69.0	70.0					1																	21014237		2203	4300	6503	SO:0001583	missense	57576				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding	g.chr1:21014237C>T	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1582G>A	1.37:g.21014237C>T	ENSP00000247986:p.Glu528Lys		Somatic				KIF17_uc001bdp.3_5'Flank|KIF17_uc001bdq.3_5'Flank|KIF17_uc009vpx.2_Intron|KIF17_uc001bds.3_Missense_Mutation_p.E528K	p.E528K	NM_020816	NP_065867	WXS	Illumina HiSeq	Unspecified	Q9P2E2	KIF17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)	8	1700	-		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	528					A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	c.1582G>A	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372453	0.24857	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71103	-0.54;-0.42;-0.42	5.18	4.27	0.50696	.	.	.	.	.	T	0.62073	0.2398	L	0.47716	1.5	0.09310	N	1	B;B	0.32829	0.386;0.278	B;B	0.31337	0.128;0.039	T	0.50701	-0.8797	9	0.27082	T	0.32	.	11.1579	0.48499	0.0:0.7847:0.2153:0.0	.	528;528	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	K	428;528;528	ENSP00000364184:E428K;ENSP00000383311:E528K;ENSP00000247986:E528K	ENSP00000247986:E528K	E	-	1	0	KIF17	20886824	0.006000	0.16342	0.002000	0.10522	0.022000	0.10575	1.884000	0.39668	1.401000	0.46761	0.591000	0.81541	GAA		0.562	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816		19	98	0	0	0	0.012319	0	19	98				
USP48	84196	broad.mit.edu	37	1	22030794	22030794	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:22030794C>G	ENST00000308271.9	-	20	3124	c.2476G>C	c.(2476-2478)Gat>Cat	p.D826H	USP48_ENST00000529637.1_Missense_Mutation_p.D838H|USP48_ENST00000400301.1_Missense_Mutation_p.D826H|USP48_ENST00000374732.3_Missense_Mutation_p.D364H	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	826					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.D826H(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GGGTTTACATCTCCCACTTCA	0.373																																							uc001bfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(2476-2478)GAT>CAT		ubiquitin specific protease 48 isoform a							93.0	93.0	93.0					1																	22030794		2203	4300	6503	SO:0001583	missense	84196				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:22030794C>G	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2476G>C	1.37:g.22030794C>G	ENSP00000309262:p.Asp826His		Somatic				USP48_uc001bfa.2_Missense_Mutation_p.D364H|USP48_uc010odq.1_Missense_Mutation_p.D838H|USP48_uc009vqc.2_Missense_Mutation_p.D760H|USP48_uc001bfc.2_Missense_Mutation_p.D826H|USP48_uc001bfd.1_5'UTR	p.D826H	NM_032236	NP_115612	WXS	Illumina HiSeq	Unspecified	Q86UV5	UBP48_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)	20	2714	-		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	826					B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	c.2476G>C	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406384	0.25378	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T	0.05447	3.44;3.45;3.44	5.52	5.52	0.82312	.	0.345944	0.34223	N	0.004155	T	0.08358	0.0208	L	0.40543	1.245	0.09310	N	1	P;B;P;P;P	0.51653	0.694;0.031;0.643;0.947;0.846	B;B;B;P;P	0.44946	0.243;0.01;0.247;0.453;0.465	T	0.21075	-1.0256	10	0.56958	D	0.05	.	11.835	0.52319	0.0:0.9205:0.0:0.0795	.	838;826;826;826;364	B7ZKS7;B7ZKS3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;UBP48_HUMAN;.	H	826;826;364;838	ENSP00000383157:D826H;ENSP00000309262:D826H;ENSP00000431949:D838H	ENSP00000309262:D826H	D	-	1	0	USP48	21903381	0.380000	0.25131	0.814000	0.32528	0.504000	0.33889	2.143000	0.42187	2.590000	0.87494	0.655000	0.94253	GAT		0.373	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		14	110	0	0	0	0.00245	0	14	110				
DHDDS	79947	broad.mit.edu	37	1	26774059	26774059	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:26774059G>T	ENST00000236342.7	+	6	543	c.450G>T	c.(448-450)ctG>ctT	p.L150L	DHDDS_ENST00000526219.1_Silent_p.L111L|DHDDS_ENST00000427245.2_Silent_p.L150L|DHDDS_ENST00000525682.2_Intron|DHDDS_ENST00000360009.2_Silent_p.L150L|DHDDS_ENST00000374185.3_Silent_p.L150L			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	150					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)	p.L150L(1)		breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGTGTTTCCTGAATGTCTGTT	0.507																																							uc001bml.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)	3						c.(448-450)CTG>CTT		dehydrodolichyl diphosphate synthase isoform b							152.0	136.0	142.0					1																	26774059		2203	4300	6503	SO:0001819	synonymous_variant	79947						protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups	g.chr1:26774059G>T	AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.450G>T	1.37:g.26774059G>T			Somatic				DHDDS_uc001bmk.2_Silent_p.L150L|DHDDS_uc001bmm.2_Silent_p.L57L|DHDDS_uc001bmn.2_Silent_p.L111L|DHDDS_uc010ofd.1_Intron	p.L150L	NM_205861	NP_995583	WXS	Illumina HiSeq	Unspecified	Q86SQ9	DHDDS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)	6	571	+		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	150					B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Silent	SNP	ENST00000236342.7	37	c.450G>T	CCDS282.1	.	.	.	.	.	.	.	.	.	.	G	9.501	1.103103	0.20632	.	.	ENSG00000117682	ENST00000416052	.	.	.	5.93	-0.823	0.10815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.5445	6.8378	0.23945	0.3098:0.3958:0.2944:0.0	.	.	.	.	X	27	.	.	E	+	1	0	DHDDS	26646646	1.000000	0.71417	0.972000	0.41901	0.992000	0.81027	0.765000	0.26546	-0.159000	0.11021	0.655000	0.94253	GAA		0.507	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392504.1	NM_024887		6	66	1	0	2.0095e-06	0.001984	2.30614e-06	6	66				
ERICH3	127254	broad.mit.edu	37	1	75038823	75038823	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:75038823G>T	ENST00000326665.5	-	14	2789	c.2571C>A	c.(2569-2571)gaC>gaA	p.D857E	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		857	Glu-rich.							p.D857E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTCCTATGGGGTCTGACCCCC	0.527																																							uc001dgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(2569-2571)GAC>GAA		hypothetical protein LOC127254							137.0	133.0	135.0					1																	75038823		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75038823G>T																												ENST00000326665.5:c.2571C>A	1.37:g.75038823G>T	ENSP00000322609:p.Asp857Glu		Somatic					p.D857E	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			14	2790	-			857			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.2571C>A	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	9.492	1.101010	0.20552	.	.	ENSG00000178965	ENST00000326665	T	0.12465	2.68	5.19	-2.86	0.05717	.	.	.	.	.	T	0.01421	0.0046	N	0.22421	0.69	0.09310	N	1	B	0.32467	0.372	B	0.27796	0.083	T	0.43540	-0.9385	9	0.02654	T	1	1.5713	6.983	0.24713	0.408:0.2035:0.3885:0.0	.	857	Q5RHP9	CA173_HUMAN	E	857	ENSP00000322609:D857E	ENSP00000322609:D857E	D	-	3	2	C1orf173	74811411	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.666000	0.01963	-0.627000	0.05589	-0.797000	0.03246	GAC		0.527	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			25	207	1	0	1.17739e-12	0.005443	1.47022e-12	25	207				
ST6GALNAC3	256435	broad.mit.edu	37	1	76779523	76779523	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:76779523G>A	ENST00000328299.3	+	2	200	c.52G>A	c.(52-54)Gcg>Acg	p.A18T		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	18					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.A18T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						CTTCATAGCAGCGTTCCTTTT	0.403																																							uc001dhh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(52-54)GCG>ACG		sialyltransferase 7C isoform 1							216.0	188.0	197.0					1																	76779523		2203	4300	6503	SO:0001583	missense	256435				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:76779523G>A		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.52G>A	1.37:g.76779523G>A	ENSP00000329214:p.Ala18Thr		Somatic				ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.A18T|ST6GALNAC3_uc010orh.1_Intron	p.A18T	NM_152996	NP_694541	WXS	Illumina HiSeq	Unspecified	Q8NDV1	SIA7C_HUMAN			2	215	+			18			Helical; Signal-anchor for type II membrane protein; (Potential).		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	c.52G>A	CCDS672.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072536	0.36566	.	.	ENSG00000184005	ENST00000394994;ENST00000328299;ENST00000394993	T	0.33216	1.42	5.26	4.33	0.51752	.	0.583893	0.18577	N	0.137166	T	0.08891	0.0220	L	0.29908	0.895	0.26115	N	0.980625	B;B	0.33238	0.18;0.403	B;B	0.33121	0.076;0.158	T	0.14035	-1.0487	10	0.33141	T	0.24	-16.9481	8.3567	0.32335	0.0831:0.164:0.7529:0.0	.	18;18	Q8NDV1;Q8NDV1-2	SIA7C_HUMAN;.	T	18;18;17	ENSP00000329214:A18T	ENSP00000329214:A18T	A	+	1	0	ST6GALNAC3	76552111	0.971000	0.33674	0.932000	0.37286	0.955000	0.61496	3.759000	0.55227	1.178000	0.42870	0.491000	0.48974	GCG		0.403	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		15	116	0	0	0	0.004007	0	15	116				
GBP6	163351	broad.mit.edu	37	1	89846103	89846103	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:89846103C>T	ENST00000370456.4	+	6	877	c.784C>T	c.(784-786)Cag>Tag	p.Q262*	GBP6_ENST00000535065.1_Nonsense_Mutation_p.Q132*	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	262	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.Q262*(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TCCCAAATTCCAGGAACAAAC	0.438																																							uc001dnf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(784-786)CAG>TAG		guanylate binding protein family, member 6							78.0	73.0	75.0					1																	89846103		2203	4300	6503	SO:0001587	stop_gained	163351						GTP binding|GTPase activity	g.chr1:89846103C>T	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.784C>T	1.37:g.89846103C>T	ENSP00000359485:p.Gln262*		Somatic				GBP6_uc010ost.1_Nonsense_Mutation_p.Q132*	p.Q262*	NM_198460	NP_940862	WXS	Illumina HiSeq	Unspecified	Q6ZN66	GBP6_HUMAN		all cancers(265;0.0108)|Epithelial(280;0.0398)	6	1058	+		Lung NSC(277;0.0908)	262					A2RRM3|Q6ZN86|Q7Z3F0	Nonsense_Mutation	SNP	ENST00000370456.4	37	c.784C>T	CCDS723.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229399	0.79688	.	.	ENSG00000183347	ENST00000544311;ENST00000370456;ENST00000535065	.	.	.	4.8	2.64	0.31445	.	1.649840	0.03508	N	0.219131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	1.847	8.0141	0.30370	0.3148:0.5461:0.1391:0.0	.	.	.	.	X	233;262;132	.	ENSP00000359485:Q262X	Q	+	1	0	GBP6	89618691	0.020000	0.18652	0.011000	0.14972	0.003000	0.03518	0.763000	0.26517	0.977000	0.38444	-0.282000	0.10007	CAG		0.438	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460		8	47	0	0	0	0.006214	0	8	47				
PPM1J	333926	broad.mit.edu	37	1	113253122	113253122	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:113253122C>G	ENST00000309276.6	-	9	1505	c.1330G>C	c.(1330-1332)Gac>Cac	p.D444H	RP11-426L16.10_ENST00000606505.1_Missense_Mutation_p.G125A|RP11-426L16.10_ENST00000471038.2_5'UTR|PPM1J_ENST00000464951.1_Missense_Mutation_p.D238H|PPM1J_ENST00000359994.4_Missense_Mutation_p.D238H	NM_005167.5	NP_005158.5	Q5JR12	PPM1J_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1J	444	PP2C-like.				protein dephosphorylation (GO:0006470)		protein serine/threonine phosphatase activity (GO:0004722)	p.D444H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	14	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCACCCTGTCCACAGTGGCA	0.547																																							uc001ect.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(1330-1332)GAC>CAC		protein phosphatase 1J (PP2C domain containing)							117.0	101.0	107.0					1																	113253122		2203	4300	6503	SO:0001583	missense	333926							g.chr1:113253122C>G	AK093270	CCDS855.2	1p13.1	2012-04-17	2010-03-05		ENSG00000155367	ENSG00000155367	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	20785	protein-coding gene	gene with protein product	"""protein phosphatase 2C zeta"""	609957	"""protein phosphatase 1J (PP2C domain containing)"""			12633878	Standard	NM_005167		Approved	FLJ35951, MGC19531, DKFZp434P1514, PP2Czeta, PPP2CZ	uc001ect.1	Q5JR12	OTTHUMG00000012019	ENST00000309276.6:c.1330G>C	1.37:g.113253122C>G	ENSP00000308926:p.Asp444His		Somatic				PPM1J_uc009wgl.1_RNA|PPM1J_uc001ecs.1_Missense_Mutation_p.D238H	p.D444H	NM_005167	NP_005158	WXS	Illumina HiSeq	Unspecified	Q5JR12	PPM1J_HUMAN		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	9	1357	-	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)	444			PP2C-like.		B3KSB7|Q6DKJ7|Q96EZ7|Q9UF84	Missense_Mutation	SNP	ENST00000309276.6	37	c.1330G>C	CCDS855.2	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603504	0.46423	.	.	ENSG00000155367	ENST00000309276;ENST00000359994	T;T	0.16743	2.32;2.32	5.51	5.51	0.81932	Protein phosphatase 2C-like (5);	0.352847	0.31936	N	0.006824	T	0.05227	0.0139	N	0.01168	-0.975	0.32861	D	0.507915	D;P	0.56287	0.975;0.931	P;P	0.60173	0.87;0.689	T	0.09952	-1.0651	10	0.41790	T	0.15	-24.9223	5.5711	0.17198	0.169:0.6795:0.0:0.1515	.	444;238	Q5JR12;Q5JR12-2	PPM1J_HUMAN;.	H	444;238	ENSP00000308926:D444H;ENSP00000353088:D238H	ENSP00000308926:D444H	D	-	1	0	PPM1J	113054645	0.990000	0.36364	1.000000	0.80357	0.844000	0.47949	1.630000	0.37081	2.603000	0.88011	0.491000	0.48974	GAC		0.547	PPM1J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033251.1	NM_005167		12	68	0	0	0	0.008871	0	12	68				
LOC728989	728989	broad.mit.edu	37	1	146494510	146494510	+	IGR	SNP	T	T	C	rs11585592|rs34958799	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:146494510T>C								RP4-704D21.2 (19333 upstream) : RNVU1-8 (56784 downstream)																							TGCCAGGCAGTGCAGGGATGT	0.557													.|||	1678	0.335064	0.3328	0.2723	5008	,	,		20743	0.2758		0.4732	False		,,,				2504	0.3016						uc001epd.2		NA																	0					0						c.(487-489)GCA>GCG		SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;																																				SO:0001628	intergenic_variant	728989							g.chr1:146494510T>C																													1.37:g.146494510T>C			Somatic					p.A163A	NR_024442		WXS	Illumina HiSeq	Unspecified					4	563	-									Silent	SNP		37	c.489A>G																																																																																				0	0.557									4	26	0	0	0	0.009096	0	4	26				
HRNR	388697	broad.mit.edu	37	1	152191367	152191367	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:152191367G>T	ENST00000368801.2	-	3	2813	c.2738C>A	c.(2737-2739)tCc>tAc	p.S913Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	913					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S913Y(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCGACCGGAGCCAGACCC	0.637																																							uc001ezt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(2737-2739)TCC>TAC		hornerin							125.0	138.0	134.0					1																	152191367		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152191367G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2738C>A	1.37:g.152191367G>T	ENSP00000357791:p.Ser913Tyr		Somatic					p.S913Y	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2814	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		913			10.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.2738C>A	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	5.254	0.232393	0.09969	.	.	ENSG00000197915	ENST00000368801	T	0.01767	4.65	3.49	1.38	0.22167	.	.	.	.	.	T	0.00845	0.0028	N	0.14661	0.345	0.09310	N	1	D	0.65815	0.995	P	0.56278	0.795	T	0.51616	-0.8683	9	0.48119	T	0.1	.	4.1874	0.10404	0.118:0.0:0.4493:0.4327	.	913	Q86YZ3	HORN_HUMAN	Y	913	ENSP00000357791:S913Y	ENSP00000357791:S913Y	S	-	2	0	HRNR	150457991	0.228000	0.23718	0.000000	0.03702	0.011000	0.07611	1.279000	0.33191	0.219000	0.20840	0.498000	0.49722	TCC		0.637	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		21	190	1	0	2.50493e-22	0.004656	3.24564e-22	21	190				
SHC1	6464	broad.mit.edu	37	1	154940731	154940731	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:154940731G>A	ENST00000368445.5	-	5	967	c.753C>T	c.(751-753)atC>atT	p.I251I	SHC1_ENST00000368453.4_Silent_p.I141I|SHC1_ENST00000606391.1_Silent_p.I52I|SHC1_ENST00000448116.2_Silent_p.I251I|SHC1_ENST00000368450.1_Silent_p.I141I|SHC1_ENST00000368449.4_Silent_p.I22I|SHC1_ENST00000490667.1_5'Flank	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	251	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.I141I(1)|p.I251I(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGTTGGCGATGATCTGAGAAT	0.567																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)	NSCLC(4;32 234 1864 2492 3259 13747 17376)	uc001ffv.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)|skin(1)	2						c.(751-753)ATC>ATT		SHC-transforming protein 1 isoform 1							234.0	230.0	231.0					1																	154940731		2203	4300	6503	SO:0001819	synonymous_variant	6464				activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr1:154940731G>A	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.753C>T	1.37:g.154940731G>A			Somatic				SHC1_uc001ffu.2_5'Flank|SHC1_uc001ffz.1_Silent_p.I22I|SHC1_uc001ffw.2_Silent_p.I251I|SHC1_uc001ffx.2_Silent_p.I141I|SHC1_uc001ffy.2_Silent_p.I141I	p.I251I	NM_183001	NP_892113	WXS	Illumina HiSeq	Unspecified	P29353	SHC1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		5	974	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		251			PID.		B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Silent	SNP	ENST00000368445.5	37	c.753C>T	CCDS30881.1																																																																																				0.567	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001		19	254	0	0	0	0.006122	0	19	254				
FAM129A	116496	broad.mit.edu	37	1	184863220	184863220	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:184863220C>T	ENST00000367511.3	-	3	500	c.307G>A	c.(307-309)Gag>Aag	p.E103K		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	103					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E103K(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TCTTTATTCTCATAGCTCTCC	0.378																																							uc001gra.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(307-309)GAG>AAG		niban protein isoform 2							219.0	213.0	215.0					1																	184863220		2203	4300	6503	SO:0001583	missense	116496				negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane		g.chr1:184863220C>T	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.307G>A	1.37:g.184863220C>T	ENSP00000356481:p.Glu103Lys		Somatic				FAM129A_uc009wyh.1_Missense_Mutation_p.E103K|FAM129A_uc009wyi.1_Intron	p.E103K	NM_052966	NP_443198	WXS	Illumina HiSeq	Unspecified	Q9BZQ8	NIBAN_HUMAN			3	501	-			103					Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	c.307G>A	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856492	0.71834	.	.	ENSG00000135842	ENST00000367511	T	0.12672	2.66	5.31	5.31	0.75309	.	0.156942	0.56097	D	0.000027	T	0.20373	0.0490	M	0.71036	2.16	0.46416	D	0.999032	P	0.42296	0.775	B	0.39660	0.306	T	0.01212	-1.1417	10	0.56958	D	0.05	-21.6066	16.0062	0.80363	0.0:1.0:0.0:0.0	.	103	Q9BZQ8	NIBAN_HUMAN	K	103	ENSP00000356481:E103K	ENSP00000356481:E103K	E	-	1	0	FAM129A	183129843	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	4.725000	0.61979	2.763000	0.94921	0.557000	0.71058	GAG		0.378	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1			9	114	0	0	0	0.010729	0	9	114				
ASPM	259266	broad.mit.edu	37	1	197112595	197112595	+	Missense_Mutation	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:197112595T>G	ENST00000367409.4	-	3	1043	c.787A>C	c.(787-789)Agt>Cgt	p.S263R	ASPM_ENST00000294732.7_Missense_Mutation_p.S263R	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	263					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.S263R(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACGTTGGCACTGTGTACATTT	0.378																																							uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(787-789)AGT>CGT		asp (abnormal spindle)-like, microcephaly							109.0	104.0	106.0					1																	197112595		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197112595T>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.787A>C	1.37:g.197112595T>G	ENSP00000356379:p.Ser263Arg		Somatic				ASPM_uc001gtv.2_Missense_Mutation_p.S263R|ASPM_uc001gtw.3_Intron	p.S263R	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			3	1044	-			263					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.787A>C	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	4.976	0.181334	0.09495	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.57273	0.41;1.69	5.11	-0.0522	0.13823	.	1.379260	0.04260	N	0.340165	T	0.35653	0.0939	N	0.24115	0.695	0.09310	N	1	B;P	0.38335	0.049;0.627	B;B	0.28553	0.017;0.091	T	0.34725	-0.9817	10	0.52906	T	0.07	.	9.1017	0.36673	0.0:0.6295:0.0:0.3705	.	263;263	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	R	263	ENSP00000356379:S263R;ENSP00000294732:S263R	ENSP00000294732:S263R	S	-	1	0	ASPM	195379218	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.983000	0.01488	0.019000	0.15079	-0.394000	0.06481	AGT		0.378	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		11	94	0	0	0	0.008291	0	11	94				
PPP1R15B	84919	broad.mit.edu	37	1	204379201	204379201	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:204379201C>G	ENST00000367188.4	-	1	1718	c.1339G>C	c.(1339-1341)Gat>Cat	p.D447H	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	447					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.D447H(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TCATCCCAATCCTCACCTTCT	0.458																																							uc001hav.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1339-1341)GAT>CAT		protein phosphatase 1, regulatory subunit 15B							135.0	135.0	135.0					1																	204379201		2203	4300	6503	SO:0001583	missense	84919				regulation of translation			g.chr1:204379201C>G	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1339G>C	1.37:g.204379201C>G	ENSP00000356156:p.Asp447His		Somatic					p.D447H	NM_032833	NP_116222	WXS	Illumina HiSeq	Unspecified	Q5SWA1	PR15B_HUMAN	all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)		1	1744	-	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		447					Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	c.1339G>C	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751441	0.49257	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.26373	1.74	4.76	1.83	0.25207	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.711544	0.13382	N	0.392046	T	0.44973	0.1319	M	0.72118	2.19	0.19775	N	0.999957	D	0.71674	0.998	D	0.66847	0.947	T	0.22556	-1.0213	10	0.87932	D	0	-1.688	8.519	0.33264	0.0:0.7502:0.0:0.2498	.	447	Q5SWA1	PR15B_HUMAN	H	447;357	ENSP00000356156:D447H	ENSP00000356156:D447H	D	-	1	0	PPP1R15B	202645824	0.897000	0.30589	0.002000	0.10522	0.915000	0.54546	3.830000	0.55768	0.160000	0.19432	0.655000	0.94253	GAT		0.458	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833		21	313	0	0	0	0.012319	0	21	313				
SLC26A9	115019	broad.mit.edu	37	1	205890767	205890767	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:205890767G>C	ENST00000367135.3	-	17	2095	c.1982C>G	c.(1981-1983)aCc>aGc	p.T661S	SLC26A9_ENST00000340781.4_Missense_Mutation_p.T661S|SLC26A9_ENST00000367134.2_Missense_Mutation_p.T661S	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	661	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.T661S(2)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGTGTGGAAGGTGACGAAGGG	0.647																																							uc001hdq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1981-1983)ACC>AGC		solute carrier family 26, member 9 isoform a							53.0	42.0	46.0					1																	205890767		2203	4300	6503	SO:0001583	missense	115019					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity	g.chr1:205890767G>C	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1982C>G	1.37:g.205890767G>C	ENSP00000356103:p.Thr661Ser		Somatic				SLC26A9_uc001hdo.2_Missense_Mutation_p.T329S|SLC26A9_uc001hdp.2_Missense_Mutation_p.T661S	p.T661S	NM_052934	NP_443166	WXS	Illumina HiSeq	Unspecified	Q7LBE3	S26A9_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0458)		17	2096	-	Breast(84;0.201)		661			STAS.		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	c.1982C>G	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	G	6.147	0.395247	0.11638	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	T;T;T	0.59083	0.29;0.29;0.29	4.9	3.96	0.45880	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.373179	0.28006	N	0.016966	T	0.30978	0.0782	N	0.20685	0.6	0.25687	N	0.985735	B;B	0.14012	0.003;0.009	B;B	0.15052	0.012;0.012	T	0.34304	-0.9834	10	0.02654	T	1	.	4.0359	0.09729	0.085:0.1329:0.5267:0.2554	.	661;661	Q7LBE3;B1AVM8	S26A9_HUMAN;.	S	661	ENSP00000341682:T661S;ENSP00000356103:T661S;ENSP00000356102:T661S	ENSP00000341682:T661S	T	-	2	0	SLC26A9	204157390	1.000000	0.71417	0.995000	0.50966	0.412000	0.31113	1.755000	0.38379	2.429000	0.82318	0.655000	0.94253	ACC		0.647	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934		4	24	0	0	0	0.001168	0	4	24				
CENPF	1063	broad.mit.edu	37	1	214819010	214819010	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:214819010C>G	ENST00000366955.3	+	13	6265	c.6097C>G	c.(6097-6099)Ctc>Gtc	p.L2033V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2129					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.L2033V(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAAAACTCATCTCCAGGAAAA	0.438																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(6097-6099)CTC>GTC		centromere protein F							69.0	71.0	70.0					1																	214819010		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214819010C>G	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.6097C>G	1.37:g.214819010C>G	ENSP00000355922:p.Leu2033Val		Somatic					p.L2033V	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	6271	+			2129			Potential.|Interaction with NDE1 and NDEL1.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.6097C>G	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233408	0.58886	.	.	ENSG00000117724	ENST00000366955	T	0.55052	0.54	5.45	5.45	0.79879	.	0.000000	0.34200	N	0.004169	T	0.72220	0.3433	M	0.72894	2.215	0.45330	D	0.998329	D	0.89917	1.0	D	0.87578	0.998	T	0.72701	-0.4214	10	0.49607	T	0.09	.	17.4866	0.87691	0.0:1.0:0.0:0.0	.	2129	P49454	CENPF_HUMAN	V	2033	ENSP00000355922:L2033V	ENSP00000355922:L2033V	L	+	1	0	CENPF	212885633	0.994000	0.37717	0.944000	0.38274	0.417000	0.31264	3.275000	0.51639	2.555000	0.86185	0.603000	0.83216	CTC		0.438	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		7	122	0	0	0	0.00308	0	7	122				
OR2C3	81472	broad.mit.edu	37	1	247694892	247694892	+	Missense_Mutation	SNP	C	C	T	rs568852733		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:247694892C>T	ENST00000366487.3	-	2	1283	c.922G>A	c.(922-924)Gag>Aag	p.E308K	GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000531662.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E307K(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CAGCAGTTCTCTAATACCATG	0.512																																							uc009xgy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(922-924)GAG>AAG		olfactory receptor, family 2, subfamily C,							64.0	59.0	60.0					1																	247694892		2203	4300	6503	SO:0001583	missense	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247694892C>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.922G>A	1.37:g.247694892C>T	ENSP00000355443:p.Glu308Lys		Somatic				C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.E308K	NM_198074	NP_932340	WXS	Illumina HiSeq	Unspecified	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	1284	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	308			Cytoplasmic (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	c.922G>A	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	C	0.576	-0.839082	0.02692	.	.	ENSG00000196242	ENST00000366487	T	0.34275	1.37	3.91	-0.256	0.12984	.	1.572660	0.04866	U	0.445036	T	0.09555	0.0235	N	0.00985	-1.075	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27468	-1.0073	10	0.02654	T	1	.	1.5801	0.02633	0.1564:0.3512:0.3056:0.1868	.	308	Q8N628	OR2C3_HUMAN	K	308	ENSP00000355443:E308K	ENSP00000355443:E308K	E	-	1	0	OR2C3	245761515	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.064000	0.11636	-0.146000	0.11274	-0.886000	0.02939	GAG		0.512	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		7	62	0	0	0	0.004482	0	7	62				
CUBN	8029	broad.mit.edu	37	10	16996511	16996511	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:16996511C>A	ENST00000377833.4	-	32	4797	c.4732G>T	c.(4732-4734)Gcc>Tcc	p.A1578S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1578	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A1578S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACGTCCTGGCAAGGCGGGAC	0.527																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(4732-4734)GCC>TCC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						87.0	65.0	73.0					10																	16996511		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16996511C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4732G>T	10.37:g.16996511C>A	ENSP00000367064:p.Ala1578Ser		Somatic					p.A1578S	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			32	4784	-			1578			CUB 10.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.4732G>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254629	0.22965	.	.	ENSG00000107611	ENST00000377833	T	0.18810	2.19	5.83	1.73	0.24493	CUB (5);	0.803177	0.10544	N	0.662357	T	0.15955	0.0384	L	0.49513	1.565	0.09310	N	1	B	0.16802	0.019	B	0.17433	0.018	T	0.40478	-0.9561	10	0.11182	T	0.66	.	4.9501	0.14009	0.0:0.4726:0.2901:0.2373	.	1578	O60494	CUBN_HUMAN	S	1578	ENSP00000367064:A1578S	ENSP00000367064:A1578S	A	-	1	0	CUBN	17036517	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	0.536000	0.23129	0.376000	0.24707	-0.143000	0.13931	GCC		0.527	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		19	94	1	0	1.56452e-12	0.007413	1.94356e-12	19	94				
PCDH15	65217	broad.mit.edu	37	10	55912864	55912864	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:55912864G>T	ENST00000320301.6	-	14	2174	c.1780C>A	c.(1780-1782)Cga>Aga	p.R594R	PCDH15_ENST00000373957.3_Silent_p.R572R|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Silent_p.R594R|PCDH15_ENST00000409834.1_Silent_p.R205R|PCDH15_ENST00000395445.1_Silent_p.R601R|PCDH15_ENST00000414778.1_Silent_p.R599R|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Silent_p.R557R|PCDH15_ENST00000395433.1_Silent_p.R572R|PCDH15_ENST00000395446.1_Silent_p.R594R|PCDH15_ENST00000361849.3_Silent_p.R594R|PCDH15_ENST00000395430.1_Silent_p.R594R|PCDH15_ENST00000373955.1_Silent_p.R594R|PCDH15_ENST00000437009.1_Silent_p.R594R|PCDH15_ENST00000373965.2_Silent_p.R601R	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	594	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.R599R(2)|p.R594R(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AATTACCTTCGCTCTGCAGGA	0.458										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1780-1782)CGA>AGA		protocadherin 15 isoform CD1-4 precursor							88.0	79.0	82.0					10																	55912864		2203	4300	6503	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55912864G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1780C>A	10.37:g.55912864G>T		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Silent_p.R599R|PCDH15_uc010qhr.1_Silent_p.R594R|PCDH15_uc010qhs.1_Silent_p.R606R|PCDH15_uc010qht.1_Silent_p.R601R|PCDH15_uc010qhu.1_Silent_p.R594R|PCDH15_uc001jjv.1_Silent_p.R572R|PCDH15_uc010qhv.1_Silent_p.R594R|PCDH15_uc010qhw.1_Silent_p.R557R|PCDH15_uc010qhx.1_Silent_p.R594R|PCDH15_uc010qhy.1_Silent_p.R599R|PCDH15_uc010qhz.1_Silent_p.R594R|PCDH15_uc010qia.1_Silent_p.R572R|PCDH15_uc010qib.1_Silent_p.R572R|PCDH15_uc001jjw.2_Silent_p.R594R	p.R594R	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			14	2175	-		Melanoma(3;0.117)|Lung SC(717;0.238)	594			Cadherin 5.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	c.1780C>A	CCDS7248.1																																																																																				0.458	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		4	34	1	0	0.00909568	0.009096	0.00944853	4	34				
MYPN	84665	broad.mit.edu	37	10	69881674	69881674	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:69881674A>C	ENST00000358913.5	+	2	967	c.479A>C	c.(478-480)gAg>gCg	p.E160A	MYPN_ENST00000540630.1_Missense_Mutation_p.E160A|MYPN_ENST00000373675.3_Missense_Mutation_p.E160A|MYPN_ENST00000354393.2_Intron	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	160	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.E160A(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TTCATTGAAGAGCTATCCTCC	0.423																																							uc001jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(478-480)GAG>GCG		myopalladin							51.0	52.0	52.0					10																	69881674		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69881674A>C	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.479A>C	10.37:g.69881674A>C	ENSP00000351790:p.Glu160Ala		Somatic				MYPN_uc001jnl.1_Missense_Mutation_p.E160A|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.E160A|MYPN_uc001jnp.1_Missense_Mutation_p.E160A|MYPN_uc009xps.2_Missense_Mutation_p.E160A|MYPN_uc009xpt.2_Missense_Mutation_p.E160A|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	p.E160A	NM_032578	NP_115967	WXS	Illumina HiSeq	Unspecified	Q86TC9	MYPN_HUMAN			3	664	+			160			Interaction with CARP.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.479A>C	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331827	0.81801	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.68624	-0.34;-0.34;-0.34	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.81173	0.4767	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.81022	-0.1121	9	.	.	.	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	160;160	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	A	160	ENSP00000351790:E160A;ENSP00000441668:E160A;ENSP00000362779:E160A	.	E	+	2	0	MYPN	69551680	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.586000	0.90806	2.308000	0.77769	0.533000	0.62120	GAG		0.423	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		14	93	0	0	0	0.004007	0	14	93				
CFAP46	54777	broad.mit.edu	37	10	134755107	134755107	+	Silent	SNP	C	C	T	rs143120032		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:134755107C>T	ENST00000368586.5	-	3	394	c.294G>A	c.(292-294)tcG>tcA	p.S98S	RP13-137A17.4_ENST00000443633.1_lincRNA|TTC40_ENST00000368585.3_Silent_p.S98S|TTC40_ENST00000368582.2_Silent_p.S98S	NM_001200049.2	NP_001186978.2												p.S98S(2)|p.S40S(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTTTTCTGCCGACTTCGGGG	0.567																																							uc001llt.1		NA																	3	Substitution - coding silent(3)		lung(3)	pancreas(1)	1						c.(292-294)TCG>TCA		hypothetical protein LOC255352		C		1,4405	2.1+/-5.4	0,1,2202	77.0	72.0	74.0		294	-8.1	0.0	10	dbSNP_134	74	0,8600		0,0,4300	no	coding-synonymous	C10orf93	NM_173572.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		98/406	134755107	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	255352						binding	g.chr10:134755107C>T																												ENST00000368586.5:c.294G>A	10.37:g.134755107C>T			Somatic				C10orf93_uc001llu.2_Silent_p.S98S	p.S98S	NM_173572	NP_775843	WXS	Illumina HiSeq	Unspecified	Q5SR76	CJ093_HUMAN		Epithelial(32;4.28e-05)|OV - Ovarian serous cystadenocarcinoma(35;4.31e-05)|all cancers(32;5.02e-05)	3	370	-		all_cancers(35;1.8e-07)|all_epithelial(44;6.22e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Colorectal(31;0.119)|Glioma(114;0.172)|Melanoma(40;0.175)	98			TPR 1.			Silent	SNP	ENST00000368586.5	37	c.294G>A	CCDS58101.1																																																																																				0.567	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			15	70	0	0	0	0.004007	0	15	70				
RRM1	6240	broad.mit.edu	37	11	4142838	4142838	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:4142838C>T	ENST00000300738.5	+	10	1085	c.881C>T	c.(880-882)cCt>cTt	p.P294L	RRM1_ENST00000537197.1_5'UTR|RRM1_ENST00000423050.2_Missense_Mutation_p.P197L|RRM1_ENST00000534285.1_Missense_Mutation_p.P72L|RRM1_ENST00000528470.1_3'UTR	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	294					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)	p.P294L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	CACTAGCGTCCTGGGGCATTT	0.368																																					NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	uc001lyw.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(880-882)CCT>CTT		ribonucleoside-diphosphate reductase M1 chain	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)						82.0	84.0	83.0					11																	4142838		2201	4298	6499	SO:0001583	missense	6240				deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity	g.chr11:4142838C>T	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.881C>T	11.37:g.4142838C>T	ENSP00000300738:p.Pro294Leu		Somatic				RRM1_uc009yej.2_RNA|RRM1_uc009yei.2_Missense_Mutation_p.P254L|RRM1_uc010qyc.1_Missense_Mutation_p.P197L|RRM1_uc010qyd.1_5'UTR	p.P294L	NM_001033	NP_001024	WXS	Illumina HiSeq	Unspecified	P23921	RIR1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	10	1200	+		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)	294					Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	37	c.881C>T	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398757	0.83120	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838	T;T;T	0.46063	0.88;0.88;0.88	5.4	4.49	0.54785	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.67608	0.2911	M	0.91818	3.245	0.80722	D	1	D	0.67145	0.996	P	0.61874	0.895	T	0.74959	-0.3486	10	0.56958	D	0.05	-12.9135	13.056	0.58980	0.0:0.9225:0.0:0.0775	.	294	P23921	RIR1_HUMAN	L	294;197;207;72;72	ENSP00000300738:P294L;ENSP00000390539:P197L;ENSP00000431464:P72L	ENSP00000300738:P294L	P	+	2	0	RRM1	4099414	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	1.265000	0.44215	0.650000	0.86243	CCT		0.368	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033		13	97	0	0	0	0.00245	0	13	97				
TAF10	6881	broad.mit.edu	37	11	6636182	6636182	+	5'Flank	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:6636182T>C	ENST00000299424.4	-	0	0				TPP1_ENST00000533371.1_Missense_Mutation_p.N246S|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000299427.6_Missense_Mutation_p.N489S|TAF10_ENST00000531760.1_5'Flank	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa						chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)	p.N489S(1)					Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCTGTGCTCATTGATCAAGGA	0.527																																							uc001mel.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1465-1467)AAT>AGT		tripeptidyl-peptidase I preproprotein							118.0	122.0	121.0					11																	6636182		2201	4296	6497	SO:0001631	upstream_gene_variant	1200				bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity	g.chr11:6636182T>C	U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402		11.37:g.6636182T>C	Exception_encountered		Somatic				TAF10_uc001mej.1_5'Flank|TPP1_uc001mek.1_Missense_Mutation_p.N246S	p.N489S	NM_000391	NP_000382	WXS	Illumina HiSeq	Unspecified	O14773	TPP1_HUMAN		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	12	1527	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	489					O00703|Q13175|Q6FH13	Missense_Mutation	SNP	ENST00000299424.4	37	c.1466A>G	CCDS7769.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242544	0.79912	.	.	ENSG00000166340	ENST00000299427;ENST00000533371;ENST00000453338	D;D	0.95307	-3.67;-3.67	4.88	4.88	0.63580	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.97739	0.9258	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98302	1.0519	10	0.87932	D	0	-19.1519	10.9	0.47045	0.0:0.0:0.0:1.0	.	489	O14773	TPP1_HUMAN	S	489;246;272	ENSP00000299427:N489S;ENSP00000437066:N246S	ENSP00000299427:N489S	N	-	2	0	TPP1	6592758	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.316000	0.79007	1.834000	0.53371	0.459000	0.35465	AAT		0.527	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257259.2	NM_006284		44	198	0	0	0	0.011902	0	44	198				
NLRP14	338323	broad.mit.edu	37	11	7079078	7079078	+	Splice_Site	SNP	C	C	A	rs532721330|rs201841419	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:7079078C>A	ENST00000299481.4	+	7	2808	c.2462C>A	c.(2461-2463)tCc>tAc	p.S821Y		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	821					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.S821Y(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GAGAGACTGTCGTGAGTGTTT	0.398																																							uc001mfb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2461-2463)TCC>TAC		NLR family, pyrin domain containing 14							191.0	170.0	177.0					11																	7079078		2201	4296	6497	SO:0001630	splice_region_variant	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7079078C>A	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2462+1C>A	11.37:g.7079078C>A			Somatic					p.S821Y	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	7	2785	+			821			LRR 4.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2462C>A	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158594	0.57368	.	.	ENSG00000158077	ENST00000299481	T	0.43294	0.95	4.89	1.79	0.24919	.	0.396853	0.18663	N	0.134664	T	0.43144	0.1234	M	0.63843	1.955	0.33881	D	0.636087	D	0.76494	0.999	P	0.59221	0.854	T	0.57382	-0.7821	10	0.02654	T	1	.	4.0624	0.09844	0.0:0.5902:0.1976:0.2122	.	821	Q86W24	NAL14_HUMAN	Y	821	ENSP00000299481:S821Y	ENSP00000299481:S821Y	S	+	2	0	NLRP14	7035654	0.075000	0.21258	0.974000	0.42286	0.996000	0.88848	0.000000	0.12993	1.203000	0.43233	0.585000	0.79938	TCC		0.398	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	Missense_Mutation	11	134	1	0	3.07112e-06	0.010729	3.49122e-06	11	134				
OR4A5	81318	broad.mit.edu	37	11	51412143	51412143	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:51412143A>T	ENST00000319760.6	-	1	305	c.253T>A	c.(253-255)Tgt>Agt	p.C85S		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C85S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TTTTTATCACAGAATAAGCCT	0.438																																							uc001nhi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(253-255)TGT>AGT		olfactory receptor, family 4, subfamily A,							59.0	60.0	60.0					11																	51412143		2201	4296	6497	SO:0001583	missense	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51412143A>T	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.253T>A	11.37:g.51412143A>T	ENSP00000367664:p.Cys85Ser		Somatic					p.C85S	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	253	-		all_lung(304;0.236)	85			Extracellular (Potential).		Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	c.253T>A	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.919611	0.00498	.	.	ENSG00000221840	ENST00000319760	T	0.02916	4.11	1.93	0.773	0.18516	GPCR, rhodopsin-like superfamily (1);	1.223440	0.05870	N	0.624445	T	0.00695	0.0023	N	0.00048	-2.425	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44620	-0.9316	10	0.20519	T	0.43	.	4.1221	0.10109	0.6171:0.0:0.3829:0.0	.	85	Q8NH83	OR4A5_HUMAN	S	85	ENSP00000367664:C85S	ENSP00000367664:C85S	C	-	1	0	OR4A5	51268719	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-4.130000	0.00289	0.211000	0.20683	0.136000	0.15936	TGT		0.438	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		5	56	0	0	0	0.001168	0	5	56				
OR5M8	219484	broad.mit.edu	37	11	56258676	56258676	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:56258676G>T	ENST00000327216.2	-	1	195	c.171C>A	c.(169-171)ccC>ccA	p.P57P		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P57P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					AAAAGTACATGGGCATGTGGA	0.493																																							uc001nix.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(169-171)CCC>CCA		olfactory receptor, family 5, subfamily M,							79.0	79.0	79.0					11																	56258676		2201	4296	6497	SO:0001819	synonymous_variant	219484				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56258676G>T	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.171C>A	11.37:g.56258676G>T			Somatic					p.P57P	NM_001005282	NP_001005282	WXS	Illumina HiSeq	Unspecified	Q8NGP6	OR5M8_HUMAN			1	171	-	Esophageal squamous(21;0.00352)		57			Helical; Name=2; (Potential).		B2RNM5|Q6IEW3|Q96RB8	Silent	SNP	ENST00000327216.2	37	c.171C>A	CCDS31533.1																																																																																				0.493	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282		17	114	1	0	2.94398e-08	0.007413	3.52985e-08	17	114				
TNKS1BP1	85456	broad.mit.edu	37	11	57089342	57089342	+	Silent	SNP	G	G	A	rs553347344		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:57089342G>A	ENST00000532437.1	-	1	329	c.18C>T	c.(16-18)ctC>ctT	p.L6L	TNKS1BP1_ENST00000358252.3_Silent_p.L6L			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	6	Arg/Glu/Lys/Pro-rich (charged).				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.L6L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				AGCTTTCCCTGAGAGTAGACA	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		16175	0.0		0.001	False		,,,				2504	0.0						uc001njr.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(16-18)CTC>CTT		tankyrase 1-binding protein 1							59.0	52.0	54.0					11																	57089342		2201	4296	6497	SO:0001819	synonymous_variant	85456				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding	g.chr11:57089342G>A	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.18C>T	11.37:g.57089342G>A			Somatic				TNKS1BP1_uc001njs.2_Silent_p.L6L|TNKS1BP1_uc009ymd.1_5'UTR	p.L6L	NM_033396	NP_203754	WXS	Illumina HiSeq	Unspecified	Q9C0C2	TB182_HUMAN			1	330	-		all_epithelial(135;0.21)	6			Arg/Glu/Lys/Pro-rich (charged).		A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	c.18C>T	CCDS7951.1																																																																																				0.597	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		5	36	0	0	0	0.004482	0	5	36				
OSBP	5007	broad.mit.edu	37	11	59361700	59361700	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:59361700A>C	ENST00000263847.1	-	8	1819	c.1340T>G	c.(1339-1341)cTt>cGt	p.L447R	MIR3162_ENST00000581818.1_RNA	NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	447	Sterol binding. {ECO:0000250}.				lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)	p.L447R(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AAGGCGCTGAAGCATGGACAA	0.393																																							uc001noc.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1339-1341)CTT>CGT		oxysterol binding protein							78.0	73.0	75.0					11																	59361700		2201	4295	6496	SO:0001583	missense	5007				lipid transport	Golgi membrane	oxysterol binding	g.chr11:59361700A>C	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1340T>G	11.37:g.59361700A>C	ENSP00000263847:p.Leu447Arg		Somatic				OSBP_uc009ymr.1_RNA	p.L447R	NM_002556	NP_002547	WXS	Illumina HiSeq	Unspecified	P22059	OSBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)	8	1820	-		all_epithelial(135;0.000236)	447			Sterol binding (By similarity).		Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	c.1340T>G	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886492	0.91814	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.52754	0.65	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.81024	0.4737	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88102	0.2820	10	0.87932	D	0	-13.0437	16.2827	0.82703	1.0:0.0:0.0:0.0	.	447	P22059	OSBP1_HUMAN	R	447;47	ENSP00000263847:L447R	ENSP00000263847:L447R	L	-	2	0	OSBP	59118276	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.229000	0.95273	2.324000	0.78689	0.533000	0.62120	CTT		0.393	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1			19	90	0	0	0	0.014323	0	19	90				
MRPL16	54948	broad.mit.edu	37	11	59575233	59575233	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:59575233C>T	ENST00000300151.4	-	3	424	c.211G>A	c.(211-213)Gac>Aac	p.D71N		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	71					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.D71N(1)		central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						CCCCGTATGTCACTTAAATTT	0.413																																							uc001noh.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(211-213)GAC>AAC		mitochondrial ribosomal protein L16 precursor							250.0	261.0	257.0					11																	59575233		2201	4295	6496	SO:0001583	missense	54948						rRNA binding	g.chr11:59575233C>T	AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.211G>A	11.37:g.59575233C>T	ENSP00000300151:p.Asp71Asn		Somatic					p.D71N	NM_017840	NP_060310	WXS	Illumina HiSeq	Unspecified	Q9NX20	RM16_HUMAN			3	425	-			71					Q9BYD0|Q9HB70	Missense_Mutation	SNP	ENST00000300151.4	37	c.211G>A	CCDS7976.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541851	0.85917	.	.	ENSG00000166902	ENST00000300151	T	0.23348	1.91	6.07	6.07	0.98685	Ribosomal protein L10e/L16 (2);	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.11494	-1.0585	10	0.27785	T	0.31	-33.4857	16.144	0.81551	0.0:1.0:0.0:0.0	.	71	Q9NX20	RM16_HUMAN	N	71	ENSP00000300151:D71N	ENSP00000300151:D71N	D	-	1	0	MRPL16	59331809	1.000000	0.71417	0.969000	0.41365	0.796000	0.44982	6.555000	0.73928	2.890000	0.99128	0.650000	0.86243	GAC		0.413	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394521.1	NM_017840		53	300	0	0	0	0.01441	0	53	300				
TMEM151A	256472	broad.mit.edu	37	11	66062484	66062484	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:66062484G>A	ENST00000327259.4	+	2	911	c.767G>A	c.(766-768)cGc>cAc	p.R256H		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	256						integral component of membrane (GO:0016021)		p.R256H(1)		central_nervous_system(1)|kidney(4)|lung(6)	11						CTGGAGGCGCGCGAGGGCATG	0.692																																							uc001ohl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(766-768)CGC>CAC		transmembrane protein 151A							16.0	13.0	14.0					11																	66062484		2148	4172	6320	SO:0001583	missense	256472					integral to membrane		g.chr11:66062484G>A	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.767G>A	11.37:g.66062484G>A	ENSP00000326244:p.Arg256His		Somatic					p.R256H	NM_153266	NP_694998	WXS	Illumina HiSeq	Unspecified	Q8N4L1	T151A_HUMAN			2	879	+			256					Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	37	c.767G>A	CCDS8133.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942825	0.92526	.	.	ENSG00000179292	ENST00000327259	.	.	.	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000002	T	0.78355	0.4270	M	0.74467	2.265	0.54753	D	0.999989	D	0.89917	1.0	D	0.85130	0.997	T	0.82022	-0.0663	9	0.87932	D	0	.	15.4875	0.75578	0.0:0.0:1.0:0.0	.	256	Q8N4L1	T151A_HUMAN	H	256	.	ENSP00000326244:R256H	R	+	2	0	TMEM151A	65819060	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	9.522000	0.98032	2.167000	0.68274	0.655000	0.94253	CGC		0.692	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391897.1	NM_153266		4	15	0	0	0	0.009096	0	4	15				
FAT3	120114	broad.mit.edu	37	11	92533924	92533924	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:92533924C>G	ENST00000298047.6	+	9	7762	c.7745C>G	c.(7744-7746)aCt>aGt	p.T2582S	FAT3_ENST00000525166.1_Missense_Mutation_p.T2432S|FAT3_ENST00000409404.2_Missense_Mutation_p.T2582S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2582	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T2582S(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGAGAACAACTTTCTGCACT	0.483										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(7744-7746)ACT>AGT		FAT tumor suppressor homolog 3							86.0	81.0	83.0					11																	92533924		1961	4170	6131	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92533924C>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7745C>G	11.37:g.92533924C>G	ENSP00000298047:p.Thr2582Ser	TCGA Ovarian(4;0.039)	Somatic					p.T2582S	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	7762	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2582			Cadherin 23.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.7745C>G		.	.	.	.	.	.	.	.	.	.	C	9.008	0.981846	0.18812	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50813	0.73;0.73;0.73	6.17	5.26	0.73747	.	.	.	.	.	T	0.20170	0.0485	N	0.00808	-1.17	0.51012	D	0.999908	B	0.17268	0.021	B	0.18561	0.022	T	0.17930	-1.0353	9	0.10111	T	0.7	.	17.652	0.88167	0.0:0.877:0.123:0.0	.	2582	Q8TDW7-3	.	S	2582;2582;2432	ENSP00000298047:T2582S;ENSP00000387040:T2582S;ENSP00000432586:T2432S	ENSP00000298047:T2582S	T	+	2	0	FAT3	92173572	0.114000	0.22134	0.136000	0.22124	0.992000	0.81027	2.413000	0.44618	1.608000	0.50180	-0.176000	0.13171	ACT		0.483	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		6	60	0	0	0	0.001984	0	6	60				
KDM4D	55693	broad.mit.edu	37	11	94705238	94705238	+	5'Flank	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:94705238G>C	ENST00000335080.5	+	0	0				CWC15_ENST00000279839.6_Missense_Mutation_p.H38D|CWC15_ENST00000545018.1_5'UTR|KDM4D_ENST00000536741.1_5'Flank	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ATCTTTGTATGAGAGGGTAGG	0.398																																							uc001pfd.3		NA																	0					0						c.(112-114)CAT>GAT		CWC15 homolog							157.0	161.0	159.0					11																	94705238		1859	4090	5949	SO:0001631	upstream_gene_variant	51503				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding	g.chr11:94705238G>C	AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838		11.37:g.94705238G>C	Exception_encountered		Somatic				CWC15_uc009ywl.1_Missense_Mutation_p.H38D|KDM4D_uc001pfe.2_5'Flank	p.H38D	NM_016403	NP_057487	WXS	Illumina HiSeq	Unspecified	Q9P013	CWC15_HUMAN			2	235	-		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	38					B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	ENST00000335080.5	37	c.112C>G	CCDS8302.1																																																																																				0.398	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039		38	165	0	0	0	0.005524	0	38	165				
PUS3	83480	broad.mit.edu	37	11	125765210	125765210	+	Missense_Mutation	SNP	T	T	C	rs575899270		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:125765210T>C	ENST00000530811.1	-	2	898	c.853A>G	c.(853-855)Atc>Gtc	p.I285V	HYLS1_ENST00000425380.2_Intron|PUS3_ENST00000227474.3_Missense_Mutation_p.I285V|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000356438.3_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	285					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.I285V(1)		NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		AGAAAGAGGATAGCCATCATA	0.443																																							uc001qcy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(853-855)ATC>GTC		pseudouridylate synthase 3							109.0	107.0	107.0					11																	125765210		2201	4299	6500	SO:0001583	missense	83480					nucleus	RNA binding	g.chr11:125765210T>C	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.853A>G	11.37:g.125765210T>C	ENSP00000432386:p.Ile285Val		Somatic				HYLS1_uc009zbv.2_Intron|HYLS1_uc001qcx.3_Intron	p.I285V	NM_031307	NP_112597	WXS	Illumina HiSeq	Unspecified	Q9BZE2	PUS3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)	3	951	-	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)	285					B2RAM0|Q96D17|Q96J23|Q96NB4	Missense_Mutation	SNP	ENST00000530811.1	37	c.853A>G	CCDS8466.1	.	.	.	.	.	.	.	.	.	.	T	1.418	-0.573775	0.03882	.	.	ENSG00000110060	ENST00000227474;ENST00000530811	T;T	0.53423	0.62;0.62	5.82	-1.84	0.07809	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.301786	0.38720	N	0.001592	T	0.25644	0.0624	N	0.11789	0.175	0.32287	N	0.56686	B	0.06786	0.001	B	0.15052	0.012	T	0.17684	-1.0361	10	0.20519	T	0.43	-3.122	13.6324	0.62202	0.0:0.499:0.0:0.501	.	285	Q9BZE2	PUS3_HUMAN	V	285	ENSP00000227474:I285V;ENSP00000432386:I285V	ENSP00000227474:I285V	I	-	1	0	PUS3	125270420	0.000000	0.05858	0.939000	0.37840	0.984000	0.73092	-0.810000	0.04505	-0.612000	0.05701	-0.353000	0.07706	ATC		0.443	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307		10	87	0	0	0	0.013537	0	10	87				
LRRK2	120892	broad.mit.edu	37	12	40702915	40702915	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:40702915G>T	ENST00000298910.7	+	30	4255	c.4197G>T	c.(4195-4197)gaG>gaT	p.E1399D		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1399	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.E1399D(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TAGGTCGTGAGGAATTCTATA	0.368																																							uc001rmg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24						c.(4195-4197)GAG>GAT		leucine-rich repeat kinase 2							86.0	85.0	85.0					12																	40702915		2203	4300	6503	SO:0001583	missense	120892				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding	g.chr12:40702915G>T	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4197G>T	12.37:g.40702915G>T	ENSP00000298910:p.Glu1399Asp		Somatic				LRRK2_uc009zjw.2_Missense_Mutation_p.E237D|LRRK2_uc001rmi.2_Missense_Mutation_p.E232D	p.E1399D	NM_198578	NP_940980	WXS	Illumina HiSeq	Unspecified	Q5S007	LRRK2_HUMAN			30	4318	+	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)	1399			Roc.		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	c.4197G>T	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555744	0.65425	.	.	ENSG00000188906	ENST00000298910	T	0.70631	-0.5	5.63	4.55	0.56014	ROC GTPase (1);Small GTP-binding protein domain (1);Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	T	0.81997	0.4941	M	0.73372	2.23	0.80722	D	1	D;P	0.64830	0.994;0.669	D;P	0.75020	0.985;0.808	T	0.82772	-0.0292	10	0.54805	T	0.06	.	14.3022	0.66359	0.1257:0.0:0.8743:0.0	.	1399;1399	Q17RV3;Q5S007	.;LRRK2_HUMAN	D	1399	ENSP00000298910:E1399D	ENSP00000298910:E1399D	E	+	3	2	LRRK2	38989182	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	1.032000	0.30178	2.654000	0.90174	0.655000	0.94253	GAG		0.368	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		7	73	1	0	5.18039e-06	0.00308	5.86138e-06	7	73				
CDK4	1019	broad.mit.edu	37	12	58145430	58145430	+	Missense_Mutation	SNP	C	C	A	rs104894340		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:58145430C>A	ENST00000257904.6	-	2	436	c.71G>T	c.(70-72)cGt>cTt	p.R24L	CDK4_ENST00000551888.1_5'UTR|CDK4_ENST00000540325.1_5'UTR|CDK4_ENST00000312990.6_Missense_Mutation_p.R24L|CDK4_ENST00000549606.1_Intron	NM_000075.3	NP_000066.1	P11802	CDK4_HUMAN	cyclin-dependent kinase 4	24	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> C (in CMM3; somatic and familial; generates a dominant oncogene resistant to inhibition by p16(INK4a); dbSNP:rs11547328). {ECO:0000269|PubMed:7652577, ECO:0000269|PubMed:8528263}.|R -> H (in CMM3). {ECO:0000269|PubMed:9425228}.		cell division (GO:0051301)|circadian rhythm (GO:0007623)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle arrest (GO:0071157)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell size (GO:0045793)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of translation (GO:0045727)|protein phosphorylation (GO:0006468)|regulation of gene expression (GO:0010468)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to lead ion (GO:0010288)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.R24L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	21	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GTGGGGATCACGGGCCTTGTA	0.557			Mis			melanoma			Hereditary Melanoma																														uc001spv.2		NA	yes	Dom		Familial malignant melanoma	12	12q14	1019	Mis	cyclin-dependent kinase 4			E		melanoma 			1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|central_nervous_system(1)	3	GRCh37	CM980320	CDK4	M	rs104894340	c.(70-72)CGT>CTT		cyclin-dependent kinase 4							75.0	73.0	74.0					12																	58145430		2203	4300	6503	SO:0001583	missense	1019	Hereditary_Melanoma	Familial Cancer Database	Familial Atypical Multiple Mole Melanoma sydrome, FAMMM, Familial Dysplastic Nevus syndrome	cell division|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|positive regulation of fibroblast proliferation|regulation of gene expression|response to drug|S phase of mitotic cell cycle	cyclin-dependent protein kinase holoenzyme complex|cytosol|membrane	ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chr12:58145430C>A	M14505	CCDS8953.1	12q13	2014-09-17				ENSG00000135446		"""Cyclin-dependent kinases"""	1773	protein-coding gene	gene with protein product		123829				8275715	Standard	NM_000075		Approved	PSK-J3	uc001spv.3	P11802		ENST00000257904.6:c.71G>T	12.37:g.58145430C>A	ENSP00000257904:p.Arg24Leu		Somatic				CDK4_uc010ssb.1_5'UTR|CDK4_uc001spw.2_RNA|uc010ssc.1_RNA	p.R24L	NM_000075	NP_000066	WXS	Illumina HiSeq	Unspecified	P11802	CDK4_HUMAN	GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		2	298	-	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		24		R -> H (in CMM3).	Protein kinase.		B2R9A0|B4DNF9|O00576|Q6FG61	Missense_Mutation	SNP	ENST00000257904.6	37	c.71G>T	CCDS8953.1	.	.	.	.	.	.	.	.	.	.	C	35	5.574841	0.96553	.	.	ENSG00000135446	ENST00000257904;ENST00000312990;ENST00000552254;ENST00000552388;ENST00000552862	T;T;T;T;T	0.43688	0.96;0.94;2.05;2.05;2.05	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48960	0.1529	L	0.38733	1.17	0.80722	D	1	D	0.53151	0.958	P	0.54026	0.74	T	0.44251	-0.9340	10	0.54805	T	0.06	.	17.9543	0.89063	0.0:1.0:0.0:0.0	.	24	P11802	CDK4_HUMAN	L	24	ENSP00000257904:R24L;ENSP00000316889:R24L;ENSP00000449179:R24L;ENSP00000448963:R24L;ENSP00000446763:R24L	ENSP00000257904:R24L	R	-	2	0	CDK4	56431697	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.640000	0.67875	2.855000	0.98099	0.655000	0.94253	CGT		0.557	CDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408790.2	NM_000075		15	80	1	0	1.67942e-08	0.006122	2.0237e-08	15	80				
LRRIQ1	84125	broad.mit.edu	37	12	85449619	85449619	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:85449619A>C	ENST00000393217.2	+	8	1109	c.1048A>C	c.(1048-1050)Aaa>Caa	p.K350Q		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	350	Glu-rich.							p.K350Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		agaagagagaaaaaagcaaaa	0.338																																							uc001tac.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1048-1050)AAA>CAA		leucine-rich repeats and IQ motif containing 1							17.0	18.0	17.0					12																	85449619		2186	4251	6437	SO:0001583	missense	84125							g.chr12:85449619A>C	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1048A>C	12.37:g.85449619A>C	ENSP00000376910:p.Lys350Gln		Somatic				LRRIQ1_uc001tab.1_Missense_Mutation_p.K350Q|LRRIQ1_uc001taa.1_Missense_Mutation_p.K325Q	p.K350Q	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	1159	+			350			Glu-rich.		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.1048A>C	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.251465	0.22880	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.60424	0.19	5.27	1.31	0.21738	.	0.767161	0.12646	N	0.450890	T	0.38268	0.1034	L	0.29908	0.895	0.09310	N	1	B;B	0.26195	0.144;0.144	B;B	0.20955	0.032;0.021	T	0.18871	-1.0323	10	0.34782	T	0.22	.	4.0295	0.09703	0.4154:0.364:0.2206:0.0	.	350;325	Q96JM4;C9JI57	LRIQ1_HUMAN;.	Q	350;325;350	ENSP00000376910:K350Q	ENSP00000256007:K350Q	K	+	1	0	LRRIQ1	83973750	0.013000	0.17824	0.001000	0.08648	0.846000	0.48090	0.915000	0.28638	0.312000	0.23038	0.260000	0.18958	AAA		0.338	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		4	15	0	0	0	0.009096	0	4	15				
ALX1	8092	broad.mit.edu	37	12	85680674	85680674	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:85680674G>T	ENST00000316824.3	+	3	730	c.575G>T	c.(574-576)cGt>cTt	p.R192L		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	192					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R192L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		AAAAGGGAACGTTATGGCCAA	0.353																																							uc001tae.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(574-576)CGT>CTT		cartilage paired-class homeoprotein 1							112.0	97.0	102.0					12																	85680674		2203	4300	6503	SO:0001583	missense	8092				brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:85680674G>T	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.575G>T	12.37:g.85680674G>T	ENSP00000315417:p.Arg192Leu		Somatic					p.R192L	NM_006982	NP_008913	WXS	Illumina HiSeq	Unspecified	Q15699	ALX1_HUMAN		GBM - Glioblastoma multiforme(134;0.134)	3	579	+			192					Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	c.575G>T	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	31	5.087314	0.94100	.	.	ENSG00000180318	ENST00000316824	D	0.95918	-3.85	5.87	5.87	0.94306	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95329	0.8484	M	0.71206	2.165	0.80722	D	1	B	0.30114	0.269	B	0.32211	0.142	D	0.93731	0.7041	10	0.87932	D	0	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	192	Q15699	ALX1_HUMAN	L	192	ENSP00000315417:R192L	ENSP00000315417:R192L	R	+	2	0	ALX1	84204805	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.864000	0.99589	2.770000	0.95276	0.650000	0.86243	CGT		0.353	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982		11	41	1	0	1.58986e-06	0.008291	1.83329e-06	11	41				
PXN	5829	broad.mit.edu	37	12	120651681	120651681	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:120651681G>A	ENST00000228307.7	-	11	1614	c.1473C>T	c.(1471-1473)ctC>ctT	p.L491L	PXN-AS1_ENST00000535200.1_RNA|PXN_ENST00000267257.7_Silent_p.L505L|PXN_ENST00000424649.2_Silent_p.L457L|PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000397506.3_Silent_p.L303L|PXN_ENST00000536957.1_Silent_p.L489L|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000458477.2_Silent_p.L324L|PXN-AS1_ENST00000539446.1_RNA	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	491	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L457L(2)|p.L491L(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACAGCGTGTTGAGGGCTGAGA	0.617																																							uc001txt.2		NA																	3	Substitution - coding silent(3)	p.L457L(1)	lung(2)|breast(1)	ovary(1)|breast(1)	2						c.(1471-1473)CTC>CTT		paxillin isoform 1							41.0	48.0	46.0					12																	120651681		2028	4169	6197	SO:0001819	synonymous_variant	5829				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding	g.chr12:120651681G>A	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.1473C>T	12.37:g.120651681G>A			Somatic				PXN_uc001txu.2_Silent_p.L303L|PXN_uc001txv.2_Silent_p.L372L|PXN_uc001txx.2_Silent_p.L324L|PXN_uc001txy.2_Silent_p.L457L|PXN_uc001txz.2_RNA	p.L491L	NM_001080855	NP_001074324	WXS	Illumina HiSeq	Unspecified	P49023	PAXI_HUMAN			11	1604	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		491			LIM zinc-binding 3.		B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Silent	SNP	ENST00000228307.7	37	c.1473C>T	CCDS44997.1																																																																																				0.617	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859		3	13	0	0	0	0.009096	0	3	13				
MPHOSPH9	10198	broad.mit.edu	37	12	123706321	123706321	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:123706321G>C	ENST00000606320.1	-	5	676	c.470C>G	c.(469-471)tCt>tGt	p.S157C	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.S5C|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.S5C|MPHOSPH9_ENST00000539639.1_5'UTR|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.S127C			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	157						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.S5C(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		ACTGCTTAGAGAAAAAAAACC	0.373																																							uc001uel.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)TCT>TGT		M-phase phosphoprotein 9							76.0	73.0	74.0					12																	123706321		2203	4300	6503	SO:0001583	missense	10198				M phase of mitotic cell cycle	centriole|Golgi membrane		g.chr12:123706321G>C	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.470C>G	12.37:g.123706321G>C	ENSP00000475489:p.Ser157Cys		Somatic				MPHOSPH9_uc010tal.1_5'UTR|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_5'UTR	p.S5C	NM_022782	NP_073619	WXS	Illumina HiSeq	Unspecified	Q99550	MPP9_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)	1	121	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		5					A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	ENST00000606320.1	37	c.14C>G		.	.	.	.	.	.	.	.	.	.	G	25.2	4.618812	0.87460	.	.	ENSG00000051825;ENSG00000051825;ENSG00000257076	ENST00000302349;ENST00000541076;ENST00000540674	T;T	0.46819	0.86;0.9	5.94	5.94	0.96194	.	0.421487	0.23836	N	0.044083	T	0.59224	0.2178	L	0.32530	0.975	0.34574	D	0.713734	D	0.76494	0.999	D	0.65874	0.939	T	0.67722	-0.5597	10	0.87932	D	0	-3.4948	18.1282	0.89592	0.0:0.0:1.0:0.0	.	5	Q99550	MPP9_HUMAN	C	5;5;157	ENSP00000303597:S5C;ENSP00000445859:S5C	ENSP00000303597:S5C	S	-	2	0	MPHOSPH9;RP11-546D6.2	122272274	1.000000	0.71417	0.844000	0.33320	0.973000	0.67179	3.552000	0.53705	2.812000	0.96745	0.557000	0.71058	TCT		0.373	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2			19	128	0	0	0	0.010504	0	19	128				
AACS	65985	broad.mit.edu	37	12	125561082	125561082	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:125561082A>G	ENST00000316519.6	+	3	489	c.283A>G	c.(283-285)Aaa>Gaa	p.K95E	AACS_ENST00000261686.6_Missense_Mutation_p.K95E	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	95					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)	p.K95E(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		CGAGTGGTTCAAAGGCAGTCG	0.493																																							uc001uhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|liver(1)|central_nervous_system(1)	3						c.(283-285)AAA>GAA		acetoacetyl-CoA synthetase							185.0	165.0	172.0					12																	125561082		2203	4300	6503	SO:0001583	missense	65985				fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding	g.chr12:125561082A>G	AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.283A>G	12.37:g.125561082A>G	ENSP00000324842:p.Lys95Glu		Somatic				AACS_uc009zyg.2_RNA|AACS_uc001uhd.2_Missense_Mutation_p.K95E|AACS_uc009zyh.2_RNA	p.K95E	NM_023928	NP_076417	WXS	Illumina HiSeq	Unspecified	Q86V21	AACS_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)	3	489	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		95					Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	37	c.283A>G	CCDS9263.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.431246	0.43122	.	.	ENSG00000081760	ENST00000316519;ENST00000536752;ENST00000261686	T;T;T	0.10288	2.89;2.89;2.89	5.28	-0.439	0.12264	Acyl-CoA synthase, domain of unknown function DUF3448 (1);	0.348223	0.29964	N	0.010745	T	0.06645	0.0170	L	0.28014	0.82	0.35472	D	0.797407	B;B	0.16166	0.016;0.002	B;B	0.14578	0.01;0.011	T	0.29701	-1.0003	10	0.32370	T	0.25	.	8.4723	0.32993	0.4782:0.4491:0.0726:0.0	.	95;95	Q86V21-2;Q86V21	.;AACS_HUMAN	E	95	ENSP00000324842:K95E;ENSP00000442691:K95E;ENSP00000261686:K95E	ENSP00000261686:K95E	K	+	1	0	AACS	124127035	1.000000	0.71417	0.085000	0.20634	0.854000	0.48673	3.770000	0.55310	-0.245000	0.09625	0.482000	0.46254	AAA		0.493	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928		14	155	0	0	0	0.00499	0	14	155				
KCTD4	386618	broad.mit.edu	37	13	45768147	45768147	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr13:45768147C>T	ENST00000379108.1	-	1	705	c.556G>A	c.(556-558)Gag>Aag	p.E186K	KCTD4_ENST00000405872.1_Missense_Mutation_p.E186K|GTF2F2_ENST00000340473.6_Intron			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	186					protein homooligomerization (GO:0051260)			p.E186K(2)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		ATTGAAAACTCCTCTGGAAAT	0.363																																							uc001uzx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(556-558)GAG>AAG		potassium channel tetramerisation domain							102.0	101.0	101.0					13																	45768147		2203	4300	6503	SO:0001583	missense	386618					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr13:45768147C>T	BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.556G>A	13.37:g.45768147C>T	ENSP00000368402:p.Glu186Lys		Somatic				GTF2F2_uc001uzv.2_Intron|GTF2F2_uc001uzw.2_Intron	p.E186K	NM_198404	NP_940686	WXS	Illumina HiSeq	Unspecified	Q8WVF5	KCTD4_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)	2	960	-		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	186					Q5W0P9	Missense_Mutation	SNP	ENST00000379108.1	37	c.556G>A	CCDS9396.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375779	0.82682	.	.	ENSG00000180332	ENST00000379108;ENST00000405872	T;T	0.57436	0.4;0.4	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	N	0.19112	0.55	0.80722	D	1	D	0.57571	0.98	D	0.68192	0.956	T	0.43032	-0.9416	10	0.07175	T	0.84	.	19.3457	0.94362	0.0:1.0:0.0:0.0	.	186	Q8WVF5	KCTD4_HUMAN	K	186	ENSP00000368402:E186K;ENSP00000385144:E186K	ENSP00000368402:E186K	E	-	1	0	KCTD4	44666147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.464000	0.80887	2.809000	0.96659	0.655000	0.94253	GAG		0.363	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044757.1			12	135	0	0	0	0.013537	0	12	135				
UGGT2	55757	broad.mit.edu	37	13	96624892	96624892	+	Missense_Mutation	SNP	C	C	T	rs192124348		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr13:96624892C>T	ENST00000376747.3	-	11	1196	c.1126G>A	c.(1126-1128)Gat>Aat	p.D376N		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	376					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.D376N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						AGACGAGCATCGCCTGGCTGA	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		17334	0.001		0.0	False		,,,				2504	0.0						uc001vmt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1126-1128)GAT>AAT		UDP-glucose ceramide glucosyltransferase-like 2							102.0	102.0	102.0					13																	96624892		2203	4300	6503	SO:0001583	missense	55757				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity	g.chr13:96624892C>T	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1126G>A	13.37:g.96624892C>T	ENSP00000365938:p.Asp376Asn		Somatic					p.D376N	NM_020121	NP_064506	WXS	Illumina HiSeq	Unspecified	Q9NYU1	UGGG2_HUMAN			11	1296	-			376					A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	c.1126G>A	CCDS9480.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	22.8	4.333738	0.81801	.	.	ENSG00000102595	ENST00000376747	T	0.40225	1.04	5.21	4.36	0.52297	.	0.218648	0.46145	N	0.000301	T	0.62804	0.2458	M	0.89287	3.02	0.80722	D	1	D	0.67145	0.996	P	0.57960	0.83	T	0.67902	-0.5550	10	0.46703	T	0.11	-11.301	11.5819	0.50896	0.0:0.9124:0.0:0.0876	.	376	Q9NYU1	UGGG2_HUMAN	N	376	ENSP00000365938:D376N	ENSP00000365938:D376N	D	-	1	0	UGGT2	95422893	0.994000	0.37717	0.988000	0.46212	0.923000	0.55619	3.466000	0.53071	1.195000	0.43115	-0.140000	0.14226	GAT		0.343	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121		9	93	0	0	0	0.006214	0	9	93				
TRAPPC6B	122553	broad.mit.edu	37	14	39628703	39628703	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:39628703G>C	ENST00000330149.5	-	2	359	c.133C>G	c.(133-135)Caa>Gaa	p.Q45E	TRAPPC6B_ENST00000557764.1_Intron|TRAPPC6B_ENST00000347691.5_Missense_Mutation_p.Q45E	NM_001079537.1	NP_001073005.1	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B	45					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)		p.Q45E(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		ATCAATCCTTGTCCCACTCGA	0.338																																							uc001wut.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(133-135)CAA>GAA		trafficking protein particle complex 6B isoform							133.0	129.0	130.0					14																	39628703		2202	4300	6502	SO:0001583	missense	122553				vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding	g.chr14:39628703G>C	AK025437	CCDS9670.1, CCDS41947.1	14q13.3	2011-10-10			ENSG00000182400	ENSG00000182400		"""Trafficking protein particle complex"""	23066	protein-coding gene	gene with protein product		610397					Standard	NM_177452		Approved		uc001wut.1	Q86SZ2	OTTHUMG00000140259	ENST00000330149.5:c.133C>G	14.37:g.39628703G>C	ENSP00000330289:p.Gln45Glu		Somatic				TRAPPC6B_uc001wuu.1_Missense_Mutation_p.Q45E|TRAPPC6B_uc001wuv.1_RNA|TRAPPC6B_uc010tqd.1_Intron	p.Q45E	NM_001079537	NP_001073005	WXS	Illumina HiSeq	Unspecified	Q86SZ2	TPC6B_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)	2	468	-	Hepatocellular(127;0.213)		45					B3KPS2|Q5JPD6|Q86U35|Q86X35	Missense_Mutation	SNP	ENST00000330149.5	37	c.133C>G	CCDS41947.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959102	0.92726	.	.	ENSG00000182400	ENST00000330149;ENST00000347691;ENST00000554018	T;T;T	0.46819	0.86;0.86;0.86	5.95	5.95	0.96441	NO signalling/Golgi transport  ligand-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.81802	2.56	0.80722	D	1	D;P	0.54397	0.966;0.721	B;B	0.43386	0.418;0.063	T	0.61476	-0.7055	10	0.41790	T	0.15	-23.0987	20.3931	0.98965	0.0:0.0:1.0:0.0	.	45;45	Q86SZ2-2;Q86SZ2	.;TPC6B_HUMAN	E	45;45;44	ENSP00000330289:Q45E;ENSP00000335171:Q45E;ENSP00000450670:Q44E	ENSP00000330289:Q45E	Q	-	1	0	TRAPPC6B	38698454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.923000	0.92808	2.824000	0.97209	0.655000	0.94253	CAA		0.338	TRAPPC6B-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276775.1	NM_177452		12	108	0	0	0	0.007413	0	12	108				
NIN	51199	broad.mit.edu	37	14	51288719	51288719	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:51288719C>A	ENST00000382041.3	-	3	246	c.56G>T	c.(55-57)aGt>aTt	p.S19I	NIN_ENST00000530997.2_Missense_Mutation_p.S19I|NIN_ENST00000324330.9_Missense_Mutation_p.S19I|NIN_ENST00000382043.4_Missense_Mutation_p.S19I|NIN_ENST00000453196.1_Missense_Mutation_p.S19I|NIN_ENST00000389868.3_Missense_Mutation_p.S19I|NIN_ENST00000245441.5_Missense_Mutation_p.S19I|RP11-286O18.1_ENST00000555966.1_RNA	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	19	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.S19I(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CGTGTCAAAACTGTCAAACAG	0.582			T	PDGFRB	MPD																																		uc001wym.2		NA		Dom	yes		14	14q24	51199	T	ninein (GSK3B interacting protein)			L	PDGFRB		MPD		1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6						c.(55-57)AGT>ATT		ninein isoform 5							252.0	228.0	237.0					14																	51288719		2203	4300	6503	SO:0001583	missense	51199				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding	g.chr14:51288719C>A	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.56G>T	14.37:g.51288719C>A	ENSP00000371472:p.Ser19Ile		Somatic				NIN_uc001wyi.2_Missense_Mutation_p.S19I|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.S19I|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Missense_Mutation_p.S19I|NIN_uc001wyp.1_Splice_Site	p.S19I	NM_182946	NP_891991	WXS	Illumina HiSeq	Unspecified	Q8N4C6	NIN_HUMAN			3	247	-	all_epithelial(31;0.00244)|Breast(41;0.127)		19			EF-hand 1.		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	c.56G>T	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210483	0.79240	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000496749	T;T;T;T;T;T;T	0.67523	1.2;-0.27;-0.27;-0.27;-0.27;-0.27;1.32	5.81	5.81	0.92471	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.82010	0.4944	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.999;0.999	T	0.82987	-0.0184	10	0.87932	D	0	-13.533	18.6464	0.91411	0.0:1.0:0.0:0.0	.	19;19;19;19	C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;NIN_HUMAN;.;.	I	19	ENSP00000245441:S19I;ENSP00000374518:S19I;ENSP00000371474:S19I;ENSP00000371472:S19I;ENSP00000324210:S19I;ENSP00000412391:S19I;ENSP00000431826:S19I	ENSP00000245441:S19I	S	-	2	0	NIN	50358469	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.168000	0.77570	2.746000	0.94184	0.655000	0.94253	AGT		0.582	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		42	395	1	0	4.44401e-20	0.010771	5.69685e-20	42	395				
SQRDL	58472	broad.mit.edu	37	15	45981368	45981368	+	Silent	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:45981368C>G	ENST00000260324.7	+	9	1634	c.1248C>G	c.(1246-1248)ctC>ctG	p.L416L	SQRDL_ENST00000568606.1_Silent_p.L416L	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	416					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)	p.L416L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		CCATGTATCTCATGAAAGCTG	0.473																																							uc001zvt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1246-1248)CTC>CTG		sulfide dehydrogenase like precursor							118.0	111.0	113.0					15																	45981368		2198	4297	6495	SO:0001819	synonymous_variant	58472						oxidoreductase activity	g.chr15:45981368C>G	AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.1248C>G	15.37:g.45981368C>G			Somatic				SQRDL_uc001zvu.2_Silent_p.L416L|SQRDL_uc001zvv.2_Silent_p.L416L	p.L416L	NM_021199	NP_067022	WXS	Illumina HiSeq	Unspecified	Q9Y6N5	SQRD_HUMAN		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)	10	1437	+		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)	416					Q9UQM8	Silent	SNP	ENST00000260324.7	37	c.1248C>G	CCDS10127.1																																																																																				0.473	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254319.2			20	156	0	0	0	0.014323	0	20	156				
ADAM10	102	broad.mit.edu	37	15	58984338	58984338	+	Intron	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:58984338G>A	ENST00000260408.3	-	3	650				ADAM10_ENST00000561288.1_Intron|ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000396140.2_Intron|ADAM10_ENST00000558733.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10						cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		ATCCACACATGATGGACACAG	0.443																																							uc002afh.1		NA																	0					0						c.(925-927)CAT>TAT		RecName: Full=Putative heat shock protein HSP 90-beta 4;																																				SO:0001627	intron_variant	664618							g.chr15:58984338G>A	AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.207-9825C>T	15.37:g.58984338G>A			Somatic				ADAM10_uc002afd.1_Intron|ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Intron	p.H309Y	NR_002927		WXS	Illumina HiSeq	Unspecified					2	925	-								B4DU28|Q10742|Q92650	Missense_Mutation	SNP	ENST00000260408.3	37	c.925C>T	CCDS10167.1																																																																																				0.443	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110		7	16	0	0	0	0.001984	0	7	16				
C15orf26	161502	broad.mit.edu	37	15	81440802	81440802	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:81440802G>T	ENST00000286732.4	+	7	917	c.834G>T	c.(832-834)atG>atT	p.M278I		NM_173528.2	NP_775799.2	Q6P656	CO026_HUMAN	chromosome 15 open reading frame 26	278								p.M278I(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(6)|skin(1)	17						CGTCCTCCATGTTGGATCTGC	0.542																																							uc002bgb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(832-834)ATG>ATT		hypothetical protein LOC161502							90.0	89.0	89.0					15																	81440802		2037	4188	6225	SO:0001583	missense	161502							g.chr15:81440802G>T	AK095934	CCDS42068.1	15q25.1	2012-09-10			ENSG00000156206	ENSG00000156206			26782	protein-coding gene	gene with protein product						14702039	Standard	NM_173528		Approved	FLJ38615	uc002bgb.3	Q6P656	OTTHUMG00000172263	ENST00000286732.4:c.834G>T	15.37:g.81440802G>T	ENSP00000286732:p.Met278Ile		Somatic					p.M278I	NM_173528	NP_775799	WXS	Illumina HiSeq	Unspecified	Q6P656	CO026_HUMAN			7	861	+			278					Q8N906	Missense_Mutation	SNP	ENST00000286732.4	37	c.834G>T	CCDS42068.1	.	.	.	.	.	.	.	.	.	.	G	5.587	0.293128	0.10567	.	.	ENSG00000156206	ENST00000286732	T	0.44083	0.93	5.33	2.38	0.29361	.	0.179859	0.47455	N	0.000231	T	0.36771	0.0979	M	0.67953	2.075	0.39075	D	0.96078	B	0.09022	0.002	B	0.09377	0.004	T	0.21042	-1.0257	10	0.33940	T	0.23	-25.0268	7.7206	0.28729	0.1467:0.0:0.7222:0.1311	.	278	Q6P656	CO026_HUMAN	I	278	ENSP00000286732:M278I	ENSP00000286732:M278I	M	+	3	0	C15orf26	79227857	0.632000	0.27172	0.661000	0.29709	0.058000	0.15608	0.246000	0.18160	0.618000	0.30179	-0.119000	0.15052	ATG		0.542	C15orf26-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417587.1	NM_173528		12	122	1	0	0.000978159	0.010729	0.00105239	12	122				
SH3GL3	6457	broad.mit.edu	37	15	84245390	84245390	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:84245390G>T	ENST00000427482.2	+	6	827	c.521G>T	c.(520-522)cGa>cTa	p.R174L	SH3GL3_ENST00000324537.5_Missense_Mutation_p.R182L|SH3GL3_ENST00000434347.1_Missense_Mutation_p.R182L|SH3GL3_ENST00000535412.1_Missense_Mutation_p.R174L	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	174	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.R182L(2)		central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						AAAAAGAAACGAGTAGGTAAG	0.398																																							uc002bjw.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(520-522)CGA>CTA		SH3-domain GRB2-like 3							55.0	58.0	57.0					15																	84245390		2203	4300	6503	SO:0001583	missense	6457				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding	g.chr15:84245390G>T	AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.521G>T	15.37:g.84245390G>T	ENSP00000391372:p.Arg174Leu		Somatic				SH3GL3_uc010uot.1_Missense_Mutation_p.R174L|SH3GL3_uc002bjx.2_Missense_Mutation_p.R105L|SH3GL3_uc002bju.2_Missense_Mutation_p.R182L|SH3GL3_uc002bjv.2_RNA	p.R174L	NM_003027	NP_003018	WXS	Illumina HiSeq	Unspecified	Q99963	SH3G3_HUMAN			6	716	+			174			BAR.		O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	c.521G>T	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530161	0.85706	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.05	4.14	0.48551	BAR (3);	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.89287	3.02	0.80722	D	1	D;D;P	0.76494	0.999;0.998;0.744	P;D;B	0.69824	0.896;0.966;0.408	T	0.71580	-0.4550	10	0.87932	D	0	-36.172	12.8835	0.58030	0.0786:0.0:0.9214:0.0	.	174;174;182	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	L	174;174;182;182	ENSP00000391372:R174L;ENSP00000439239:R174L;ENSP00000320092:R182L;ENSP00000397871:R182L	ENSP00000320092:R182L	R	+	2	0	SH3GL3	82036394	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.552000	0.82192	1.255000	0.44051	0.591000	0.81541	CGA		0.398	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027		9	83	1	0	0.000274275	0.004482	0.000299096	9	83				
BAIAP3	8938	broad.mit.edu	37	16	1392790	1392790	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:1392790T>A	ENST00000324385.5	+	13	1399	c.1241T>A	c.(1240-1242)cTg>cAg	p.L414Q	BAIAP3_ENST00000562208.1_Missense_Mutation_p.L356Q|BAIAP3_ENST00000426824.3_Missense_Mutation_p.L379Q|BAIAP3_ENST00000421665.2_Missense_Mutation_p.L343Q|BAIAP3_ENST00000397489.1_Missense_Mutation_p.L396Q|BAIAP3_ENST00000568887.1_Missense_Mutation_p.L351Q|BAIAP3_ENST00000397488.2_Missense_Mutation_p.L396Q	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	414					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)	p.L414Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				AGCCATCTGCTGCGGTTGGAG	0.672																																							uc002clk.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1240-1242)CTG>CAG		BAI1-associated protein 3							30.0	29.0	29.0					16																	1392790		2198	4296	6494	SO:0001583	missense	8938				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding	g.chr16:1392790T>A	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1241T>A	16.37:g.1392790T>A	ENSP00000324510:p.Leu414Gln		Somatic				BAIAP3_uc002clj.2_Missense_Mutation_p.L396Q|BAIAP3_uc010uuz.1_Missense_Mutation_p.L379Q|BAIAP3_uc010uva.1_Missense_Mutation_p.L351Q|BAIAP3_uc010uvc.1_Missense_Mutation_p.L343Q	p.L414Q	NM_003933	NP_003924	WXS	Illumina HiSeq	Unspecified	O94812	BAIP3_HUMAN			13	1241	+		Hepatocellular(780;0.0893)	414					A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	c.1241T>A	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.033731	0.54896	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000440627;ENST00000421665	T;T;T;T;T	0.74842	-0.8;-0.81;-0.81;-0.81;-0.88	4.75	4.75	0.60458	.	0.311090	0.26654	N	0.023187	T	0.81148	0.4762	M	0.73598	2.24	0.52099	D	0.999948	D;P;D;P	0.56746	0.977;0.951;0.977;0.951	P;P;P;P	0.55667	0.781;0.695;0.781;0.695	T	0.81623	-0.0849	10	0.42905	T	0.14	-9.3654	12.205	0.54346	0.0:0.0:0.0:1.0	.	343;356;414;396	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	Q	379;396;414;396;20;343	ENSP00000407242:L379Q;ENSP00000380625:L396Q;ENSP00000324510:L414Q;ENSP00000380626:L396Q;ENSP00000409533:L343Q	ENSP00000324510:L414Q	L	+	2	0	BAIAP3	1332791	0.771000	0.28555	0.604000	0.28916	0.012000	0.07955	1.733000	0.38156	1.774000	0.52232	0.482000	0.46254	CTG		0.672	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			4	24	0	0	0	0.001984	0	4	24				
ITGAL	3683	broad.mit.edu	37	16	30495497	30495497	+	Missense_Mutation	SNP	G	G	A	rs202150477		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30495497G>A	ENST00000356798.6	+	9	1099	c.919G>A	c.(919-921)Gcg>Acg	p.A307T	ITGAL_ENST00000358164.5_Missense_Mutation_p.A224T|RP11-297C4.2_ENST00000569459.1_RNA|RP11-297C4.3_ENST00000562525.1_RNA|RNU7-61P_ENST00000515897.1_RNA|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	307	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.A307T(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	ATCAAAACCCGCGAGCGAGTT	0.473																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(919-921)GCG>ACG		integrin alpha L isoform a precursor	Efalizumab(DB00095)	G	THR/ALA,THR/ALA	0,4394		0,0,2197	111.0	113.0	112.0		670,919	-2.5	0.0	16		112	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ITGAL	NM_001114380.1,NM_002209.2	58,58	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	224/1087,307/1171	30495497	1,12993	2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30495497G>A		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.919G>A	16.37:g.30495497G>A	ENSP00000349252:p.Ala307Thr		Somatic				ITGAL_uc010veu.1_RNA|ITGAL_uc002dyj.3_Missense_Mutation_p.A224T|ITGAL_uc010vev.1_Intron	p.A307T	NM_002209	NP_002200	WXS	Illumina HiSeq	Unspecified	P20701	ITAL_HUMAN			9	1095	+			307			VWFA.|Extracellular (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.919G>A	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	9.017	0.984016	0.18889	0.0	1.16E-4	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.21361	2.01;2.01	5.97	-2.55	0.06288	von Willebrand factor, type A (3);	1.423190	0.04560	N	0.391387	T	0.10078	0.0247	N	0.11341	0.13	0.09310	N	1	B;B	0.19583	0.037;0.014	B;B	0.14578	0.011;0.004	T	0.32719	-0.9896	10	0.10636	T	0.68	.	8.4787	0.33030	0.3471:0.1233:0.5296:0.0	.	224;307	Q96HB1;P20701	.;ITAL_HUMAN	T	307;224	ENSP00000349252:A307T;ENSP00000350886:A224T	ENSP00000349252:A307T	A	+	1	0	ITGAL	30402998	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.077000	0.11394	-0.506000	0.06558	-0.218000	0.12543	GCG		0.473	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			43	261	0	0	0	0.007835	0	43	261				
PHKG2	5261	broad.mit.edu	37	16	30768316	30768316	+	Silent	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30768316C>A	ENST00000563588.1	+	10	1358	c.1119C>A	c.(1117-1119)ctC>ctA	p.L373L	PHKG2_ENST00000424889.3_Intron|PHKG2_ENST00000328273.7_Silent_p.L377L	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	373					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.L373L(1)		ovary(1)|skin(1)	2			Colorectal(24;0.198)			GGGCGGCTCTCTTTCAGCACC	0.612																																							uc002dzk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1117-1119)CTC>CTA		phosphorylase kinase, gamma 2 (testis)							68.0	76.0	73.0					16																	30768316		2197	4300	6497	SO:0001819	synonymous_variant	5261				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity	g.chr16:30768316C>A	S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.1119C>A	16.37:g.30768316C>A			Somatic				PHKG2_uc002dzi.1_Silent_p.L377L|PHKG2_uc002dzj.1_Silent_p.L271L	p.L373L	NM_000294	NP_000285	WXS	Illumina HiSeq	Unspecified	P15735	PHKG2_HUMAN	Colorectal(24;0.198)		10	1212	+			373					A8K0C7|B4DEB7|E9PEU3|P11800	Silent	SNP	ENST00000563588.1	37	c.1119C>A	CCDS10690.1																																																																																				0.612	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255531.2	NM_000294		25	166	1	0	3.7963e-18	0.00333	4.84079e-18	25	166				
SETD1A	9739	broad.mit.edu	37	16	30972797	30972797	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30972797C>T	ENST00000262519.8	+	4	1142	c.456C>T	c.(454-456)gtC>gtT	p.V152V		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	152	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V152V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AGGAAACGGTCAAAAACCTCC	0.597																																							uc002ead.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(454-456)GTC>GTT		SET domain containing 1A							59.0	59.0	59.0					16																	30972797		2197	4300	6497	SO:0001819	synonymous_variant	9739				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding	g.chr16:30972797C>T	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.456C>T	16.37:g.30972797C>T			Somatic				SETD1A_uc002eae.1_Silent_p.V152V	p.V152V	NM_014712	NP_055527	WXS	Illumina HiSeq	Unspecified	O15047	SET1A_HUMAN			4	1142	+			152			RRM.		A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	c.456C>T	CCDS32435.1																																																																																				0.597	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712		7	50	0	0	0	0.00308	0	7	50				
ITGAM	3684	broad.mit.edu	37	16	31341648	31341648	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:31341648G>T	ENST00000287497.8	+	27	3155	c.3080G>T	c.(3079-3081)tGc>tTc	p.C1027F	ITGAM_ENST00000544665.3_Missense_Mutation_p.C1028F			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1027					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.C1027F(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						ATCGCTGTCTGCCAGAGAATC	0.547																																							uc002ebq.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(3079-3081)TGC>TTC		integrin alpha M isoform 2 precursor							77.0	78.0	78.0					16																	31341648		2009	4189	6198	SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31341648G>T	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3080G>T	16.37:g.31341648G>T	ENSP00000287497:p.Cys1027Phe		Somatic				ITGAM_uc002ebr.2_Missense_Mutation_p.C1028F|ITGAM_uc010can.2_Missense_Mutation_p.C433F	p.C1027F	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			27	3178	+			1027			Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	c.3080G>T	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521278	0.64747	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.70631	-0.5;-0.5	5.51	5.51	0.81932	.	.	.	.	.	D	0.85465	0.5703	M	0.87456	2.885	0.39163	D	0.962458	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87121	0.2191	9	0.45353	T	0.12	.	14.9214	0.70841	0.0:0.0:1.0:0.0	.	1027;1027	Q4VAK1;P11215	.;ITAM_HUMAN	F	1028;1027	ENSP00000441691:C1028F;ENSP00000287497:C1027F	ENSP00000287497:C1027F	C	+	2	0	ITGAM	31249149	1.000000	0.71417	0.104000	0.21259	0.981000	0.71138	4.933000	0.63484	2.594000	0.87642	0.453000	0.30009	TGC		0.547	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		17	81	1	0	1.50039e-11	0.012319	1.85433e-11	17	81				
NLRC5	84166	broad.mit.edu	37	16	57063703	57063703	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:57063703C>T	ENST00000262510.6	+	9	2487	c.2262C>T	c.(2260-2262)ctC>ctT	p.L754L	NLRC5_ENST00000539144.1_Silent_p.L754L|NLRC5_ENST00000308149.7_Silent_p.L754L|NLRC5_ENST00000436936.1_Silent_p.L754L	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	754					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.L754L(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				ACAACCAGCTCAGTGACCAGG	0.582																																							uc002ekk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|breast(1)	7						c.(2260-2262)CTC>CTT		nucleotide-binding oligomerization domains 27							102.0	75.0	84.0					16																	57063703		2198	4300	6498	SO:0001819	synonymous_variant	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57063703C>T	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2262C>T	16.37:g.57063703C>T			Somatic				NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Silent_p.L559L|NLRC5_uc002ekm.2_Silent_p.L559L|NLRC5_uc010ccr.1_RNA	p.L754L	NM_032206	NP_115582	WXS	Illumina HiSeq	Unspecified	Q86WI3	NLRC5_HUMAN			9	2487	+		all_neural(199;0.225)	754			LRR 3.		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	c.2262C>T	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	C	7.817	0.716846	0.15306	.	.	ENSG00000140853	ENST00000538805	.	.	.	5.12	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1944	0.48704	0.0:0.5424:0.4576:0.0	.	.	.	.	X	507	.	.	Q	+	1	0	NLRC5	55621204	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	1.108000	0.31123	1.137000	0.42214	0.563000	0.77884	CAG		0.582	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		7	45	0	0	0	0.00308	0	7	45				
NIP7	51388	broad.mit.edu	37	16	69373735	69373735	+	Start_Codon_SNP	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:69373735G>A	ENST00000254940.5	+	1	403	c.3G>A	c.(1-3)atG>atA	p.M1I	NIP7_ENST00000254941.6_Start_Codon_SNP_p.M1I|NIP7_ENST00000569637.2_Start_Codon_SNP_p.M1I|COG8_ENST00000562081.1_5'Flank|RP11-343C2.7_ENST00000564737.1_Intron|COG8_ENST00000306875.4_5'Flank|RP11-343C2.9_ENST00000563634.1_Intron	NM_016101.4	NP_057185.1	Q9Y221	NIP7_HUMAN	NIP7, nucleolar pre-rRNA processing protein	1	N-terminal domain.				ribosome assembly (GO:0042255)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.M1I(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Ovarian(137;0.101)				GGGGAAAAATGCGGCCTTTGA	0.592											OREG0023907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002exa.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1-3)ATG>ATA		nuclear import 7							135.0	155.0	149.0					16																	69373735		2198	4300	6498	SO:0001582	initiator_codon_variant	51388				ribosome assembly	nucleolus	protein binding|RNA binding	g.chr16:69373735G>A	AB112439	CCDS10877.1, CCDS56003.1	16q22.1	2013-03-04	2013-03-04		ENSG00000132603	ENSG00000132603			24328	protein-coding gene	gene with protein product			"""nuclear import 7 homolog (S. cerevisiae)"""			14660641, 22195017	Standard	NM_016101		Approved	CGI-37, FLJ10296, HSPC031, KD93	uc002exa.3	Q9Y221	OTTHUMG00000137568	ENST00000254940.5:c.3G>A	16.37:g.69373735G>A	ENSP00000254940:p.Met1Ile		Somatic	OREG0023907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1114	COG8_uc002ewy.2_5'Flank|COG8_uc002ewz.3_5'Flank|NIP7_uc002exb.2_Missense_Mutation_p.M1I	p.M1I	NM_016101	NP_057185	WXS	Illumina HiSeq	Unspecified	Q9Y221	NIP7_HUMAN			1	190	+		Ovarian(137;0.101)	1					B2RD04|Q9NZZ0	Missense_Mutation	SNP	ENST00000254940.5	37	c.3G>A	CCDS10877.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644547	0.67358	.	.	ENSG00000132603	ENST00000254940;ENST00000254941	.	.	.	5.69	5.69	0.88448	.	0.071528	0.85682	D	0.000000	D	0.83677	0.5306	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85147	0.0984	8	0.87932	D	0	3.1219	19.4683	0.94952	0.0:0.0:1.0:0.0	.	1;1	Q9Y221-2;Q9Y221	.;NIP7_HUMAN	I	1	.	ENSP00000254940:M1I	M	+	3	0	NIP7	67931236	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.941000	0.75922	2.698000	0.92095	0.456000	0.33151	ATG		0.592	NIP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268947.2	NM_016101	Missense_Mutation	39	380	0	0	0	0.009718	0	39	380				
TAT	6898	broad.mit.edu	37	16	71604652	71604652	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:71604652C>A	ENST00000355962.4	-	8	975	c.842G>T	c.(841-843)cGc>cTc	p.R281L	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	281					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)	p.R281L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	AACCAGCCAGCGCTTGGCCAG	0.512																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	uc002fap.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(841-843)CGC>CTC		tyrosine aminotransferase	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)						82.0	73.0	76.0					16																	71604652		2198	4300	6498	SO:0001583	missense	6898				2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr16:71604652C>A		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.842G>T	16.37:g.71604652C>A	ENSP00000348234:p.Arg281Leu		Somatic					p.R281L	NM_000353	NP_000344	WXS	Illumina HiSeq	Unspecified	P17735	ATTY_HUMAN		Kidney(780;0.0157)	8	941	-		Ovarian(137;0.125)	281					B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	c.842G>T	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	35	5.579904	0.96565	.	.	ENSG00000198650	ENST00000355962	D	0.90620	-2.7	5.44	5.44	0.79542	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.047824	0.85682	D	0.000000	D	0.96269	0.8783	M	0.91717	3.235	0.80722	D	1	D	0.71674	0.998	D	0.65573	0.936	D	0.96736	0.9543	10	0.66056	D	0.02	-16.4812	19.2736	0.94021	0.0:1.0:0.0:0.0	.	281	P17735	ATTY_HUMAN	L	281	ENSP00000348234:R281L	ENSP00000348234:R281L	R	-	2	0	TAT	70162153	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.783000	0.85696	2.546000	0.85860	0.563000	0.77884	CGC		0.512	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1			5	41	1	0	0.000673444	0.008291	0.000727803	5	41				
GLG1	2734	broad.mit.edu	37	16	74524978	74524978	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:74524978C>A	ENST00000422840.2	-	8	1369	c.1370G>T	c.(1369-1371)cGa>cTa	p.R457L	GLG1_ENST00000447066.2_Missense_Mutation_p.R446L|GLG1_ENST00000205061.5_Missense_Mutation_p.R457L	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	457					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.R457L(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CCGCCCTTTTCGATGTAATCC	0.507																																							uc002fcy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1369-1371)CGA>CTA		golgi apparatus protein 1 isoform 3							157.0	137.0	144.0					16																	74524978		2198	4300	6498	SO:0001583	missense	2734					Golgi membrane|integral to membrane	receptor binding	g.chr16:74524978C>A		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1370G>T	16.37:g.74524978C>A	ENSP00000405984:p.Arg457Leu		Somatic				GLG1_uc002fcx.2_Missense_Mutation_p.R457L|GLG1_uc002fcw.3_Missense_Mutation_p.R446L|GLG1_uc002fcz.3_Intron	p.R457L	NM_001145667	NP_001139139	WXS	Illumina HiSeq	Unspecified	Q92896	GSLG1_HUMAN			8	1420	-			457			Extracellular (Potential).|Cys-rich GLG1 6.		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	c.1370G>T	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997867	0.74818	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.59891	0.2227	L	0.36672	1.1	0.80722	D	1	P;D;P	0.54772	0.796;0.968;0.653	P;P;B	0.50791	0.65;0.643;0.226	T	0.54569	-0.8274	9	0.30854	T	0.27	-5.1832	19.8636	0.96797	0.0:1.0:0.0:0.0	.	457;457;446	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	L	457;446;457	.	ENSP00000205061:R457L	R	-	2	0	GLG1	73082479	1.000000	0.71417	0.986000	0.45419	0.964000	0.63967	5.654000	0.67974	2.694000	0.91930	0.655000	0.94253	CGA		0.507	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		27	138	1	0	9.04412e-07	0.004656	1.05296e-06	27	138				
WDR59	79726	broad.mit.edu	37	16	74920199	74920199	+	Nonsense_Mutation	SNP	G	G	A	rs200814192		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:74920199G>A	ENST00000262144.6	-	24	2645	c.2515C>T	c.(2515-2517)Cga>Tga	p.R839*		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	839								p.R839*(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						TCGCGTTCTCGCTCACGGGGA	0.547																																							uc002fdh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)	2						c.(2515-2517)CGA>TGA		WD repeat domain 59							134.0	127.0	129.0					16																	74920199		2198	4300	6498	SO:0001587	stop_gained	79726							g.chr16:74920199G>A	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.2515C>T	16.37:g.74920199G>A	ENSP00000262144:p.Arg839*		Somatic				WDR59_uc002fdf.1_Nonsense_Mutation_p.R284*|WDR59_uc002fdg.1_Nonsense_Mutation_p.R431*	p.R839*	NM_030581	NP_085058	WXS	Illumina HiSeq	Unspecified	Q6PJI9	WDR59_HUMAN			24	2617	-			839					B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Nonsense_Mutation	SNP	ENST00000262144.6	37	c.2515C>T	CCDS32488.1	.	.	.	.	.	.	.	.	.	.	G	41	8.730444	0.98931	.	.	ENSG00000103091	ENST00000262144	.	.	.	5.29	3.26	0.37387	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-4.5625	11.0443	0.47849	0.0:0.1249:0.6159:0.2591	.	.	.	.	X	839	.	ENSP00000262144:R839X	R	-	1	2	WDR59	73477700	1.000000	0.71417	0.980000	0.43619	0.372000	0.29890	5.284000	0.65627	0.567000	0.29293	0.505000	0.49811	CGA		0.547	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581		19	152	0	0	0	0.008871	0	19	152				
ITGAE	3682	broad.mit.edu	37	17	3649126	3649126	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:3649126A>C	ENST00000263087.4	-	18	2349	c.2251T>G	c.(2251-2253)Tgc>Ggc	p.C751G		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	751					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.C751G(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TCCCTCAGGCAGCCCAGACAG	0.597																																					NSCLC(182;635 2928 8995 38788)	NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|breast(1)|pancreas(1)	4						c.(2251-2253)TGC>GGC		integrin, alpha E precursor							125.0	98.0	107.0					17																	3649126		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3649126A>C	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.2251T>G	17.37:g.3649126A>C	ENSP00000263087:p.Cys751Gly		Somatic					p.C751G	NM_002208	NP_002199	WXS	Illumina HiSeq	Unspecified	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	18	2350	-			751			Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.2251T>G	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	A	6.148	0.395503	0.11638	.	.	ENSG00000083457	ENST00000263087	T	0.41758	0.99	4.33	-4.72	0.03269	Integrin alpha-2 (1);	.	.	.	.	T	0.23572	0.0570	L	0.36672	1.1	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.24225	-1.0166	9	0.19147	T	0.46	.	3.7698	0.08637	0.3715:0.0:0.1673:0.4612	.	751	P38570	ITAE_HUMAN	G	751	ENSP00000263087:C751G	ENSP00000263087:C751G	C	-	1	0	ITGAE	3595875	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.638000	0.02013	-0.926000	0.03770	0.438000	0.28831	TGC		0.597	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		16	115	0	0	0	0.007413	0	16	115				
POLR2A	5430	broad.mit.edu	37	17	7405004	7405004	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:7405004A>G	ENST00000322644.6	+	14	2704	c.2305A>G	c.(2305-2307)Atg>Gtg	p.M769V		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	769					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.M769V(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CTTCAAGTCTATGGTCGTGTC	0.483																																							uc002ghf.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2305-2307)ATG>GTG		DNA-directed RNA polymerase II A							70.0	65.0	67.0					17																	7405004		2203	4300	6503	SO:0001583	missense	5430				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding	g.chr17:7405004A>G			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2305A>G	17.37:g.7405004A>G	ENSP00000314949:p.Met769Val		Somatic					p.M769V	NM_000937	NP_000928	WXS	Illumina HiSeq	Unspecified	P24928	RPB1_HUMAN			14	2539	+		Prostate(122;0.173)	769					A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	c.2305A>G	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.283039	0.80803	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	D	0.88586	-2.4	5.82	5.82	0.92795	RNA polymerase Rpb1, domain 4 (1);	0.000000	0.85682	D	0.000000	D	0.97065	0.9041	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98674	1.0689	10	0.87932	D	0	-15.4911	15.1554	0.72735	1.0:0.0:0.0:0.0	.	769	P24928	RPB1_HUMAN	V	725;769	ENSP00000314949:M769V	ENSP00000314949:M769V	M	+	1	0	SLC35G6	7345728	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.082000	0.94059	2.228000	0.72767	0.533000	0.62120	ATG		0.483	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		8	79	0	0	0	0.004482	0	8	79				
TP53	7157	broad.mit.edu	37	17	7577081	7577081	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:7577081T>C	ENST00000269305.4	-	8	1046	c.857A>G	c.(856-858)gAa>gGa	p.E286G	TP53_ENST00000455263.2_Missense_Mutation_p.E286G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.E286G|TP53_ENST00000445888.2_Missense_Mutation_p.E286G|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.E286G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286G(18)|p.E286V(9)|p.0?(8)|p.?(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E286A(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGATTCTCTTCCTCTGTGCG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		51	Substitution - Missense(28)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	p.E286K(50)|p.E286*(14)|p.E286G(14)|p.0?(7)|p.E286V(6)|p.E286Q(5)|p.?(2)|p.E286D(2)|p.E286E(2)|p.R283fs*16(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.E286A(1)|p.V272_K292del21(1)|p.E285_L289delEEENL(1)	large_intestine(9)|liver(6)|haematopoietic_and_lymphoid_tissue(5)|upper_aerodigestive_tract(4)|lung(4)|breast(4)|bone(4)|stomach(3)|central_nervous_system(3)|urinary_tract(3)|oesophagus(2)|ovary(2)|soft_tissue(1)|skin(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM920679	TP53	M		c.(856-858)GAA>GGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							95.0	81.0	86.0					17																	7577081		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577081T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.857A>G	17.37:g.7577081T>C	ENSP00000269305:p.Glu286Gly	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E286G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E154G|TP53_uc010cng.1_Missense_Mutation_p.E154G|TP53_uc002gii.1_Missense_Mutation_p.E154G|TP53_uc010cnh.1_Missense_Mutation_p.E286G|TP53_uc010cni.1_Missense_Mutation_p.E286G|TP53_uc002gij.2_Missense_Mutation_p.E286G	p.E286G	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1051	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	286		E -> V (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> G (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.857A>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.431106	0.62844	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99859	-7.24;-7.24;-7.24;-7.24;-7.24;-7.24	5.12	4.04	0.47022	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.81914	0.992;0.989;0.992;0.995	D	0.97429	1.0014	10	0.87932	D	0	-23.2961	9.0226	0.36209	0.0:0.0873:0.0:0.9127	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	G	286;286;286;286;286;275;154	ENSP00000352610:E286G;ENSP00000269305:E286G;ENSP00000398846:E286G;ENSP00000391127:E286G;ENSP00000391478:E286G;ENSP00000425104:E154G	ENSP00000269305:E286G	E	-	2	0	TP53	7517806	1.000000	0.71417	0.970000	0.41538	0.305000	0.27757	7.447000	0.80620	0.965000	0.38133	-0.379000	0.06801	GAA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		11	53	0	0	0	0.010729	0	11	53				
ADPRM	56985	broad.mit.edu	37	17	10614344	10614344	+	Silent	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:10614344A>T	ENST00000379774.4	+	4	1003	c.912A>T	c.(910-912)ccA>ccT	p.P304P	ADPRM_ENST00000609540.1_3'UTR	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	304							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)	p.P304P(1)									AAACAGCTCCAGACAGCCAAG	0.433																																							uc002gmt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(910-912)CCA>CCT		ADP-ribose/CDP-alcohol pyrophosphatase							143.0	129.0	134.0					17																	10614344		2203	4300	6503	SO:0001819	synonymous_variant	56985						ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding	g.chr17:10614344A>T	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.912A>T	17.37:g.10614344A>T			Somatic				C17orf48_uc002gmu.2_RNA|C17orf48_uc002gmv.2_RNA	p.P304P	NM_020233	NP_064618	WXS	Illumina HiSeq	Unspecified	Q3LIE5	ADPRM_HUMAN			4	987	+			304					A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Silent	SNP	ENST00000379774.4	37	c.912A>T	CCDS11159.2																																																																																				0.433	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233		11	77	0	0	0	0.008291	0	11	77				
NLE1	54475	broad.mit.edu	37	17	33460195	33460195	+	Silent	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:33460195G>C	ENST00000442241.4	-	12	1479	c.1440C>G	c.(1438-1440)ctC>ctG	p.L480L	NLE1_ENST00000586869.1_Silent_p.L188L|NLE1_ENST00000360831.5_Silent_p.L438L	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	480					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)		p.L480L(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				CTCACATCCGGAGGCATTTGT	0.557																																							uc002hiy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(1)	4						c.(1438-1440)CTC>CTG		Notchless gene homolog isoform a							216.0	152.0	174.0					17																	33460195		2203	4300	6503	SO:0001819	synonymous_variant	54475					nucleolus		g.chr17:33460195G>C		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.1440C>G	17.37:g.33460195G>C			Somatic				NLE1_uc010ctn.1_Intron|NLE1_uc002hiz.1_Silent_p.L188L	p.L480L	NM_018096	NP_060566	WXS	Illumina HiSeq	Unspecified	Q9NVX2	NLE1_HUMAN			12	1468	-		Ovarian(249;0.17)	480			WD 8.		O60868|Q59GJ8|Q9BU54	Silent	SNP	ENST00000442241.4	37	c.1440C>G	CCDS11291.1	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922839	0.18056	.	.	ENSG00000073536	ENST00000436188	.	.	.	5.41	3.29	0.37713	.	.	.	.	.	T	0.58991	0.2161	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56123	-0.8031	4	.	.	.	-20.1934	9.1767	0.37116	0.0:0.2951:0.5528:0.1521	.	.	.	.	C	299	.	.	S	-	2	0	NLE1	30484308	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.410000	0.21098	1.466000	0.48025	0.563000	0.77884	TCC		0.557	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096		11	111	0	0	0	0.004007	0	11	111				
MED1	5469	broad.mit.edu	37	17	37566052	37566052	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:37566052G>A	ENST00000300651.6	-	17	2645	c.2422C>T	c.(2422-2424)Cga>Tga	p.R808*	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.R808*(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GAAGAATCTCGAAGAGGGGTG	0.443										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(2422-2424)CGA>TGA		mediator complex subunit 1							85.0	89.0	88.0					17																	37566052		2203	4300	6503	SO:0001587	stop_gained	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37566052G>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2422C>T	17.37:g.37566052G>A	ENSP00000300651:p.Arg808*	HNSCC(31;0.082)	Somatic				MED1_uc010wee.1_Nonsense_Mutation_p.R636*|MED1_uc002hru.2_Intron	p.R808*	NM_004774	NP_004765	WXS	Illumina HiSeq	Unspecified	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	2634	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	808			Interaction with ESR1.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Nonsense_Mutation	SNP	ENST00000300651.6	37	c.2422C>T	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	G	37	6.601968	0.97697	.	.	ENSG00000125686	ENST00000300651	.	.	.	6.03	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6272	13.9916	0.64369	0.0:0.0:0.7445:0.2555	.	.	.	.	X	808	.	ENSP00000300651:R808X	R	-	1	2	MED1	34819578	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.715000	0.61909	2.854000	0.98071	0.655000	0.94253	CGA		0.443	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		41	142	0	0	0	0.01441	0	41	142				
BRCA1	672	broad.mit.edu	37	17	41244550	41244550	+	Missense_Mutation	SNP	C	C	G	rs80357124|rs80358333		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:41244550C>G	ENST00000357654.3	-	10	3116	c.2998G>C	c.(2998-3000)Gag>Cag	p.E1000Q	BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.E1000Q|BRCA1_ENST00000309486.4_Missense_Mutation_p.E704Q|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.E1000Q|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.E953Q|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.E1000Q	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1000					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1000Q(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAGTTTTCCTCTAGCAGATTT	0.343			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		1	Substitution - Missense(1)		lung(1)	ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(2998-3000)GAG>CAG	Homologous_recombination	breast cancer 1, early onset isoform 1							92.0	93.0	93.0					17																	41244550		2203	4299	6502	SO:0001583	missense	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41244550C>G	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2998G>C	17.37:g.41244550C>G	ENSP00000350283:p.Glu1000Gln	TCGA Ovarian(2;0.000030)	Somatic				BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.E929Q|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.E953Q|BRCA1_uc002ict.2_Missense_Mutation_p.E1000Q|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.E1000Q|BRCA1_uc002ide.1_Missense_Mutation_p.E831Q|BRCA1_uc010cyy.1_Missense_Mutation_p.E1000Q|BRCA1_uc010whs.1_Missense_Mutation_p.E1000Q|BRCA1_uc010cyz.2_Missense_Mutation_p.E953Q|BRCA1_uc010cza.2_Missense_Mutation_p.E974Q|BRCA1_uc010wht.1_Missense_Mutation_p.E704Q	p.E1000Q	NM_007294	NP_009225	WXS	Illumina HiSeq	Unspecified	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	10	3230	-		Breast(137;0.000717)	1000					O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	c.2998G>C	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	7.226	0.598317	0.13939	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	4.35	3.38	0.38709	.	0.275088	0.25912	N	0.027492	D	0.87581	0.6213	M	0.93328	3.405	0.09310	N	1	B;P;D;D;D;D	0.65815	0.363;0.62;0.972;0.991;0.995;0.993	B;B;P;D;D;D	0.65573	0.138;0.138;0.843;0.917;0.917;0.936	T	0.78952	-0.2001	10	0.87932	D	0	.	3.9023	0.09167	0.0:0.5555:0.1906:0.2539	.	1000;959;1000;1000;1000;1000	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	Q	1000;1000;1000;1000;704;1000;953	ENSP00000350283:E1000Q;ENSP00000326002:E1000Q;ENSP00000246907:E1000Q;ENSP00000310938:E704Q;ENSP00000418960:E1000Q;ENSP00000418775:E953Q	ENSP00000310938:E704Q	E	-	1	0	BRCA1	38498076	0.007000	0.16637	0.019000	0.16419	0.004000	0.04260	0.465000	0.22004	1.055000	0.40461	-0.145000	0.13849	GAG		0.343	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		9	167	0	0	0	0.004482	0	9	167				
DGKE	8526	broad.mit.edu	37	17	54912529	54912529	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:54912529C>T	ENST00000284061.3	+	2	553	c.373C>T	c.(373-375)Cac>Tac	p.H125Y	DGKE_ENST00000572810.1_Missense_Mutation_p.H125Y|C17orf67_ENST00000397861.2_5'Flank|C17orf67_ENST00000487705.1_Intron|DGKE_ENST00000576869.1_3'UTR|C17orf67_ENST00000575658.1_5'Flank	NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	125					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.H125Y(1)		breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					CGCCATGCCCCACCACTGGAT	0.577																																							uc002iur.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(373-375)CAC>TAC		diacylglycerol kinase epsilon							82.0	71.0	74.0					17																	54912529		2203	4300	6503	SO:0001583	missense	8526				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding	g.chr17:54912529C>T	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.373C>T	17.37:g.54912529C>T	ENSP00000284061:p.His125Tyr		Somatic				DGKE_uc002ius.1_Missense_Mutation_p.H125Y|C17orf67_uc002iuq.2_5'Flank	p.H125Y	NM_003647	NP_003638	WXS	Illumina HiSeq	Unspecified	P52429	DGKE_HUMAN			2	553	+	Breast(9;3.59e-07)		125			Phorbol-ester/DAG-type 2.		Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	ENST00000284061.3	37	c.373C>T	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	C	32	5.180659	0.94846	.	.	ENSG00000153933	ENST00000284061	D	0.99719	-6.52	5.51	5.51	0.81932	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.93507	3.425	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	D	0.97149	0.9830	10	0.87932	D	0	.	19.4119	0.94677	0.0:1.0:0.0:0.0	.	125;125	A1L4Q0;P52429	.;DGKE_HUMAN	Y	125	ENSP00000284061:H125Y	ENSP00000284061:H125Y	H	+	1	0	DGKE	52267528	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.767000	0.74975	2.575000	0.86900	0.655000	0.94253	CAC		0.577	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647		11	95	0	0	0	0.010729	0	11	95				
PPM1D	8493	broad.mit.edu	37	17	58725387	58725387	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:58725387C>G	ENST00000305921.3	+	4	1193	c.961C>G	c.(961-963)Cca>Gca	p.P321A		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	321	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.P321A(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GAATATGATTCCACCACAAGA	0.408																																							uc002iyt.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(961-963)CCA>GCA		protein phosphatase 1D							126.0	112.0	117.0					17																	58725387		2203	4300	6503	SO:0001583	missense	8493				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity	g.chr17:58725387C>G	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.961C>G	17.37:g.58725387C>G	ENSP00000306682:p.Pro321Ala		Somatic				PPM1D_uc010ddm.1_RNA	p.P321A	NM_003620	NP_003611	WXS	Illumina HiSeq	Unspecified	O15297	PPM1D_HUMAN	Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)		4	1183	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		321			PP2C-like.		Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	c.961C>G	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402383	0.62288	.	.	ENSG00000170836	ENST00000305921;ENST00000544712;ENST00000392995	T;T	0.09350	2.99;2.99	5.05	4.08	0.47627	Protein phosphatase 2C-like (4);	0.095859	0.64402	D	0.000001	T	0.14056	0.0340	L	0.45137	1.4	0.52501	D	0.999957	P	0.50369	0.934	P	0.50934	0.654	T	0.03673	-1.1014	10	0.34782	T	0.22	-8.5761	8.2668	0.31819	0.0:0.76:0.0:0.24	.	321	O15297	PPM1D_HUMAN	A	321;169;321	ENSP00000306682:P321A;ENSP00000376720:P321A	ENSP00000306682:P321A	P	+	1	0	PPM1D	56080169	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.012000	0.49575	1.139000	0.42245	0.484000	0.47621	CCA		0.408	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620		29	142	0	0	0	0.007291	0	29	142				
TANC2	26115	broad.mit.edu	37	17	61498475	61498475	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:61498475A>G	ENST00000424789.2	+	25	5136	c.5132A>G	c.(5131-5133)tAc>tGc	p.Y1711C	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.Y1721C	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1711					in utero embryonic development (GO:0001701)			p.Y1721C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GGCGTGAGATACAGCCAGACA	0.557																																							uc002jal.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(5131-5133)TAC>TGC		tetratricopeptide repeat, ankyrin repeat and							181.0	184.0	183.0					17																	61498475		2177	4263	6440	SO:0001583	missense	26115						binding	g.chr17:61498475A>G	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5132A>G	17.37:g.61498475A>G	ENSP00000387593:p.Tyr1711Cys		Somatic				TANC2_uc010wpe.1_3'UTR|TANC2_uc002jao.3_Missense_Mutation_p.Y822C	p.Y1711C	NM_025185	NP_079461	WXS	Illumina HiSeq	Unspecified	Q9HCD6	TANC2_HUMAN			25	5155	+			1711					Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	37	c.5132A>G	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350163	0.41599	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.73469	-0.75;-0.75	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	T	0.76630	0.4014	N	0.19112	0.55	0.58432	D	0.999997	D	0.76494	0.999	D	0.77557	0.99	T	0.79680	-0.1702	10	0.62326	D	0.03	.	13.8253	0.63346	1.0:0.0:0.0:0.0	.	1711	Q9HCD6	TANC2_HUMAN	C	1721;1711	ENSP00000374171:Y1721C;ENSP00000387593:Y1711C	ENSP00000374171:Y1721C	Y	+	2	0	TANC2	58852207	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	6.534000	0.73833	2.257000	0.74773	0.459000	0.35465	TAC		0.557	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1			23	238	0	0	0	0.014323	0	23	238				
POLG2	11232	broad.mit.edu	37	17	62492601	62492601	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:62492601C>T	ENST00000539111.2	-	1	553	c.486G>A	c.(484-486)ctG>ctA	p.L162L		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	162					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.L162L(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			GTTCCTTACTCAGCTCTTTGT	0.473																																					Colon(3;18 21 435 17652 48887)	Colon(3;18 21 435 17652 48887)	uc002jei.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(484-486)CTG>CTA		DNA polymerase subunit gamma-2, mitochondrial							118.0	123.0	122.0					17																	62492601		2203	4300	6503	SO:0001819	synonymous_variant	11232				DNA repair|DNA-dependent DNA replication|glycyl-tRNA aminoacylation	mitochondrial chromosome	ATP binding|DNA-directed DNA polymerase activity|glycine-tRNA ligase activity|identical protein binding|single-stranded DNA binding	g.chr17:62492601C>T	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.486G>A	17.37:g.62492601C>T			Somatic				POLG2_uc010deg.1_Silent_p.L162L	p.L162L	NM_007215	NP_009146	WXS	Illumina HiSeq	Unspecified	Q9UHN1	DPOG2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;4.97e-11)		1	569	-	Breast(5;2.15e-14)		162					O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Silent	SNP	ENST00000539111.2	37	c.486G>A	CCDS32706.1																																																																																				0.473	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1	NM_007215		38	207	0	0	0	0.004878	0	38	207				
SLC39A11	201266	broad.mit.edu	37	17	70732859	70732859	+	Splice_Site	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:70732859C>G	ENST00000542342.2	-	7	711		c.e7-1		SLC39A11_ENST00000255559.3_Splice_Site	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11						zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.?(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GCGAGACCCTCTGAAATAGAT	0.483																																					NSCLC(95;736 1527 12296 39625 41839)	NSCLC(95;736 1527 12296 39625 41839)	uc002jjb.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e7-1		solute carrier family 39, member 11 isoform 1							119.0	111.0	113.0					17																	70732859		2203	4300	6503	SO:0001630	splice_region_variant	201266				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr17:70732859C>G	AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.623-1G>C	17.37:g.70732859C>G			Somatic				SLC39A11_uc002jja.2_Splice_Site_p.E201_splice	p.E208_splice	NM_001159770	NP_001153242	WXS	Illumina HiSeq	Unspecified	Q8N1S5	S39AB_HUMAN			7	738	-								B2R8H7|Q8WZ81	Splice_Site	SNP	ENST00000542342.2	37	c.623_splice	CCDS54160.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631017	0.67015	.	.	ENSG00000133195	ENST00000542342;ENST00000255559	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9575	0.64160	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC39A11	68244454	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.318000	0.65829	2.669000	0.90835	0.655000	0.94253	.		0.483	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1		Intron	14	144	0	0	0	0.003163	0	14	144				
COG1	9382	broad.mit.edu	37	17	71197584	71197584	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:71197584G>A	ENST00000299886.4	+	7	1698	c.1618G>A	c.(1618-1620)Gac>Aac	p.D540N		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	540					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.D540N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			CCCCTCTGATGACTCATCACT	0.532																																							uc002jjg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1618-1620)GAC>AAC		component of oligomeric golgi complex 1							119.0	116.0	117.0					17																	71197584		2203	4300	6503	SO:0001583	missense	9382				Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding	g.chr17:71197584G>A		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1618G>A	17.37:g.71197584G>A	ENSP00000299886:p.Asp540Asn		Somatic				COG1_uc002jjh.2_Missense_Mutation_p.D540N|COG1_uc002jjf.1_Missense_Mutation_p.D540N	p.D540N	NM_018714	NP_061184	WXS	Illumina HiSeq	Unspecified	Q8WTW3	COG1_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.197)		7	1654	+			540					Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	c.1618G>A	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.969272	0.34754	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.23754	1.89;1.89	4.77	3.8	0.43715	.	0.460871	0.24657	N	0.036663	T	0.22322	0.0538	L	0.57536	1.79	0.39885	D	0.97368	P;P;P	0.44627	0.704;0.839;0.704	B;B;B	0.36134	0.165;0.218;0.165	T	0.09509	-1.0671	10	0.20046	T	0.44	-22.3568	13.0593	0.58997	0.0772:0.0:0.9228:0.0	.	540;540;540	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	N	540	ENSP00000400111:D540N;ENSP00000299886:D540N	ENSP00000299886:D540N	D	+	1	0	COG1	68709179	1.000000	0.71417	0.021000	0.16686	0.856000	0.48823	6.776000	0.75023	1.245000	0.43885	0.655000	0.94253	GAC		0.532	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1			28	274	0	0	0	0.00632	0	28	274				
CD300LB	124599	broad.mit.edu	37	17	72527484	72527484	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:72527484C>A	ENST00000392621.1	-	1	121	c.117G>T	c.(115-117)tgG>tgT	p.W39C	CD300LB_ENST00000314401.3_Missense_Mutation_p.W39C	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	2	Ig-like V-type.				cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W39C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						CAGGGGGCAGCCACATGGCTC	0.627																																							uc002jkx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(115-117)TGG>TGT		CD300 molecule-like family member b							59.0	58.0	58.0					17																	72527484		2203	4300	6503	SO:0001583	missense	124599					integral to membrane|plasma membrane	receptor activity	g.chr17:72527484C>A	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.117G>T	17.37:g.72527484C>A	ENSP00000376397:p.Trp39Cys		Somatic				CD300LB_uc010wqz.1_Missense_Mutation_p.W39C	p.W39C	NM_174892	NP_777552	WXS	Illumina HiSeq	Unspecified	A8K4G0	CLM7_HUMAN			1	130	-			2					Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	ENST00000392621.1	37	c.117G>T	CCDS11700.1	.	.	.	.	.	.	.	.	.	.	C	1.289	-0.608062	0.03717	.	.	ENSG00000178789	ENST00000392621;ENST00000314401	T	0.06528	3.29	4.3	2.14	0.27477	.	0.893166	0.09416	N	0.805120	T	0.20292	0.0488	M	0.84082	2.675	0.48762	D	0.9997	D;D	0.76494	0.999;0.999	P;P	0.61328	0.887;0.887	T	0.10776	-1.0615	10	0.62326	D	0.03	-10.4477	4.588	0.12291	0.2175:0.6688:0.0:0.1137	.	39;2	B4DQ71;A8K4G0	.;CLM7_HUMAN	C	2;39	ENSP00000317337:W39C	ENSP00000317337:W39C	W	-	3	0	CD300LB	70039079	0.940000	0.31905	0.989000	0.46669	0.065000	0.16274	0.732000	0.26072	1.156000	0.42514	0.563000	0.77884	TGG		0.627	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145082.2	NM_174892		13	87	1	0	1.5842e-08	0.001855	1.91855e-08	13	87				
CLUL1	27098	broad.mit.edu	37	18	645015	645015	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:645015G>A	ENST00000400606.2	+	8	1460	c.1315G>A	c.(1315-1317)Gaa>Aaa	p.E439K	CLUL1_ENST00000338387.7_Missense_Mutation_p.E439K|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000540035.1_Missense_Mutation_p.E491K|CLUL1_ENST00000581619.1_Missense_Mutation_p.E464K|CLUL1_ENST00000579494.1_Missense_Mutation_p.E439K	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	439					cell death (GO:0008219)	extracellular region (GO:0005576)		p.E439K(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						GATCCCTCTTGAAGAAAGTGC	0.393																																							uc002kkp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1315-1317)GAA>AAA		clusterin-like 1 (retinal) precursor							99.0	91.0	94.0					18																	645015		1845	4089	5934	SO:0001583	missense	27098				cell death	extracellular region		g.chr18:645015G>A	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1315G>A	18.37:g.645015G>A	ENSP00000383449:p.Glu439Lys		Somatic				CLUL1_uc010wys.1_Missense_Mutation_p.E491K|CLUL1_uc002kkq.2_Missense_Mutation_p.E439K	p.E439K	NM_014410	NP_055225	WXS	Illumina HiSeq	Unspecified	Q15846	CLUL1_HUMAN			8	1460	+			439					A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	c.1315G>A	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633649	0.67015	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.26373	1.74;1.74;1.74	4.87	4.87	0.63330	Clusterin, C-terminal (1);	0.334831	0.32687	N	0.005763	T	0.33235	0.0856	M	0.62723	1.935	0.41354	D	0.987384	D;P	0.54964	0.969;0.905	P;P	0.50934	0.654;0.637	T	0.05550	-1.0878	10	0.46703	T	0.11	-11.1498	8.4086	0.32629	0.0851:0.1575:0.7574:0.0	.	491;439	F5GWQ8;Q15846	.;CLUL1_HUMAN	K	439;491;439	ENSP00000383449:E439K;ENSP00000441726:E491K;ENSP00000341128:E439K	ENSP00000341128:E439K	E	+	1	0	CLUL1	635015	0.915000	0.31059	0.988000	0.46212	0.911000	0.54048	1.227000	0.32576	2.534000	0.85438	0.591000	0.81541	GAA		0.393	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			24	95	0	0	0	0.005443	0	24	95				
TWSG1	57045	broad.mit.edu	37	18	9396447	9396447	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:9396447G>A	ENST00000262120.5	+	4	584	c.393G>A	c.(391-393)gaG>gaA	p.E131E	TWSG1_ENST00000581641.1_Silent_p.E131E	NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	131					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E131E(1)|p.E131D(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						CACATCATGAGAATCTGGTTT	0.448																																							uc002knz.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	ovary(1)|pancreas(1)	2						c.(391-393)GAG>GAA		twisted gastrulation precursor							107.0	102.0	104.0					18																	9396447		2203	4300	6503	SO:0001819	synonymous_variant	57045							g.chr18:9396447G>A	AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.393G>A	18.37:g.9396447G>A			Somatic				TWSG1_uc002koa.2_Silent_p.E56E	p.E131E	NM_020648	NP_065699	WXS	Illumina HiSeq	Unspecified	Q9GZX9	TWSG1_HUMAN			4	584	+			131					B2RE08|D3DUH9|Q8NBI7|Q96K46	Silent	SNP	ENST00000262120.5	37	c.393G>A	CCDS11844.1																																																																																				0.448	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2			9	136	0	0	0	0.006214	0	9	136				
GALNT1	2589	broad.mit.edu	37	18	33282891	33282891	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:33282891G>C	ENST00000269195.5	+	9	1433	c.1330G>C	c.(1330-1332)Gat>Cat	p.D444H	GALNT1_ENST00000537549.1_Missense_Mutation_p.D384H	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	444	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D444H(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						TCAGTGTCTAGATAACATGGC	0.343																																							uc010dmu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1330-1332)GAT>CAT		polypeptide N-acetylgalactosaminyltransferase 1							95.0	97.0	97.0					18																	33282891		2203	4299	6502	SO:0001583	missense	2589				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr18:33282891G>C		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.1330G>C	18.37:g.33282891G>C	ENSP00000269195:p.Asp444His		Somatic				GALNT1_uc002kyz.3_Missense_Mutation_p.D384H|GALNT1_uc002kzb.2_Missense_Mutation_p.D444H	p.D444H	NM_020474	NP_065207	WXS	Illumina HiSeq	Unspecified	Q10472	GALT1_HUMAN			10	1383	+			444			Lumenal (Potential).|Ricin B-type lectin.		Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	c.1330G>C	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929726	0.92389	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	D;D	0.85955	-2.05;-2.05	6.06	6.06	0.98353	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	D	0.94414	0.8203	H	0.95043	3.615	0.80722	D	1	P	0.51791	0.948	P	0.60541	0.876	D	0.95281	0.8386	10	0.87932	D	0	.	18.1182	0.89563	0.0:0.0:1.0:0.0	.	444	Q10472	GALT1_HUMAN	H	444;444;384	ENSP00000269195:D444H;ENSP00000440910:D384H	ENSP00000269195:D444H	D	+	1	0	GALNT1	31536889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.879000	0.98667	0.650000	0.86243	GAT		0.343	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474		12	77	0	0	0	0.003163	0	12	77				
PIK3C3	5289	broad.mit.edu	37	18	39647380	39647380	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:39647380C>T	ENST00000262039.4	+	24	2638	c.2552C>T	c.(2551-2553)tCg>tTg	p.S851L	PIK3C3_ENST00000587328.1_Missense_Mutation_p.S29L|PIK3C3_ENST00000398870.3_Missense_Mutation_p.S788L|PIK3C3_ENST00000593098.1_Missense_Mutation_p.S336L|PIK3C3_ENST00000588156.1_Missense_Mutation_p.S75L	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	851	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.S851L(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						TTAGACCTGTCGGATGAAGAG	0.423										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	NSCLC(37;552 1060 2683 16430 37914)	uc002lap.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(1)|breast(1)	10						c.(2551-2553)TCG>TTG		catalytic phosphatidylinositol 3-kinase 3							135.0	120.0	125.0					18																	39647380		2203	4300	6503	SO:0001583	missense	5289				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding	g.chr18:39647380C>T	Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2552C>T	18.37:g.39647380C>T	ENSP00000262039:p.Ser851Leu	TSP Lung(28;0.18)	Somatic				PIK3C3_uc010xcl.1_Missense_Mutation_p.S788L|PIK3C3_uc002laq.2_Missense_Mutation_p.S336L	p.S851L	NM_002647	NP_002638	WXS	Illumina HiSeq	Unspecified	Q8NEB9	PK3C3_HUMAN			24	2610	+			851			PI3K/PI4K.		Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	c.2552C>T	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.207831	0.79240	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	D;D	0.83673	-1.75;-1.75	5.24	5.24	0.73138	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.90338	0.6977	M	0.84585	2.705	0.80722	D	1	D;D	0.65815	0.991;0.995	P;P	0.56088	0.698;0.791	D	0.91132	0.4938	9	.	.	.	.	18.806	0.92037	0.0:1.0:0.0:0.0	.	788;851	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	L	851;788	ENSP00000262039:S851L;ENSP00000381845:S788L	.	S	+	2	0	PIK3C3	37901378	1.000000	0.71417	0.947000	0.38551	0.957000	0.61999	7.313000	0.78978	2.450000	0.82876	0.585000	0.79938	TCG		0.423	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647		12	48	0	0	0	0.00499	0	12	48				
ATP5A1	498	broad.mit.edu	37	18	43671709	43671709	+	Missense_Mutation	SNP	C	C	T	rs146467617	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:43671709C>T	ENST00000398752.6	-	3	369	c.248G>A	c.(247-249)cGc>cAc	p.R83H	ATP5A1_ENST00000590665.1_Missense_Mutation_p.R83H|ATP5A1_ENST00000282050.2_Missense_Mutation_p.R83H|ATP5A1_ENST00000591267.1_5'Flank|ATP5A1_ENST00000593152.2_Missense_Mutation_p.R33H	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	83					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)	p.R83H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						CCCATGTACGCGGGCAATACC	0.393																																							uc002lbr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(247-249)CGC>CAC		ATP synthase, H+ transporting, mitochondrial F1		C	HIS/ARG,HIS/ARG	6,4400	11.4+/-27.6	0,6,2197	108.0	105.0	106.0		248,248	5.2	1.0	18	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ATP5A1	NM_001001937.1,NM_004046.4	29,29	0,7,6496	TT,TC,CC		0.0116,0.1362,0.0538	probably-damaging,probably-damaging	83/554,83/554	43671709	7,12999	2203	4300	6503	SO:0001583	missense	498				ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr18:43671709C>T	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.248G>A	18.37:g.43671709C>T	ENSP00000381736:p.Arg83His		Somatic				ATP5A1_uc010dnl.1_Missense_Mutation_p.R33H|ATP5A1_uc002lbs.1_Missense_Mutation_p.R33H|ATP5A1_uc002lbt.1_Missense_Mutation_p.R83H|ATP5A1_uc010xct.1_Missense_Mutation_p.R33H|ATP5A1_uc010dnm.1_RNA	p.R83H	NM_004046	NP_004037	WXS	Illumina HiSeq	Unspecified	P25705	ATPA_HUMAN			3	338	-			83					A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	37	c.248G>A	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403120	0.83230	0.001362	1.16E-4	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.86865	-2.18;-2.18	5.24	5.24	0.73138	ATPase, F1/A1 complex, alpha subunit, N-terminal (1);ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);ATPase, F1/A1 complex, alpha/beta subunit, N-terminal (1);	0.106086	0.64402	D	0.000015	D	0.87083	0.6089	M	0.71036	2.16	0.58432	D	0.999999	P	0.40197	0.706	B	0.36567	0.228	D	0.89102	0.3490	10	0.87932	D	0	-7.3638	18.8287	0.92128	0.0:1.0:0.0:0.0	.	83	P25705	ATPA_HUMAN	H	83;83;33	ENSP00000282050:R83H;ENSP00000381736:R83H	ENSP00000282050:R83H	R	-	2	0	ATP5A1	41925707	1.000000	0.71417	0.958000	0.39756	0.913000	0.54294	7.771000	0.85420	2.438000	0.82558	0.655000	0.94253	CGC		0.393	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046		20	141	0	0	0	0.008871	0	20	141				
ALPK2	115701	broad.mit.edu	37	18	56203560	56203560	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:56203560C>G	ENST00000361673.3	-	5	4072	c.3859G>C	c.(3859-3861)Gaa>Caa	p.E1287Q	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1287						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E1287Q(1)|p.E648Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GGGGCCAATTCAGGCACAACA	0.507																																							uc002lhj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(3859-3861)GAA>CAA		heart alpha-kinase							132.0	121.0	125.0					18																	56203560		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56203560C>G	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3859G>C	18.37:g.56203560C>G	ENSP00000354991:p.Glu1287Gln		Somatic				ALPK2_uc002lhk.1_Missense_Mutation_p.E618Q	p.E1287Q	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			5	4073	-			1287					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.3859G>C	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858993	0.51376	.	.	ENSG00000198796	ENST00000361673	T	0.55052	0.54	5.39	2.2	0.27929	.	1.605380	0.03420	N	0.206117	T	0.64940	0.2644	L	0.48642	1.525	0.09310	N	1	D;D	0.67145	0.996;0.987	D;P	0.64776	0.929;0.755	T	0.46233	-0.9206	10	0.45353	T	0.12	-8.9077	8.3813	0.32472	0.0:0.7287:0.0:0.2713	.	1282;1287	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	Q	1287	ENSP00000354991:E1287Q	ENSP00000354991:E1287Q	E	-	1	0	ALPK2	54354540	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	0.021000	0.13489	0.658000	0.30925	0.462000	0.41574	GAA		0.507	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		13	219	0	0	0	0.00245	0	13	219				
TNFRSF11A	8792	broad.mit.edu	37	18	60028991	60028991	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:60028991G>T	ENST00000586569.1	+	7	733	c.695G>T	c.(694-696)gGc>gTc	p.G232V	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	232					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)	p.G232V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				ATCATCTTTGGCGTTTGCTAT	0.413																																							uc002lin.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(694-696)GGC>GTC		tumor necrosis factor receptor superfamily,							202.0	193.0	196.0					18																	60028991		2203	4300	6503	SO:0001583	missense	8792	Paget_Disease_of_Bone			adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity	g.chr18:60028991G>T	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.695G>T	18.37:g.60028991G>T	ENSP00000465500:p.Gly232Val		Somatic				TNFRSF11A_uc010dpv.2_Intron	p.G232V	NM_003839	NP_003830	WXS	Illumina HiSeq	Unspecified	Q9Y6Q6	TNR11_HUMAN			7	733	+		Colorectal(73;0.188)	232			Helical; (Potential).		I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	37	c.695G>T	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	G	9.052	0.992304	0.18966	.	.	ENSG00000141655	ENST00000269485	.	.	.	5.66	2.71	0.32032	.	0.454258	0.20296	N	0.095126	T	0.42630	0.1211	M	0.67953	2.075	0.19775	N	0.999959	B	0.18461	0.028	B	0.16722	0.016	T	0.31888	-0.9927	8	.	.	.	-4.7406	8.5427	0.33402	0.0:0.2402:0.3933:0.3665	.	232	Q9Y6Q6	TNR11_HUMAN	V	232	.	.	G	+	2	0	TNFRSF11A	58179971	0.263000	0.24083	0.013000	0.15412	0.751000	0.42716	0.954000	0.29175	0.324000	0.23333	0.655000	0.94253	GGC		0.413	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2			71	414	1	0	6.07461e-23	0.01441	7.91341e-23	71	414				
FUT3	2525	broad.mit.edu	37	19	5844225	5844225	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:5844225T>C	ENST00000303225.6	-	3	1260	c.626A>G	c.(625-627)tAc>tGc	p.Y209C	FUT3_ENST00000589620.1_Missense_Mutation_p.Y209C|FUT3_ENST00000589918.1_Missense_Mutation_p.Y209C|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000458379.2_Missense_Mutation_p.Y209C	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	209					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.Y209C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GCTCTGGTAGTAGCGCACCCT	0.657																																					Esophageal Squamous(82;745 1728 24593 44831)	Esophageal Squamous(82;745 1728 24593 44831)	uc002mdk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(625-627)TAC>TGC		fucosyltransferase 3							68.0	66.0	66.0					19																	5844225		2203	4300	6503	SO:0001583	missense	2525				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity	g.chr19:5844225T>C		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.626A>G	19.37:g.5844225T>C	ENSP00000305603:p.Tyr209Cys		Somatic				FUT3_uc002mdm.2_Missense_Mutation_p.Y209C|FUT3_uc002mdj.2_Missense_Mutation_p.Y209C|FUT3_uc002mdl.2_Missense_Mutation_p.Y209C	p.Y209C	NM_001097641	NP_001091110	WXS	Illumina HiSeq	Unspecified	P21217	FUT3_HUMAN			2	723	-			209			Lumenal (Potential).		B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	c.626A>G	CCDS12153.1	.	.	.	.	.	.	.	.	.	.	T	8.023	0.760140	0.15846	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.32515	1.45;1.45	1.89	1.89	0.25635	.	0.264750	0.26780	N	0.022532	T	0.58779	0.2146	M	0.93016	3.37	0.37580	D	0.919773	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.992;0.992;0.992	T	0.66260	-0.5968	10	0.87932	D	0	.	7.7641	0.28970	0.0:0.0:0.0:1.0	.	209;209;209;209	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	C	209	ENSP00000305603:Y209C;ENSP00000416443:Y209C	ENSP00000305603:Y209C	Y	-	2	0	FUT3	5795225	0.997000	0.39634	0.135000	0.22099	0.038000	0.13279	1.080000	0.30779	0.816000	0.34421	0.163000	0.16589	TAC		0.657	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149		22	96	0	0	0	0.010504	0	22	96				
QTRT1	81890	broad.mit.edu	37	19	10823252	10823252	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:10823252G>C	ENST00000250237.5	+	7	819	c.809G>C	c.(808-810)tGc>tCc	p.C270S		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	270					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)	p.C270S(1)		large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTGGTAGTCTGCGTGGCTCTT	0.642																																							uc002mpr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(808-810)TGC>TCC		queuine tRNA-ribosyltransferase 1							142.0	132.0	136.0					19																	10823252		2203	4300	6503	SO:0001583	missense	81890				queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr19:10823252G>C	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.809G>C	19.37:g.10823252G>C	ENSP00000250237:p.Cys270Ser		Somatic				DNM2_uc010dxk.2_5'Flank	p.C270S	NM_031209	NP_112486	WXS	Illumina HiSeq	Unspecified	Q9BXR0	TGT_HUMAN	Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)		7	834	+			270					B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	c.809G>C	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900477	0.72754	.	.	ENSG00000213339	ENST00000250237	.	.	.	4.01	4.01	0.46588	.	0.000000	0.85682	U	0.000000	T	0.75369	0.3840	M	0.64676	1.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76119	-0.3076	9	0.42905	T	0.14	-2.5515	15.0488	0.71850	0.0:0.0:1.0:0.0	.	270	Q9BXR0	TGT_HUMAN	S	270	.	ENSP00000250237:C270S	C	+	2	0	QTRT1	10684252	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.739000	0.91574	2.079000	0.62486	0.462000	0.41574	TGC		0.642	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		32	248	0	0	0	0.003755	0	32	248				
ZNF763	284390	broad.mit.edu	37	19	12087895	12087895	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:12087895G>T	ENST00000358987.3	+	2	173	c.46G>T	c.(46-48)Gag>Tag	p.E16*	ZNF763_ENST00000343949.5_Nonsense_Mutation_p.E19*|ZNF763_ENST00000590798.1_Nonsense_Mutation_p.E36*|ZNF763_ENST00000538752.1_Nonsense_Mutation_p.E36*|ZNF763_ENST00000592625.1_Nonsense_Mutation_p.E16*|ZNF763_ENST00000545530.1_Intron|ZNF763_ENST00000591944.1_Nonsense_Mutation_p.E85*			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	16	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E18*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CTTCACCCAGGAGGAGTGGGC	0.507																																							uc002msw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(46-48)GAG>TAG		zinc finger protein 763							136.0	138.0	137.0					19																	12087895		2203	4300	6503	SO:0001587	stop_gained	284390				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12087895G>T	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.46G>T	19.37:g.12087895G>T	ENSP00000402017:p.Glu16*		Somatic				ZNF763_uc010xmf.1_Nonsense_Mutation_p.E36*|ZNF763_uc002msv.2_Nonsense_Mutation_p.E19*|ZNF763_uc010xmg.1_Intron	p.E16*	NM_001012753	NP_001012771	WXS	Illumina HiSeq	Unspecified	Q0D2J5	ZN763_HUMAN			2	201	+			16			KRAB.		B3KRU3|B4DRE7	Nonsense_Mutation	SNP	ENST00000358987.3	37	c.46G>T		.	.	.	.	.	.	.	.	.	.	g	18.31	3.596586	0.66332	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000358987	.	.	.	0.864	0.864	0.19068	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.5368	0.27714	0.0:0.0:1.0:0.0	.	.	.	.	X	36;19;16	.	ENSP00000369774:E19X	E	+	1	0	ZNF763	11948895	0.997000	0.39634	0.609000	0.28983	0.185000	0.23345	3.631000	0.54280	0.734000	0.32515	0.195000	0.17529	GAG		0.507	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753		23	162	1	0	1.22574e-08	0.014323	1.49193e-08	23	162				
FARSA	2193	broad.mit.edu	37	19	13035487	13035487	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:13035487G>A	ENST00000314606.4	-	10	1179	c.1161C>T	c.(1159-1161)ctC>ctT	p.L387L	FARSA_ENST00000588025.1_Silent_p.L427L|FARSA_ENST00000423140.2_Silent_p.L356L	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	387					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.L387L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	GAACGCCCATGAGGTGGCCCA	0.637																																							uc002mvs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1159-1161)CTC>CTT		phenylalanyl-tRNA synthetase, alpha subunit	L-Phenylalanine(DB00120)						49.0	48.0	48.0					19																	13035487		2203	4300	6503	SO:0001819	synonymous_variant	2193				phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding	g.chr19:13035487G>A	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1161C>T	19.37:g.13035487G>A			Somatic				FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Silent_p.L356L|FARSA_uc010dyy.1_Silent_p.L308L	p.L387L	NM_004461	NP_004452	WXS	Illumina HiSeq	Unspecified	Q9Y285	SYFA_HUMAN			10	1209	-			387					B4E363|Q9NSD8|Q9Y4W8	Silent	SNP	ENST00000314606.4	37	c.1161C>T	CCDS12287.1																																																																																				0.637	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461		7	68	0	0	0	0.00308	0	7	68				
FAM129C	199786	broad.mit.edu	37	19	17653042	17653042	+	Missense_Mutation	SNP	C	C	T	rs565920221	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:17653042C>T	ENST00000335393.4	+	11	1499	c.1361C>T	c.(1360-1362)gCa>gTa	p.A454V	FAM129C_ENST00000449408.2_Missense_Mutation_p.A180V|FAM129C_ENST00000595684.1_Missense_Mutation_p.A454V|FAM129C_ENST00000599124.1_Missense_Mutation_p.A423V|FAM129C_ENST00000332386.5_Missense_Mutation_p.A454V|FAM129C_ENST00000352727.3_Missense_Mutation_p.A454V|FAM129C_ENST00000300971.2_Missense_Mutation_p.A454V|FAM129C_ENST00000599164.1_Missense_Mutation_p.A423V|FAM129C_ENST00000600871.1_Missense_Mutation_p.A400V|FAM129C_ENST00000601861.1_Missense_Mutation_p.A423V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	454								p.A454V(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						CAGCTGGCAGCACCGTTTGGC	0.627																																							uc010xpr.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1360-1362)GCA>GTA		B-cell novel protein 1 isoform a							113.0	121.0	119.0					19																	17653042		2203	4300	6503	SO:0001583	missense	199786							g.chr19:17653042C>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1361C>T	19.37:g.17653042C>T	ENSP00000335040:p.Ala454Val		Somatic				FAM129C_uc010xpq.1_Missense_Mutation_p.A454V|FAM129C_uc002ngy.3_Missense_Mutation_p.A180V|FAM129C_uc010xpu.1_Missense_Mutation_p.A180V|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Missense_Mutation_p.A180V|FAM129C_uc002nhb.2_Missense_Mutation_p.A53V	p.A454V	NM_173544	NP_775815	WXS	Illumina HiSeq	Unspecified	Q86XR2	NIBL2_HUMAN			11	1499	+			454					B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	c.1361C>T	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	c	4.299	0.054677	0.08291	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000449408;ENST00000435646	T;T;T;T;T	0.24151	2.2;2.23;1.91;1.91;1.87	4.5	-6.8	0.01709	.	0.916921	0.09111	N	0.847029	T	0.11239	0.0274	N	0.17674	0.51	0.09310	N	1	B;B;B;B;B;B	0.21753	0.004;0.004;0.004;0.004;0.06;0.004	B;B;B;B;B;B	0.20184	0.009;0.009;0.009;0.009;0.028;0.016	T	0.34453	-0.9828	10	0.21014	T	0.42	-1.7883	5.771	0.18253	0.6105:0.1985:0.0:0.1909	.	400;454;454;454;180;454	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;B4DNU3;Q86XR2-2	.;NIBL2_HUMAN;.;.;.;.	V	454;454;454;454;180;400	ENSP00000335040:A454V;ENSP00000333447:A454V;ENSP00000341067:A454V;ENSP00000300971:A454V;ENSP00000394929:A180V	ENSP00000300971:A454V	A	+	2	0	FAM129C	17514042	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.915000	0.04033	-0.671000	0.05274	0.461000	0.40582	GCA		0.627	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		37	274	0	0	0	0.00623	0	37	274				
ZNF257	113835	broad.mit.edu	37	19	22272062	22272062	+	Missense_Mutation	SNP	C	C	G	rs200841378	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:22272062C>G	ENST00000594947.1	+	4	1654	c.1510C>G	c.(1510-1512)Caa>Gaa	p.Q504E		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q504E(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACACCTTTCTCAACATAAGAT	0.383																																							uc010ecx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1510-1512)CAA>GAA		zinc finger protein 257							40.0	44.0	43.0					19																	22272062		2111	4255	6366	SO:0001583	missense	113835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22272062C>G	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1510C>G	19.37:g.22272062C>G	ENSP00000470209:p.Gln504Glu		Somatic				ZNF257_uc010ecy.2_Missense_Mutation_p.Q472E	p.Q504E	NM_033468	NP_258429	WXS	Illumina HiSeq	Unspecified	Q9Y2Q1	ZN257_HUMAN			4	1679	+		all_lung(12;0.0961)|Lung NSC(12;0.103)	504			C2H2-type 12.		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	c.1510C>G	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	C	0.084	-1.178030	0.01633	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	-0.71	0.11234	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15349	0.0370	N	0.13003	0.285	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30765	-0.9967	8	0.10902	T	0.67	.	3.5055	0.07689	0.2355:0.3164:0.4481:0.0	.	504	Q9Y2Q1	ZN257_HUMAN	E	504;476	.	ENSP00000380312:Q476E	Q	+	1	0	ZNF257	22063902	0.000000	0.05858	0.057000	0.19452	0.124000	0.20399	-7.308000	0.00039	0.518000	0.28383	0.313000	0.20887	CAA		0.383	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			10	54	0	0	0	0.006214	0	10	54				
NPHS1	4868	broad.mit.edu	37	19	36322010	36322010	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:36322010C>T	ENST00000378910.5	-	27	3425	c.3426G>A	c.(3424-3426)ctG>ctA	p.L1142L	NPHS1_ENST00000353632.6_Silent_p.L1102L	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1142					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.L1142L(2)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGAAGTCCCTCAGGGAGCGGT	0.587																																							uc002oby.2		NA																	2	Substitution - coding silent(2)		urinary_tract(1)|lung(1)	ovary(4)|skin(1)	5						c.(3424-3426)CTG>CTA		nephrin precursor							78.0	75.0	76.0					19																	36322010		2203	4300	6503	SO:0001819	synonymous_variant	4868				cell adhesion|excretion|muscle organ development	integral to plasma membrane		g.chr19:36322010C>T		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3426G>A	19.37:g.36322010C>T			Somatic				NPHS1_uc010eem.1_RNA	p.L1142L	NM_004646	NP_004637	WXS	Illumina HiSeq	Unspecified	O60500	NPHN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		27	3426	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		1142			Cytoplasmic (Potential).		A6NDH2|C3RX61	Silent	SNP	ENST00000378910.5	37	c.3426G>A	CCDS32996.1																																																																																				0.587	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			29	149	0	0	0	0.010818	0	29	149				
CLASRP	11129	broad.mit.edu	37	19	45559743	45559743	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:45559743G>A	ENST00000221455.3	+	6	513	c.415G>A	c.(415-417)Gat>Aat	p.D139N	CLASRP_ENST00000391953.4_Missense_Mutation_p.D77N|CLASRP_ENST00000544944.2_Missense_Mutation_p.D139N	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	139					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.D139N(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GATCTACATTGATGAGTTGTA	0.572																																							uc002pak.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(415-417)GAT>AAT		splicing factor, arginine/serine-rich 16							113.0	102.0	106.0					19																	45559743		2203	4300	6503	SO:0001583	missense	11129				mRNA processing|RNA splicing	nucleus		g.chr19:45559743G>A	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.415G>A	19.37:g.45559743G>A	ENSP00000221455:p.Asp139Asn		Somatic				SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Missense_Mutation_p.D77N|SFRS16_uc002pam.2_Missense_Mutation_p.D139N|SFRS16_uc002pan.1_RNA	p.D139N	NM_007056	NP_008987	WXS	Illumina HiSeq	Unspecified	Q8N2M8	CLASR_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	6	513	+		Ovarian(192;0.0728)|all_neural(266;0.112)	139					B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	c.415G>A	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638240	0.87760	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.46819	1.48;1.46;0.86;1.47	4.31	4.31	0.51392	Splicing factor, suppressor of white apricot (1);	0.000000	0.37809	U	0.001929	T	0.57140	0.2033	L	0.33485	1.01	0.80722	D	1	D;D;P	0.67145	0.996;0.991;0.558	D;P;P	0.77557	0.99;0.86;0.461	T	0.61377	-0.7075	10	0.72032	D	0.01	-27.7478	14.3468	0.66672	0.0:0.0:1.0:0.0	.	77;139;139	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	N	139;139;77;139	ENSP00000221455:D139N;ENSP00000375814:D139N;ENSP00000375815:D77N;ENSP00000438702:D139N	ENSP00000221455:D139N	D	+	1	0	CLASRP	50251583	1.000000	0.71417	0.488000	0.27440	0.941000	0.58515	9.277000	0.95755	2.245000	0.73994	0.655000	0.94253	GAT		0.572	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056		9	131	0	0	0	0.010729	0	9	131				
ZC3H4	23211	broad.mit.edu	37	19	47569697	47569697	+	Silent	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:47569697C>A	ENST00000253048.5	-	15	3865	c.3828G>T	c.(3826-3828)ccG>ccT	p.P1276P	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1276							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P1276P(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		CCTCGCGGGCCGGACTGTTCC	0.637																																							uc002pga.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(2)	6						c.(3826-3828)CCG>CCT		zinc finger CCCH-type containing 4							12.0	15.0	14.0					19																	47569697		1936	4123	6059	SO:0001819	synonymous_variant	23211						nucleic acid binding|zinc ion binding	g.chr19:47569697C>A	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3828G>T	19.37:g.47569697C>A			Somatic				ZC3H4_uc002pgb.1_RNA	p.P1276P	NM_015168	NP_055983	WXS	Illumina HiSeq	Unspecified	Q9UPT8	ZC3H4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)	15	3866	-		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)	1276					Q9Y420	Silent	SNP	ENST00000253048.5	37	c.3828G>T	CCDS42582.1																																																																																				0.637	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1			3	11	1	0	6.4e-05	0.004672	7.10783e-05	3	11				
CRX	1406	broad.mit.edu	37	19	48342693	48342693	+	Silent	SNP	G	G	A	rs368752695		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:48342693G>A	ENST00000221996.7	+	4	575	c.369G>A	c.(367-369)acG>acA	p.T123T	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Silent_p.T123T	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	123					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T123T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		AGGCGGGCACGTCCCCAAGAC	0.667																																					Pancreas(57;461 1196 22201 40716 47188)	Pancreas(57;461 1196 22201 40716 47188)	uc002phq.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(367-369)ACG>ACA		cone-rod homeobox protein		G		0,4406		0,0,2203	47.0	51.0	50.0		369	-7.7	0.0	19		50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CRX	NM_000554.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		123/300	48342693	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1406				organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:48342693G>A	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.369G>A	19.37:g.48342693G>A			Somatic					p.T123T	NM_000554	NP_000545	WXS	Illumina HiSeq	Unspecified	O43186	CRX_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)	4	573	+		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)	123					Q0QD45	Silent	SNP	ENST00000221996.7	37	c.369G>A	CCDS12706.1																																																																																				0.667	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409812.4	NM_000554		17	119	0	0	0	0.007413	0	17	119				
SIGLEC14	100049587	broad.mit.edu	37	19	52149116	52149116	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:52149116G>T	ENST00000360844.6	-	3	660	c.619C>A	c.(619-621)Cat>Aat	p.H207N	SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000599649.1_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	207	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.H207N(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		TTGGTGCCATGGTCCTCGGGC	0.632																																							uc002pxf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(619-621)CAT>AAT		sialic acid binding Ig-like lectin 14 precursor							55.0	53.0	53.0					19																	52149116		2062	4193	6255	SO:0001583	missense	100049587				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding	g.chr19:52149116G>T	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.619C>A	19.37:g.52149116G>T	ENSP00000354090:p.His207Asn		Somatic					p.H207N	NM_001098612	NP_001092082	WXS	Illumina HiSeq	Unspecified	Q08ET2	SIG14_HUMAN		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)	3	739	-		all_neural(266;0.0299)	207			Ig-like C2-type 1.|Extracellular (Potential).		Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	c.619C>A	CCDS42604.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731926	0.30684	.	.	ENSG00000254415	ENST00000360844	T	0.21932	1.98	3.1	3.1	0.35709	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.146056	0.31472	N	0.007597	T	0.40694	0.1127	M	0.73962	2.25	0.09310	N	0.999996	D	0.63046	0.992	D	0.66716	0.946	T	0.08066	-1.0740	10	0.49607	T	0.09	.	9.82	0.40876	0.0:0.0:1.0:0.0	.	207	Q08ET2	SIG14_HUMAN	N	207	ENSP00000354090:H207N	ENSP00000354090:H207N	H	-	1	0	SIGLEC14	56840928	0.994000	0.37717	0.539000	0.28077	0.207000	0.24258	2.268000	0.43338	1.755000	0.51935	0.514000	0.50259	CAT		0.632	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612		7	73	1	0	0.00198382	0.001984	0.00210617	7	73				
ZNF616	90317	broad.mit.edu	37	19	52618739	52618739	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:52618739G>A	ENST00000600228.1	-	4	1939	c.1678C>T	c.(1678-1680)Caa>Taa	p.Q560*	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	560					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q560*(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CGTGAACATTGACTGAAGACC	0.438																																							uc002pym.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1678-1680)CAA>TAA		zinc finger protein 616							114.0	102.0	106.0					19																	52618739		2203	4300	6503	SO:0001587	stop_gained	90317				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52618739G>A	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1678C>T	19.37:g.52618739G>A	ENSP00000471000:p.Gln560*		Somatic				ZNF616_uc002pyn.2_RNA	p.Q560*	NM_178523	NP_848618	WXS	Illumina HiSeq	Unspecified	Q08AN1	ZN616_HUMAN		GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)	4	1961	-			560			C2H2-type 14.		B3KRV1|Q0P658|Q658V7	Nonsense_Mutation	SNP	ENST00000600228.1	37	c.1678C>T	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403781	0.83230	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.24	-2.48	0.06423	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	0.9815	0.01437	0.2498:0.3014:0.2919:0.157	.	.	.	.	X	560	.	ENSP00000328722:Q560X	Q	-	1	0	ZNF616	57310551	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-6.931000	0.00049	-1.906000	0.01089	0.484000	0.47621	CAA		0.438	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892		10	94	0	0	0	0.008291	0	10	94				
TSEN34	79042	broad.mit.edu	37	19	54696204	54696204	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:54696204G>C	ENST00000396383.1	+	4	1036	c.725G>C	c.(724-726)gGt>gCt	p.G242A	TSEN34_ENST00000429671.2_Missense_Mutation_p.G242A|MBOAT7_ENST00000245615.1_5'Flank|MBOAT7_ENST00000338624.6_5'Flank|MBOAT7_ENST00000431666.2_5'Flank|TSEN34_ENST00000396388.2_Missense_Mutation_p.G242A|TSEN34_ENST00000302937.4_Missense_Mutation_p.G242A|MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000474910.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	242					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)	p.G242A(1)		endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AAGTTCGGAGGTGACTTCCTG	0.552																																					Esophageal Squamous(37;841 964 4869 42824)	Esophageal Squamous(37;841 964 4869 42824)	uc002qdu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(724-726)GGT>GCT		tRNA-intron endonuclease 34							69.0	74.0	72.0					19																	54696204		1996	4171	6167	SO:0001583	missense	79042				mRNA processing|tRNA-type intron splice site recognition and cleavage	nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity	g.chr19:54696204G>C	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.725G>C	19.37:g.54696204G>C	ENSP00000379667:p.Gly242Ala		Somatic				MBOAT7_uc002qdq.2_5'Flank|MBOAT7_uc002qdr.2_5'Flank|MBOAT7_uc002qds.2_5'Flank|MBOAT7_uc010yen.1_5'Flank|MBOAT7_uc002qdt.3_5'Flank|TSEN34_uc010yeo.1_Missense_Mutation_p.G242A|TSEN34_uc002qdv.2_Missense_Mutation_p.G242A|TSEN34_uc002qdw.2_Missense_Mutation_p.G242A	p.G242A	NM_024075	NP_076980	WXS	Illumina HiSeq	Unspecified	Q9BSV6	SEN34_HUMAN			4	834	+	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		242					A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	ENST00000396383.1	37	c.725G>C	CCDS42609.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451635	0.63290	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	D;T;T;T;T;T	0.90069	-2.61;-0.74;-0.38;-0.51;-0.38;-0.38	4.56	4.56	0.56223	tRNA intron endonuclease, catalytic domain-like (2);Endonuclease TnsA, N-terminal/resolvase Hjc/tRNA endonuclease, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91462	0.7305	L	0.42487	1.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89170	0.3536	10	0.22109	T	0.4	.	16.4935	0.84208	0.0:0.0:1.0:0.0	.	242;242	E7EQB3;Q9BSV6	.;SEN34_HUMAN	A	242;245;242;242;242;242	ENSP00000400743:G242A;ENSP00000408689:G245A;ENSP00000305524:G242A;ENSP00000397402:G242A;ENSP00000379667:G242A;ENSP00000379671:G242A	ENSP00000305524:G242A	G	+	2	0	TSEN34	59388016	1.000000	0.71417	0.972000	0.41901	0.069000	0.16628	8.610000	0.90902	2.270000	0.75569	0.561000	0.74099	GGT		0.552	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075		9	107	0	0	0	0.004482	0	9	107				
WDPCP	51057	broad.mit.edu	37	2	63666936	63666936	+	Missense_Mutation	SNP	C	C	A	rs562112451		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:63666936C>A	ENST00000272321.7	-	7	981	c.454G>T	c.(454-456)Gac>Tac	p.D152Y	WDPCP_ENST00000409562.3_Missense_Mutation_p.D152Y|WDPCP_ENST00000398544.3_5'Flank|WDPCP_ENST00000409199.1_Intron|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409120.1_5'UTR	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	152					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.D152Y(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						AGGCTTCTGTCAATCACCACT	0.507																																							uc002sch.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(454-456)GAC>TAC		hypothetical protein LOC51057 isoform 2							136.0	133.0	134.0					2																	63666936		1959	4165	6124	SO:0001583	missense	51057				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane		g.chr2:63666936C>A		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.454G>T	2.37:g.63666936C>A	ENSP00000272321:p.Asp152Tyr		Somatic				C2orf86_uc002scf.2_5'Flank|C2orf86_uc010ypu.1_5'Flank|C2orf86_uc002scg.2_5'UTR|C2orf86_uc002sci.1_Missense_Mutation_p.D128Y|C2orf86_uc010fcr.1_Missense_Mutation_p.D42Y	p.D152Y	NM_015910	NP_056994	WXS	Illumina HiSeq	Unspecified	O95876	FRITZ_HUMAN			7	900	-			152					Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	c.454G>T	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347796	0.82022	.	.	ENSG00000143951	ENST00000272321;ENST00000409562	T;T	0.57595	0.39;0.39	5.48	5.48	0.80851	.	0.059130	0.64402	D	0.000004	T	0.75027	0.3794	M	0.77820	2.39	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77838	-0.2439	10	0.87932	D	0	-9.7387	19.3535	0.94401	0.0:1.0:0.0:0.0	.	152;152	O95876-2;O95876	.;FRITZ_HUMAN	Y	152	ENSP00000272321:D152Y;ENSP00000387222:D152Y	ENSP00000272321:D152Y	D	-	1	0	WDPCP	63520440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.965000	0.70387	2.580000	0.87095	0.655000	0.94253	GAC		0.507	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910		23	115	1	0	0.00047179	0.00333	0.000512168	23	115				
MOGS	7841	broad.mit.edu	37	2	74690085	74690085	+	Silent	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:74690085T>G	ENST00000233616.4	-	4	993	c.831A>C	c.(829-831)gtA>gtC	p.V277V	MOGS_ENST00000452063.2_Silent_p.V171V|MOGS_ENST00000535045.1_3'UTR|MOGS_ENST00000462443.1_5'UTR|MOGS_ENST00000409065.1_3'UTR	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	277					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.V277V(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						GGCGACTCTTTACCATCTCTG	0.537																																							uc010ffj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(829-831)GTA>GTC		mannosyl-oligosaccharide glucosidase isoform 1							111.0	120.0	117.0					2																	74690085		1998	4182	6180	SO:0001819	synonymous_variant	7841				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity	g.chr2:74690085T>G	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.831A>C	2.37:g.74690085T>G			Somatic				MOGS_uc010ffh.2_Silent_p.V2V|MOGS_uc010yrt.1_Silent_p.V158V|MOGS_uc010ffi.2_Silent_p.V171V|MOGS_uc010yru.1_3'UTR	p.V277V	NM_006302	NP_006293	WXS	Illumina HiSeq	Unspecified	Q13724	MOGS_HUMAN			4	994	-			277			Lumenal (Potential).		A8K938|F5H6D0|Q17RN9|Q8TCT5	Silent	SNP	ENST00000233616.4	37	c.831A>C	CCDS42700.1																																																																																				0.537	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302		45	318	0	0	0	0.01441	0	45	318				
RETSAT	54884	broad.mit.edu	37	2	85576586	85576586	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:85576586C>T	ENST00000295802.4	-	5	1030	c.918G>A	c.(916-918)gtG>gtA	p.V306V	RETSAT_ENST00000457495.2_Silent_p.V245V|RETSAT_ENST00000263854.6_Silent_p.V306V	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	306					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.V306V(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	CCCGCTGAATCACAGGGATGG	0.592																																							uc002spd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(916-918)GTG>GTA		all-trans-13,14-dihydroretinol saturase	Vitamin A(DB00162)						84.0	81.0	82.0					2																	85576586		2203	4300	6503	SO:0001819	synonymous_variant	54884				retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity	g.chr2:85576586C>T	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.918G>A	2.37:g.85576586C>T			Somatic				RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Silent_p.V245V|RETSAT_uc010fgf.2_Silent_p.V97V	p.V306V	NM_017750	NP_060220	WXS	Illumina HiSeq	Unspecified	Q6NUM9	RETST_HUMAN			5	1109	-			306					A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Silent	SNP	ENST00000295802.4	37	c.918G>A	CCDS1972.1																																																																																				0.592	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750		10	85	0	0	0	0.001855	0	10	85				
C2orf40	84417	broad.mit.edu	37	2	106694260	106694260	+	Silent	SNP	C	C	A	rs375563861	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:106694260C>A	ENST00000238044.3	+	4	434	c.325C>A	c.(325-327)Cga>Aga	p.R109R	C2orf40_ENST00000409944.1_Silent_p.R73R	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	109					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)		p.R109R(1)		lung(7)|urinary_tract(1)	8						TAACAGAGATCGAAATGGACA	0.453																																							uc010fjf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(325-327)CGA>AGA		esophageal cancer related gene 4 protein							153.0	141.0	145.0					2																	106694260		2203	4300	6503	SO:0001819	synonymous_variant	84417					extracellular region|transport vesicle		g.chr2:106694260C>A	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.325C>A	2.37:g.106694260C>A			Somatic					p.R109R	NM_032411	NP_115787	WXS	Illumina HiSeq	Unspecified	Q9H1Z8	AUGN_HUMAN			4	433	+			109					D3DVK2	Silent	SNP	ENST00000238044.3	37	c.325C>A	CCDS2072.1																																																																																				0.453	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411		14	108	1	0	2.23348e-06	0.004007	2.55104e-06	14	108				
IL36A	27179	broad.mit.edu	37	2	113763598	113763598	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:113763598C>T	ENST00000259211.6	+	2	469	c.58C>T	c.(58-60)Cat>Tat	p.H20Y		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	20					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.H20Y(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						GGATATCAATCATCGGGTGTG	0.473																																							uc010yxr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(58-60)CAT>TAT		interleukin 1 family, member 6 (epsilon)							97.0	101.0	100.0					2																	113763598		1951	4142	6093	SO:0001583	missense	27179				immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding	g.chr2:113763598C>T	AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.58C>T	2.37:g.113763598C>T	ENSP00000259211:p.His20Tyr		Somatic					p.H20Y	NM_014440	NP_055255	WXS	Illumina HiSeq	Unspecified	Q9UHA7	IL36A_HUMAN			2	58	+			20					B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	c.58C>T	CCDS42734.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350594	0.24512	.	.	ENSG00000136694	ENST00000259211	T	0.17528	2.27	4.99	3.01	0.34805	.	0.583280	0.16503	N	0.211571	T	0.18383	0.0441	L	0.54323	1.7	0.09310	N	1	D	0.56968	0.978	P	0.45913	0.497	T	0.13683	-1.0500	10	0.72032	D	0.01	-22.5422	5.421	0.16400	0.2711:0.6284:0.0:0.1005	.	20	Q9UHA7	IL36A_HUMAN	Y	20	ENSP00000259211:H20Y	ENSP00000259211:H20Y	H	+	1	0	IL36A	113480069	0.006000	0.16342	0.002000	0.10522	0.431000	0.31685	1.020000	0.30027	0.512000	0.28257	0.585000	0.79938	CAT		0.473	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330711.1	NM_014440		13	131	0	0	0	0.00245	0	13	131				
NIFK	84365	broad.mit.edu	37	2	122488554	122488554	+	Missense_Mutation	SNP	C	C	T	rs185431138		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:122488554C>T	ENST00000285814.4	-	4	551	c.479G>A	c.(478-480)cGg>cAg	p.R160Q	AC018737.1_ENST00000419902.1_RNA	NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		160					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R160Q(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						CTCCTCCATCCGTAGCTTTTG	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		18952	0.0		0.001	False		,,,				2504	0.0						uc002tnk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(478-480)CGG>CAG		MKI67 interacting nucleolar phosphoprotein							111.0	110.0	110.0					2																	122488554		2202	4299	6501	SO:0001583	missense	84365				protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr2:122488554C>T																												ENST00000285814.4:c.479G>A	2.37:g.122488554C>T	ENSP00000285814:p.Arg160Gln		Somatic				MKI67IP_uc010fls.2_Missense_Mutation_p.R160Q	p.R160Q	NM_032390	NP_115766	WXS	Illumina HiSeq	Unspecified	Q9BYG3	MK67I_HUMAN			4	556	-			160					A8K788|Q8TB66|Q96ED4	Missense_Mutation	SNP	ENST00000285814.4	37	c.479G>A	CCDS2135.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.29	1.308494	0.23821	.	.	ENSG00000155438	ENST00000285814;ENST00000409201;ENST00000447132;ENST00000451734	T;T;T	0.44881	2.35;0.91;1.55	5.64	-1.93	0.07594	.	0.475733	0.23569	N	0.046776	T	0.27384	0.0672	L	0.35644	1.08	0.09310	N	1	B;B	0.23650	0.089;0.059	B;B	0.12156	0.007;0.003	T	0.12811	-1.0533	10	0.38643	T	0.18	0.2944	10.2212	0.43198	0.0:0.3506:0.0:0.6494	.	160;160	B4DSM4;Q9BYG3	.;MK67I_HUMAN	Q	160;160;55;128	ENSP00000285814:R160Q;ENSP00000406227:R55Q;ENSP00000398116:R128Q	ENSP00000285814:R160Q	R	-	2	0	MKI67IP	122205024	0.287000	0.24315	0.014000	0.15608	0.518000	0.34316	0.103000	0.15292	-0.467000	0.06932	-0.355000	0.07637	CGG		0.343	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254239.2			16	134	0	0	0	0.00499	0	16	134				
ACMSD	130013	broad.mit.edu	37	2	135621051	135621051	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:135621051G>A	ENST00000356140.5	+	5	472	c.336G>A	c.(334-336)gtG>gtA	p.V112V	AC016725.4_ENST00000392929.2_RNA|ACMSD_ENST00000283054.4_Silent_p.V54V|ACMSD_ENST00000392928.1_Silent_p.V54V	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	112					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)	p.V112V(1)		endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		GGAGGTTCGTGGGTCTGGGGA	0.592																																							uc002ttz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(334-336)GTG>GTA		aminocarboxymuconate semialdehyde decarboxylase							80.0	73.0	75.0					2																	135621051		2203	4300	6503	SO:0001819	synonymous_variant	130013				quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding	g.chr2:135621051G>A	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.336G>A	2.37:g.135621051G>A			Somatic				ACMSD_uc002tua.2_Silent_p.V54V	p.V112V	NM_138326	NP_612199	WXS	Illumina HiSeq	Unspecified	Q8TDX5	ACMSD_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.115)	5	403	+			112					Q3B7X3|Q53SR5|Q96KY2	Silent	SNP	ENST00000356140.5	37	c.336G>A	CCDS2173.2																																																																																				0.592	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1			18	116	0	0	0	0.008871	0	18	116				
THSD7B	80731	broad.mit.edu	37	2	138373849	138373849	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:138373849G>A	ENST00000409968.1	+	18	3706	c.3528G>A	c.(3526-3528)ctG>ctA	p.L1176L	THSD7B_ENST00000413152.2_Silent_p.L1148L|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Silent_p.L1179L			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1178	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.L1179L(1)|p.L1148L(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTTGCCTCCTGAATGAAAATT	0.453																																							uc002tva.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(3439-3441)CTG>CTA		thrombospondin, type I, domain containing 7B							169.0	181.0	177.0					2																	138373849		2081	4205	6286	SO:0001819	synonymous_variant	80731							g.chr2:138373849G>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3528G>A	2.37:g.138373849G>A			Somatic				THSD7B_uc010zbj.1_Intron	p.L1147L	NM_001080427	NP_001073896	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(221;0.19)	17	3441	+									Silent	SNP	ENST00000409968.1	37	c.3441G>A																																																																																					0.453	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		20	143	0	0	0	0.010504	0	20	143				
PLA2R1	22925	broad.mit.edu	37	2	160836348	160836348	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:160836348C>G	ENST00000283243.7	-	14	2467	c.2261G>C	c.(2260-2262)aGa>aCa	p.R754T	PLA2R1_ENST00000392771.1_Missense_Mutation_p.R754T	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	754	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.R754T(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TACAGGAGTTCTATCAGACCA	0.428																																							uc002ube.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(2260-2262)AGA>ACA		phospholipase A2 receptor 1 isoform 1 precursor							59.0	57.0	58.0					2																	160836348		2203	4300	6503	SO:0001583	missense	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160836348C>G	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2261G>C	2.37:g.160836348C>G	ENSP00000283243:p.Arg754Thr		Somatic				PLA2R1_uc010zcp.1_Missense_Mutation_p.R754T|PLA2R1_uc002ubf.2_Missense_Mutation_p.R754T	p.R754T	NM_007366	NP_031392	WXS	Illumina HiSeq	Unspecified	Q13018	PLA2R_HUMAN			14	2468	-			754			Extracellular (Potential).|C-type lectin 4.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	c.2261G>C	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164804	0.57476	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.17054	2.3;2.3	5.99	5.12	0.69794	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.242323	0.41712	D	0.000836	T	0.26702	0.0653	L	0.52011	1.625	0.32977	D	0.523074	P;P;P	0.50272	0.933;0.709;0.583	P;B;B	0.50896	0.653;0.135;0.223	T	0.38520	-0.9657	10	0.62326	D	0.03	.	14.0472	0.64712	0.0:0.9265:0.0:0.0735	.	754;754;754	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	T	754	ENSP00000283243:R754T;ENSP00000376524:R754T	ENSP00000283243:R754T	R	-	2	0	PLA2R1	160544594	1.000000	0.71417	0.996000	0.52242	0.864000	0.49448	3.782000	0.55401	1.535000	0.49220	0.655000	0.94253	AGA		0.428	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			4	25	0	0	0	0.009096	0	4	25				
TTN	7273	broad.mit.edu	37	2	179479392	179479392	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:179479392G>T	ENST00000591111.1	-	211	44150	c.43926C>A	c.(43924-43926)acC>acA	p.T14642T	TTN_ENST00000342175.6_Silent_p.T7410T|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.T7218T|TTN_ENST00000359218.5_Silent_p.T7343T|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Silent_p.T16283T|TTN_ENST00000342992.6_Silent_p.T13715T|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14642	Ig-like 96.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T13715T(2)|p.T7218T(1)|p.T7410T(1)|p.T7343T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGTTTTCCGGTTACGGTGG	0.433																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(41143-41145)ACC>ACA		titin isoform N2-A							97.0	87.0	90.0					2																	179479392		1861	4099	5960	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179479392G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43926C>A	2.37:g.179479392G>T			Somatic				uc002ump.1_RNA|TTN_uc010zfh.1_Silent_p.T7410T|TTN_uc010zfi.1_Silent_p.T7343T|TTN_uc010zfj.1_Silent_p.T7218T	p.T13715T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		210	41369	-			14642					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.41145C>A																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	44	1	0	0.00621372	0.006214	0.00651089	7	44				
DNAH7	56171	broad.mit.edu	37	2	196664163	196664163	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:196664163T>C	ENST00000312428.6	-	55	10310	c.10210A>G	c.(10210-10212)Aga>Gga	p.R3404G		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3404	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.R3404G(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CGTCCCAATCTGTTGATTATA	0.393																																							uc002utj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(2)	12						c.(10210-10212)AGA>GGA		dynein, axonemal, heavy chain 7							87.0	89.0	88.0					2																	196664163		1845	4093	5938	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196664163T>C	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.10210A>G	2.37:g.196664163T>C	ENSP00000311273:p.Arg3404Gly		Somatic					p.R3404G	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			55	10311	-			3404			AAA 6 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.10210A>G	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	4.620	0.115236	0.08831	.	.	ENSG00000118997	ENST00000312428	T	0.08458	3.09	5.07	2.58	0.30949	Dynein heavy chain (1);	0.704196	0.14016	N	0.347145	T	0.05090	0.0136	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35699	-0.9778	10	0.42905	T	0.14	.	7.724	0.28748	0.1199:0.0:0.2706:0.6095	.	3404	Q8WXX0	DYH7_HUMAN	G	3404	ENSP00000311273:R3404G	ENSP00000311273:R3404G	R	-	1	2	DNAH7	196372408	0.154000	0.22792	0.001000	0.08648	0.177000	0.22998	3.110000	0.50352	0.900000	0.36469	0.455000	0.32223	AGA		0.393	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		10	109	0	0	0	0.010729	0	10	109				
SPAG16	79582	broad.mit.edu	37	2	215274887	215274887	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:215274887G>T	ENST00000331683.5	+	16	1839	c.1744G>T	c.(1744-1746)Ggc>Tgc	p.G582C	VWC2L_ENST00000312504.5_5'Flank|AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA|SPAG16_ENST00000374309.3_Missense_Mutation_p.G488C|VWC2L_ENST00000427124.1_5'Flank	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	582					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.G582C(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TCAGGCAAGTGGCAATGGTGT	0.433																																							uc002veq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1744-1746)GGC>TGC		sperm associated antigen 16 isoform 1							89.0	86.0	87.0					2																	215274887		2203	4300	6503	SO:0001583	missense	79582				cilium assembly	cilium axoneme|flagellar axoneme		g.chr2:215274887G>T	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1744G>T	2.37:g.215274887G>T	ENSP00000332592:p.Gly582Cys		Somatic				SPAG16_uc002ver.2_Missense_Mutation_p.G528C|SPAG16_uc010zjk.1_Missense_Mutation_p.G488C|VWC2L_uc002vet.2_5'Flank|VWC2L_uc010zjl.1_5'Flank	p.G582C	NM_024532	NP_078808	WXS	Illumina HiSeq	Unspecified	Q8N0X2	SPG16_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)	16	1836	+		Renal(323;0.00461)	582			WD 6.		Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	c.1744G>T	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.629734	0.28978	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	D;D;D	0.81659	-1.52;-1.52;-1.5	5.19	0.176	0.15049	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.669254	0.13698	N	0.369068	T	0.72486	0.3466	L	0.43923	1.385	0.09310	N	0.999994	P;D;P	0.55800	0.913;0.973;0.951	B;P;B	0.45232	0.443;0.474;0.443	T	0.62431	-0.6856	10	0.38643	T	0.18	.	8.1158	0.30942	0.5842:0.0:0.4158:0.0	.	488;522;582	B4DYB5;Q4G1A2;Q8N0X2	.;.;SPG16_HUMAN	C	582;488;206	ENSP00000332592:G582C;ENSP00000363428:G488C;ENSP00000416600:G206C	ENSP00000332592:G582C	G	+	1	0	SPAG16	214983132	0.484000	0.25964	0.093000	0.20910	0.197000	0.23852	-0.026000	0.12392	0.027000	0.15297	-0.251000	0.11542	GGC		0.433	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532		11	104	1	0	3.86212e-05	0.008291	4.30912e-05	11	104				
SERPINE2	5270	broad.mit.edu	37	2	224847476	224847476	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:224847476C>G	ENST00000258405.4	-	6	1149	c.907G>C	c.(907-909)Gat>Cat	p.D303H	SERPINE2_ENST00000409304.1_Missense_Mutation_p.D303H|SERPINE2_ENST00000409840.3_Missense_Mutation_p.D303H|SERPINE2_ENST00000447280.2_Missense_Mutation_p.D315H	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	303					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D303H(1)|p.D315H(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCCTTCAAATCTGTTTGTGCT	0.353																																							uc002vnu.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|ovary(1)|central_nervous_system(1)	4						c.(907-909)GAT>CAT		plasminogen activator inhibitor type 1, member 2							69.0	71.0	70.0					2																	224847476		2203	4300	6503	SO:0001583	missense	5270				negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity	g.chr2:224847476C>G	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.907G>C	2.37:g.224847476C>G	ENSP00000258405:p.Asp303His		Somatic				SERPINE2_uc002vnt.2_Missense_Mutation_p.D303H|SERPINE2_uc010zlr.1_Missense_Mutation_p.D315H|SERPINE2_uc002vnv.2_Missense_Mutation_p.D303H	p.D303H	NM_006216	NP_006207	WXS	Illumina HiSeq	Unspecified	P07093	GDN_HUMAN		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)	6	1150	-		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)	303					B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	c.907G>C	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967301	0.74131	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280	T;T;T;T	0.78481	1.64;-1.18;1.64;1.64	6.02	6.02	0.97574	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.89822	0.6826	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89941	0.4073	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	315;303	B4DIF2;P07093	.;GDN_HUMAN	H	303;303;303;315	ENSP00000386412:D303H;ENSP00000258405:D303H;ENSP00000386969:D303H;ENSP00000415786:D315H	ENSP00000258405:D303H	D	-	1	0	SERPINE2	224555720	1.000000	0.71417	0.995000	0.50966	0.436000	0.31835	6.987000	0.76206	2.865000	0.98341	0.655000	0.94253	GAT		0.353	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216		6	46	0	0	0	0.001984	0	6	46				
COL4A4	1286	broad.mit.edu	37	2	227924124	227924124	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:227924124C>T	ENST00000396625.3	-	28	2587	c.2380G>A	c.(2380-2382)Gaa>Aaa	p.E794K	COL4A4_ENST00000329662.7_Missense_Mutation_p.E794K	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	794	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.E794K(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTCATACCTTCAGCCCCTGGA	0.517																																							uc010zlt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11						c.(2380-2382)GAA>AAA		alpha 4 type IV collagen precursor							142.0	154.0	150.0					2																	227924124		1934	4114	6048	SO:0001583	missense	1286				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding	g.chr2:227924124C>T		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2380G>A	2.37:g.227924124C>T	ENSP00000379866:p.Glu794Lys		Somatic					p.E794K	NM_000092	NP_000083	WXS	Illumina HiSeq	Unspecified	P53420	CO4A4_HUMAN		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)	28	3034	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	794			Triple-helical region.		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	c.2380G>A	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057746	0.36277	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.93547	-3.24;-3.24	5.99	3.7	0.42460	.	.	.	.	.	T	0.80025	0.4548	N	0.03084	-0.415	0.26312	N	0.977809	B	0.23937	0.094	B	0.16722	0.016	T	0.67616	-0.5625	9	0.06757	T	0.87	.	8.0747	0.30710	0.0:0.625:0.2855:0.0895	.	794	P53420	CO4A4_HUMAN	K	794	ENSP00000379866:E794K;ENSP00000328553:E794K	ENSP00000328553:E794K	E	-	1	0	COL4A4	227632368	0.841000	0.29509	0.994000	0.49952	0.437000	0.31866	0.891000	0.28309	2.840000	0.97914	0.655000	0.94253	GAA		0.517	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		33	237	0	0	0	0.004878	0	33	237				
DGKD	8527	broad.mit.edu	37	2	234358641	234358641	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:234358641G>C	ENST00000264057.2	+	16	1914	c.1902G>C	c.(1900-1902)caG>caC	p.Q634H	DGKD_ENST00000409813.3_Missense_Mutation_p.Q590H	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	634					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Q634H(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCGATGAGCAGAATGCCCAGA	0.632																																							uc002vui.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5						c.(1900-1902)CAG>CAC		diacylglycerol kinase, delta 130kDa isoform 2	Phosphatidylserine(DB00144)						55.0	48.0	51.0					2																	234358641		2203	4300	6503	SO:0001583	missense	8527				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr2:234358641G>C	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1902G>C	2.37:g.234358641G>C	ENSP00000264057:p.Gln634His		Somatic				DGKD_uc002vuj.1_Missense_Mutation_p.Q590H|DGKD_uc010fyh.1_Missense_Mutation_p.Q501H|DGKD_uc010fyi.1_RNA	p.Q634H	NM_152879	NP_690618	WXS	Illumina HiSeq	Unspecified	Q16760	DGKD_HUMAN		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	16	1914	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)	634					Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	c.1902G>C	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847148	0.71603	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.81415	-1.33;-1.49	3.98	3.1	0.35709	.	0.000000	0.64402	D	0.000005	D	0.86464	0.5939	M	0.62088	1.915	0.47698	D	0.999497	P;D;D	0.76494	0.942;0.999;0.999	P;D;D	0.85130	0.643;0.997;0.928	D	0.85544	0.1217	10	0.44086	T	0.13	.	12.0827	0.53680	0.0844:0.0:0.9156:0.0	.	518;590;634	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	H	634;590	ENSP00000264057:Q634H;ENSP00000386455:Q590H	ENSP00000264057:Q634H	Q	+	3	2	DGKD	234023380	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.220000	0.78008	1.043000	0.40175	-0.150000	0.13652	CAG		0.632	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		6	70	0	0	0	0.008291	0	6	70				
PDYN	5173	broad.mit.edu	37	20	1961296	1961296	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:1961296C>T	ENST00000217305.2	-	4	663	c.438G>A	c.(436-438)atG>atA	p.M146I	RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000540134.1_Missense_Mutation_p.M146I|PDYN_ENST00000539905.1_Missense_Mutation_p.M146I	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	146					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.M146I(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGCATCCCTCATCAGCTCAG	0.557																																							uc010gaj.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(436-438)ATG>ATA		beta-neoendorphin-dynorphin preproprotein							118.0	110.0	113.0					20																	1961296		2203	4300	6503	SO:0001583	missense	5173				cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity	g.chr20:1961296C>T		CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.438G>A	20.37:g.1961296C>T	ENSP00000217305:p.Met146Ile		Somatic				uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.M146I|PDYN_uc010zpt.1_5'UTR	p.M146I	NM_024411	NP_077722	WXS	Illumina HiSeq	Unspecified	P01213	PDYN_HUMAN			3	680	-			146					A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	37	c.438G>A	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	C	8.476	0.858682	0.17178	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	T;T;T	0.80033	-1.33;-1.33;-1.33	4.71	0.385	0.16249	.	1.585980	0.02994	N	0.147212	T	0.75384	0.3842	L	0.57536	1.79	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.48246	-0.9052	10	0.21540	T	0.41	0.1214	5.2632	0.15586	0.1434:0.6023:0.0:0.2544	.	146	P01213	PDYN_HUMAN	I	146	ENSP00000440185:M146I;ENSP00000442259:M146I;ENSP00000217305:M146I	ENSP00000217305:M146I	M	-	3	0	PDYN	1909296	0.000000	0.05858	0.003000	0.11579	0.061000	0.15899	-0.279000	0.08479	0.201000	0.20466	0.491000	0.48974	ATG		0.557	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2			11	152	0	0	0	0.013537	0	11	152				
HAO1	54363	broad.mit.edu	37	20	7915177	7915177	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:7915177G>T	ENST00000378789.3	-	2	294	c.243C>A	c.(241-243)gcC>gcA	p.A81A		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	81	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.A81A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TGCGCTGCATGGCCGTAGCCC	0.532																																							uc002wmw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(241-243)GCC>GCA		hydroxyacid oxidase 1							107.0	96.0	100.0					20																	7915177		2203	4300	6503	SO:0001819	synonymous_variant	54363				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity	g.chr20:7915177G>T	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.243C>A	20.37:g.7915177G>T			Somatic				HAO1_uc010gbu.2_Silent_p.A81A	p.A81A	NM_017545	NP_060015	WXS	Illumina HiSeq	Unspecified	Q9UJM8	HAOX1_HUMAN			2	267	-			81			FMN hydroxy acid dehydrogenase.		Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	37	c.243C>A	CCDS13100.1																																																																																				0.532	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2			12	135	1	0	1.3612e-06	0.003163	1.57716e-06	12	135				
TOP1	7150	broad.mit.edu	37	20	39728776	39728776	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:39728776C>G	ENST00000361337.2	+	12	1306	c.1056C>G	c.(1054-1056)aaC>aaG	p.N352K	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	352					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)	p.N352K(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	GGATTGCTAACTTCAAGATAG	0.428			T	NUP98	AML*																																		uc002xjl.2		NA		Dom	yes		20	20q12-q13.1	7150	T	topoisomerase (DNA) I			L	NUP98		AML*		1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7						c.(1054-1056)AAC>AAG		DNA topoisomerase I	Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)						63.0	64.0	64.0					20																	39728776		2203	4300	6503	SO:0001583	missense	7150				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding	g.chr20:39728776C>G		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.1056C>G	20.37:g.39728776C>G	ENSP00000354522:p.Asn352Lys		Somatic				uc002xjn.1_Intron	p.N352K	NM_003286	NP_003277	WXS	Illumina HiSeq	Unspecified	P11387	TOP1_HUMAN			12	1302	+		Myeloproliferative disorder(115;0.00878)	352					A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	ENST00000361337.2	37	c.1056C>G	CCDS13312.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593507	0.86953	.	.	ENSG00000198900	ENST00000361337	T	0.55760	0.5	5.27	5.27	0.74061	DNA topoisomerase I, DNA binding, mixed alpha/beta motif, eukaryotic-type (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.000000	0.85682	D	0.000000	T	0.80502	0.4635	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85928	0.1450	10	0.87932	D	0	-28.6975	13.56	0.61784	0.0:0.925:0.0:0.075	.	352	P11387	TOP1_HUMAN	K	352	ENSP00000354522:N352K	ENSP00000354522:N352K	N	+	3	2	TOP1	39162190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.970000	0.63742	2.641000	0.89580	0.655000	0.94253	AAC		0.428	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			9	62	0	0	0	0.004482	0	9	62				
EYA2	2139	broad.mit.edu	37	20	45725774	45725774	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:45725774A>T	ENST00000327619.5	+	9	1229	c.855A>T	c.(853-855)ttA>ttT	p.L285F	EYA2_ENST00000357410.3_Missense_Mutation_p.L285F|EYA2_ENST00000317304.6_Missense_Mutation_p.L285F	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	285					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.L285F(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				TTCACTCCTTACTCACGGGGA	0.423																																					Pancreas(120;56 1725 18501 25218 43520)	Pancreas(120;56 1725 18501 25218 43520)	uc002xsm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(853-855)TTA>TTT		eyes absent 2 isoform a							268.0	246.0	254.0					20																	45725774		2203	4300	6503	SO:0001583	missense	2139				DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity	g.chr20:45725774A>T		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.855A>T	20.37:g.45725774A>T	ENSP00000333640:p.Leu285Phe		Somatic				EYA2_uc010ghp.2_Missense_Mutation_p.L285F|EYA2_uc002xsn.2_Missense_Mutation_p.L290F|EYA2_uc002xso.2_Missense_Mutation_p.L285F|EYA2_uc002xsp.2_Missense_Mutation_p.L285F|EYA2_uc002xsq.2_Missense_Mutation_p.L285F	p.L285F	NM_005244	NP_005235	WXS	Illumina HiSeq	Unspecified	O00167	EYA2_HUMAN			9	1229	+		Myeloproliferative disorder(115;0.0241)	285					Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	ENST00000327619.5	37	c.855A>T	CCDS13403.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196899	0.79015	.	.	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304;ENST00000458636	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.91	4.81	0.61882	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.89774	0.6812	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;1.0	D	0.89989	0.4106	10	0.87932	D	0	-23.7105	11.1743	0.48590	0.9278:0.0:0.0722:0.0	.	285;285;285;285	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	F	285;285;285;285;156	ENSP00000333640:L285F;ENSP00000349986:L285F;ENSP00000321590:L285F;ENSP00000395427:L156F	ENSP00000321590:L285F	L	+	3	2	EYA2	45159181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.545000	0.36169	1.072000	0.40860	0.533000	0.62120	TTA		0.423	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		43	294	0	0	0	0.011902	0	43	294				
TAF4	6874	broad.mit.edu	37	20	60584215	60584215	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:60584215C>T	ENST00000252996.4	-	5	1776	c.1777G>A	c.(1777-1779)Gtg>Atg	p.V593M	TAF4_ENST00000609045.1_5'Flank	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	593	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.V593L(1)|p.V593M(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CATTTCTTCACGTTTTCCATA	0.343																																							uc002ybs.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(2)|pancreas(1)	3						c.(1777-1779)GTG>ATG		TBP-associated factor 4							67.0	67.0	67.0					20																	60584215		2203	4300	6503	SO:0001583	missense	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60584215C>T	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1777G>A	20.37:g.60584215C>T	ENSP00000252996:p.Val593Met		Somatic					p.V593M	NM_003185	NP_003176	WXS	Illumina HiSeq	Unspecified	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		5	1777	-	Breast(26;1e-08)		593			TAFH.		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	c.1777G>A	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621095	0.87460	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.52295	0.67;0.67	5.15	5.15	0.70609	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.74099	0.3672	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79276	-0.1870	10	0.66056	D	0.02	-17.5576	18.5942	0.91225	0.0:1.0:0.0:0.0	.	593	O00268	TAF4_HUMAN	M	593;457	ENSP00000252996:V593M;ENSP00000399091:V457M	ENSP00000252996:V593M	V	-	1	0	TAF4	60017610	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.513000	0.81739	2.385000	0.81259	0.561000	0.74099	GTG		0.343	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		9	66	0	0	0	0.004482	0	9	66				
SRMS	6725	broad.mit.edu	37	20	62178813	62178813	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:62178813C>T	ENST00000217188.1	-	1	44	c.4G>A	c.(4-6)Gag>Aag	p.E2K		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	2	N-terminal.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.E2K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			AGGAACGGCTCCATCCCCCGG	0.731																																							uc002yfi.1		NA																	1	Substitution - Missense(1)		lung(1)	stomach(1)|lung(1)	2						c.(4-6)GAG>AAG		src-related kinase lacking C-terminal regulatory							16.0	19.0	18.0					20																	62178813		2001	3931	5932	SO:0001583	missense	6725						ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr20:62178813C>T		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.4G>A	20.37:g.62178813C>T	ENSP00000217188:p.Glu2Lys		Somatic					p.E2K	NM_080823	NP_543013	WXS	Illumina HiSeq	Unspecified	Q9H3Y6	SRMS_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		1	45	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		2						Missense_Mutation	SNP	ENST00000217188.1	37	c.4G>A	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445050	0.83993	.	.	ENSG00000125508	ENST00000217188	T	0.76448	-1.02	3.85	3.85	0.44370	.	0.000000	0.53938	D	0.000043	T	0.63034	0.2477	L	0.34521	1.04	0.32174	N	0.581235	P	0.46987	0.888	B	0.36289	0.221	T	0.70912	-0.4743	10	0.34782	T	0.22	.	11.7602	0.51898	0.0:0.8212:0.1788:0.0	.	2	Q9H3Y6	SRMS_HUMAN	K	2	ENSP00000217188:E2K	ENSP00000217188:E2K	E	-	1	0	SRMS	61649257	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	4.076000	0.57591	1.841000	0.53522	0.491000	0.48974	GAG		0.731	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823		7	46	0	0	0	0.00308	0	7	46				
TSPEAR	54084	broad.mit.edu	37	21	45987864	45987864	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr21:45987864C>T	ENST00000323084.4	-	2	173	c.108G>A	c.(106-108)gcG>gcA	p.A36A	TSPEAR_ENST00000397916.1_5'UTR	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	36					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)		p.A36A(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GGACCACTTCCGCCAGGATGT	0.587																																							uc002zfe.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(106-108)GCG>GCA		chromosome 21 open reading frame 29 precursor							51.0	45.0	47.0					21																	45987864		2203	4300	6503	SO:0001819	synonymous_variant	54084				cell adhesion	extracellular region	structural molecule activity	g.chr21:45987864C>T	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.108G>A	21.37:g.45987864C>T			Somatic				C21orf29_uc010gpv.1_5'UTR	p.A36A	NM_144991	NP_659428	WXS	Illumina HiSeq	Unspecified	Q8WU66	TSEAR_HUMAN			2	174	-			36						Silent	SNP	ENST00000323084.4	37	c.108G>A	CCDS13712.1																																																																																				0.587	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991		4	45	0	0	0	0.000602	0	4	45				
MYO18B	84700	broad.mit.edu	37	22	26422991	26422991	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:26422991T>A	ENST00000407587.2	+	43	7223	c.7054T>A	c.(7054-7056)Tgc>Agc	p.C2352S	MYO18B_ENST00000536101.1_Missense_Mutation_p.C2351S|MYO18B_ENST00000335473.7_Missense_Mutation_p.C2351S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2351						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.C2352S(2)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						ATTCAGTTCCTGCGAGTCCCT	0.562																																							uc003abz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(7051-7053)TGC>AGC		myosin XVIIIB							78.0	86.0	84.0					22																	26422991		1935	4137	6072	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26422991T>A	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7054T>A	22.37:g.26422991T>A	ENSP00000386096:p.Cys2352Ser		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.C2232S|MYO18B_uc010guy.1_Missense_Mutation_p.C2233S|MYO18B_uc010guz.1_Missense_Mutation_p.C2231S|MYO18B_uc011aka.1_Missense_Mutation_p.C1505S|MYO18B_uc011akb.1_Missense_Mutation_p.C1864S|MYO18B_uc010gva.1_Missense_Mutation_p.C334S|MYO18B_uc010gvb.1_RNA	p.C2351S	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			43	7301	+			2351					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.7051T>A		.	.	.	.	.	.	.	.	.	.	T	18.22	3.575845	0.65878	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88201	-2.33;-2.33;-2.35	4.89	4.89	0.63831	.	0.186759	0.31347	N	0.007810	D	0.92041	0.7478	L	0.52364	1.645	0.37257	D	0.906798	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.994;0.994;0.997;0.997	D	0.93121	0.6525	10	0.45353	T	0.12	.	13.3206	0.60430	0.0:0.0:0.0:1.0	.	1864;2353;2351;2352;2351	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	S	2351;2351;2352	ENSP00000441229:C2351S;ENSP00000334563:C2351S;ENSP00000386096:C2352S	ENSP00000334563:C2351S	C	+	1	0	MYO18B	24752991	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	3.847000	0.55895	1.821000	0.53095	0.379000	0.24179	TGC		0.562	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		13	167	0	0	0	0.003163	0	13	167				
SFI1	9814	broad.mit.edu	37	22	31924785	31924785	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:31924785C>T	ENST00000400288.2	+	3	307	c.202C>T	c.(202-204)Cta>Tta	p.L68L	SFI1_ENST00000443326.1_Intron|SFI1_ENST00000540643.1_Silent_p.L68L|SFI1_ENST00000432498.1_Silent_p.L68L|SFI1_ENST00000400289.1_Intron|SFI1_ENST00000443011.1_Intron|SFI1_ENST00000414585.1_Intron	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	68					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.L68L(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						TACCAGTCATCTAGTGCAGTA	0.493																																							uc003ale.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(202-204)CTA>TTA		spindle assembly associated Sfi1 homolog isoform							135.0	126.0	129.0					22																	31924785		1987	4177	6164	SO:0001819	synonymous_variant	9814				G2/M transition of mitotic cell cycle	centriole|cytosol		g.chr22:31924785C>T	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.202C>T	22.37:g.31924785C>T			Somatic				SFI1_uc003ald.1_Silent_p.L68L|SFI1_uc003alf.2_Silent_p.L68L|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Silent_p.L68L|SFI1_uc003alh.2_Intron	p.L68L	NM_001007467	NP_001007468	WXS	Illumina HiSeq	Unspecified	A8K8P3	SFI1_HUMAN			3	595	+			68					A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	ENST00000400288.2	37	c.202C>T	CCDS43004.1																																																																																				0.493	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775		16	151	0	0	0	0.00499	0	16	151				
CBX7	23492	broad.mit.edu	37	22	39530045	39530045	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:39530045C>T	ENST00000216133.5	-	6	812	c.607G>A	c.(607-609)Gac>Aac	p.D203N	CBX7_ENST00000475962.1_Intron|CBX7_ENST00000401405.3_Missense_Mutation_p.D110N	NM_175709.3	NP_783640.1	O95931	CBX7_HUMAN	chromobox homolog 7	203					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)	p.D203N(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					TCGGCCAGGTCGGCATCTGCT	0.647																																					GBM(46;845 904 3560 9866 23971)	GBM(46;845 904 3560 9866 23971)	uc003axb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(607-609)GAC>AAC		chromobox homolog 7							58.0	62.0	60.0					22																	39530045		2203	4300	6503	SO:0001583	missense	23492				chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex		g.chr22:39530045C>T		CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000216133.5:c.607G>A	22.37:g.39530045C>T	ENSP00000216133:p.Asp203Asn		Somatic				CBX7_uc003axc.2_Missense_Mutation_p.D110N	p.D203N	NM_175709	NP_783640	WXS	Illumina HiSeq	Unspecified	O95931	CBX7_HUMAN			6	696	-	Melanoma(58;0.04)		203					Q86T17	Missense_Mutation	SNP	ENST00000216133.5	37	c.607G>A	CCDS13986.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829717	0.91036	.	.	ENSG00000100307	ENST00000216133;ENST00000401405	T;T	0.48836	0.8;0.8	5.16	5.16	0.70880	.	0.000000	0.43579	D	0.000545	T	0.58221	0.2107	L	0.31926	0.97	0.28256	N	0.92505	D;B	0.76494	0.999;0.029	D;B	0.71184	0.972;0.009	T	0.53627	-0.8412	10	0.31617	T	0.26	.	18.6372	0.91383	0.0:1.0:0.0:0.0	.	110;203	B0QYP2;O95931	.;CBX7_HUMAN	N	203;110	ENSP00000216133:D203N;ENSP00000384035:D110N	ENSP00000216133:D203N	D	-	1	0	CBX7	37859991	0.999000	0.42202	0.987000	0.45799	0.799000	0.45148	3.601000	0.54059	2.413000	0.81919	0.561000	0.74099	GAC		0.647	CBX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318020.1	NM_175709		8	111	0	0	0	0.006214	0	8	111				
TNRC6B	23112	broad.mit.edu	37	22	40697001	40697001	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:40697001G>A	ENST00000454349.2	+	14	4139	c.3928G>A	c.(3928-3930)Gag>Aag	p.E1310K	TNRC6B_ENST00000335727.9_Missense_Mutation_p.E1200K|TNRC6B_ENST00000402203.1_Missense_Mutation_p.E506K|TNRC6B_ENST00000301923.9_Missense_Mutation_p.E506K	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1310	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E1324K(1)|p.E506K(1)		breast(1)	1						CCAACAGCAAGAGCAGCAGGT	0.527																																							uc011aor.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3928-3930)GAG>AAG		trinucleotide repeat containing 6B isoform 1							42.0	43.0	43.0					22																	40697001		2087	4225	6312	SO:0001583	missense	23112				gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding	g.chr22:40697001G>A	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3928G>A	22.37:g.40697001G>A	ENSP00000401946:p.Glu1310Lys		Somatic				TNRC6B_uc003aym.2_Missense_Mutation_p.E506K|TNRC6B_uc003ayn.3_Missense_Mutation_p.E1200K|TNRC6B_uc003ayo.2_Missense_Mutation_p.E1057K	p.E1310K	NM_001162501	NP_001155973	WXS	Illumina HiSeq	Unspecified	Q9UPQ9	TNR6B_HUMAN			14	4139	+			1310					B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	c.3928G>A	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	36	5.676250	0.96764	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.36	5.36	0.76844	.	0.050159	0.85682	D	0.000000	T	0.45518	0.1346	L	0.29908	0.895	0.48236	D	0.999619	D;D;D;P	0.60160	0.987;0.982;0.969;0.89	P;P;P;P	0.55923	0.787;0.525;0.533;0.496	T	0.13019	-1.0525	10	0.10111	T	0.7	-3.3652	19.4472	0.94852	0.0:0.0:1.0:0.0	.	1310;1200;1200;506	Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.;.	K	506;506;1310;1200;1200	ENSP00000306759:E506K;ENSP00000384795:E506K;ENSP00000401946:E1310K;ENSP00000338371:E1200K	ENSP00000306759:E506K	E	+	1	0	TNRC6B	39026947	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.104000	0.77024	2.669000	0.90835	0.655000	0.94253	GAG		0.527	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				4	20	0	0	0	0.009096	0	4	20				
CCDC13	152206	broad.mit.edu	37	3	42777198	42777198	+	Splice_Site	SNP	C	C	T	rs531063281	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:42777198C>T	ENST00000310232.6	-	10	1455		c.e10+1		CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13									p.?(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						GCCCTACTCACGTGCACATTG	0.587													C|||	5	0.000998403	0.0	0.0	5008	,	,		21971	0.0		0.0	False		,,,				2504	0.0051						uc003cly.3		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e10+1		coiled-coil domain containing 13							116.0	108.0	111.0					3																	42777198		2203	4300	6503	SO:0001630	splice_region_variant	152206							g.chr3:42777198C>T	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1371+1G>A	3.37:g.42777198C>T			Somatic					p.H457_splice	NM_144719	NP_653320	WXS	Illumina HiSeq	Unspecified	Q8IYE1	CCD13_HUMAN			10	1455	-									Splice_Site	SNP	ENST00000310232.6	37	c.1371_splice	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428970	0.43122	.	.	ENSG00000244607	ENST00000310232	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8025	0.85617	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC13	42752202	1.000000	0.71417	0.997000	0.53966	0.375000	0.29983	5.014000	0.64029	2.267000	0.75376	0.511000	0.50034	.		0.587	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	Intron	33	202	0	0	0	0.003755	0	33	202				
CCR2	729230	broad.mit.edu	37	3	46399605	46399605	+	Missense_Mutation	SNP	G	G	A	rs372424162		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:46399605G>A	ENST00000400888.2	+	1	626	c.587G>A	c.(586-588)cGa>cAa	p.R196Q	CCR2_ENST00000292301.4_Missense_Mutation_p.R196Q|CCR2_ENST00000465202.1_Intron|CCR2_ENST00000445132.2_Missense_Mutation_p.R196Q			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	196					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)	p.R196Q(2)		breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		TATTTTCCACGAGGATGGAAT	0.458																																							uc003cpn.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|breast(1)	2						c.(586-588)CGA>CAA		chemokine (C-C motif) receptor 2 isoform A		G	GLN/ARG,GLN/ARG	0,3136		0,0,1568	253.0	245.0	248.0		587,587	-10.1	0.0	3		248	1,7163		0,1,3581	no	missense,missense	CCR2	NM_001123396.1,NM_001123041.2	43,43	0,1,5149	AA,AG,GG		0.014,0.0,0.0097	benign,benign	196/361,196/375	46399605	1,10299	1568	3582	5150	SO:0001583	missense	729230				astrocyte cell migration|blood vessel remodeling|cellular defense response|chemokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response|interspecies interaction between organisms|JAK-STAT cascade|monocyte extravasation|negative regulation of adenylate cyclase activity|negative regulation of angiogenesis|negative regulation of eosinophil degranulation|negative regulation of type 2 immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of immune complex clearance by monocytes and macrophages|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-2 production|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|positive regulation of T cell extravasation|positive regulation of T-helper 1 type immune response|positive regulation of tumor necrosis factor biosynthetic process|regulation of vascular endothelial growth factor production|T-helper 17 cell chemotaxis	cytosol|dendrite|integral to plasma membrane|perikaryon|perinuclear region of cytoplasm|soluble fraction	C-C chemokine receptor activity|CCR2 chemokine receptor binding|protein homodimerization activity	g.chr3:46399605G>A		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.587G>A	3.37:g.46399605G>A	ENSP00000383681:p.Arg196Gln		Somatic				CCR2_uc003cpm.3_Missense_Mutation_p.R196Q	p.R196Q	NM_001123041	NP_001116513	WXS	Illumina HiSeq	Unspecified	P41597	CCR2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)	2	1072	+			196			Extracellular (Potential).		A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	37	c.587G>A	CCDS43078.1	.	.	.	.	.	.	.	.	.	.	G	3.319	-0.139210	0.06669	0.0	1.4E-4	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000400888	T;T;T	0.71698	-0.59;-0.59;-0.59	5.04	-10.1	0.00402	GPCR, rhodopsin-like superfamily (1);	3.389930	0.00829	N	0.001656	T	0.31040	0.0784	N	0.01668	-0.77	0.09310	N	1	B;B	0.17852	0.024;0.013	B;B	0.08055	0.003;0.001	T	0.38394	-0.9663	10	0.02654	T	1	.	4.4215	0.11482	0.2155:0.424:0.2252:0.1353	.	196;196	P41597;Q4VBL2	CCR2_HUMAN;.	Q	196	ENSP00000399285:R196Q;ENSP00000292301:R196Q;ENSP00000383681:R196Q	ENSP00000292301:R196Q	R	+	2	0	CCR2	46374609	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-3.551000	0.00433	-2.937000	0.00298	-1.069000	0.02264	CGA		0.458	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647		50	414	0	0	0	0.01441	0	50	414				
SCAP	22937	broad.mit.edu	37	3	47456639	47456639	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:47456639C>G	ENST00000265565.5	-	19	3500	c.3088G>C	c.(3088-3090)Gat>Cat	p.D1030H	SCAP_ENST00000441517.2_Missense_Mutation_p.D774H|SCAP_ENST00000545718.1_Missense_Mutation_p.D637H	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1030	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)	p.D1030H(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GAGAAGAAATCAAGGGAACCG	0.622																																					Pancreas(149;978 1908 29304 37806 46700)	Pancreas(149;978 1908 29304 37806 46700)	uc003crh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3088-3090)GAT>CAT		SREBF chaperone protein							52.0	54.0	53.0					3																	47456639		2202	4299	6501	SO:0001583	missense	22937				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding	g.chr3:47456639C>G	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3088G>C	3.37:g.47456639C>G	ENSP00000265565:p.Asp1030His		Somatic				SCAP_uc011baz.1_Missense_Mutation_p.D774H|SCAP_uc003crg.2_Missense_Mutation_p.D637H|uc003cri.2_RNA	p.D1030H	NM_012235	NP_036367	WXS	Illumina HiSeq	Unspecified	Q12770	SCAP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)	19	3343	-			1030			Interaction with SREBF2 (By similarity).|Cytoplasmic (By similarity).|WD 3.		Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	c.3088G>C	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733372	0.89482	.	.	ENSG00000114650	ENST00000339815;ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.39592	1.65;2.27;1.07	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.109620	0.64402	D	0.000009	T	0.53658	0.1810	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71656	0.958;0.974	T	0.53760	-0.8393	10	0.59425	D	0.04	-17.4012	16.4142	0.83728	0.0:1.0:0.0:0.0	.	774;1030	F8W921;Q12770	.;SCAP_HUMAN	H	522;656;1030;774;637	ENSP00000265565:D1030H;ENSP00000416847:D774H;ENSP00000438956:D637H	ENSP00000265565:D1030H	D	-	1	0	SCAP	47431643	1.000000	0.71417	0.881000	0.34555	0.982000	0.71751	7.111000	0.77077	2.728000	0.93425	0.561000	0.74099	GAT		0.622	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235		5	50	0	0	0	0.000602	0	5	50				
CELSR3	1951	broad.mit.edu	37	3	48677227	48677227	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:48677227G>A	ENST00000164024.4	-	34	10071	c.9791C>T	c.(9790-9792)tCa>tTa	p.S3264L	CELSR3_ENST00000544264.1_Missense_Mutation_p.S3269L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	3264					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S3264L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGTGTGCTTGAAGATTGCAC	0.597																																							uc003cul.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(9790-9792)TCA>TTA		cadherin EGF LAG seven-pass G-type receptor 3							215.0	212.0	213.0					3																	48677227		2203	4300	6503	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48677227G>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.9791C>T	3.37:g.48677227G>A	ENSP00000164024:p.Ser3264Leu		Somatic				CELSR3_uc003cuf.1_Missense_Mutation_p.S3362L|CELSR3_uc010hkf.2_Missense_Mutation_p.S554L|CELSR3_uc010hkg.2_Missense_Mutation_p.S1247L	p.S3264L	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	34	10072	-			3264			Cytoplasmic (Potential).		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.9791C>T	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831595	0.71258	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.73469	-0.75;-0.75	5.31	5.31	0.75309	.	.	.	.	.	T	0.66489	0.2794	L	0.27053	0.805	0.42181	D	0.991685	B;B;B	0.21147	0.052;0.016;0.016	B;B;B	0.17433	0.018;0.005;0.007	T	0.63985	-0.6513	9	0.62326	D	0.03	.	18.9727	0.92721	0.0:0.0:1.0:0.0	.	3269;3264;3362	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	L	3264;3269	ENSP00000164024:S3264L;ENSP00000445694:S3269L	ENSP00000164024:S3264L	S	-	2	0	CELSR3	48652231	1.000000	0.71417	0.988000	0.46212	0.677000	0.39632	5.906000	0.69900	2.473000	0.83533	0.561000	0.74099	TCA		0.597	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		33	178	0	0	0	0.003755	0	33	178				
P4HTM	54681	broad.mit.edu	37	3	49042348	49042348	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49042348G>T	ENST00000383729.4	+	6	1313	c.942G>T	c.(940-942)ctG>ctT	p.L314L	P4HTM_ENST00000343546.4_Silent_p.L314L|WDR6_ENST00000415265.2_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000608424.1_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	314	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.L314L(2)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	GCGAGCCGCTGCAGGTTGTTC	0.637																																							uc003cvg.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)|pancreas(1)	2						c.(940-942)CTG>CTT		hypoxia-inducible factor prolyl 4-hydroxylase	Vitamin C(DB00126)						83.0	75.0	78.0					3																	49042348		2203	4300	6503	SO:0001819	synonymous_variant	54681					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr3:49042348G>T		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.942G>T	3.37:g.49042348G>T			Somatic				P4HTM_uc003cvh.2_Silent_p.L314L|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	p.L314L	NM_177939	NP_808808	WXS	Illumina HiSeq	Unspecified	Q9NXG6	P4HTM_HUMAN			6	1291	+			314			Lumenal (Potential).|Fe2OG dioxygenase.		Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Silent	SNP	ENST00000383729.4	37	c.942G>T	CCDS43089.1																																																																																				0.637	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938		10	75	1	0	0.000219431	0.00245	0.000242582	10	75				
P4HTM	54681	broad.mit.edu	37	3	49042350	49042350	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49042350A>C	ENST00000383729.4	+	6	1315	c.944A>C	c.(943-945)cAg>cCg	p.Q315P	P4HTM_ENST00000343546.4_Missense_Mutation_p.Q315P|WDR6_ENST00000415265.2_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000608424.1_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	315	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.Q315P(2)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	GAGCCGCTGCAGGTTGTTCGA	0.637																																							uc003cvg.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)|pancreas(1)	2						c.(943-945)CAG>CCG		hypoxia-inducible factor prolyl 4-hydroxylase	Vitamin C(DB00126)						86.0	77.0	80.0					3																	49042350		2203	4300	6503	SO:0001583	missense	54681					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr3:49042350A>C		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.944A>C	3.37:g.49042350A>C	ENSP00000373235:p.Gln315Pro		Somatic				P4HTM_uc003cvh.2_Missense_Mutation_p.Q315P|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	p.Q315P	NM_177939	NP_808808	WXS	Illumina HiSeq	Unspecified	Q9NXG6	P4HTM_HUMAN			6	1293	+			315			Lumenal (Potential).|Fe2OG dioxygenase.		Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	c.944A>C	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.713913	0.89112	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.60672	0.17	5.29	5.29	0.74685	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.182601	0.49916	D	0.000131	D	0.83885	0.5351	H	0.97023	3.925	0.53688	D	0.999979	D;P	0.89917	1.0;0.879	D;P	0.85130	0.997;0.637	D	0.89563	0.3808	10	0.87932	D	0	-9.519	15.3015	0.73955	1.0:0.0:0.0:0.0	.	315;315	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	P	315	ENSP00000373235:Q315P	ENSP00000341422:Q315P	Q	+	2	0	P4HTM	49017354	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	8.919000	0.92770	2.017000	0.59298	0.529000	0.55759	CAG		0.637	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938		11	75	0	0	0	0.003163	0	11	75				
LAMB2	3913	broad.mit.edu	37	3	49161339	49161339	+	Missense_Mutation	SNP	G	G	A	rs372032732		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49161339G>A	ENST00000418109.1	-	25	3783	c.3619C>T	c.(3619-3621)Cgt>Tgt	p.R1207C	USP19_ENST00000453664.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.R1207C|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000398888.2_5'Flank|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1207	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.R1207C(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGCTGTGTACGGGCTGCCAAG	0.612																																							uc003cwe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3619-3621)CGT>TGT		laminin, beta 2 precursor		G	CYS/ARG	1,4405		0,1,2202	45.0	43.0	44.0		3619	5.8	0.9	3		44	0,8600		0,0,4300	no	missense	LAMB2	NM_002292.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1207/1799	49161339	1,13005	2203	4300	6503	SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49161339G>A		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3619C>T	3.37:g.49161339G>A	ENSP00000388325:p.Arg1207Cys		Somatic					p.R1207C	NM_002292	NP_002283	WXS	Illumina HiSeq	Unspecified	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	24	3918	-			1207			Domain II.		Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	c.3619C>T	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965455	0.53507	2.27E-4	0.0	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.24723	1.84;1.84	5.84	5.84	0.93424	.	0.053759	0.64402	D	0.000001	T	0.41003	0.1140	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	P	0.50231	0.635	T	0.13953	-1.0490	10	0.52906	T	0.07	.	20.1278	0.97990	0.0:0.0:1.0:0.0	.	1207	P55268	LAMB2_HUMAN	C	1207	ENSP00000388325:R1207C;ENSP00000307156:R1207C	ENSP00000307156:R1207C	R	-	1	0	LAMB2	49136343	0.995000	0.38212	0.910000	0.35882	0.267000	0.26476	4.372000	0.59530	2.768000	0.95171	0.561000	0.74099	CGT		0.612	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		6	55	0	0	0	0.008291	0	6	55				
RNF123	63891	broad.mit.edu	37	3	49724892	49724892	+	5'Flank	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49724892G>A	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Silent_p.I125I|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000494828.2_5'UTR|MST1_ENST00000545762.1_Intron|MST1_ENST00000383728.3_Silent_p.I50I	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.I111I(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CATTGTTCATGATGCAGGTCC	0.597																																						GBM(110;181 1524 8005 22865 46297)	uc003cxg.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(373-375)ATC>ATT		macrophage stimulating 1 (hepatocyte growth							62.0	58.0	59.0					3																	49724892		2203	4300	6503	SO:0001631	upstream_gene_variant	4485				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr3:49724892G>A	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724892G>A	Exception_encountered		Somatic				MST1_uc011bcs.1_Silent_p.I125I|MST1_uc010hkx.2_Silent_p.I46I|MST1_uc011bct.1_Silent_p.I125I|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	p.I125I	NM_020998	NP_066278	WXS	Illumina HiSeq	Unspecified	P26927	HGFL_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	4	447	-			111			Kringle 1.		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	c.375C>T	CCDS33758.1																																																																																				0.597	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064		19	87	0	0	0	0.006122	0	19	87				
FLNB	2317	broad.mit.edu	37	3	58080588	58080588	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:58080588G>T	ENST00000295956.4	+	5	978	c.813G>T	c.(811-813)gtG>gtT	p.V271V	FLNB_ENST00000348383.5_Silent_p.V271V|FLNB_ENST00000419752.2_Silent_p.V102V|FLNB_ENST00000429972.2_Silent_p.V271V|FLNB_ENST00000493452.1_Silent_p.V102V|FLNB_ENST00000358537.3_Silent_p.V271V|FLNB_ENST00000490882.1_Silent_p.V271V|FLNB_ENST00000357272.4_Silent_p.V271V	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	271					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.V271V(2)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GAAACATGGTGAAGCAGCCAG	0.537																																							uc003djj.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19						c.(811-813)GTG>GTT		filamin B isoform 2							193.0	179.0	184.0					3																	58080588		2203	4300	6503	SO:0001819	synonymous_variant	2317				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding	g.chr3:58080588G>T	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.813G>T	3.37:g.58080588G>T			Somatic				FLNB_uc010hne.2_Silent_p.V271V|FLNB_uc003djk.2_Silent_p.V271V|FLNB_uc010hnf.2_Silent_p.V271V|FLNB_uc003djl.2_Silent_p.V102V|FLNB_uc003djm.2_Silent_p.V102V	p.V271V	NM_001457	NP_001448	WXS	Illumina HiSeq	Unspecified	O75369	FLNB_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)	5	978	+			271			Filamin 1.		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	c.813G>T	CCDS2885.1																																																																																				0.537	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		26	178	1	0	5.61819e-17	0.005443	7.12623e-17	26	178				
KIAA2018	205717	broad.mit.edu	37	3	113375010	113375010	+	Nonsense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:113375010G>C	ENST00000478658.1	-	5	5536	c.5519C>G	c.(5518-5520)tCa>tGa	p.S1840*	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Nonsense_Mutation_p.S1840*			Q68DE3	K2018_HUMAN	KIAA2018	1840						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.S1840*(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTGATGTTCTGAGAGTGACCT	0.448																																							uc003eam.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)	3						c.(5518-5520)TCA>TGA		hypothetical protein LOC205717							96.0	94.0	95.0					3																	113375010		1974	4172	6146	SO:0001587	stop_gained	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113375010G>C	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5519C>G	3.37:g.113375010G>C	ENSP00000420721:p.Ser1840*		Somatic				KIAA2018_uc003eal.2_Nonsense_Mutation_p.S1784*	p.S1840*	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	5930	-			1840					Q7Z3L9|Q8IVF3|Q9H8T4	Nonsense_Mutation	SNP	ENST00000478658.1	37	c.5519C>G	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	G	43	10.414994	0.99401	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	.	.	.	5.91	5.91	0.95273	.	0.472244	0.23153	N	0.051335	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-2.8408	20.2983	0.98569	0.0:0.0:1.0:0.0	.	.	.	.	X	1840	.	ENSP00000320794:S1840X	S	-	2	0	KIAA2018	114857700	.	.	1.000000	0.80357	0.997000	0.91878	.	.	2.802000	0.96397	0.655000	0.94253	TCA		0.448	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		23	141	0	0	0	0.014323	0	23	141				
CPNE4	131034	broad.mit.edu	37	3	131261579	131261579	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:131261579C>T	ENST00000512055.1	-	19	3487	c.1361G>A	c.(1360-1362)cGg>cAg	p.R454Q	CPNE4_ENST00000512332.1_Missense_Mutation_p.R472Q|CPNE4_ENST00000511604.1_Missense_Mutation_p.R454Q|CPNE4_ENST00000502818.1_Missense_Mutation_p.R472Q|CPNE4_ENST00000429747.1_Missense_Mutation_p.R454Q			Q96A23	CPNE4_HUMAN	copine IV	454	VWFA.					extracellular vesicular exosome (GO:0070062)		p.R454Q(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						AATGGCCTCCCGGGTGTCGGC	0.557																																							uc003eok.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1360-1362)CGG>CAG		copine IV							119.0	105.0	110.0					3																	131261579		2203	4300	6503	SO:0001583	missense	131034							g.chr3:131261579C>T	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1361G>A	3.37:g.131261579C>T	ENSP00000421705:p.Arg454Gln		Somatic				CPNE4_uc011blq.1_Missense_Mutation_p.R472Q|CPNE4_uc003eol.2_Missense_Mutation_p.R472Q|CPNE4_uc003eom.2_Missense_Mutation_p.R454Q|CPNE4_uc003eoj.2_Missense_Mutation_p.R5Q	p.R454Q	NM_130808	NP_570720	WXS	Illumina HiSeq	Unspecified	Q96A23	CPNE4_HUMAN			15	1796	-			454			VWFA.		D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	c.1361G>A	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	C	35	5.496180	0.96355	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	5.3	5.3	0.74995	von Willebrand factor, type A (1);Copine (1);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	M	0.62209	1.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.983;0.994	T	0.42599	-0.9442	10	0.72032	D	0.01	-18.4852	19.0375	0.92985	0.0:1.0:0.0:0.0	.	472;454	Q96A23-2;Q96A23	.;CPNE4_HUMAN	Q	454;454;472;454;472	ENSP00000421705:R454Q;ENSP00000411904:R454Q;ENSP00000424853:R472Q;ENSP00000423811:R454Q;ENSP00000421646:R472Q	ENSP00000411904:R454Q	R	-	2	0	CPNE4	132744269	0.985000	0.35326	1.000000	0.80357	0.995000	0.86356	7.815000	0.86186	2.503000	0.84419	0.650000	0.86243	CGG		0.557	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808		8	93	0	0	0	0.00308	0	8	93				
MED12L	116931	broad.mit.edu	37	3	150883660	150883660	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:150883660C>T	ENST00000474524.1	+	10	1423	c.1385C>T	c.(1384-1386)aCg>aTg	p.T462M	MED12L_ENST00000422248.2_Missense_Mutation_p.T462M|MED12L_ENST00000273432.4_Missense_Mutation_p.T322M|MED12L_ENST00000309237.4_Missense_Mutation_p.T462M	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	462						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.T462M(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTTTGCACACGTTGGAAGTT	0.383																																							uc003eyp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(1384-1386)ACG>ATG		mediator of RNA polymerase II transcription,							172.0	164.0	167.0					3																	150883660		2203	4300	6503	SO:0001583	missense	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:150883660C>T	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1385C>T	3.37:g.150883660C>T	ENSP00000417235:p.Thr462Met		Somatic				MED12L_uc011bnz.1_Missense_Mutation_p.T322M|MED12L_uc003eyn.2_Missense_Mutation_p.T462M|MED12L_uc003eyo.2_Missense_Mutation_p.T462M	p.T462M	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		10	1423	+			462					Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	c.1385C>T	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635741	0.87760	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.69	5.69	0.88448	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	M	0.80616	2.505	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;P	0.87578	0.966;0.998;0.997;0.897	T	0.72147	-0.4378	10	0.87932	D	0	-17.4251	19.3996	0.94623	0.0:1.0:0.0:0.0	.	322;462;462;462	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	M	462;462;462;322	ENSP00000403308:T462M;ENSP00000310760:T462M;ENSP00000417235:T462M;ENSP00000273432:T322M	ENSP00000273432:T322M	T	+	2	0	MED12L	152366350	1.000000	0.71417	0.959000	0.39883	0.882000	0.50991	5.139000	0.64801	2.676000	0.91093	0.655000	0.94253	ACG		0.383	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		19	183	0	0	0	0.010504	0	19	183				
SI	6476	broad.mit.edu	37	3	164725726	164725726	+	Missense_Mutation	SNP	C	C	T	rs145734588	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:164725726C>T	ENST00000264382.3	-	36	4302	c.4240G>A	c.(4240-4242)Gaa>Aaa	p.E1414K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1414	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.E1414K(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TAATTTAGTTCGTCATTTCTG	0.264										HNSCC(35;0.089)			C|||	7	0.00139776	0.0045	0.0014	5008	,	,		12506	0.0		0.0	False		,,,				2504	0.0						uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(4240-4242)GAA>AAA		sucrase-isomaltase	Acarbose(DB00284)	C	LYS/GLU	12,4392	19.1+/-41.9	0,12,2190	148.0	154.0	152.0		4240	-9.8	0.0	3	dbSNP_134	152	2,8584	2.2+/-6.3	0,2,4291	yes	missense	SI	NM_001041.3	56	0,14,6481	TT,TC,CC		0.0233,0.2725,0.1078	benign	1414/1828	164725726	14,12976	2202	4293	6495	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164725726C>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4240G>A	3.37:g.164725726C>T	ENSP00000264382:p.Glu1414Lys	HNSCC(35;0.089)	Somatic					p.E1414K	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			36	4302	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1414			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.4240G>A	CCDS3196.1	3	0.0013736263736263737	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	0	0.0	C	0.202	-1.043725	0.01997	0.002725	2.33E-4	ENSG00000090402	ENST00000264382	D	0.88586	-2.4	4.92	-9.84	0.00479	Glycoside hydrolase, superfamily (1);	2.488890	0.01481	N	0.016680	T	0.68476	0.3005	N	0.11131	0.1	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.66736	-0.5848	10	0.06365	T	0.9	.	1.8534	0.03174	0.142:0.2719:0.2608:0.3253	.	1414	P14410	SUIS_HUMAN	K	1414	ENSP00000264382:E1414K	ENSP00000264382:E1414K	E	-	1	0	SI	166208420	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-4.477000	0.00228	-2.415000	0.00568	-1.288000	0.01363	GAA		0.264	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		4	43	0	0	0	0.009096	0	4	43				
MAP3K13	9175	broad.mit.edu	37	3	185167766	185167766	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:185167766G>T	ENST00000265026.3	+	6	1423	c.1089G>T	c.(1087-1089)tgG>tgT	p.W363C	MAP3K13_ENST00000446828.1_Missense_Mutation_p.W156C|MAP3K13_ENST00000443863.1_Missense_Mutation_p.W219C|MAP3K13_ENST00000424227.1_Missense_Mutation_p.W363C|MAP3K13_ENST00000535426.1_Missense_Mutation_p.W219C	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.W363C(2)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CCATTATCTGGGGTGTTGGAA	0.468																																							uc010hyf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1087-1089)TGG>TGT		mitogen-activated protein kinase kinase kinase							102.0	95.0	97.0					3																	185167766		2203	4300	6503	SO:0001583	missense	9175				activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr3:185167766G>T	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1089G>T	3.37:g.185167766G>T	ENSP00000265026:p.Trp363Cys		Somatic				MAP3K13_uc011brt.1_Missense_Mutation_p.W156C|MAP3K13_uc003fph.3_Missense_Mutation_p.W131C|MAP3K13_uc011bru.1_Missense_Mutation_p.W219C|MAP3K13_uc003fpi.2_Missense_Mutation_p.W363C|MAP3K13_uc010hyg.2_Missense_Mutation_p.W53C	p.W363C	NM_004721	NP_004712	WXS	Illumina HiSeq	Unspecified	O43283	M3K13_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)		7	1355	+	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		363			Protein kinase.			Missense_Mutation	SNP	ENST00000265026.3	37	c.1089G>T	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570112	0.86542	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86707	0.5997	N	0.21583	0.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.994;0.998	D	0.88007	0.2760	10	0.87932	D	0	.	20.1467	0.98079	0.0:0.0:1.0:0.0	.	219;156;363	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	C	156;363;219;219;363;108	ENSP00000411483:W156C;ENSP00000399910:W363C;ENSP00000409325:W219C;ENSP00000439257:W219C;ENSP00000265026:W363C;ENSP00000415712:W108C	ENSP00000265026:W363C	W	+	3	0	MAP3K13	186650460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.838000	0.97847	0.655000	0.94253	TGG		0.468	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721		17	97	1	0	3.41278e-10	0.00499	4.17503e-10	17	97				
LPP	4026	broad.mit.edu	37	3	188426068	188426068	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:188426068G>T	ENST00000312675.4	+	7	1373	c.1127G>T	c.(1126-1128)gGg>gTg	p.G376V	LPP_ENST00000448637.1_Missense_Mutation_p.G376V|LPP_ENST00000471917.1_3'UTR|LPP_ENST00000543006.1_Missense_Mutation_p.G376V	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	376					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.G376V(1)	HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		GGCCATTCAGGGCAACTGGGG	0.522			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																		uc003frs.1		NA		Dom	yes		3	3q28	4026	T	LIM domain containing preferred translocation partner in lipoma			"""L, M"""	HMGA2|MLL|C12orf9		lipoma|leukemia	HMGA2/LPP(161)	1	Substitution - Missense(1)		lung(1)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165						c.(1126-1128)GGG>GTG		LIM domain containing preferred translocation							101.0	91.0	95.0					3																	188426068		2203	4300	6503	SO:0001583	missense	4026				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding	g.chr3:188426068G>T	AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1127G>T	3.37:g.188426068G>T	ENSP00000318089:p.Gly376Val		Somatic				LPP_uc011bsg.1_Missense_Mutation_p.G229V|LPP_uc011bsi.1_Missense_Mutation_p.G376V|LPP_uc003frt.2_Missense_Mutation_p.G376V|LPP_uc011bsj.1_Missense_Mutation_p.G213V	p.G376V	NM_005578	NP_005569	WXS	Illumina HiSeq	Unspecified	Q93052	LPP_HUMAN		GBM - Glioblastoma multiforme(93;0.00602)	7	1373	+	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)	376					A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	37	c.1127G>T	CCDS3291.1	.	.	.	.	.	.	.	.	.	.	G	2.220	-0.378629	0.05000	.	.	ENSG00000145012	ENST00000448637;ENST00000312675;ENST00000543006;ENST00000415906	T;T;T;T	0.56611	1.8;0.45;0.45;1.41	5.74	1.49	0.22878	.	0.469754	0.19771	N	0.106438	T	0.36303	0.0962	L	0.33485	1.01	0.21256	N	0.999741	B;B;B	0.13145	0.0;0.007;0.0	B;B;B	0.11329	0.0;0.006;0.002	T	0.18903	-1.0322	10	0.22109	T	0.4	.	8.8615	0.35261	0.0:0.2561:0.446:0.2979	.	229;376;376	B7Z8W0;C9JUT4;Q93052	.;.;LPP_HUMAN	V	376;376;376;213	ENSP00000393602:G376V;ENSP00000318089:G376V;ENSP00000438891:G376V;ENSP00000393008:G213V	ENSP00000318089:G376V	G	+	2	0	LPP	189908762	0.532000	0.26346	0.018000	0.16275	0.048000	0.14542	0.752000	0.26362	0.278000	0.22164	0.563000	0.77884	GGG		0.522	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578		12	91	1	0	2.27111e-07	0.013537	2.70959e-07	12	91				
JAKMIP1	152789	broad.mit.edu	37	4	6055780	6055780	+	Silent	SNP	G	G	C	rs370646732		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:6055780G>C	ENST00000282924.5	-	13	2288	c.1803C>G	c.(1801-1803)ctC>ctG	p.L601L	JAKMIP1_ENST00000409371.3_Silent_p.L416L|JAKMIP1_ENST00000409021.3_Silent_p.L601L|JAKMIP1_ENST00000410077.2_Silent_p.L436L|JAKMIP1_ENST00000409831.1_Silent_p.L601L	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	601	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.L601L(2)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCTTACTTCGAGTTCTAGCA	0.403																																							uc003giu.3		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(1801-1803)CTC>CTG		janus kinase and microtubule interacting protein							219.0	207.0	211.0					4																	6055780		2203	4300	6503	SO:0001819	synonymous_variant	152789				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding	g.chr4:6055780G>C	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1803C>G	4.37:g.6055780G>C			Somatic				JAKMIP1_uc010idb.1_Silent_p.L601L|JAKMIP1_uc010idc.1_Silent_p.L416L|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Silent_p.L436L|JAKMIP1_uc003giv.3_Silent_p.L601L|JAKMIP1_uc010ide.2_3'UTR	p.L601L	NM_144720	NP_653321	WXS	Illumina HiSeq	Unspecified	Q96N16	JKIP1_HUMAN			13	2079	-			601			Mediates interaction with TYK2 and GABBR1.|Potential.		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	37	c.1803C>G	CCDS3385.1																																																																																				0.403	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720		30	251	0	0	0	0.009535	0	30	251				
TADA2B	93624	broad.mit.edu	37	4	7056332	7056332	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:7056332G>C	ENST00000310074.7	+	2	1003	c.814G>C	c.(814-816)Gat>Cat	p.D272H	TADA2B_ENST00000512388.1_Missense_Mutation_p.D197H|TADA2B_ENST00000515646.1_Missense_Mutation_p.D180H	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	272					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D272H(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						CAAGGAGTTTGATGACCTTTT	0.522																																							uc003gjw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(814-816)GAT>CAT		transcriptional adaptor 2 (ADA2 homolog,							38.0	45.0	43.0					4																	7056332		2036	4179	6215	SO:0001583	missense	93624				regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr4:7056332G>C	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.814G>C	4.37:g.7056332G>C	ENSP00000308022:p.Asp272His		Somatic				TADA2B_uc010idi.2_Missense_Mutation_p.D197H	p.D272H	NM_152293	NP_689506	WXS	Illumina HiSeq	Unspecified	Q86TJ2	TAD2B_HUMAN			2	965	+			272					A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	ENST00000310074.7	37	c.814G>C	CCDS47007.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653115	0.67472	.	.	ENSG00000173011	ENST00000310074;ENST00000512388;ENST00000515646	T;T;T	0.52526	0.66;0.66;0.66	4.96	4.96	0.65561	.	0.052246	0.64402	D	0.000001	T	0.45256	0.1333	L	0.46157	1.445	0.53688	D	0.999978	P;P	0.39964	0.697;0.533	B;B	0.37422	0.249;0.17	T	0.53472	-0.8434	10	0.87932	D	0	-41.4781	18.2471	0.89989	0.0:0.0:1.0:0.0	.	197;272	Q86TJ2-2;Q86TJ2	.;TAD2B_HUMAN	H	272;197;180	ENSP00000308022:D272H;ENSP00000423947:D197H;ENSP00000423181:D180H	ENSP00000308022:D272H	D	+	1	0	TADA2B	7107233	1.000000	0.71417	0.731000	0.30826	0.974000	0.67602	8.901000	0.92560	2.307000	0.77673	0.561000	0.74099	GAT		0.522	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293		9	76	0	0	0	0.008291	0	9	76				
UGT2B10	7365	broad.mit.edu	37	4	69682206	69682206	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:69682206G>T	ENST00000265403.7	+	1	496	c.469G>T	c.(469-471)Gag>Tag	p.E157*	UGT2B10_ENST00000458688.2_Intron	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	157					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.E157*(2)		endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						ACCCTGTGGTGAGCTGCTGGC	0.388																																					Melanoma(133;755 1763 25578 26334 46021)	Melanoma(133;755 1763 25578 26334 46021)	uc003hee.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(3)|ovary(2)	5						c.(469-471)GAG>TAG		UDP glucuronosyltransferase 2B10 isoform 1							126.0	123.0	124.0					4																	69682206		2202	4297	6499	SO:0001587	stop_gained	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69682206G>T	X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.469G>T	4.37:g.69682206G>T	ENSP00000265403:p.Glu157*		Somatic				UGT2B10_uc011cam.1_Intron	p.E157*	NM_001075	NP_001066	WXS	Illumina HiSeq	Unspecified	P36537	UDB10_HUMAN			1	494	+			157					A8K9M3|B4DPP1|Q14CR8	Nonsense_Mutation	SNP	ENST00000265403.7	37	c.469G>T		.	.	.	.	.	.	.	.	.	.	g	18.89	3.720438	0.68959	.	.	ENSG00000109181	ENST00000265403	.	.	.	2.63	2.63	0.31362	.	0.081913	0.47852	U	0.000201	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	10.7026	0.45937	0.0:0.0:1.0:0.0	.	.	.	.	X	157	.	ENSP00000265403:E157X	E	+	1	0	UGT2B10	69716795	1.000000	0.71417	0.471000	0.27229	0.018000	0.09664	6.317000	0.72862	1.309000	0.44985	0.184000	0.17185	GAG		0.388	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365169.1	NM_001075		9	107	1	0	4.3838e-07	0.001855	5.15364e-07	9	107				
COPS4	51138	broad.mit.edu	37	4	83984321	83984321	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:83984321G>C	ENST00000264389.2	+	7	943	c.808G>C	c.(808-810)Gat>Cat	p.D270H	COPS4_ENST00000509093.1_Missense_Mutation_p.D270H|COPS4_ENST00000511653.1_Missense_Mutation_p.D270H|COPS4_ENST00000503682.1_Missense_Mutation_p.D270H	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	270	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)		p.D270H(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				AATGTATCTAGATAGGATCAT	0.438																																							uc003hoa.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(808-810)GAT>CAT		COP9 signalosome subunit 4							87.0	85.0	86.0					4																	83984321		2203	4300	6503	SO:0001583	missense	51138				cullin deneddylation	cytoplasm|signalosome	protein binding	g.chr4:83984321G>C	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.808G>C	4.37:g.83984321G>C	ENSP00000264389:p.Asp270His		Somatic				COPS4_uc003hob.2_Missense_Mutation_p.D270H|COPS4_uc010ijw.2_Missense_Mutation_p.D270H|COPS4_uc010ijx.2_Missense_Mutation_p.D270H	p.D270H	NM_016129	NP_057213	WXS	Illumina HiSeq	Unspecified	Q9BT78	CSN4_HUMAN			7	947	+		Hepatocellular(203;0.114)	270			PCI.		B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	37	c.808G>C	CCDS3600.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713339	0.89112	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.67	5.67	0.87782	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.76494	0.999;0.994;0.999;0.995	D;D;D;D	0.71870	0.975;0.937;0.975;0.963	T	0.60372	-0.7276	10	0.49607	T	0.09	-18.3876	19.7712	0.96366	0.0:0.0:1.0:0.0	.	270;270;270;270	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	H	270;270;158;270;270	ENSP00000425976:D270H;ENSP00000264389:D270H;ENSP00000425486:D158H;ENSP00000424791:D270H;ENSP00000424655:D270H	ENSP00000264389:D270H	D	+	1	0	COPS4	84203345	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	9.523000	0.98034	2.677000	0.91161	0.585000	0.79938	GAT		0.438	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1			10	80	0	0	0	0.010729	0	10	80				
TIGD2	166815	broad.mit.edu	37	4	90034222	90034222	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:90034222G>A	ENST00000317005.2	+	1	255	c.97G>A	c.(97-99)Gtg>Atg	p.V33M	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	33	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V33M(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		AAAACTTTCCGTGGTGTACGG	0.373																																							uc003hsk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(97-99)GTG>ATG		tigger transposable element derived 2							103.0	106.0	105.0					4																	90034222		2203	4300	6503	SO:0001583	missense	166815				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr4:90034222G>A	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.97G>A	4.37:g.90034222G>A	ENSP00000317170:p.Val33Met		Somatic				FAM13A_uc003hsh.1_5'Flank	p.V33M	NM_145715	NP_663761	WXS	Illumina HiSeq	Unspecified	Q4W5G0	TIGD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)	1	255	+		Hepatocellular(203;0.114)	33			H-T-H motif (By similarity).|HTH psq-type.			Missense_Mutation	SNP	ENST00000317005.2	37	c.97G>A	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	g	9.391	1.075517	0.20227	.	.	ENSG00000180346	ENST00000317005	T	0.43294	0.95	3.31	1.42	0.22433	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.218004	0.22824	U	0.055185	T	0.39784	0.1091	N	0.22421	0.69	0.09310	N	1	D	0.71674	0.998	P	0.61800	0.894	T	0.11203	-1.0597	10	0.66056	D	0.02	.	5.6834	0.17788	0.1172:0.0:0.6901:0.1927	.	33	Q4W5G0	TIGD2_HUMAN	M	33	ENSP00000317170:V33M	ENSP00000317170:V33M	V	+	1	0	TIGD2	90253245	0.179000	0.23135	0.623000	0.29173	0.508000	0.34012	1.604000	0.36804	0.576000	0.29452	0.298000	0.19748	GTG		0.373	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715		22	160	0	0	0	0.012319	0	22	160				
LEF1	51176	broad.mit.edu	37	4	109088908	109088908	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:109088908C>T	ENST00000265165.1	-	1	670	c.16G>A	c.(16-18)Gga>Aga	p.G6R	LEF1_ENST00000379951.2_Missense_Mutation_p.G6R|LEF1_ENST00000510624.1_5'Flank|LEF1-AS1_ENST00000436413.1_RNA|LEF1_ENST00000512172.1_5'Flank|LEF1_ENST00000438313.2_Missense_Mutation_p.G6R	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	6	CTNNB1-binding. {ECO:0000250}.|Poly-Gly.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G6R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		CCACCTCCTCCGGAGAGTTGG	0.647																																							uc003hyt.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(16-18)GGA>AGA		lymphoid enhancer-binding factor 1 isoform 1							37.0	47.0	44.0					4																	109088908		2199	4294	6493	SO:0001583	missense	51176				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr4:109088908C>T		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.16G>A	4.37:g.109088908C>T	ENSP00000265165:p.Gly6Arg		Somatic				LEF1_uc011cfj.1_5'Flank|LEF1_uc011cfk.1_5'Flank|LEF1_uc003hyu.1_Missense_Mutation_p.G6R|LEF1_uc003hyv.1_Missense_Mutation_p.G6R|LEF1_uc010imb.1_RNA	p.G6R	NM_016269	NP_057353	WXS	Illumina HiSeq	Unspecified	Q9UJU2	LEF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000224)	1	671	-			6			Poly-Gly.|CTNNB1-binding (By similarity).		B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	c.16G>A	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179197	0.78564	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313	D;D;D	0.99470	-5.96;-5.95;-5.93	4.52	4.52	0.55395	CTNNB1 binding, N-teminal (1);	1.698820	0.03173	N	0.170993	D	0.99278	0.9748	M	0.71206	2.165	0.58432	D	0.999996	B;B;D	0.63046	0.021;0.021;0.992	B;B;P	0.51582	0.008;0.008;0.674	D	0.95900	0.8914	10	0.72032	D	0.01	-7.0148	14.0773	0.64897	0.0:0.8368:0.1632:0.0	.	6;6;6	Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;LEF1_HUMAN	R	6	ENSP00000265165:G6R;ENSP00000369284:G6R;ENSP00000406176:G6R	ENSP00000265165:G6R	G	-	1	0	LEF1	109308357	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.987000	0.63857	2.053000	0.61076	0.591000	0.81541	GGA		0.647	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2			11	122	0	0	0	0.008871	0	11	122				
SPATA5	166378	broad.mit.edu	37	4	124235149	124235149	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:124235149C>G	ENST00000274008.4	+	16	2681	c.2612C>G	c.(2611-2613)cCt>cGt	p.P871R		NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	871					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.P871R(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						ACTGTGACACCTAGAATTCCT	0.413																																							uc003iez.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2611-2613)CCT>CGT		spermatogenesis associated 5							98.0	88.0	92.0					4																	124235149		2203	4300	6503	SO:0001583	missense	166378				cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity	g.chr4:124235149C>G	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.2612C>G	4.37:g.124235149C>G	ENSP00000274008:p.Pro871Arg		Somatic					p.P871R	NM_145207	NP_660208	WXS	Illumina HiSeq	Unspecified	Q8NB90	SPAT5_HUMAN			16	2685	+			871					C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	ENST00000274008.4	37	c.2612C>G	CCDS3730.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497245	0.44352	.	.	ENSG00000145375	ENST00000274008	D	0.95205	-3.64	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	D	0.95906	0.8667	M	0.64567	1.98	0.52099	D	0.999946	D	0.67145	0.996	P	0.61003	0.882	D	0.93780	0.7083	10	0.15066	T	0.55	-38.6676	19.425	0.94737	0.0:1.0:0.0:0.0	.	871	Q8NB90	SPAT5_HUMAN	R	871	ENSP00000274008:P871R	ENSP00000274008:P871R	P	+	2	0	SPATA5	124454599	1.000000	0.71417	0.958000	0.39756	0.195000	0.23768	5.983000	0.70540	2.584000	0.87258	0.563000	0.77884	CCT		0.413	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207		12	90	0	0	0	0.013537	0	12	90				
FHDC1	85462	broad.mit.edu	37	4	153874673	153874673	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:153874673G>A	ENST00000511601.1	+	3	709	c.521G>A	c.(520-522)cGg>cAg	p.R174Q	FHDC1_ENST00000260008.3_Missense_Mutation_p.R174Q			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	174	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.							p.R174L(1)|p.R174Q(1)	ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GATGCAAAACGGAGCATGAAC	0.313																																							uc003inf.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)	2						c.(520-522)CGG>CAG		FH2 domain containing 1							127.0	131.0	130.0					4																	153874673		2202	4300	6502	SO:0001583	missense	85462				actin cytoskeleton organization		actin binding	g.chr4:153874673G>A	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.521G>A	4.37:g.153874673G>A	ENSP00000427567:p.Arg174Gln		Somatic					p.R174Q	NM_033393	NP_203751	WXS	Illumina HiSeq	Unspecified	Q9C0D6	FHDC1_HUMAN			2	596	+	all_hematologic(180;0.093)		174			FH2.			Missense_Mutation	SNP	ENST00000511601.1	37	c.521G>A	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	G	36	5.657326	0.96724	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.62788	-0.0;-0.0	5.91	5.91	0.95273	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.052038	0.64402	D	0.000001	D	0.85186	0.5639	M	0.92604	3.325	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.87670	0.2540	10	0.87932	D	0	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	174	Q9C0D6	FHDC1_HUMAN	Q	174	ENSP00000427567:R174Q;ENSP00000260008:R174Q	ENSP00000260008:R174Q	R	+	2	0	FHDC1	154094123	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.209000	0.95087	2.793000	0.96121	0.655000	0.94253	CGG		0.313	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393		16	96	0	0	0	0.007413	0	16	96				
DROSHA	29102	broad.mit.edu	37	5	31515172	31515172	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:31515172C>T	ENST00000511367.2	-	7	1457	c.1213G>A	c.(1213-1215)Gaa>Aaa	p.E405K	DROSHA_ENST00000513349.1_Missense_Mutation_p.E368K|DROSHA_ENST00000344624.3_Missense_Mutation_p.E405K|DROSHA_ENST00000442743.1_Missense_Mutation_p.E368K	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	405					defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.E405K(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						AGAAGTTCTTCTTCTTCCTCC	0.463																																							uc003jhg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1213-1215)GAA>AAA		ribonuclease III, nuclear isoform 1							173.0	164.0	167.0					5																	31515172		1919	4126	6045	SO:0001583	missense	29102				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr5:31515172C>T	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.1213G>A	5.37:g.31515172C>T	ENSP00000425979:p.Glu405Lys		Somatic				RNASEN_uc003jhh.2_Missense_Mutation_p.E368K|RNASEN_uc003jhi.2_Missense_Mutation_p.E368K|RNASEN_uc010iui.1_Missense_Mutation_p.E328K	p.E405K	NM_013235	NP_037367	WXS	Illumina HiSeq	Unspecified	Q9NRR4	RNC_HUMAN			7	1572	-			405					E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	c.1213G>A	CCDS47195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.501914|4.501914	0.85176|0.85176	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302|ENST00000512076	T;T;T;T;T|.	0.52983|.	1.52;1.52;0.89;0.89;0.64|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.147747|.	0.64402|.	D|.	0.000016|.	T|T	0.68897|0.68897	0.3051|0.3051	L|L	0.44542|0.44542	1.39|1.39	0.58432|0.58432	D|D	0.999991|0.999991	B;B;B|.	0.32829|.	0.386;0.139;0.139|.	B;B;B|.	0.31101|.	0.124;0.037;0.037|.	T|T	0.63207|0.63207	-0.6689|-0.6689	10|5	0.09590|.	T|.	0.72|.	-15.2211|-15.2211	19.8465|19.8465	0.96710|0.96710	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	337;368;405|.	Q9NRR4-2;E7EMP9;Q9NRR4|.	.;.;RNC_HUMAN|.	K|K	405;405;368;368;330;361;172|166	ENSP00000425979:E405K;ENSP00000339845:E405K;ENSP00000409335:E368K;ENSP00000424161:E368K;ENSP00000428782:E172K|.	ENSP00000265075:E330K|.	E|R	-|-	1|2	0|0	DROSHA|DROSHA	31550929|31550929	1.000000|1.000000	0.71417|0.71417	0.286000|0.286000	0.24833|0.24833	0.986000|0.986000	0.74619|0.74619	5.708000|5.708000	0.68377|0.68377	2.769000|2.769000	0.95229|0.95229	0.561000|0.561000	0.74099|0.74099	GAA|AGA		0.463	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235		27	162	0	0	0	0.008361	0	27	162				
NIPBL	25836	broad.mit.edu	37	5	36985803	36985803	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:36985803C>T	ENST00000282516.8	+	10	3020	c.2521C>T	c.(2521-2523)Cga>Tga	p.R841*	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Nonsense_Mutation_p.R841*	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	841					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.R841*(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GTCTAGGGTTCGAAGACCAGA	0.403																																							uc003jkl.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(2521-2523)CGA>TGA		delangin isoform A							62.0	59.0	60.0					5																	36985803		2203	4300	6503	SO:0001587	stop_gained	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:36985803C>T	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.2521C>T	5.37:g.36985803C>T	ENSP00000282516:p.Arg841*		Somatic				NIPBL_uc003jkk.3_Nonsense_Mutation_p.R841*|NIPBL_uc003jkm.1_Nonsense_Mutation_p.R720*	p.R841*	NM_133433	NP_597677	WXS	Illumina HiSeq	Unspecified	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		10	3020	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		841					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Nonsense_Mutation	SNP	ENST00000282516.8	37	c.2521C>T	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	C	42	9.727336	0.99249	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.99	5.07	0.68467	.	0.238872	0.34777	N	0.003690	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9809	12.4775	0.55823	0.3176:0.6824:0.0:0.0	.	.	.	.	X	841	.	ENSP00000282516:R841X	R	+	1	2	NIPBL	37021560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.589000	0.61006	2.840000	0.97914	0.655000	0.94253	CGA		0.403	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		9	66	0	0	0	0.004482	0	9	66				
ARL15	54622	broad.mit.edu	37	5	53467697	53467697	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:53467697C>G	ENST00000504924.1	-	2	203	c.110G>C	c.(109-111)tGc>tCc	p.C37S	ARL15_ENST00000510591.2_5'UTR|ARL15_ENST00000507646.2_Missense_Mutation_p.C37S|ARL15_ENST00000502271.1_Intron	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	37					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)	p.C37S(1)|p.C25S(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				GAGGCCTATGCAAACCAGGTC	0.498																																							uc003jpg.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(109-111)TGC>TCC		ADP-ribosylation factor-like 15							81.0	81.0	81.0					5																	53467697		1945	4133	6078	SO:0001583	missense	54622						GTP binding	g.chr5:53467697C>G	BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.110G>C	5.37:g.53467697C>G	ENSP00000433427:p.Cys37Ser		Somatic				ARL15_uc010ivs.1_Intron	p.C37S	NM_019087	NP_061960	WXS	Illumina HiSeq	Unspecified	Q9NXU5	ARL15_HUMAN			2	204	-		Lung NSC(810;0.000779)	37					Q6IAD0	Missense_Mutation	SNP	ENST00000504924.1	37	c.110G>C	CCDS54850.1	.	.	.	.	.	.	.	.	.	.	C	32	5.108955	0.94292	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;D	0.82167	-0.43;-1.58	5.93	5.93	0.95920	.	0.081590	0.85682	D	0.000000	D	0.89942	0.6861	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.89721	0.3919	10	0.72032	D	0.01	-6.8016	20.3437	0.98782	0.0:1.0:0.0:0.0	.	37	Q9NXU5	ARL15_HUMAN	S	37	ENSP00000433427:C37S;ENSP00000432680:C37S	ENSP00000433427:C37S	C	-	2	0	ARL15	53503454	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.790000	0.85794	2.815000	0.96918	0.561000	0.74099	TGC		0.498	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368432.2	NM_019087		7	38	0	0	0	0.00308	0	7	38				
RNF180	285671	broad.mit.edu	37	5	63509899	63509899	+	Missense_Mutation	SNP	A	A	T	rs142108516		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:63509899A>T	ENST00000389100.4	+	4	818	c.746A>T	c.(745-747)cAt>cTt	p.H249L	RNF180_ENST00000381081.2_Intron|RNF180_ENST00000296615.6_Missense_Mutation_p.H249L	NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	249					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H249L(2)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TATGAAATACATAGTAAGACT	0.358																																							uc003jti.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(745-747)CAT>CTT		ring finger protein 180 isoform 1							77.0	86.0	83.0					5																	63509899		2203	4300	6503	SO:0001583	missense	285671					integral to membrane|nuclear envelope	zinc ion binding	g.chr5:63509899A>T	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.746A>T	5.37:g.63509899A>T	ENSP00000373752:p.His249Leu		Somatic				RNF180_uc003jth.3_Missense_Mutation_p.H249L|RNF180_uc010iws.2_Intron	p.H249L	NM_001113561	NP_001107033	WXS	Illumina HiSeq	Unspecified	Q86T96	RN180_HUMAN		Lung(70;0.114)	4	856	+		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)	249			Cytoplasmic (Potential).		Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	ENST00000389100.4	37	c.746A>T	CCDS47219.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.953443	0.34471	.	.	ENSG00000164197	ENST00000296615;ENST00000389100	T	0.43294	0.95	6.08	1.14	0.20703	.	0.481100	0.23579	N	0.046665	T	0.33469	0.0864	M	0.63428	1.95	0.28400	N	0.918661	B;P	0.41848	0.309;0.763	B;B	0.36608	0.081;0.229	T	0.24657	-1.0154	10	0.54805	T	0.06	-7.1874	6.4501	0.21898	0.5446:0.1255:0.3299:0.0	.	249;249	Q86T96;Q86T96-2	RN180_HUMAN;.	L	249	ENSP00000373752:H249L	ENSP00000296615:H249L	H	+	2	0	RNF180	63545655	0.555000	0.26530	0.996000	0.52242	0.965000	0.64279	0.167000	0.16602	0.184000	0.20083	-0.264000	0.10439	CAT		0.358	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532		15	128	0	0	0	0.004007	0	15	128				
TRAPPC13	80006	broad.mit.edu	37	5	64956651	64956651	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:64956651G>C	ENST00000399438.3	+	10	1169	c.824G>C	c.(823-825)gGa>gCa	p.G275A	TRAPPC13_ENST00000438419.2_Missense_Mutation_p.G275A|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.G269A|TRAPPC13_ENST00000231526.4_Missense_Mutation_p.G269A|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.G276A	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	275								p.G275A(2)									ACAGTAATTGGAAAATTGGAT	0.398																																							uc003jtz.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(823-825)GGA>GCA		hypothetical protein LOC80006 isoform 2							85.0	80.0	82.0					5																	64956651		1848	4096	5944	SO:0001583	missense	80006							g.chr5:64956651G>C		CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.824G>C	5.37:g.64956651G>C	ENSP00000382367:p.Gly275Ala		Somatic				C5orf44_uc003jua.3_Missense_Mutation_p.G275A|C5orf44_uc003juc.3_Missense_Mutation_p.G269A|C5orf44_uc010iwv.2_Missense_Mutation_p.G269A	p.G275A	NM_024941	NP_079217	WXS	Illumina HiSeq	Unspecified	A5PLN9	CE044_HUMAN			10	1154	+			275					Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	ENST00000399438.3	37	c.824G>C	CCDS47222.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779060	0.90195	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.85982	0.5824	M	0.91354	3.2	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	D;D;D;D	0.80764	0.99;0.99;0.99;0.994	D	0.89163	0.3531	9	0.87932	D	0	-21.5061	18.9172	0.92510	0.0:0.0:1.0:0.0	.	269;269;275;275	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	A	275;275;269;269;276	.	ENSP00000231526:G269A	G	+	2	0	C5orf44	64992407	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.420000	0.97426	2.534000	0.85438	0.563000	0.77884	GGA		0.398	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1	NM_024941		8	28	0	0	0	0.00308	0	8	28				
ARHGEF28	64283	broad.mit.edu	37	5	73048996	73048996	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:73048996G>A	ENST00000426542.2	+	3	464	c.444G>A	c.(442-444)gaG>gaA	p.E148E	ARHGEF28_ENST00000437974.1_Silent_p.E148E|ARHGEF28_ENST00000296794.6_Silent_p.E148E|ARHGEF28_ENST00000287898.5_Silent_p.E148E|ARHGEF28_ENST00000545377.1_Silent_p.E148E|ARHGEF28_ENST00000513042.2_Silent_p.E148E			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	148					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.E148E(2)									TGCCTCTAGAGTGGACTGTGT	0.512																																							uc011csq.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(442-444)GAG>GAA		Rho-guanine nucleotide exchange factor							41.0	42.0	42.0					5																	73048996		2049	4200	6249	SO:0001819	synonymous_variant	64283				cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding	g.chr5:73048996G>A		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.444G>A	5.37:g.73048996G>A			Somatic				RGNEF_uc003kcx.2_Silent_p.E148E|RGNEF_uc003kcy.1_Silent_p.E148E|RGNEF_uc010izf.2_Silent_p.E148E	p.E148E	NM_001080479	NP_001073948	WXS	Illumina HiSeq	Unspecified	Q8N1W1	RGNEF_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)	3	455	+		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)	148					B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	c.444G>A	CCDS54870.1																																																																																				0.512	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1			5	25	0	0	0	0.001168	0	5	25				
PCDHB11	56125	broad.mit.edu	37	5	140580730	140580730	+	Silent	SNP	C	C	T	rs114264306	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:140580730C>T	ENST00000354757.3	+	1	1383	c.1383C>T	c.(1381-1383)cgC>cgT	p.R461R	PCDHB11_ENST00000536699.1_Silent_p.R96R	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	461	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R461R(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTCCGCGAGAACAACA	0.592																																							uc003liy.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1381-1383)CGC>CGT		protocadherin beta 11 precursor							129.0	120.0	123.0					5																	140580730		2203	4296	6499	SO:0001819	synonymous_variant	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140580730C>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1383C>T	5.37:g.140580730C>T			Somatic				PCDHB11_uc011daj.1_Silent_p.R96R	p.R461R	NM_018931	NP_061754	WXS	Illumina HiSeq	Unspecified	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1383	+			461			Extracellular (Potential).|Cadherin 5.		B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	c.1383C>T	CCDS4253.1																																																																																				0.592	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		19	192	0	0	0	0.00278	0	19	192				
PCDHGC4	56098	broad.mit.edu	37	5	140865098	140865098	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:140865098G>C	ENST00000306593.1	+	1	358	c.358G>C	c.(358-360)Gag>Cag	p.E120Q	PCDHGB2_ENST00000522605.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	120	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E120Q(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACCGAGCAGAGGTAGAGAT	0.577																																							uc003lky.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(358-360)GAG>CAG		protocadherin gamma subfamily C, 4 isoform 1							86.0	85.0	85.0					5																	140865098		2203	4300	6503	SO:0001583	missense	56098				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140865098G>C	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.358G>C	5.37:g.140865098G>C	ENSP00000306918:p.Glu120Gln		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Missense_Mutation_p.E120Q	p.E120Q	NM_018928	NP_061751	WXS	Illumina HiSeq	Unspecified	Q9Y5F7	PCDGL_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	358	+			120			Cadherin 1.|Extracellular (Potential).		Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	37	c.358G>C	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713967	0.89112	.	.	ENSG00000242419	ENST00000306593	T	0.52983	0.64	5.0	5.0	0.66597	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.72252	0.3437	M	0.85542	2.76	0.36249	D	0.853773	D;D	0.76494	0.999;0.999	D;D	0.68621	0.953;0.959	T	0.81204	-0.1039	9	0.72032	D	0.01	.	18.4946	0.90860	0.0:0.0:1.0:0.0	.	120;120	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	Q	120	ENSP00000306918:E120Q	ENSP00000306918:E120Q	E	+	1	0	PCDHGC4	140845282	1.000000	0.71417	0.974000	0.42286	0.994000	0.84299	6.505000	0.73708	2.596000	0.87737	0.561000	0.74099	GAG		0.577	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928		11	134	0	0	0	0.008291	0	11	134				
ZNF354C	30832	broad.mit.edu	37	5	178506452	178506452	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:178506452G>A	ENST00000315475.6	+	5	1325	c.1019G>A	c.(1018-1020)aGa>aAa	p.R340K		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R340K(1)		endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TTCAACTGTAGAGCAAAACTT	0.428																																							uc003mju.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1018-1020)AGA>AAA		zinc finger protein 354C							163.0	175.0	171.0					5																	178506452		2203	4300	6503	SO:0001583	missense	30832				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:178506452G>A		CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1019G>A	5.37:g.178506452G>A	ENSP00000324064:p.Arg340Lys		Somatic					p.R340K	NM_014594	NP_055409	WXS	Illumina HiSeq	Unspecified	Q86Y25	Z354C_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)	5	1134	+	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	340			C2H2-type 5.		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	ENST00000315475.6	37	c.1019G>A	CCDS4443.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.368826	0.24771	.	.	ENSG00000177932	ENST00000315475	T	0.03951	3.75	4.04	4.04	0.47022	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01661	0.0053	N	0.00608	-1.33	0.09310	N	0.999998	B	0.16166	0.016	B	0.12156	0.007	T	0.43750	-0.9372	9	0.27082	T	0.32	-22.4146	7.8103	0.29228	0.1123:0.0:0.8877:0.0	.	340	Q86Y25	Z354C_HUMAN	K	340	ENSP00000324064:R340K	ENSP00000324064:R340K	R	+	2	0	ZNF354C	178439058	0.000000	0.05858	0.993000	0.49108	0.969000	0.65631	0.590000	0.23954	2.226000	0.72624	0.591000	0.81541	AGA		0.428	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2			16	290	0	0	0	0.006122	0	16	290				
ADAMTS2	9509	broad.mit.edu	37	5	178581848	178581848	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:178581848G>A	ENST00000251582.7	-	7	1306	c.1205C>T	c.(1204-1206)tCa>tTa	p.S402L	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.S402L	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	402	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S402L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CACAAACGCTGAGGAGAAGCC	0.652																																							uc003mjw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1204-1206)TCA>TTA		ADAM metallopeptidase with thrombospondin type 1							55.0	44.0	48.0					5																	178581848		2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178581848G>A	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1205C>T	5.37:g.178581848G>A	ENSP00000251582:p.Ser402Leu		Somatic				ADAMTS2_uc011dgm.1_Missense_Mutation_p.S402L	p.S402L	NM_014244	NP_055059	WXS	Illumina HiSeq	Unspecified	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	7	1205	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	402			Peptidase M12B.			Missense_Mutation	SNP	ENST00000251582.7	37	c.1205C>T	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332836	0.81801	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.60548	0.18;0.18	4.5	4.5	0.54988	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.48286	D	0.000193	T	0.67590	0.2909	L	0.41356	1.27	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.99;0.999	T	0.65278	-0.6207	10	0.31617	T	0.26	.	16.5518	0.84474	0.0:0.0:1.0:0.0	.	402;402	O95450-2;O95450	.;ATS2_HUMAN	L	402	ENSP00000251582:S402L;ENSP00000274609:S402L	ENSP00000251582:S402L	S	-	2	0	ADAMTS2	178514454	1.000000	0.71417	0.926000	0.36857	0.596000	0.36781	9.671000	0.98627	2.208000	0.71279	0.655000	0.94253	TCA		0.652	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		4	15	0	0	0	0.000602	0	4	15				
DAAM2	23500	broad.mit.edu	37	6	39835326	39835326	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:39835326C>G	ENST00000398904.2	+	6	651	c.469C>G	c.(469-471)Ctg>Gtg	p.L157V	DAAM2_ENST00000274867.4_Missense_Mutation_p.L157V|DAAM2_ENST00000538976.1_Missense_Mutation_p.L157V			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	157	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.L157V(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTTGACCTGTCTGCTAAATTT	0.478																																							uc003oow.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(469-471)CTG>GTG		dishevelled associated activator of							115.0	118.0	117.0					6																	39835326		2103	4229	6332	SO:0001583	missense	23500				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr6:39835326C>G	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.469C>G	6.37:g.39835326C>G	ENSP00000381876:p.Leu157Val		Somatic				DAAM2_uc010jxc.2_Missense_Mutation_p.L157V|DAAM2_uc003oox.2_Missense_Mutation_p.L157V	p.L157V	NM_015345	NP_056160	WXS	Illumina HiSeq	Unspecified	Q86T65	DAAM2_HUMAN			6	625	+	Ovarian(28;0.0355)|Colorectal(47;0.196)		157			GBD/FH3.		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	c.469C>G	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775779	0.70107	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	D;D;D	0.94966	-3.57;-3.57;-3.57	5.43	5.43	0.79202	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.64402	D	0.000001	D	0.92570	0.7640	M	0.87827	2.91	0.80722	D	1	P;P	0.42203	0.732;0.773	B;B	0.42138	0.26;0.377	D	0.93363	0.6728	10	0.87932	D	0	.	5.8801	0.18850	0.1814:0.6982:0.0:0.1204	.	157;157	G5EA45;Q86T65	.;DAAM2_HUMAN	V	157	ENSP00000274867:L157V;ENSP00000381876:L157V;ENSP00000437808:L157V	ENSP00000274867:L157V	L	+	1	2	DAAM2	39943304	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.130000	0.31393	2.540000	0.85666	0.561000	0.74099	CTG		0.478	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1			9	131	0	0	0	0.004482	0	9	131				
PTCHD4	442213	broad.mit.edu	37	6	47976380	47976380	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:47976380G>T	ENST00000339488.4	-	2	930	c.897C>A	c.(895-897)ttC>ttA	p.F299L	PTCHD4_ENST00000543600.1_Missense_Mutation_p.F282L	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	299	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.					integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.F299L(1)									CCATGGCGAAGAACGGGATTC	0.473																																							uc011dwm.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(844-846)TTC>TTA		hypothetical protein LOC442213							47.0	45.0	46.0					6																	47976380		1947	4141	6088	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47976380G>T		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.897C>A	6.37:g.47976380G>T	ENSP00000341914:p.Phe299Leu		Somatic				C6orf138_uc011dwn.1_Missense_Mutation_p.F46L|C6orf138_uc003ozf.2_Missense_Mutation_p.F299L	p.F282L	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			2	931	-			299			Helical; (Potential).|SSD.		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.846C>A	CCDS34473.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.334902|4.334902	0.81801|0.81801	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;D|.	0.94828|.	-3.53;-3.53|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Sterol-sensing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79149|0.79149	0.4397|0.4397	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.979|.	D;D|.	0.77557|.	0.99;0.982|.	T|T	0.77770|0.77770	-0.2463|-0.2463	10|5	0.72032|.	D|.	0.01|.	.|.	19.769|19.769	0.96353|0.96353	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	299;282|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	L|I	299;282|299	ENSP00000341914:F299L;ENSP00000439864:F282L|.	ENSP00000341914:F299L|.	F|L	-|-	3|1	2|0	C6orf138|C6orf138	48084339|48084339	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.390000|6.390000	0.73204|0.73204	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	TTC|CTT		0.473	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		7	28	1	0	3.09899e-07	0.004482	3.67909e-07	7	28				
DST	667	broad.mit.edu	37	6	56371470	56371470	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:56371470C>G	ENST00000361203.3	-	71	18404	c.18397G>C	c.(18397-18399)Gat>Cat	p.D6133H	DST_ENST00000244364.6_Missense_Mutation_p.D3830H|DST_ENST00000340834.4_5'UTR|DST_ENST00000421834.2_Missense_Mutation_p.D4156H|DST_ENST00000370769.4_Missense_Mutation_p.D6244H|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.D4047H|DST_ENST00000370754.5_Missense_Mutation_p.D6422H|DST_ENST00000446842.2_Missense_Mutation_p.D5918H			Q03001	DYST_HUMAN	dystonin	6133					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.D3830H(1)|p.D6244H(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGTACCTCATCTATACTCTTC	0.358																																							uc003pdf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(13000-13002)GAT>CAT		dystonin isoform 2							115.0	111.0	112.0					6																	56371470		1866	4106	5972	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56371470C>G	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18397G>C	6.37:g.56371470C>G	ENSP00000354508:p.Asp6133His		Somatic				DST_uc003pcz.3_Missense_Mutation_p.D4156H|DST_uc011dxj.1_Missense_Mutation_p.D4185H|DST_uc011dxk.1_Missense_Mutation_p.D4196H|DST_uc003pcy.3_Missense_Mutation_p.D3830H	p.D4334H	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		70	13028	-	Lung NSC(77;0.103)		6242			Spectrin 13.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.13000G>C		.	.	.	.	.	.	.	.	.	.	C	19.04	3.750857	0.69533	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	T;T;T;T;T;T;T	0.52526	0.66;0.66;1.19;0.66;0.66;0.66;1.19	5.41	5.41	0.78517	.	0.000000	0.49305	D	0.000145	T	0.64594	0.2612	M	0.71581	2.175	0.34944	D	0.750626	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.96	T	0.67341	-0.5695	9	0.66056	D	0.02	.	19.195	0.93684	0.0:1.0:0.0:0.0	.	4156;6244;6422;6242;3830	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	H	3830;6422;6244;4156;5918;4047;6133;246	ENSP00000244364:D3830H;ENSP00000359790:D6422H;ENSP00000359805:D6244H;ENSP00000400883:D4156H;ENSP00000393645:D5918H;ENSP00000359824:D4047H;ENSP00000354508:D6133H	ENSP00000244364:D3830H	D	-	1	0	DST	56479429	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.792000	0.85828	2.531000	0.85337	0.585000	0.79938	GAT		0.358	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		8	50	0	0	0	0.004482	0	8	50				
ELOVL4	6785	broad.mit.edu	37	6	80629227	80629227	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:80629227C>T	ENST00000369816.4	-	5	879	c.579G>A	c.(577-579)gtG>gtA	p.V193V		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	193					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.V193V(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	AGTACATAATCACATGGATAA	0.363																																							uc003pja.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(577-579)GTG>GTA		elongation of very long chain fatty acids-like	Alpha-Linolenic Acid(DB00132)						86.0	81.0	83.0					6																	80629227		2203	4300	6503	SO:0001819	synonymous_variant	6785				fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups	g.chr6:80629227C>T	AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.579G>A	6.37:g.80629227C>T			Somatic				ELOVL4_uc011dyt.1_Intron	p.V193V	NM_022726	NP_073563	WXS	Illumina HiSeq	Unspecified	Q9GZR5	ELOV4_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0168)	5	898	-		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)	193			Helical; (Potential).		B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Silent	SNP	ENST00000369816.4	37	c.579G>A	CCDS4992.1																																																																																				0.363	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1			15	61	0	0	0	0.004007	0	15	61				
CNR1	1268	broad.mit.edu	37	6	88854698	88854698	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:88854698C>G	ENST00000537554.1	-	2	3858	c.296G>C	c.(295-297)gGg>gCg	p.G99A	CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000428600.2_Missense_Mutation_p.G99A|CNR1_ENST00000549890.1_Missense_Mutation_p.G99A|CNR1_ENST00000468898.1_Missense_Mutation_p.G66A|CNR1_ENST00000535130.1_Missense_Mutation_p.G99A|CNR1_ENST00000369499.2_Missense_Mutation_p.G99A|CNR1_ENST00000369501.2_Missense_Mutation_p.G99A|CNR1_ENST00000549716.1_Missense_Mutation_p.G38A	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	99					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)	p.G99A(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	GAAGTTCTCCCCACACTGGAT	0.532																																							uc011dzq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(295-297)GGG>GCG		cannabinoid receptor 1 isoform a	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)						77.0	75.0	76.0					6																	88854698		2203	4300	6503	SO:0001583	missense	1268				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding	g.chr6:88854698C>G	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.296G>C	6.37:g.88854698C>G	ENSP00000441046:p.Gly99Ala		Somatic				CNR1_uc010kbz.2_Missense_Mutation_p.G99A|CNR1_uc011dzr.1_Missense_Mutation_p.G99A|CNR1_uc011dzs.1_Missense_Mutation_p.G99A|CNR1_uc003pmq.3_Missense_Mutation_p.G99A|CNR1_uc011dzt.1_Missense_Mutation_p.G99A|CNR1_uc010kca.2_Missense_Mutation_p.G66A	p.G99A	NM_001160260	NP_001153732	WXS	Illumina HiSeq	Unspecified	P21554	CNR1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.15)	2	3859	-		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)	99			Extracellular (Potential).		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	ENST00000537554.1	37	c.296G>C	CCDS5015.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930511	0.52866	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.74842	-0.85;-0.85;-0.85;-0.85;-0.85;-0.88;-0.85;-0.8	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	L	0.50333	1.59	0.80722	D	1	B;P	0.35328	0.336;0.495	B;B	0.33121	0.158;0.105	T	0.69665	-0.5084	10	0.72032	D	0.01	.	20.0015	0.97412	0.0:1.0:0.0:0.0	.	66;99	P21554-3;P21554	.;CNR1_HUMAN	A	99;99;99;99;99;66;99;38	ENSP00000358513:G99A;ENSP00000442689:G99A;ENSP00000441046:G99A;ENSP00000358511:G99A;ENSP00000446819:G99A;ENSP00000420188:G66A;ENSP00000412192:G99A;ENSP00000449549:G38A	ENSP00000358511:G99A	G	-	2	0	CNR1	88911417	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.732000	0.93576	0.563000	0.77884	GGG		0.532	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2			7	75	0	0	0	0.00308	0	7	75				
ASCC3	10973	broad.mit.edu	37	6	100957385	100957385	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:100957385C>G	ENST00000369162.2	-	42	6830	c.6486G>C	c.(6484-6486)atG>atC	p.M2162I		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	2162	SEC63 2.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.M2162I(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AGCAGTCACTCATGAAATATA	0.358																																							uc003pqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(1)	6						c.(6484-6486)ATG>ATC		activating signal cointegrator 1 complex subunit							129.0	123.0	125.0					6																	100957385		2203	4300	6503	SO:0001583	missense	10973				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr6:100957385C>G	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.6486G>C	6.37:g.100957385C>G	ENSP00000358159:p.Met2162Ile		Somatic					p.M2162I	NM_006828	NP_006819	WXS	Illumina HiSeq	Unspecified	Q8N3C0	HELC1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)	42	6815	-		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)	2162			SEC63 3.		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	c.6486G>C	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905449	0.52333	.	.	ENSG00000112249	ENST00000369162	T	0.58506	0.33	6.02	6.02	0.97574	Sec63 domain (3);	0.000000	0.85682	D	0.000000	T	0.40171	0.1106	L	0.46819	1.47	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	T	0.31280	-0.9949	10	0.18276	T	0.48	.	20.547	0.99278	0.0:1.0:0.0:0.0	.	2162	Q8N3C0	HELC1_HUMAN	I	2162	ENSP00000358159:M2162I	ENSP00000358159:M2162I	M	-	3	0	ASCC3	101064106	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.511000	0.60462	2.850000	0.98022	0.650000	0.86243	ATG		0.358	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828		10	111	0	0	0	0.010729	0	10	111				
TBC1D32	221322	broad.mit.edu	37	6	121624836	121624836	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:121624836G>A	ENST00000398212.2	-	9	1056	c.1007C>T	c.(1006-1008)tCa>tTa	p.S336L	TBC1D32_ENST00000275159.6_Missense_Mutation_p.S336L	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	336					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.S336L(1)									AATCTTTTGTGAGACAACATG	0.318																																							uc003pyo.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1006-1008)TCA>TTA		hypothetical protein LOC221322							105.0	96.0	99.0					6																	121624836		1813	4075	5888	SO:0001583	missense	221322				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity	g.chr6:121624836G>A	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1007C>T	6.37:g.121624836G>A	ENSP00000381270:p.Ser336Leu		Somatic				C6orf170_uc003pyq.1_RNA	p.S336L	NM_152730	NP_689943	WXS	Illumina HiSeq	Unspecified	Q96NH3	BROMI_HUMAN		GBM - Glioblastoma multiforme(226;0.00521)	9	1075	-			336					Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	37	c.1007C>T	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577623	0.45902	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.25085	1.82;1.82	5.19	4.33	0.51752	.	0.338931	0.28161	N	0.016372	T	0.12475	0.0303	L	0.43152	1.355	0.38256	D	0.941751	B	0.16802	0.019	B	0.13407	0.009	T	0.03922	-1.0992	10	0.59425	D	0.04	-11.3451	14.0794	0.64912	0.0733:0.0:0.9267:0.0	.	336	Q96NH3	BROMI_HUMAN	L	336	ENSP00000275159:S336L;ENSP00000381270:S336L	ENSP00000275159:S336L	S	-	2	0	C6orf170	121666535	1.000000	0.71417	0.336000	0.25522	0.733000	0.41908	7.320000	0.79064	1.314000	0.45095	0.585000	0.79938	TCA		0.318	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		8	38	0	0	0	0.006214	0	8	38				
HIVEP2	3097	broad.mit.edu	37	6	143095798	143095798	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:143095798C>G	ENST00000367604.1	-	4	717	c.78G>C	c.(76-78)tgG>tgC	p.W26C	HIVEP2_ENST00000367603.2_Missense_Mutation_p.W26C|HIVEP2_ENST00000012134.2_Missense_Mutation_p.W26C			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W26C(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GTTCCTGTCTCCATCTACCTG	0.448																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	Esophageal Squamous(107;843 1510 13293 16805 42198)	uc003qjd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(76-78)TGG>TGC		human immunodeficiency virus type I enhancer							206.0	201.0	203.0					6																	143095798		2014	4192	6206	SO:0001583	missense	3097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:143095798C>G	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.78G>C	6.37:g.143095798C>G	ENSP00000356576:p.Trp26Cys		Somatic					p.W26C	NM_006734	NP_006725	WXS	Illumina HiSeq	Unspecified	P31629	ZEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)	5	821	-			26					Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	c.78G>C	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371333	0.61624	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.03358	3.96;3.96;3.96	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00984	-1.1491	10	0.87932	D	0	-18.6139	19.8917	0.96932	0.0:1.0:0.0:0.0	.	26	P31629	ZEP2_HUMAN	C	26	ENSP00000356576:W26C;ENSP00000356575:W26C;ENSP00000012134:W26C	ENSP00000012134:W26C	W	-	3	0	HIVEP2	143137491	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.828000	0.75308	2.776000	0.95493	0.650000	0.86243	TGG		0.448	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			26	300	0	0	0	0.003954	0	26	300				
MAP3K4	4216	broad.mit.edu	37	6	161470184	161470184	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:161470184A>T	ENST00000392142.4	+	3	1028	c.880A>T	c.(880-882)Att>Ttt	p.I294F	MAP3K4_ENST00000366919.2_Missense_Mutation_p.I294F|MAP3K4_ENST00000366920.2_Missense_Mutation_p.I294F|MAP3K4_ENST00000348824.7_Missense_Mutation_p.I294F	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	294			I -> T (in dbSNP:rs35842248). {ECO:0000269|PubMed:17344846}.		activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.I294F(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CATCCCAGATATTATTAATGA	0.428																																							uc003qtn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(880-882)ATT>TTT		mitogen-activated protein kinase kinase kinase 4							63.0	67.0	66.0					6																	161470184		2203	4298	6501	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161470184A>T	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.880A>T	6.37:g.161470184A>T	ENSP00000375986:p.Ile294Phe		Somatic				MAP3K4_uc010kkc.1_Missense_Mutation_p.I294F|MAP3K4_uc003qto.2_Missense_Mutation_p.I294F|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	p.I294F	NM_005922	NP_005913	WXS	Illumina HiSeq	Unspecified	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	3	1022	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	294					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.880A>T	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.799694	0.90538	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.52645	0.1747	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.56372	-0.7990	10	0.72032	D	0.01	-31.9509	16.8061	0.85666	1.0:0.0:0.0:0.0	.	294;294	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	F	294	ENSP00000355886:I294F;ENSP00000375986:I294F;ENSP00000355887:I294F;ENSP00000297332:I294F	ENSP00000297332:I294F	I	+	1	0	MAP3K4	161390174	1.000000	0.71417	0.974000	0.42286	0.997000	0.91878	8.930000	0.92872	2.367000	0.80283	0.528000	0.53228	ATT		0.428	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			15	97	0	0	0	0.003163	0	15	97				
HOXA6	3203	broad.mit.edu	37	7	27187160	27187160	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:27187160G>T	ENST00000222728.3	-	1	233	c.209C>A	c.(208-210)gCg>gAg	p.A70E	HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA6_ENST00000521478.1_5'UTR|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	70					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A70E(1)		central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						CTCGTAGGACGCCCGGTTGCA	0.637																																							uc003syo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(208-210)GCG>GAG		homeobox A6							45.0	46.0	46.0					7																	27187160		2203	4300	6503	SO:0001583	missense	3203					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27187160G>T		CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.209C>A	7.37:g.27187160G>T	ENSP00000222728:p.Ala70Glu		Somatic				uc003syp.1_Intron|HOXA6_uc003syq.1_Intron	p.A70E	NM_024014	NP_076919	WXS	Illumina HiSeq	Unspecified	P31267	HXA6_HUMAN			1	209	-			70					A4D192|Q2M3G3|Q9UPM0	Missense_Mutation	SNP	ENST00000222728.3	37	c.209C>A	CCDS5407.1	.	.	.	.	.	.	.	.	.	.	g	18.44	3.624700	0.66901	.	.	ENSG00000106006	ENST00000222728	D	0.91011	-2.77	4.89	4.01	0.46588	.	0.407215	0.20641	N	0.088416	D	0.87838	0.6278	M	0.65975	2.015	0.33550	D	0.596036	B	0.25609	0.13	B	0.23419	0.046	D	0.88000	0.2755	10	0.72032	D	0.01	.	7.4913	0.27462	0.0845:0.0:0.7516:0.164	.	70	P31267	HXA6_HUMAN	E	70	ENSP00000222728:A70E	ENSP00000222728:A70E	A	-	2	0	HOXA6	27153685	0.945000	0.32115	0.995000	0.50966	0.995000	0.86356	3.105000	0.50314	1.039000	0.40074	0.651000	0.88453	GCG		0.637	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358697.1			26	78	1	0	4.87955e-14	0.005443	6.12486e-14	26	78				
INHBA	3624	broad.mit.edu	37	7	41729294	41729294	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:41729294T>C	ENST00000242208.4	-	3	1481	c.1235A>G	c.(1234-1236)aAa>aGa	p.K412R	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.K412R|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	412					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.K412R(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						AATGTCCTTTTTGATGATGTT	0.522										TSP Lung(11;0.080)																													uc003thq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(1)	6						c.(1234-1236)AAA>AGA		inhibin beta A precursor							111.0	96.0	101.0					7																	41729294		2203	4300	6503	SO:0001583	missense	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41729294T>C		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1235A>G	7.37:g.41729294T>C	ENSP00000242208:p.Lys412Arg	TSP Lung(11;0.080)	Somatic				INHBA_uc003thr.2_Missense_Mutation_p.K412R	p.K412R	NM_002192	NP_002183	WXS	Illumina HiSeq	Unspecified	P08476	INHBA_HUMAN			2	1470	-			412					Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	c.1235A>G	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	18.94	3.729379	0.69074	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.63255	-0.03;-0.03	5.71	5.71	0.89125	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.77405	0.4125	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.75187	-0.3406	10	0.07644	T	0.81	-17.0247	15.9792	0.80094	0.0:0.0:0.0:1.0	.	412	P08476	INHBA_HUMAN	R	412	ENSP00000242208:K412R;ENSP00000397197:K412R	ENSP00000242208:K412R	K	-	2	0	INHBA	41695819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.033000	0.88852	2.186000	0.69663	0.482000	0.46254	AAA		0.522	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			39	91	0	0	0	0.011902	0	39	91				
SEMA3A	10371	broad.mit.edu	37	7	83640502	83640502	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:83640502G>A	ENST00000265362.4	-	8	1236	c.922C>T	c.(922-924)Ctg>Ttg	p.L308L	SEMA3A_ENST00000436949.1_Silent_p.L308L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	308	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.L308L(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TTCTTACGCAGTTCATCAAAA	0.383																																							uc003uhz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|kidney(1)	4						c.(922-924)CTG>TTG		semaphorin 3A precursor							123.0	113.0	116.0					7																	83640502		2203	4300	6503	SO:0001819	synonymous_variant	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83640502G>A	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.922C>T	7.37:g.83640502G>A			Somatic					p.L308L	NM_006080	NP_006071	WXS	Illumina HiSeq	Unspecified	Q14563	SEM3A_HUMAN			8	1237	-			308			Sema.			Silent	SNP	ENST00000265362.4	37	c.922C>T	CCDS5599.1																																																																																				0.383	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		5	67	0	0	0	0.000602	0	5	67				
AKAP9	10142	broad.mit.edu	37	7	91660865	91660865	+	Missense_Mutation	SNP	G	G	A	rs371307390		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:91660865G>A	ENST00000359028.2	+	17	4546	c.4321G>A	c.(4321-4323)Gtt>Att	p.V1441I	AKAP9_ENST00000356239.3_Missense_Mutation_p.V1429I|AKAP9_ENST00000358100.2_Missense_Mutation_p.V1441I			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1441					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.V1429I(1)|p.V1441I(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AACAAATATCGTTAAGTTGCT	0.284			T	BRAF	papillary thyroid								G|||	1	0.000199681	0.0	0.0014	5008	,	,		17057	0.0		0.0	False		,,,				2504	0.0						uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(4285-4287)GTT>ATT		A-kinase anchor protein 9 isoform 2		G	ILE/VAL,ILE/VAL	0,4404		0,0,2202	127.0	134.0	131.0		4285,4285	3.3	1.0	7		131	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	AKAP9	NM_005751.4,NM_147185.2	29,29	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	1429/3908,1429/3900	91660865	1,12997	2202	4297	6499	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91660865G>A	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4321G>A	7.37:g.91660865G>A	ENSP00000351922:p.Val1441Ile		Somatic				AKAP9_uc003ule.2_Missense_Mutation_p.V1441I|AKAP9_uc003ulf.2_Missense_Mutation_p.V1429I|AKAP9_uc003uli.2_Missense_Mutation_p.V1054I	p.V1429I	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		16	4510	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		1441			Potential.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.4285G>A		.	.	.	.	.	.	.	.	.	.	G	9.798	1.179762	0.21787	0.0	1.16E-4	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03580	3.89;3.89;3.88	4.32	3.32	0.38043	.	0.000000	0.34178	N	0.004198	T	0.05181	0.0138	L	0.55103	1.725	0.28673	N	0.905547	B;P;P;D	0.54047	0.452;0.785;0.772;0.964	B;B;B;B	0.42062	0.041;0.127;0.089;0.374	T	0.17501	-1.0367	10	0.51188	T	0.08	.	11.1401	0.48398	0.0953:0.0:0.9047:0.0	.	1441;1429;1429;1441	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	I	1429;1441;1441;1441;1441	ENSP00000348573:V1429I;ENSP00000351922:V1441I;ENSP00000350813:V1441I	ENSP00000348573:V1429I	V	+	1	0	AKAP9	91498801	0.001000	0.12720	0.996000	0.52242	0.570000	0.35934	-0.278000	0.08490	1.242000	0.43836	0.557000	0.71058	GTT		0.284	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		15	97	0	0	0	0.003163	0	15	97				
AKAP9	10142	broad.mit.edu	37	7	91700233	91700233	+	Silent	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:91700233A>G	ENST00000359028.2	+	29	6783	c.6558A>G	c.(6556-6558)aaA>aaG	p.K2186K	AKAP9_ENST00000356239.3_Silent_p.K2174K|AKAP9_ENST00000358100.2_Silent_p.K2186K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2186	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.K2174K(1)|p.K2186K(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGGACCGAAAACACTTTGGAG	0.328			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - coding silent(2)		lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(6520-6522)AAA>AAG		A-kinase anchor protein 9 isoform 2							73.0	80.0	78.0					7																	91700233		2203	4300	6503	SO:0001819	synonymous_variant	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91700233A>G	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.6558A>G	7.37:g.91700233A>G			Somatic				AKAP9_uc003ulf.2_Silent_p.K2166K|AKAP9_uc003uli.2_Silent_p.K1797K|AKAP9_uc003ulj.2_5'UTR	p.K2174K	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		28	6747	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		2186			Potential.|Glu-rich.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37	c.6522A>G																																																																																					0.328	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		42	102	0	0	0	0.01441	0	42	102				
ANKRD7	56311	broad.mit.edu	37	7	117876197	117876197	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:117876197C>G	ENST00000265224.4	+	4	726	c.571C>G	c.(571-573)Caa>Gaa	p.Q191E	ANKRD7_ENST00000477532.1_3'UTR|ANKRD7_ENST00000357099.4_Missense_Mutation_p.Q211E|ANKRD7_ENST00000417525.1_Missense_Mutation_p.Q138E|ANKRD7_ENST00000433239.1_Missense_Mutation_p.Q138E	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	191					male gonad development (GO:0008584)	nucleus (GO:0005634)		p.Q211E(1)|p.Q211*(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						AGATAATTATCAAAGGTATAA	0.363																																							uc003vji.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|kidney(1)		0						c.(571-573)CAA>GAA		ankyrin repeat domain 7							55.0	58.0	57.0					7																	117876197		1826	4079	5905	SO:0001583	missense	56311				male gonad development			g.chr7:117876197C>G	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.571C>G	7.37:g.117876197C>G	ENSP00000265224:p.Gln191Glu		Somatic					p.Q191E	NM_019644	NP_062618	WXS	Illumina HiSeq	Unspecified	Q92527	ANKR7_HUMAN			4	744	+			191			ANK 5.		B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	37	c.571C>G	CCDS43638.1	.	.	.	.	.	.	.	.	.	.	C	8.305	0.820881	0.16678	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000417525;ENST00000433239	T;T;T;T	0.52057	1.61;1.61;0.68;0.68	5.3	4.36	0.52297	Ankyrin repeat-containing domain (3);	0.283366	0.25214	N	0.032281	T	0.40570	0.1122	L	0.55481	1.735	0.22675	N	0.998866	B	0.25441	0.126	B	0.24269	0.052	T	0.25676	-1.0125	10	0.41790	T	0.15	-14.2401	9.0635	0.36449	0.1325:0.5826:0.2849:0.0	.	191	Q92527	ANKR7_HUMAN	E	211;191;138;138	ENSP00000349612:Q211E;ENSP00000265224:Q191E;ENSP00000395595:Q138E;ENSP00000388473:Q138E	ENSP00000265224:Q191E	Q	+	1	0	ANKRD7	117663433	0.462000	0.25791	0.929000	0.37066	0.401000	0.30781	0.824000	0.27379	2.651000	0.90000	0.491000	0.48974	CAA		0.363	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708		28	81	0	0	0	0.008361	0	28	81				
LRRC4	64101	broad.mit.edu	37	7	127670635	127670635	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:127670635G>A	ENST00000249363.3	-	2	316	c.59C>T	c.(58-60)cCg>cTg	p.P20L	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	20					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P20L(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GTAGACGAACGGGAGCAGGAT	0.597																																							uc003vmk.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						c.(58-60)CCG>CTG		leucine rich repeat containing 4 precursor							71.0	70.0	70.0					7																	127670635		2203	4300	6503	SO:0001583	missense	64101					cell junction|integral to membrane|postsynaptic membrane		g.chr7:127670635G>A	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.59C>T	7.37:g.127670635G>A	ENSP00000249363:p.Pro20Leu		Somatic				SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	p.P20L	NM_022143	NP_071426	WXS	Illumina HiSeq	Unspecified	Q9HBW1	LRRC4_HUMAN		Lung(243;0.124)	2	196	-			20					A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	ENST00000249363.3	37	c.59C>T	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946225	0.34377	.	.	ENSG00000128594	ENST00000249363;ENST00000476782;ENST00000478726	T;T	0.60424	0.19;1.95	4.54	4.54	0.55810	.	0.338259	0.28279	N	0.015931	T	0.32346	0.0826	N	0.08118	0	0.41367	D	0.987466	B	0.32731	0.382	B	0.17722	0.019	T	0.24368	-1.0162	10	0.17832	T	0.49	.	14.8173	0.70045	0.0:0.0:1.0:0.0	.	20	Q9HBW1	LRRC4_HUMAN	L	20	ENSP00000249363:P20L;ENSP00000418093:P20L	ENSP00000249363:P20L	P	-	2	0	LRRC4	127457871	0.987000	0.35691	1.000000	0.80357	0.997000	0.91878	1.790000	0.38734	2.310000	0.77875	0.655000	0.94253	CCG		0.597	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143		17	140	0	0	0	0.00499	0	17	140				
CPA4	51200	broad.mit.edu	37	7	129945750	129945750	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:129945750C>A	ENST00000222482.4	+	6	609	c.581C>A	c.(580-582)aCg>aAg	p.T194K	CPA4_ENST00000445470.2_Missense_Mutation_p.T161K|CPA4_ENST00000493259.1_Missense_Mutation_p.T90K	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	194					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.T194K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					GCAATCTGGACGGCAAGGAAG	0.632																																							uc003vpr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(580-582)ACG>AAG		carboxypeptidase A4 preproprotein							75.0	66.0	69.0					7																	129945750		2203	4300	6503	SO:0001583	missense	51200				histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129945750C>A	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.581C>A	7.37:g.129945750C>A	ENSP00000222482:p.Thr194Lys		Somatic				CPA4_uc011kpd.1_Missense_Mutation_p.T161K|CPA4_uc011kpe.1_Missense_Mutation_p.T90K	p.T194K	NM_016352	NP_057436	WXS	Illumina HiSeq	Unspecified	Q9UI42	CBPA4_HUMAN			6	628	+	Melanoma(18;0.0435)		194					B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	37	c.581C>A	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771146	0.69992	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000473956;ENST00000493259	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	6.02	4.0	0.46444	Peptidase M14, carboxypeptidase A (3);	0.173542	0.52532	D	0.000071	T	0.21227	0.0511	L	0.60067	1.865	0.34886	D	0.745081	P;D	0.63880	0.884;0.993	P;P	0.59012	0.632;0.85	T	0.21415	-1.0246	10	0.72032	D	0.01	.	7.8321	0.29349	0.0:0.7146:0.0:0.2854	.	161;194	B7Z576;Q9UI42	.;CBPA4_HUMAN	K	161;194;161;90	ENSP00000412947:T161K;ENSP00000222482:T194K;ENSP00000418392:T161K;ENSP00000419660:T90K	ENSP00000222482:T194K	T	+	2	0	CPA4	129732986	0.027000	0.19231	0.976000	0.42696	0.815000	0.46073	0.220000	0.17660	1.561000	0.49584	0.655000	0.94253	ACG		0.632	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352		34	91	1	0	3.76114e-14	0.004289	4.74573e-14	34	91				
KMT2C	58508	broad.mit.edu	37	7	151884816	151884816	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:151884816A>C	ENST00000262189.6	-	32	4995	c.4777T>G	c.(4777-4779)Tct>Gct	p.S1593A	KMT2C_ENST00000355193.2_Missense_Mutation_p.S1593A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1593					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S1593A(2)									TCAGGATAAGAGGATTGTGCA	0.388																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(4777-4779)TCT>GCT		myeloid/lymphoid or mixed-lineage leukemia 3							104.0	100.0	102.0					7																	151884816		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151884816A>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4777T>G	7.37:g.151884816A>C	ENSP00000262189:p.Ser1593Ala		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.S654A	p.S1593A	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	32	4996	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	1593					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.4777T>G	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724350	0.30593	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.82803	-1.65;-1.65	5.71	4.84	0.62591	.	0.156011	0.29551	U	0.011828	T	0.69387	0.3105	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.65487	-0.6156	10	0.51188	T	0.08	.	15.0841	0.72138	0.0682:0.0:0.9318:0.0	.	1593;654	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	A	1593	ENSP00000262189:S1593A;ENSP00000347325:S1593A	ENSP00000262189:S1593A	S	-	1	0	MLL3	151515749	0.999000	0.42202	0.147000	0.22382	0.987000	0.75469	3.014000	0.49590	1.557000	0.49525	-0.138000	0.14375	TCT		0.388	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			19	159	0	0	0	0.012319	0	19	159				
KIAA1429	25962	broad.mit.edu	37	8	95508682	95508682	+	Silent	SNP	G	G	A	rs139309146		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:95508682G>A	ENST00000297591.5	-	18	4332	c.4257C>T	c.(4255-4257)ctC>ctT	p.L1419L	KIAA1429_ENST00000437199.1_Missense_Mutation_p.S1375L	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1419					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L1419L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTACTTCCATGAGACCATTAT	0.363																																							uc003ygo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(4255-4257)CTC>CTT		hypothetical protein LOC25962 isoform 1		G		0,4406		0,0,2203	177.0	152.0	160.0		4257	5.5	1.0	8	dbSNP_134	160	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KIAA1429	NM_015496.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1419/1813	95508682	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	25962				mRNA processing|RNA splicing	nucleus		g.chr8:95508682G>A	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4257C>T	8.37:g.95508682G>A			Somatic				KIAA1429_uc010maz.1_RNA	p.L1419L	NM_015496	NP_056311	WXS	Illumina HiSeq	Unspecified	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)		18	4270	-	Breast(36;3.29e-05)		1419					Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	c.4257C>T	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426892	0.43020	0.0	1.16E-4	ENSG00000164944	ENST00000437199	T	0.43294	0.95	5.52	5.52	0.82312	.	.	.	.	.	T	0.34542	0.0901	.	.	.	0.23314	N	0.997926	.	.	.	.	.	.	T	0.23154	-1.0196	5	.	.	.	-1.7761	6.4008	0.21638	0.1169:0.1831:0.7:0.0	.	.	.	.	L	1375	ENSP00000395600:S1375L	.	S	-	2	0	KIAA1429	95577858	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.703000	0.37846	2.604000	0.88044	0.650000	0.86243	TCA		0.363	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		19	120	0	0	0	0.012319	0	19	120				
RGS22	26166	broad.mit.edu	37	8	100990155	100990155	+	Missense_Mutation	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:100990155T>G	ENST00000360863.6	-	23	3703	c.3509A>C	c.(3508-3510)aAa>aCa	p.K1170T	RGS22_ENST00000523287.1_Missense_Mutation_p.K989T|RGS22_ENST00000523437.1_Missense_Mutation_p.K1158T	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1170					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.K1170T(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTTTCCAGATTTTTCGTCTTC	0.289																																							uc003yjb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3508-3510)AAA>ACA		regulator of G-protein signaling 22							97.0	91.0	93.0					8																	100990155		1799	4073	5872	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:100990155T>G	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3509A>C	8.37:g.100990155T>G	ENSP00000354109:p.Lys1170Thr		Somatic				RGS22_uc003yja.1_Missense_Mutation_p.K989T|RGS22_uc003yjc.1_Missense_Mutation_p.K1158T	p.K1170T	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		23	3704	-			1170			Potential.		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.3509A>C	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	T	6.602	0.479520	0.12581	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000517843;ENST00000523437	T;T;T	0.32988	1.43;1.43;1.43	5.57	4.41	0.53225	.	0.660669	0.13655	N	0.372034	T	0.26882	0.0658	L	0.60455	1.87	0.09310	N	0.999997	P;P;P	0.38504	0.501;0.501;0.634	B;B;B	0.34242	0.086;0.086;0.178	T	0.20140	-1.0284	10	0.42905	T	0.14	.	6.2648	0.20919	0.0:0.2976:0.0:0.7024	.	1158;1170;989	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	T	1170;1157;989;42;1158	ENSP00000354109:K1170T;ENSP00000429382:K989T;ENSP00000428212:K1158T	ENSP00000354109:K1170T	K	-	2	0	RGS22	101059331	0.924000	0.31332	0.393000	0.26258	0.059000	0.15707	1.344000	0.33941	0.946000	0.37632	-0.263000	0.10527	AAA		0.289	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		6	80	0	0	0	0.004482	0	6	80				
PTPRD	5789	broad.mit.edu	37	9	8518128	8518128	+	Silent	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:8518128C>G	ENST00000381196.4	-	18	1806	c.1263G>C	c.(1261-1263)ccG>ccC	p.P421P	PTPRD_ENST00000356435.5_Silent_p.P421P|PTPRD_ENST00000397617.3_Silent_p.P411P|PTPRD_ENST00000540109.1_Silent_p.P421P|PTPRD_ENST00000397611.3_Silent_p.P418P|PTPRD_ENST00000355233.5_Silent_p.P421P|PTPRD_ENST00000397606.3_Silent_p.P411P|PTPRD_ENST00000358503.5_Silent_p.P408P|PTPRD_ENST00000360074.4_Silent_p.P408P|PTPRD_ENST00000537002.1_Silent_p.P418P|PTPRD_ENST00000486161.1_Silent_p.P421P	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	421	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P421P(4)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GGACATCCCTCGGGGCACTGG	0.493										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - coding silent(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(1261-1263)CCG>CCC		protein tyrosine phosphatase, receptor type, D							172.0	163.0	166.0					9																	8518128		2203	4300	6503	SO:0001819	synonymous_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8518128C>G	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1263G>C	9.37:g.8518128C>G		TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Silent_p.P421P|PTPRD_uc003zkq.2_Silent_p.P421P|PTPRD_uc003zkr.2_Silent_p.P415P|PTPRD_uc003zks.2_Silent_p.P411P|PTPRD_uc003zkl.2_Silent_p.P421P|PTPRD_uc003zkm.2_Silent_p.P408P|PTPRD_uc003zkn.2_Silent_p.P421P|PTPRD_uc003zko.2_Silent_p.P418P	p.P421P	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	20	1974	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	421			Fibronectin type-III 2.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	c.1263G>C	CCDS43786.1																																																																																				0.493	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			25	194	0	0	0	0.00632	0	25	194				
NFIB	4781	broad.mit.edu	37	9	14150265	14150265	+	Splice_Site	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:14150265C>A	ENST00000380959.3	-	5	1159		c.e5-1		NFIB_ENST00000397579.2_Splice_Site|NFIB_ENST00000380934.4_Splice_Site|NFIB_ENST00000380924.1_Splice_Site|NFIB_ENST00000397581.2_Splice_Site|NFIB_ENST00000380953.1_Splice_Site|NFIB_ENST00000397575.3_Splice_Site|NFIB_ENST00000543693.1_Splice_Site	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		GTTATGGGCGCTGAGGAATAA	0.438			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																Esophageal Squamous(132;921 1730 14828 40753 46471)	Esophageal Squamous(132;921 1730 14828 40753 46471)	uc003zle.2		NA		Dom	yes		9	9p24.1	4781	T	nuclear factor I/B			E	MYB|HGMA2		adenoid cystic carcinoma|lipoma		0					0						c.e5-1		nuclear factor I/B							211.0	214.0	213.0					9																	14150265		2203	4300	6503	SO:0001630	splice_region_variant	4781				anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity	g.chr9:14150265C>A	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.686-1G>T	9.37:g.14150265C>A			Somatic				NFIB_uc003zld.2_Splice_Site|NFIB_uc003zlf.2_Splice_Site_p.T229_splice|NFIB_uc011lmo.1_Splice_Site_p.T229_splice	p.T229_splice	NM_005596	NP_005587	WXS	Illumina HiSeq	Unspecified	O00712	NFIB_HUMAN		GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)	5	1121	-								G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Splice_Site	SNP	ENST00000380959.3	37	c.686_splice	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612218	0.66672	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.791	0.91974	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NFIB	14140265	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	6.897000	0.75671	2.489000	0.83994	0.655000	0.94253	.		0.438	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	Intron	10	206	1	0	3.86212e-05	0.008291	4.30912e-05	10	206				
ADAMTSL1	92949	broad.mit.edu	37	9	18574179	18574179	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:18574179T>A	ENST00000380548.4	+	4	728	c.389T>A	c.(388-390)cTg>cAg	p.L130Q	ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.L130Q|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.L130Q|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.L130Q|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.L130Q|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.L130Q|MIR3152_ENST00000579801.1_RNA	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	130						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L130Q(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GGAACAACCCTGGTTGTTGAA	0.443																																							uc003zne.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(388-390)CTG>CAG		ADAMTS-like 1 isoform 4 precursor							215.0	180.0	192.0					9																	18574179		2203	4300	6503	SO:0001583	missense	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18574179T>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.389T>A	9.37:g.18574179T>A	ENSP00000369921:p.Leu130Gln		Somatic				ADAMTSL1_uc003znb.2_Missense_Mutation_p.L130Q|ADAMTSL1_uc003znc.3_Missense_Mutation_p.L130Q	p.L130Q	NM_001040272	NP_001035362	WXS	Illumina HiSeq	Unspecified	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	4	516	+			130					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	c.389T>A	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627233	0.66901	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T;T	0.61510	0.1;0.22;0.22;0.22;0.22;0.22	5.25	5.25	0.73442	.	.	.	.	.	T	0.44435	0.1293	N	0.20766	0.605	0.80722	D	1	P;P	0.46621	0.881;0.619	B;B	0.40199	0.322;0.234	T	0.50939	-0.8768	9	0.54805	T	0.06	.	15.4522	0.75282	0.0:0.0:0.0:1.0	.	130;130	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	Q	130	ENSP00000369921:L130Q;ENSP00000327887:L130Q;ENSP00000401157:L130Q;ENSP00000369944:L130Q;ENSP00000369940:L130Q;ENSP00000276935:L130Q	ENSP00000276935:L130Q	L	+	2	0	ADAMTSL1	18564179	0.995000	0.38212	0.922000	0.36590	0.969000	0.65631	4.894000	0.63206	2.118000	0.64928	0.523000	0.50628	CTG		0.443	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			13	168	0	0	0	0.00245	0	13	168				
DNAI1	27019	broad.mit.edu	37	9	34514476	34514476	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:34514476C>G	ENST00000242317.4	+	17	1825	c.1654C>G	c.(1654-1656)Cac>Gac	p.H552D		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	552					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)	p.H552D(1)		autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GAACCCATACCACACCAAGGT	0.572									Kartagener syndrome																														uc003zum.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1654-1656)CAC>GAC		dynein, axonemal, intermediate chain 1							150.0	135.0	140.0					9																	34514476		2203	4300	6503	SO:0001583	missense	27019	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity	g.chr9:34514476C>G	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1654C>G	9.37:g.34514476C>G	ENSP00000242317:p.His552Asp		Somatic					p.H552D	NM_012144	NP_036276	WXS	Illumina HiSeq	Unspecified	Q9UI46	DNAI1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)	17	1847	+	all_epithelial(49;0.244)		552			WD 3.		B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	ENST00000242317.4	37	c.1654C>G	CCDS6557.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300600	0.60195	.	.	ENSG00000122735	ENST00000379040;ENST00000242317	T	0.63096	-0.02	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53270	0.1786	N	0.14661	0.345	0.80722	D	1	B	0.33549	0.417	B	0.40982	0.345	T	0.57236	-0.7846	10	0.49607	T	0.09	.	16.8206	0.85745	0.0:1.0:0.0:0.0	.	552	Q9UI46	DNAI1_HUMAN	D	108;552	ENSP00000242317:H552D	ENSP00000242317:H552D	H	+	1	0	DNAI1	34504476	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.585000	0.74062	2.563000	0.86464	0.561000	0.74099	CAC		0.572	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052192.1			16	173	0	0	0	0.00499	0	16	173				
CTSL3P	392360	broad.mit.edu	37	9	90388437	90388437	+	RNA	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:90388437G>A	ENST00000354530.2	+	0	303					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.W101*(1)									TGCAGACCTGGTGGACTGCTC	0.468																																							uc004apm.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(295-297)TGG>TGA		RecName: Full=Putative cathepsin L-like protein 3;          Short=Cathepsin L-like protein; AltName: Full=HCTSL-s;							146.0	136.0	139.0					9																	90388437		2203	4300	6503			392360							g.chr9:90388437G>A	AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388437G>A			Somatic					p.W99*	NR_027917		WXS	Illumina HiSeq	Unspecified					3	303	+									Nonsense_Mutation	SNP	ENST00000354530.2	37	c.297G>A																																																																																					0.468	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1	NR_027917		14	86	0	0	0	0.001855	0	14	86				
PALM2	114299	broad.mit.edu	37	9	112705636	112705636	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:112705636G>C	ENST00000374531.2	+	7	1145	c.1071G>C	c.(1069-1071)gaG>gaC	p.E357D	PALM2_ENST00000483909.1_Missense_Mutation_p.E355D|PALM2-AKAP2_ENST00000302798.7_Intron|PALM2_ENST00000314527.4_Missense_Mutation_p.E389D|AKAP2_ENST00000510514.5_Intron|AKAP2_ENST00000555236.1_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.E391D|PALM2-AKAP2_ENST00000374530.3_Intron	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	357					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)		p.E357D(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						GGAAGGAAGAGAGCCTAGCTA	0.557																																							uc004bei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1165-1167)GAG>GAC		A kinase (PRKA) anchor protein 2 isoform 2							109.0	102.0	105.0					9																	112705636		2203	4300	6503	SO:0001583	missense	445815						enzyme binding	g.chr9:112705636G>C	AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.1071G>C	9.37:g.112705636G>C	ENSP00000363656:p.Glu357Asp		Somatic				PALM2_uc004bef.2_Missense_Mutation_p.E391D|PALM2_uc004beg.2_Missense_Mutation_p.E357D|PALM2_uc004beh.3_Missense_Mutation_p.E389D|PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron	p.E389D	NM_001136562	NP_001130034	WXS	Illumina HiSeq	Unspecified	Q9Y2D5	AKAP2_HUMAN			7	1359	+			Error:Variant_position_missing_in_Q9Y2D5_after_alignment					A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	c.1167G>C	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317619	0.40996	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.25579	2.23;2.23;2.23;2.23;1.79	5.86	4.02	0.46733	.	.	.	.	.	T	0.36963	0.0986	M	0.69358	2.11	0.80722	D	1	B;D	0.63880	0.098;0.993	B;P	0.54499	0.037;0.754	T	0.10847	-1.0612	9	0.34782	T	0.22	.	9.6005	0.39601	0.2199:0.0:0.7801:0.0	.	357;391	Q8IXS6;D3YTA4	PALM2_HUMAN;.	D	357;391;355;389;389	ENSP00000363656:E357D;ENSP00000400206:E391D;ENSP00000417525:E355D;ENSP00000323805:E389D;ENSP00000397839:E389D	ENSP00000397839:E389D	E	+	3	2	PALM2-AKAP2;PALM2	111745457	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.874000	0.48483	1.493000	0.48517	0.650000	0.86243	GAG		0.557	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293		21	130	0	0	0	0.010504	0	21	130				
PRRC2B	84726	broad.mit.edu	37	9	134371229	134371229	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:134371229C>G	ENST00000357304.4	+	31	6713	c.6658C>G	c.(6658-6660)Cgg>Ggg	p.R2220G	PRRC2B_ENST00000405995.1_Missense_Mutation_p.R1526G|PRRC2B_ENST00000465931.1_3'UTR|PRRC2B_ENST00000372249.1_3'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.R1526G	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2220							poly(A) RNA binding (GO:0044822)	p.R2220G(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GATCAAGCCTCGGGCTGTCAA	0.637																																							uc004can.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(6658-6660)CGG>GGG		HLA-B associated transcript 2-like							48.0	56.0	54.0					9																	134371229		2018	4177	6195	SO:0001583	missense	84726						protein binding	g.chr9:134371229C>G	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6658C>G	9.37:g.134371229C>G	ENSP00000349856:p.Arg2220Gly		Somatic				BAT2L1_uc004cao.3_3'UTR|BAT2L1_uc004cap.3_Missense_Mutation_p.R366G|BAT2L1_uc011mch.1_Missense_Mutation_p.R143G	p.R2220G	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			31	6713	+			2220					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	c.6658C>G	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610131	0.87258	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550	T;T;T	0.02787	4.16;4.49;4.16	5.04	5.04	0.67666	.	.	.	.	.	T	0.03348	0.0097	N	0.19112	0.55	0.80722	D	1	B;P	0.34724	0.447;0.465	B;B	0.35182	0.197;0.097	T	0.57159	-0.7859	9	0.72032	D	0.01	-37.8847	17.5682	0.87927	0.0:1.0:0.0:0.0	.	1526;2220	Q5JSZ5-5;Q5JSZ5	.;PRC2B_HUMAN	G	1526;2220;1526	ENSP00000384606:R1526G;ENSP00000349856:R2220G;ENSP00000398853:R1526G	ENSP00000349856:R2220G	R	+	1	2	PRRC2B	133361050	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	6.937000	0.75898	2.614000	0.88457	0.563000	0.77884	CGG		0.637	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	42	0	0	0	0.009096	0	4	42				
TLR7	51284	broad.mit.edu	37	X	12904699	12904699	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:12904699G>T	ENST00000380659.3	+	3	1211	c.1072G>T	c.(1072-1074)Gca>Tca	p.A358S		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	358					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.A358S(1)		NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GGTCTATCGTGCATCTATGAA	0.388																																							uc004cvc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|breast(1)	5						c.(1072-1074)GCA>TCA		toll-like receptor 7 precursor	Imiquimod(DB00724)						64.0	62.0	63.0					X																	12904699		2203	4300	6503	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12904699G>T	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.1072G>T	X.37:g.12904699G>T	ENSP00000370034:p.Ala358Ser		Somatic					p.A358S	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	1211	+			358			Extracellular (Potential).|LRR 12.		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.1072G>T	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	G	2.267	-0.367866	0.05069	.	.	ENSG00000196664	ENST00000380659	T	0.34275	1.37	5.79	3.11	0.35812	.	0.408810	0.23181	N	0.051018	T	0.15739	0.0379	N	0.13198	0.31	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.19451	-1.0305	10	0.17832	T	0.49	.	1.0262	0.01528	0.2358:0.1292:0.4065:0.2286	.	358	Q9NYK1	TLR7_HUMAN	S	358	ENSP00000370034:A358S	ENSP00000370034:A358S	A	+	1	0	TLR7	12814620	0.001000	0.12720	0.002000	0.10522	0.951000	0.60555	-0.371000	0.07513	0.232000	0.21100	0.600000	0.82982	GCA		0.388	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		15	140	1	0	2.31682e-05	0.003163	2.60913e-05	15	140				
SCML1	6322	broad.mit.edu	37	X	17762333	17762333	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:17762333C>G	ENST00000380041.3	+	2	355	c.27C>G	c.(25-27)atC>atG	p.I9M	SCML1_ENST00000380043.3_Missense_Mutation_p.I9M|SCML1_ENST00000398080.1_Intron|SCML1_ENST00000380045.3_Intron	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	9					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I9M(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					CCAGTGAAATCGATGTGGTTT	0.328																																							uc004cyb.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(25-27)ATC>ATG		sex comb on midleg-like 1 isoform a							232.0	198.0	209.0					X																	17762333		2203	4300	6503	SO:0001583	missense	6322				anatomical structure morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:17762333C>G		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.27C>G	X.37:g.17762333C>G	ENSP00000369380:p.Ile9Met		Somatic				SCML1_uc004cyc.2_Missense_Mutation_p.I9M|SCML1_uc004cyd.2_Intron|SCML1_uc004cye.2_Intron	p.I9M	NM_001037540	NP_001032629	WXS	Illumina HiSeq	Unspecified	Q9UN30	SCML1_HUMAN			2	352	+	Hepatocellular(33;0.183)		9					B0FZN6|B2RA08|Q5H968|Q5H969	Missense_Mutation	SNP	ENST00000380041.3	37	c.27C>G	CCDS35210.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487373	0.44249	.	.	ENSG00000047634	ENST00000380041;ENST00000380043;ENST00000419185	.	.	.	4.88	-9.31	0.00646	.	3.767020	0.00644	N	0.000521	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B;B	0.32396	0.369;0.253	B;B	0.32022	0.139;0.048	T	0.26538	-1.0100	9	0.62326	D	0.03	-0.682	4.2192	0.10549	0.0926:0.1294:0.276:0.5021	.	9;9	Q9UN30-2;Q9UN30	.;SCML1_HUMAN	M	9	.	ENSP00000369380:I9M	I	+	3	3	SCML1	17672254	0.000000	0.05858	0.000000	0.03702	0.435000	0.31806	-3.232000	0.00547	-2.604000	0.00449	-0.278000	0.10074	ATC		0.328	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	NM_006746		16	140	0	0	0	0.00499	0	16	140				
MAGEB18	286514	broad.mit.edu	37	X	26157580	26157580	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:26157580C>A	ENST00000325250.1	+	2	665	c.478C>A	c.(478-480)Ctt>Att	p.L160I		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	160	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.L160I(1)|p.L160F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						GGAGCTGGCACTTGGTGTTGA	0.418																																							uc004dbq.1		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	central_nervous_system(1)	1						c.(478-480)CTT>ATT		melanoma antigen family B, 18							53.0	41.0	45.0					X																	26157580		2202	4300	6502	SO:0001583	missense	286514						protein binding	g.chrX:26157580C>A	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.478C>A	X.37:g.26157580C>A	ENSP00000314543:p.Leu160Ile		Somatic					p.L160I	NM_173699	NP_775970	WXS	Illumina HiSeq	Unspecified	Q96M61	MAGBI_HUMAN			2	665	+			160			MAGE.			Missense_Mutation	SNP	ENST00000325250.1	37	c.478C>A	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246935	0.22796	.	.	ENSG00000176774	ENST00000325250	T	0.04758	3.56	4.56	1.88	0.25563	.	0.104526	0.64402	D	0.000003	T	0.03564	0.0102	N	0.24115	0.695	0.09310	N	0.999996	B	0.29232	0.238	B	0.31101	0.124	T	0.38499	-0.9658	10	0.87932	D	0	.	5.8019	0.18417	0.0:0.2406:0.0:0.7594	.	160	Q96M61	MAGBI_HUMAN	I	160	ENSP00000314543:L160I	ENSP00000314543:L160I	L	+	1	0	MAGEB18	26067501	0.977000	0.34250	0.798000	0.32154	0.475000	0.33008	1.107000	0.31110	0.248000	0.21435	-0.366000	0.07423	CTT		0.418	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		5	28	1	0	5.9392e-07	0.001168	6.94829e-07	5	28				
ZNF41	7592	broad.mit.edu	37	X	47308566	47308566	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:47308566G>T	ENST00000377065.4	-	5	1242	c.603C>A	c.(601-603)aaC>aaA	p.N201K	ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000313116.7_Missense_Mutation_p.N201K|ZNF41_ENST00000397050.2_Missense_Mutation_p.N211K	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N201K(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				GATTATGTGAGTTTAAAGTAT	0.328																																							uc004dhs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(727-729)AAC>AAA		zinc finger protein 41							130.0	121.0	124.0					X																	47308566		2203	4300	6503	SO:0001583	missense	7592					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47308566G>T	X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.603C>A	X.37:g.47308566G>T	ENSP00000366265:p.Asn201Lys		Somatic				ZNF41_uc004dhu.3_Missense_Mutation_p.N235K|ZNF41_uc004dht.3_Missense_Mutation_p.N115K|ZNF41_uc004dhv.3_Missense_Mutation_p.N211K|ZNF41_uc004dhw.3_Missense_Mutation_p.N203K|ZNF41_uc004dhy.3_Missense_Mutation_p.N201K|ZNF41_uc004dhx.3_Missense_Mutation_p.N201K|ZNF41_uc011mlm.1_Missense_Mutation_p.N115K	p.N243K	NM_153380	NP_700359	WXS	Illumina HiSeq	Unspecified	P51814	ZNF41_HUMAN			4	796	-		all_lung(315;0.000129)	243					A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	c.729C>A	CCDS14279.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.727778	0.00694	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.05925	3.37;3.37;3.37	2.96	1.12	0.20585	.	0.196738	0.25127	N	0.032924	T	0.02267	0.0070	N	0.08118	0	0.24121	N	0.995802	B;B;P;B;B	0.38370	0.002;0.002;0.628;0.0;0.0	B;B;B;B;B	0.37601	0.003;0.003;0.254;0.001;0.0	T	0.35968	-0.9767	10	0.07644	T	0.81	.	3.0035	0.06021	0.2823:0.2338:0.4839:0.0	.	201;203;211;235;243	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	K	201;201;211	ENSP00000315173:N201K;ENSP00000366265:N201K;ENSP00000380243:N211K	ENSP00000315173:N201K	N	-	3	2	ZNF41	47193510	0.475000	0.25894	0.340000	0.25575	0.007000	0.05969	-0.108000	0.10857	0.180000	0.19960	-0.371000	0.07208	AAC		0.328	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380		38	210	1	0	6.2361e-21	0.007835	8.03691e-21	38	210				
ZNF182	7569	broad.mit.edu	37	X	47835779	47835779	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:47835779G>T	ENST00000396965.1	-	7	2057	c.1707C>A	c.(1705-1707)ccC>ccA	p.P569P	ZNF182_ENST00000376943.3_Silent_p.P550P|ZNF182_ENST00000305127.6_Silent_p.P569P	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	569					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P569P(1)|p.P550P(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TGCATGCATAGGGTTTCTCTC	0.423																																							uc004dir.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)	3						c.(1705-1707)CCC>CCA		zinc finger protein 21 isoform 1							126.0	105.0	112.0					X																	47835779		2203	4300	6503	SO:0001819	synonymous_variant	7569				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47835779G>T	AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.1707C>A	X.37:g.47835779G>T			Somatic				ZNF182_uc004dis.2_Silent_p.P550P|ZNF182_uc004dit.2_Silent_p.P569P|ZNF182_uc011mlu.1_Silent_p.P549P	p.P569P	NM_006962	NP_008893	WXS	Illumina HiSeq	Unspecified	P17025	ZN182_HUMAN			7	2053	-			569					A2IDD7|Q3KP67|Q96QH7	Silent	SNP	ENST00000396965.1	37	c.1707C>A	CCDS35236.1																																																																																				0.423	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277055.1	NM_006962		17	92	1	0	3.32936e-07	0.006122	3.93321e-07	17	92				
PHF8	23133	broad.mit.edu	37	X	54029107	54029107	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:54029107G>A	ENST00000357988.5	-	9	1421	c.1063C>T	c.(1063-1065)Cat>Tat	p.H355Y	PHF8_ENST00000338946.6_Missense_Mutation_p.H319Y|PHF8_ENST00000338154.6_Missense_Mutation_p.H319Y|PHF8_ENST00000322659.8_Missense_Mutation_p.H319Y	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	355	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.H319Y(2)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						AGCACAGCATGGATCCACCCT	0.488																																							uc004dsu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1063-1065)CAT>TAT		PHD finger protein 8							129.0	89.0	102.0					X																	54029107		2203	4300	6503	SO:0001583	missense	23133				brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chrX:54029107G>A	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1063C>T	X.37:g.54029107G>A	ENSP00000350676:p.His355Tyr		Somatic				PHF8_uc004dst.2_Missense_Mutation_p.H319Y|PHF8_uc004dsv.2_Missense_Mutation_p.H185Y|PHF8_uc004dsw.2_Missense_Mutation_p.H319Y|PHF8_uc004dsx.2_Missense_Mutation_p.H83Y|PHF8_uc004dsy.2_Missense_Mutation_p.H319Y	p.H355Y	NM_015107	NP_055922	WXS	Illumina HiSeq	Unspecified	Q9UPP1	PHF8_HUMAN			9	1136	-			355			JmjC.	Iron; catalytic.	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	c.1063C>T	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.44|14.44	2.537227|2.537227	0.45176|0.45176	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659|ENST00000443302	D;D;D;D|.	0.97791|.	-4.54;-4.54;-4.54;-4.54|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78419|0.78419	0.4280|0.4280	M|M	0.80332|0.80332	2.49|2.49	0.58432|0.58432	D|D	0.999999|0.999999	P;D;D;D|.	0.62365|.	0.839;0.974;0.968;0.991|.	B;B;B;P|.	0.52554|.	0.135;0.425;0.3;0.702|.	T|T	0.78996|0.78996	-0.1983|-0.1983	10|5	0.39692|.	T|.	0.17|.	-8.3152|-8.3152	17.6878|17.6878	0.88260|0.88260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	319;319;355;355|.	Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;PHF8_HUMAN|.	Y|L	355;319;319;349;319|82	ENSP00000350676:H355Y;ENSP00000338868:H319Y;ENSP00000340051:H319Y;ENSP00000319473:H319Y|.	ENSP00000319473:H319Y|.	H|P	-|-	1|2	0|0	PHF8|PHF8	54045832|54045832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	4.489000|4.489000	0.60309|0.60309	2.449000|2.449000	0.82847|0.82847	0.513000|0.513000	0.50165|0.50165	CAT|CCA		0.488	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107		5	63	0	0	0	0.001168	0	5	63				
FAM120C	54954	broad.mit.edu	37	X	54161289	54161289	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:54161289C>T	ENST00000375180.2	-	7	1647	c.1591G>A	c.(1591-1593)Gat>Aat	p.D531N	FAM120C_ENST00000328235.4_Missense_Mutation_p.D531N	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	531							poly(A) RNA binding (GO:0044822)	p.D531N(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TTTGGCTCATCACCATCAGAG	0.463																																							uc004dsz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1591-1593)GAT>AAT		hypothetical protein LOC54954							65.0	51.0	56.0					X																	54161289		2203	4300	6503	SO:0001583	missense	54954							g.chrX:54161289C>T	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1591G>A	X.37:g.54161289C>T	ENSP00000364324:p.Asp531Asn		Somatic				FAM120C_uc011moh.1_Missense_Mutation_p.D531N	p.D531N	NM_017848	NP_060318	WXS	Illumina HiSeq	Unspecified	Q9NX05	F120C_HUMAN			7	1674	-			531					B2RMT7	Missense_Mutation	SNP	ENST00000375180.2	37	c.1591G>A	CCDS14356.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125091	0.77436	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.55930	0.49;0.49	5.07	5.07	0.68467	.	0.286349	0.41097	D	0.000942	T	0.59101	0.2169	N	0.19112	0.55	0.80722	D	1	D;D	0.76494	0.999;0.995	D;P	0.71414	0.973;0.888	T	0.64980	-0.6279	10	0.72032	D	0.01	-18.1115	16.8755	0.86051	0.0:1.0:0.0:0.0	.	531;531	F8W881;Q9NX05	.;F120C_HUMAN	N	531	ENSP00000364324:D531N;ENSP00000329896:D531N	ENSP00000329896:D531N	D	-	1	0	FAM120C	54178014	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.543000	0.60684	2.447000	0.82792	0.513000	0.50165	GAT		0.463	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848		8	47	0	0	0	0.004482	0	8	47				
PGK1	5230	broad.mit.edu	37	X	77373668	77373668	+	Splice_Site	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77373668G>C	ENST00000373316.4	+	6	808		c.e6+1		PGK1_ENST00000442431.1_Splice_Site|PGK1_ENST00000537456.1_Splice_Site	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TCCTGGGCGGGTATGAAGAAC	0.478																																							uc004ecz.3		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.e6+1		phosphoglycerate kinase 1							87.0	83.0	84.0					X																	77373668		2203	4296	6499	SO:0001630	splice_region_variant	5230				gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chrX:77373668G>C	L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.641+1G>C	X.37:g.77373668G>C			Somatic				PGK1_uc010nlz.2_Splice_Site|PGK1_uc011mqq.1_Splice_Site_p.G186_splice	p.G214_splice	NM_000291	NP_000282	WXS	Illumina HiSeq	Unspecified	P00558	PGK1_HUMAN			6	813	+								A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Splice_Site	SNP	ENST00000373316.4	37	c.641_splice	CCDS14438.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214561	0.39102	.	.	ENSG00000102144	ENST00000373316;ENST00000442431;ENST00000450919;ENST00000537456	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6694	0.77262	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PGK1	77260324	1.000000	0.71417	0.999000	0.59377	0.236000	0.25371	9.769000	0.98969	1.973000	0.57446	0.513000	0.50165	.		0.478	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		Intron	14	136	0	0	0	0.001855	0	14	136				
ZCCHC5	203430	broad.mit.edu	37	X	77912563	77912563	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77912563C>A	ENST00000321110.1	-	2	1650	c.1355G>T	c.(1354-1356)gGt>gTt	p.G452V		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	452							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G452V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GGCAAAATGACCAGGATAACC	0.557																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1354-1356)GGT>GTT		zinc finger, CCHC domain containing 5							94.0	71.0	79.0					X																	77912563		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912563C>A	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1355G>T	X.37:g.77912563C>A	ENSP00000316794:p.Gly452Val		Somatic					p.G452V	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	1651	-			452			CCHC-type.		B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.1355G>T	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680835	0.29872	.	.	ENSG00000179300	ENST00000321110	D	0.96522	-4.04	3.2	1.37	0.22104	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	.	.	.	.	D	0.95153	0.8429	M	0.69523	2.12	0.40946	D	0.984506	P	0.35155	0.487	B	0.44278	0.445	D	0.91980	0.5594	9	0.87932	D	0	.	3.3023	0.06987	0.2546:0.6011:0.0:0.1443	.	452	Q8N8U3	ZCHC5_HUMAN	V	452	ENSP00000316794:G452V	ENSP00000316794:G452V	G	-	2	0	ZCCHC5	77799219	1.000000	0.71417	0.948000	0.38648	0.580000	0.36256	1.004000	0.29822	0.221000	0.20879	-0.281000	0.10026	GGT		0.557	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		7	60	1	0	0.00307968	0.00308	0.00324106	7	60				
ZCCHC5	203430	broad.mit.edu	37	X	77913582	77913582	+	Silent	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77913582T>C	ENST00000321110.1	-	2	631	c.336A>G	c.(334-336)ccA>ccG	p.P112P		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	112	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P112P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CCAGGGACTCTGGGGCTGCTG	0.642																																							uc004edc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(334-336)CCA>CCG		zinc finger, CCHC domain containing 5							21.0	24.0	23.0					X																	77913582		2201	4292	6493	SO:0001819	synonymous_variant	203430						nucleic acid binding|zinc ion binding	g.chrX:77913582T>C	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.336A>G	X.37:g.77913582T>C			Somatic					p.P112P	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	632	-			112			Pro-rich.		B2RMZ0|Q5JQE9	Silent	SNP	ENST00000321110.1	37	c.336A>G	CCDS14440.1																																																																																				0.642	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		5	25	0	0	0	0.000602	0	5	25				
SLC25A53	401612	broad.mit.edu	37	X	103349436	103349436	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:103349436G>A	ENST00000357421.4	-	2	685	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	169					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.R169W(1)									AGTGACAGCCGCCCCCAAAGC	0.532																																							uc004elu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(505-507)CGG>TGG		mitochondrial carrier triple repeat 6							71.0	80.0	77.0					X																	103349436		2203	4300	6503	SO:0001583	missense	401612				transport	integral to membrane|mitochondrial inner membrane		g.chrX:103349436G>A		CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.505C>T	X.37:g.103349436G>A	ENSP00000361681:p.Arg169Trp		Somatic					p.R169W	NM_001012755	NP_001012773	WXS	Illumina HiSeq	Unspecified	Q5H9E4	MCAR6_HUMAN			2	686	-			169			Solcar 2.		B2RTT9	Missense_Mutation	SNP	ENST00000357421.4	37	c.505C>T	CCDS35363.1	.	.	.	.	.	.	.	.	.	.	g	14.15	2.450318	0.43531	.	.	ENSG00000176274	ENST00000357421	T	0.75260	-0.92	4.18	2.29	0.28610	Mitochondrial carrier domain (2);	0.000000	0.53938	D	0.000060	T	0.79269	0.4417	L	0.50333	1.59	0.38186	D	0.939771	D	0.89917	1.0	D	0.75484	0.986	T	0.76724	-0.2854	10	0.38643	T	0.18	-45.0832	9.3632	0.38208	0.0:0.0:0.4369:0.5631	.	169	Q5H9E4	MCAR6_HUMAN	W	169	ENSP00000361681:R169W	ENSP00000361681:R169W	R	-	1	2	MCART6	103236092	0.993000	0.37304	0.999000	0.59377	0.939000	0.58152	1.464000	0.35288	0.311000	0.23014	-0.229000	0.12294	CGG		0.532	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057761.1	NM_001012755		40	196	0	0	0	0.007835	0	40	196				
PIH1D3	139212	broad.mit.edu	37	X	106466059	106466059	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:106466059C>T	ENST00000372453.3	+	5	479	c.417C>T	c.(415-417)tgC>tgT	p.C139C	PIH1D3_ENST00000535523.1_Silent_p.C139C|PIH1D3_ENST00000336387.4_Silent_p.C139C	NM_173494.1	NP_775765.1	Q9NQM4	PIHD3_HUMAN	PIH1 domain containing 3	139								p.C139C(1)									CAGGTTGTTGCAGTGAACTAG	0.358																																							uc004enc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(415-417)TGC>TGT		hypothetical protein LOC139212							120.0	113.0	116.0					X																	106466059		2203	4300	6503	SO:0001819	synonymous_variant	139212							g.chrX:106466059C>T	AL136112	CCDS14528.1	Xq22.3	2014-05-20	2012-07-18	2012-07-18	ENSG00000080572	ENSG00000080572			28570	protein-coding gene	gene with protein product	"""sarcoma antigen NY-SAR-97"""		"""chromosome X open reading frame 41"""	CXorf41		12601173, 24421334	Standard	NM_001169154		Approved	MGC35261, NYSAR97	uc004enc.3	Q9NQM4	OTTHUMG00000022160	ENST00000372453.3:c.417C>T	X.37:g.106466059C>T			Somatic				CXorf41_uc004end.2_Silent_p.C139C	p.C139C	NM_173494	NP_775765	WXS	Illumina HiSeq	Unspecified	Q9NQM4	CX041_HUMAN			5	479	+			139					D3DUX5|Q86WE1	Silent	SNP	ENST00000372453.3	37	c.417C>T	CCDS14528.1																																																																																				0.358	PIH1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057832.1	NM_173494		26	157	0	0	0	0.00632	0	26	157				
ZCCHC12	170261	broad.mit.edu	37	X	117960105	117960105	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:117960105A>G	ENST00000310164.2	+	4	1405	c.898A>G	c.(898-900)Aga>Gga	p.R300G		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	300					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R300G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						AGACAGGGCCAGACCTCAGGA	0.562																																							uc004equ.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(898-900)AGA>GGA		zinc finger, CCHC domain containing 12							97.0	88.0	91.0					X																	117960105		2203	4300	6503	SO:0001583	missense	170261				regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding	g.chrX:117960105A>G	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.898A>G	X.37:g.117960105A>G	ENSP00000308921:p.Arg300Gly		Somatic					p.R300G	NM_173798	NP_776159	WXS	Illumina HiSeq	Unspecified	Q6PEW1	ZCH12_HUMAN			4	1371	+			300					B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	37	c.898A>G	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	A	4.036	0.004257	0.07866	.	.	ENSG00000174460	ENST00000310164	T	0.33654	1.4	3.1	1.95	0.26073	.	.	.	.	.	T	0.32285	0.0824	M	0.72479	2.2	0.21147	N	0.99977	B	0.28636	0.218	B	0.28011	0.085	T	0.26677	-1.0096	9	0.29301	T	0.29	-0.6703	3.9442	0.09341	0.8193:0.0:0.1807:0.0	.	300	Q6PEW1	ZCH12_HUMAN	G	300	ENSP00000308921:R300G	ENSP00000308921:R300G	R	+	1	2	ZCCHC12	117844133	0.001000	0.12720	0.711000	0.30485	0.180000	0.23129	0.198000	0.17217	0.445000	0.26639	0.486000	0.48141	AGA		0.562	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798		28	184	0	0	0	0.008361	0	28	184				
GRIA3	2892	broad.mit.edu	37	X	122537344	122537344	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:122537344C>G	ENST00000371251.1	+	9	1319	c.1267C>G	c.(1267-1269)Cgg>Ggg	p.R423G	GRIA3_ENST00000541091.1_Missense_Mutation_p.R407G|GRIA3_ENST00000542149.1_Missense_Mutation_p.R423G|GRIA3_ENST00000264357.5_Missense_Mutation_p.R423G|GRIA3_ENST00000371256.5_Missense_Mutation_p.R423G			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	423					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.R423G(3)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	CTCAGAGAATCGGACCATAGT	0.433																																							uc004etq.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(1267-1269)CGG>GGG		glutamate receptor, ionotrophic, AMPA 3 isoform	L-Glutamic Acid(DB00142)						176.0	158.0	164.0					X																	122537344		2203	4300	6503	SO:0001583	missense	2892				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chrX:122537344C>G	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1267C>G	X.37:g.122537344C>G	ENSP00000360297:p.Arg423Gly		Somatic				GRIA3_uc004etr.3_Missense_Mutation_p.R423G|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.R407G	p.R423G	NM_007325	NP_015564	WXS	Illumina HiSeq	Unspecified	P42263	GRIA3_HUMAN			10	1560	+			423			Extracellular (Potential).		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	c.1267C>G	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565676	0.45694	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.39997	1.56;1.56;1.56;1.56;1.05	5.87	2.72	0.32119	.	0.050300	0.85682	D	0.000000	T	0.45617	0.1351	M	0.78916	2.43	0.58432	D	0.99999	P;B;P	0.43169	0.8;0.36;0.493	B;B;B	0.40038	0.317;0.096;0.196	T	0.54886	-0.8226	10	0.87932	D	0	.	13.3002	0.60321	0.5458:0.4542:0.0:0.0	.	407;423;423	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	G	423;423;423;423;407	ENSP00000264357:R423G;ENSP00000446146:R423G;ENSP00000360302:R423G;ENSP00000360297:R423G;ENSP00000446440:R407G	ENSP00000264357:R423G	R	+	1	2	GRIA3	122365025	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.849000	0.39318	0.561000	0.29186	0.594000	0.82650	CGG		0.433	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		25	220	0	0	0	0.00333	0	25	220				
CDR1	1038	broad.mit.edu	37	X	139865753	139865753	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:139865753C>T	ENST00000370532.2	-	1	970	c.779G>A	c.(778-780)tGg>tAg	p.W260*		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	260								p.W260*(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CTAGATCTTCCAGTCAATCAG	0.413																																							uc004fbg.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(778-780)TGG>TAG		cerebellar degeneration-related protein 1,							74.0	75.0	75.0					X																	139865753		2203	4299	6502	SO:0001587	stop_gained	1038							g.chrX:139865753C>T		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.779G>A	X.37:g.139865753C>T	ENSP00000359563:p.Trp260*		Somatic				uc004fbf.1_RNA	p.W260*	NM_004065	NP_004056	WXS	Illumina HiSeq	Unspecified	P51861	CDR1_HUMAN			1	971	-	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)	260					Q5JXH6	Nonsense_Mutation	SNP	ENST00000370532.2	37	c.779G>A	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854303	0.51270	.	.	ENSG00000184258	ENST00000370532	.	.	.	2.31	2.31	0.28768	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999928	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4443	0.11589	0.0:0.8051:0.0:0.1949	.	.	.	.	X	260	.	.	W	-	2	0	CDR1	139693419	0.618000	0.27051	0.046000	0.18839	0.011000	0.07611	1.302000	0.33459	1.435000	0.47434	0.460000	0.39030	TGG		0.413	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065		22	176	0	0	0	0.00278	0	22	176				
MTM1	4534	broad.mit.edu	37	X	149839952	149839952	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:149839952G>A	ENST00000370396.2	+	15	1750	c.1696G>A	c.(1696-1698)Gaa>Aaa	p.E566K	MTM1_ENST00000542741.1_3'UTR|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.E451K|MTM1_ENST00000413012.2_Missense_Mutation_p.E529K	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	566					endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.E566K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					CTTACGCGACGAATACATAAA	0.522																																							uc004fef.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(1696-1698)GAA>AAA		myotubularin							117.0	93.0	101.0					X																	149839952		2203	4300	6503	SO:0001583	missense	4534				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chrX:149839952G>A	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1696G>A	X.37:g.149839952G>A	ENSP00000359423:p.Glu566Lys		Somatic				MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.E529K|MTM1_uc011mxz.1_Missense_Mutation_p.E451K|MTM1_uc010nte.2_Missense_Mutation_p.E434K	p.E566K	NM_000252	NP_000243	WXS	Illumina HiSeq	Unspecified	Q13496	MTM1_HUMAN			15	1772	+	Acute lymphoblastic leukemia(192;6.56e-05)		566					A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	c.1696G>A	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781327	0.31502	.	.	ENSG00000171100	ENST00000370396;ENST00000543350;ENST00000413012	D;D;D	0.96011	-3.88;-3.65;-3.85	4.85	4.85	0.62838	.	0.256266	0.40554	N	0.001065	D	0.91690	0.7373	L	0.28400	0.85	0.34666	D	0.723206	B;B	0.31435	0.323;0.323	B;B	0.25884	0.064;0.064	D	0.94029	0.7299	10	0.72032	D	0.01	.	17.4112	0.87486	0.0:0.0:1.0:0.0	.	529;566	B7Z491;Q13496	.;MTM1_HUMAN	K	566;451;529	ENSP00000359423:E566K;ENSP00000439784:E451K;ENSP00000389157:E529K	ENSP00000359423:E566K	E	+	1	0	MTM1	149590610	1.000000	0.71417	0.022000	0.16811	0.059000	0.15707	5.349000	0.66010	2.123000	0.65237	0.600000	0.82982	GAA		0.522	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252		8	70	0	0	0	0.004482	0	8	70				
GPR50	9248	broad.mit.edu	37	X	150349062	150349063	+	Missense_Mutation	DNP	CC	CC	AA	rs200876781		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:150349062_150349063CC>AA	ENST00000218316.3	+	2	1076_1077	c.1007_1008CC>AA	c.(1006-1008)gCC>gAA	p.A336E	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	336	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.A336E(2)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CGTACCCTGGCCCGCGCCCGTG	0.564																																							uc010ntg.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1006-1008)GCC>GAA		G protein-coupled receptor 50																																				SO:0001583	missense	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349062_150349063CC>AA	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	Exception_encountered	X.37:g.150349062_150349063delinsAA	ENSP00000218316:p.Ala336Glu		Somatic				uc004fes.1_5'Flank|GPR50_uc011myc.1_3'UTR	p.A336E	NM_004224	NP_004215	WXS	Illumina HiSeq	Unspecified	Q13585	MTR1L_HUMAN			2	1142_1143	+	Acute lymphoblastic leukemia(192;6.56e-05)		336			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Missense_Mutation	DNP	ENST00000218316.3	37	c.1007_1008CC>AA	CCDS44012.1																																																																																				0.564	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		16	196	0	0	0	0.004672	0	16	196				
KIF26A	26153	broad.mit.edu	37	14	104643849	104643849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:104643849delC	ENST00000423312.2	+	12	4724	c.4724delC	c.(4723-4725)gccfs	p.A1575fs	KIF26A_ENST00000315264.7_Frame_Shift_Del_p.A1436fs	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1575					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCCAGTGGAGCCCCGGGCCGA	0.731																																							uc001yos.3		NA																	0				pancreas(1)	1						c.(4723-4725)GCCfs		kinesin family member 26A							2.0	3.0	3.0					14																	104643849		1540	3534	5074	SO:0001589	frameshift_variant	26153				blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity	g.chr14:104643849delC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4724delC	14.37:g.104643849delC	ENSP00000388241:p.Ala1575fs		Somatic					p.A1575fs	NM_015656	NP_056471	WXS	Illumina HiSeq	Unspecified	Q9ULI4	KI26A_HUMAN	Epithelial(46;0.152)	Epithelial(152;0.161)	12	4724	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	1575					Q8TAZ7|Q96GK3|Q9UFL3	Frame_Shift_Del	DEL	ENST00000423312.2	37	c.4724delC	CCDS45171.1																																																																																				0.731	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1			2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
KIDINS220	57498	broad.mit.edu	37	2	8931289	8931289	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:8931289delC	ENST00000256707.3	-	13	1523	c.1342delG	c.(1342-1344)gcafs	p.A448fs	KIDINS220_ENST00000319688.5_Frame_Shift_Del_p.A449fs|KIDINS220_ENST00000418530.1_Frame_Shift_Del_p.A406fs|KIDINS220_ENST00000427284.1_Frame_Shift_Del_p.A448fs|KIDINS220_ENST00000473731.1_Frame_Shift_Del_p.A448fs	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	448	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGAATATCTGCCAGGGCACTG	0.418																																							uc002qzc.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1342-1344)GCAfs		kinase D-interacting substrate of 220 kDa							99.0	95.0	96.0					2																	8931289		1905	4126	6031	SO:0001589	frameshift_variant	57498				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane		g.chr2:8931289delC	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.1342delG	2.37:g.8931289delC	ENSP00000256707:p.Ala448fs		Somatic				KIDINS220_uc010yiv.1_Frame_Shift_Del_p.A214fs|KIDINS220_uc002qzd.2_Frame_Shift_Del_p.A406fs|KIDINS220_uc010yiw.1_Frame_Shift_Del_p.A449fs	p.A448fs	NM_020738	NP_065789	WXS	Illumina HiSeq	Unspecified	Q9ULH0	KDIS_HUMAN			13	1524	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		448			Cytoplasmic (Potential).|KAP NTPase.		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Frame_Shift_Del	DEL	ENST00000256707.3	37	c.1342delG	CCDS42650.1																																																																																				0.418	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738		13	98	NA	NA	NA	NA	NA	13	98	---	---	---	---
DOK1	1796	broad.mit.edu	37	2	74783669	74783669	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:74783669delC	ENST00000233668.5	+	5	1543	c.874delC	c.(874-876)cccfs	p.P293fs	LOXL3_ENST00000409986.1_5'Flank|DOK1_ENST00000480318.1_3'UTR|DOK1_ENST00000409429.1_Frame_Shift_Del_p.P154fs|LOXL3_ENST00000264094.3_5'Flank|DOK1_ENST00000340004.6_3'UTR|LOXL3_ENST00000393937.2_5'Flank|M1AP_ENST00000464686.1_5'Flank	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	293	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCTCGACAGTCCCCCAGCCCT	0.617																																					Esophageal Squamous(36;520 860 12502 33616 51270)	Esophageal Squamous(36;520 860 12502 33616 51270)	uc002sms.2		NA																	0					0						c.(874-876)CCCfs		docking protein 1							72.0	72.0	72.0					2																	74783669		2203	4300	6503	SO:0001589	frameshift_variant	1796				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol|perinuclear region of cytoplasm	insulin receptor binding	g.chr2:74783669delC	U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.874delC	2.37:g.74783669delC	ENSP00000233668:p.Pro293fs		Somatic				LOXL3_uc002smp.1_5'Flank|LOXL3_uc002smq.1_5'Flank|LOXL3_uc010ffn.1_5'Flank|DOK1_uc002smr.2_Frame_Shift_Del_p.P153fs|DOK1_uc010ffo.2_Frame_Shift_Del_p.P153fs|DOK1_uc002smt.2_Frame_Shift_Del_p.P78fs|DOK1_uc002smu.2_Frame_Shift_Del_p.P78fs|DOK1_uc010yrz.1_Frame_Shift_Del_p.P281fs|DOK1_uc002smv.2_Frame_Shift_Del_p.P153fs|DOK1_uc002smw.1_Frame_Shift_Del_p.P78fs	p.P292fs	NM_001381	NP_001372	WXS	Illumina HiSeq	Unspecified	Q99704	DOK1_HUMAN			5	896	+			292			Pro-rich.		O43204|Q53TY2|Q9UHG6	Frame_Shift_Del	DEL	ENST00000233668.5	37	c.874delC	CCDS1954.1																																																																																				0.617	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252218.3	NM_001381		22	136	NA	NA	NA	NA	NA	22	136	---	---	---	---
RPRD1B	58490	broad.mit.edu	37	20	36676873	36676874	+	Frame_Shift_Ins	INS	-	-	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:36676873_36676874insC	ENST00000373433.4	+	3	807_808	c.405_406insC	c.(406-408)cccfs	p.P136fs		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	136					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						CCAAGAGCCCTCCCCCCAAAGG	0.47																																							uc002xho.3		NA																	0				pancreas(1)	1						c.(403-408)CCTCCCfs		Regulation of nuclear pre-mRNA domain containing																																				SO:0001589	frameshift_variant	58490							g.chr20:36676873_36676874insC	AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.411dupC	20.37:g.36676879_36676879dupC	ENSP00000362532:p.Pro136fs		Somatic					p.P135fs	NM_021215	NP_067038	WXS	Illumina HiSeq	Unspecified	Q9NQG5	RPR1B_HUMAN			3	807_808	+			135_136					Q1WDE7|Q6PKF4	Frame_Shift_Ins	INS	ENST00000373433.4	37	c.405_406insC	CCDS13301.1																																																																																				0.470	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079142.2	NM_021215		8	86	NA	NA	NA	NA	NA	8	86	---	---	---	---
VWC2	375567	broad.mit.edu	37	7	49842429	49842430	+	Frame_Shift_Ins	INS	-	-	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:49842429_49842430insA	ENST00000340652.4	+	3	1375_1376	c.819_820insA	c.(820-822)aaafs	p.K274fs		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	274	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						GTCCCATCTGCAAAAATGGTAT	0.569																																							uc003tot.1		NA																	0					0						c.(817-822)TGCAAAfs		von Willebrand factor C domain containing 2																																				SO:0001589	frameshift_variant	375567				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space		g.chr7:49842429_49842430insA	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.824dupA	7.37:g.49842434_49842434dupA	ENSP00000341819:p.Lys274fs		Somatic					p.C273fs	NM_198570	NP_940972	WXS	Illumina HiSeq	Unspecified	Q2TAL6	VWC2_HUMAN			3	1375_1376	+			273_274			VWFC 2.		Q6UXE2	Frame_Shift_Ins	INS	ENST00000340652.4	37	c.819_820insA	CCDS5508.1																																																																																				0.569	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570		19	78	NA	NA	NA	NA	NA	19	78	---	---	---	---
RPL30	6156	broad.mit.edu	37	8	99054903	99054904	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:99054903_99054904delTG	ENST00000521291.1	-	3	413_414	c.267_268delCA	c.(265-270)tacagafs	p.YR89fs	RPL30_ENST00000396070.2_Frame_Shift_Del_p.YR70fs|RPL30_ENST00000523172.1_Frame_Shift_Del_p.YR25fs|KB-1208A12.3_ENST00000501016.2_RNA|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000287038.3_Frame_Shift_Del_p.YR89fs|RPL30_ENST00000518164.1_Intron			P62888	RL30_HUMAN	ribosomal protein L30	89					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			GTGCACACTCTGTAGTATTTTC	0.366																																							uc003yif.2		NA																	0					0						c.(265-270)TACAGAfs		ribosomal protein L30																																				SO:0001589	frameshift_variant	6156				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome	g.chr8:99054903_99054904delTG		CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.267_268delCA	8.37:g.99054903_99054904delTG	ENSP00000428085:p.Tyr89fs		Somatic				RPL30_uc010mbk.1_Intron|SNORA72_uc003yig.1_5'Flank	p.Y89fs	NM_000989	NP_000980	WXS	Illumina HiSeq	Unspecified	P62888	RL30_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.192)		4	337_338	-	Breast(36;1.43e-06)		89_90					B2R591|P04645|Q502Z6	Frame_Shift_Del	DEL	ENST00000521291.1	37	c.267_268delCA	CCDS34928.1																																																																																				0.366	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380450.1			20	133	NA	NA	NA	NA	NA	20	133	---	---	---	---
FER1L6	654463	broad.mit.edu	37	8	125074159	125074159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:125074159delG	ENST00000522917.1	+	25	3420	c.3214delG	c.(3214-3216)gggfs	p.G1072fs	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Frame_Shift_Del_p.G1072fs|FER1L6-AS2_ENST00000601180.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1072	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAGAGCTTTTGGGAGGAGTAC	0.547																																							uc003yqw.2		NA																	0				ovary(5)|skin(5)|central_nervous_system(1)	11						c.(3214-3216)GGGfs		fer-1-like 6							100.0	103.0	102.0					8																	125074159		2013	4218	6231	SO:0001589	frameshift_variant	654463					integral to membrane		g.chr8:125074159delG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3214delG	8.37:g.125074159delG	ENSP00000428280:p.Gly1072fs		Somatic				uc003yqy.1_Intron	p.G1072fs	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		25	3420	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		1072			Cytoplasmic (Potential).|C2 4.			Frame_Shift_Del	DEL	ENST00000522917.1	37	c.3214delG	CCDS43767.1																																																																																				0.547	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		16	195	NA	NA	NA	NA	NA	16	195	---	---	---	---
