#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRDM16	63976	broad.mit.edu	37	1	3319367	3319367	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr1:3319367T>C	ENST00000270722.5	+	6	738	c.689T>C	c.(688-690)tTc>tCc	p.F230S	PRDM16_ENST00000441472.2_Missense_Mutation_p.F230S|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.F230S|PRDM16_ENST00000442529.2_Missense_Mutation_p.F230S|PRDM16_ENST00000511072.1_Missense_Mutation_p.F231S|PRDM16_ENST00000378398.3_Missense_Mutation_p.F231S|PRDM16_ENST00000514189.1_Missense_Mutation_p.F231S			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	230					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.F230S(2)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GAGCCCACGTTCCGCTGTGAC	0.627			T	EVI1	"""MDS, AML"""																																		uc001akf.2		NA		Dom	yes		1	1p36.23-p33	63976	T	PR domain containing 16			L	EVI1		MDS|AML		2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7						c.(688-690)TTC>TCC		PR domain containing 16 isoform 1							48.0	54.0	52.0					1																	3319367		2102	4218	6320	SO:0001583	missense	63976				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding	g.chr1:3319367T>C	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.689T>C	1.37:g.3319367T>C	ENSP00000270722:p.Phe230Ser		Somatic				PRDM16_uc001akc.2_Missense_Mutation_p.F230S|PRDM16_uc001akd.2_Missense_Mutation_p.F230S|PRDM16_uc001ake.2_Missense_Mutation_p.F230S|PRDM16_uc009vlh.2_5'UTR	p.F230S	NM_022114	NP_071397	WXS	Illumina HiSeq	Unspecified	Q9HAZ2	PRD16_HUMAN		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)	6	769	+	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)	230			C2H2-type 1; atypical.		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	c.689T>C	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	T	17.87	3.493963	0.64186	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	4.31	4.31	0.51392	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.125602	0.34110	U	0.004260	T	0.79046	0.4380	M	0.79343	2.45	0.36800	D	0.885326	D;P;P;B	0.64830	0.994;0.744;0.799;0.265	P;B;B;B	0.61658	0.892;0.288;0.23;0.101	D	0.85213	0.1022	10	0.87932	D	0	.	13.1141	0.59289	0.0:0.0:0.0:1.0	.	230;230;230;230	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	S	231;231;230;230;230;231;230;46;46;39	ENSP00000426975:F231S;ENSP00000367651:F231S;ENSP00000407968:F230S;ENSP00000405253:F230S;ENSP00000367643:F230S;ENSP00000421400:F231S;ENSP00000270722:F230S;ENSP00000422504:F46S;ENSP00000425796:F39S	ENSP00000270722:F230S	F	+	2	0	PRDM16	3309227	1.000000	0.71417	0.992000	0.48379	0.730000	0.41778	4.736000	0.62059	1.582000	0.49881	0.454000	0.30748	TTC		0.627	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114		21	73	0	0	0	0.016522	0	21	73				
PRAMEF11	440560	broad.mit.edu	37	1	12887399	12887399	+	Missense_Mutation	SNP	C	C	T	rs200799291	byFrequency	TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr1:12887399C>T	ENST00000535591.1	-	3	653	c.458G>A	c.(457-459)cGc>cAc	p.R153H		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	153					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						TCTGATATTGCGGAAGGGCAT	0.468													.|||	59	0.0117812	0.0015	0.0058	5008	,	,		23403	0.0188		0.008	False		,,,				2504	0.0266						uc001auk.2		NA																	0					0						c.(457-459)CGC>CAC		PRAME family member 11																																				SO:0001583	missense	440560							g.chr1:12887399C>T	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.458G>A	1.37:g.12887399C>T	ENSP00000439551:p.Arg153His		Somatic					p.R153H	NM_001146344	NP_001139816	WXS	Illumina HiSeq	Unspecified	O60813	PRA11_HUMAN			3	654	-			153						Missense_Mutation	SNP	ENST00000535591.1	37	c.458G>A	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	0.846	-0.740127	0.03088	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.00949	5.51;5.51	1.48	1.48	0.22813	.	1.189920	0.06091	N	0.663618	T	0.00356	0.0011	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44314	-0.9336	10	0.11485	T	0.65	.	3.4583	0.07523	0.0:0.2279:0.0:0.7721	.	153	O60813	PRA11_HUMAN	H	153;194;153	ENSP00000439551:R153H;ENSP00000391839:R153H	ENSP00000328783:R194H	R	-	2	0	PRAMEF11	12809986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.593000	0.05740	0.070000	0.16634	-0.724000	0.03597	CGC		0.468	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		142	438	0	0	0	0.01441	0	142	438				
NT5C1A	84618	broad.mit.edu	37	1	40126786	40126786	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr1:40126786G>A	ENST00000235628.1	-	5	705	c.706C>T	c.(706-708)Cat>Tat	p.H236Y		NM_032526.1	NP_115915.1	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	236					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|purine nucleobase metabolic process (GO:0006144)|purine nucleoside monophosphate catabolic process (GO:0009128)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)	15	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCCTTCTCATGCTCGAAGAAT	0.632																																							uc001cdq.1		NA																	0				ovary(1)	1						c.(706-708)CAT>TAT		5'-nucleotidase, cytosolic IA							107.0	103.0	104.0					1																	40126786		2203	4300	6503	SO:0001583	missense	84618				purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding	g.chr1:40126786G>A	AF331801	CCDS440.1	1p34.3-p33	2008-07-18			ENSG00000116981	ENSG00000116981			17819	protein-coding gene	gene with protein product	"""cytosolic 5' nucleotidase, type 1A"", ""AMP-specific 5'-NT"", ""cytosolic 5'-nucleotidase IA"""	610525				11133996, 11690631	Standard	NM_032526		Approved	CN-I, CN-IA, CN1A, CN1, MGC119199, MGC119201	uc001cdq.1	Q9BXI3	OTTHUMG00000009244	ENST00000235628.1:c.706C>T	1.37:g.40126786G>A	ENSP00000235628:p.His236Tyr		Somatic					p.H236Y	NM_032526	NP_115915	WXS	Illumina HiSeq	Unspecified	Q9BXI3	5NT1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		5	706	-	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	236					Q3SYB9|Q5TG98|Q9BWT8	Missense_Mutation	SNP	ENST00000235628.1	37	c.706C>T	CCDS440.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095746	0.76870	.	.	ENSG00000116981	ENST00000235628	.	.	.	5.19	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.55834	1.745	0.80722	D	1	B	0.28026	0.198	B	0.30716	0.119	T	0.54735	-0.8249	9	0.27785	T	0.31	0.1455	14.0356	0.64642	0.0733:0.0:0.9267:0.0	.	236	Q9BXI3	5NT1A_HUMAN	Y	236	.	ENSP00000235628:H236Y	H	-	1	0	NT5C1A	39899373	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.835000	0.99442	1.341000	0.45600	0.650000	0.86243	CAT		0.632	NT5C1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025626.1	NM_032526		6	220	0	0	0	0.001984	0	6	220				
AXDND1	126859	broad.mit.edu	37	1	179497498	179497498	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr1:179497498C>G	ENST00000367618.3	+	23	3034	c.2647C>G	c.(2647-2649)Cga>Gga	p.R883G		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	883	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						AAAACTCATTCGATTCATTGG	0.428																																							uc001gmo.2		NA																	0					0						c.(2647-2649)CGA>GGA		hypothetical protein LOC126859 isoform 1							114.0	101.0	105.0					1																	179497498		2203	4300	6503	SO:0001583	missense	126859							g.chr1:179497498C>G	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2647C>G	1.37:g.179497498C>G	ENSP00000356590:p.Arg883Gly		Somatic				C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.R809G|C1orf125_uc009wxh.2_RNA	p.R883G	NM_144696	NP_653297	WXS	Illumina HiSeq	Unspecified	Q5T1B0	AXDN1_HUMAN			23	2774	+			883			Glu-rich.		Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	c.2647C>G	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293998	0.23564	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000359183;ENST00000434088	T;T	0.23147	1.92;1.92	4.12	3.2	0.36748	.	0.086249	0.44483	D	0.000458	T	0.33352	0.0860	L	0.54323	1.7	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.53912	0.737;0.737	T	0.08411	-1.0723	10	0.87932	D	0	-12.7233	7.7481	0.28881	0.0:0.8841:0.0:0.1159	.	767;883	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	G	883;767;115;743	ENSP00000356590:R883G;ENSP00000391716:R743G	ENSP00000352107:R115G	R	+	1	2	AXDND1	177764121	0.107000	0.21998	0.849000	0.33467	0.841000	0.47740	0.244000	0.18124	1.081000	0.41110	0.655000	0.94253	CGA		0.428	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696		3	111	0	0	0	0.004672	0	3	111				
JMJD4	65094	broad.mit.edu	37	1	227921232	227921232	+	Silent	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr1:227921232G>C	ENST00000366758.3	-	4	842	c.843C>G	c.(841-843)ctC>ctG	p.L281L	JMJD4_ENST00000438896.2_Silent_p.L281L|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000315781.5_5'Flank|JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000480897.1_3'UTR|SNAP47_ENST00000366760.1_Intron	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	281	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.							p.L281L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GTGTGTCGCAGAGTGCTGGGG	0.657																																							uc001hrb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(841-843)CTC>CTG		jumonji domain containing 4 isoform 1							76.0	63.0	67.0					1																	227921232		2203	4300	6503	SO:0001819	synonymous_variant	65094							g.chr1:227921232G>C	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.843C>G	1.37:g.227921232G>C			Somatic				SNAP47_uc001hqz.2_Intron|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_5'Flank|SNAP47_uc001hre.2_5'Flank|SNAP47_uc001hrf.2_5'Flank|LOC100130093_uc001hqx.3_RNA|LOC100130093_uc001hqy.3_RNA|JMJD4_uc001hrc.2_Silent_p.L281L	p.L281L	NM_023007	NP_075383	WXS	Illumina HiSeq	Unspecified	Q9H9V9	JMJD4_HUMAN			4	843	-		Prostate(94;0.0885)	281			JmjC.		Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	37	c.843C>G	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	0.015	-1.542798	0.00934	.	.	ENSG00000081692	ENST00000438896	.	.	.	4.3	-0.13	0.13498	.	.	.	.	.	T	0.45357	0.1338	.	.	.	0.41774	D	0.989788	.	.	.	.	.	.	T	0.27297	-1.0078	4	.	.	.	-49.6164	4.2281	0.10590	0.3005:0.325:0.3745:0.0	.	.	.	.	C	274	.	.	S	-	2	0	JMJD4	225987855	0.014000	0.17966	0.006000	0.13384	0.000000	0.00434	-0.252000	0.08806	-0.105000	0.12132	-1.058000	0.02302	TCT		0.657	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007		6	59	0	0	0	0.004482	0	6	59				
ACBD5	91452	broad.mit.edu	37	10	27507108	27507108	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr10:27507108C>T	ENST00000375888.1	-	7	721	c.657G>A	c.(655-657)aaG>aaA	p.K219K	ACBD5_ENST00000375901.1_Silent_p.K101K|ACBD5_ENST00000375897.3_Intron|ACBD5_ENST00000375905.4_Silent_p.K175K|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000396271.3_Silent_p.K210K			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	219					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TCATCATTTTCTTATCTTTTA	0.353																																							uc010qdp.1		NA																	0					0						c.(628-630)AAG>AAA		acyl-Coenzyme A binding domain containing 5							124.0	122.0	123.0					10																	27507108		2203	4300	6503	SO:0001819	synonymous_variant	91452				transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding	g.chr10:27507108C>T	AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.657G>A	10.37:g.27507108C>T			Somatic				ACBD5_uc010qdm.1_Silent_p.K208K|ACBD5_uc010qdn.1_Silent_p.K101K|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Silent_p.K175K|ACBD5_uc001itp.2_Silent_p.K101K|ACBD5_uc001itq.2_Silent_p.K101K|ACBD5_uc001itr.1_5'UTR	p.K210K	NM_145698	NP_663736	WXS	Illumina HiSeq	Unspecified	Q5T8D3	ACBD5_HUMAN			7	821	-			219			Potential.		B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Silent	SNP	ENST00000375888.1	37	c.630G>A																																																																																					0.353	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698		5	190	0	0	0	0.001168	0	5	190				
IPMK	253430	broad.mit.edu	37	10	59986896	59986896	+	Missense_Mutation	SNP	T	T	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr10:59986896T>G	ENST00000373935.3	-	3	603	c.281A>C	c.(280-282)tAt>tCt	p.Y94S		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	94					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)	p.Y94S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						GTCAGCAGCATAAACCTGAAA	0.348																																							uc001jkb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(280-282)TAT>TCT		inositol polyphosphate multikinase							85.0	84.0	84.0					10																	59986896		2203	4300	6503	SO:0001583	missense	253430					nucleus	ATP binding|inositol trisphosphate 6-kinase activity	g.chr10:59986896T>G	AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.281A>C	10.37:g.59986896T>G	ENSP00000363046:p.Tyr94Ser		Somatic					p.Y94S	NM_152230	NP_689416	WXS	Illumina HiSeq	Unspecified	Q8NFU5	IPMK_HUMAN			3	604	-			94						Missense_Mutation	SNP	ENST00000373935.3	37	c.281A>C	CCDS7250.1	.	.	.	.	.	.	.	.	.	.	T	11.72	1.723610	0.30593	.	.	ENSG00000151151	ENST00000373935	T	0.13538	2.58	5.94	3.56	0.40772	.	0.298816	0.38548	N	0.001645	T	0.07728	0.0194	N	0.16368	0.405	0.38840	D	0.956043	B	0.18310	0.027	B	0.13407	0.009	T	0.30937	-0.9961	9	.	.	.	4.0716	9.218	0.37360	0.4239:0.0:0.0:0.5761	.	94	Q8NFU5	IPMK_HUMAN	S	94	ENSP00000363046:Y94S	.	Y	-	2	0	IPMK	59656902	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.899000	0.28417	0.469000	0.27268	0.528000	0.53228	TAT		0.348	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230		10	89	0	0	0	0.007413	0	10	89				
SAMD8	142891	broad.mit.edu	37	10	76910777	76910777	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr10:76910777G>C	ENST00000542569.1	+	2	594	c.491G>C	c.(490-492)gGa>gCa	p.G164A	SAMD8_ENST00000372690.3_Missense_Mutation_p.G227A|SAMD8_ENST00000372687.4_Missense_Mutation_p.G164A	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	164					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.G227A(1)|p.G164A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ATAGTATTTGGATTTACATCT	0.358																																							uc001jwx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(490-492)GGA>GCA		sterile alpha motif domain containing 8							55.0	52.0	53.0					10																	76910777		2203	4300	6503	SO:0001583	missense	142891				sphingomyelin biosynthetic process	integral to membrane		g.chr10:76910777G>C	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.491G>C	10.37:g.76910777G>C	ENSP00000438042:p.Gly164Ala		Somatic				SAMD8_uc001jwy.1_Missense_Mutation_p.G164A	p.G164A	NM_144660	NP_653261	WXS	Illumina HiSeq	Unspecified	Q96LT4	SAMD8_HUMAN			2	594	+	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)		164			Helical; (Potential).		Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	37	c.491G>C	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596728	0.66332	.	.	ENSG00000156671	ENST00000447533;ENST00000372690;ENST00000542569;ENST00000372687	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	M	0.63428	1.95	0.80722	D	1	D;P	0.63880	0.993;0.498	P;B	0.60789	0.879;0.196	T	0.01249	-1.1406	10	0.16896	T	0.51	-20.8945	19.8333	0.96644	0.0:0.0:1.0:0.0	.	164;164	Q96LT4-2;Q96LT4	.;SAMD8_HUMAN	A	164;227;164;164	ENSP00000391799:G164A;ENSP00000361775:G227A;ENSP00000438042:G164A;ENSP00000361772:G164A	ENSP00000361772:G164A	G	+	2	0	SAMD8	76580783	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	9.869000	0.99810	2.698000	0.92095	0.491000	0.48974	GGA		0.358	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660		5	94	0	0	0	0.014758	0	5	94				
MKI67	4288	broad.mit.edu	37	10	129903821	129903821	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr10:129903821C>T	ENST00000368654.3	-	13	6658	c.6283G>A	c.(6283-6285)Gat>Aat	p.D2095N	MKI67_ENST00000368653.3_Missense_Mutation_p.D1735N	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2095	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GTTTTGTCATCAGTTGTTGAT	0.498																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(6283-6285)GAT>AAT		antigen identified by monoclonal antibody Ki-67							311.0	302.0	305.0					10																	129903821		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129903821C>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6283G>A	10.37:g.129903821C>T	ENSP00000357643:p.Asp2095Asn		Somatic				MKI67_uc001lkf.2_Missense_Mutation_p.D1735N|MKI67_uc009yav.1_Missense_Mutation_p.D1670N|MKI67_uc009yaw.1_Missense_Mutation_p.D1245N	p.D2095N	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	6478	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2095			16 X 122 AA approximate repeats.		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.6283G>A	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345996	0.41599	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01304	5.06;5.03	4.32	0.287	0.15714	.	2.284800	0.01720	N	0.028204	T	0.01661	0.0053	L	0.31752	0.955	0.09310	N	1	B;B;B	0.31859	0.343;0.343;0.232	B;B;B	0.36464	0.225;0.225;0.112	T	0.45629	-0.9248	10	0.21540	T	0.41	.	3.7348	0.08507	0.0:0.5017:0.1856:0.3127	.	2094;1735;2095	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	N	2095;1735;2094	ENSP00000357643:D2095N;ENSP00000357642:D1735N	ENSP00000357642:D1735N	D	-	1	0	MKI67	129793811	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.072000	0.14617	0.185000	0.20105	-0.742000	0.03525	GAT		0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		8	509	0	0	0	0.004482	0	8	509				
CKAP5	9793	broad.mit.edu	37	11	46829658	46829658	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr11:46829658C>G	ENST00000529230.1	-	8	947	c.901G>C	c.(901-903)Gag>Cag	p.E301Q	CKAP5_ENST00000354558.3_Missense_Mutation_p.E301Q|CKAP5_ENST00000415402.1_Missense_Mutation_p.E301Q|CKAP5_ENST00000312055.5_Missense_Mutation_p.E301Q			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	301					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TCTACAGACTCCAGGGCCTCT	0.368																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	0				ovary(1)|skin(1)	2						c.(901-903)GAG>CAG		colonic and hepatic tumor over-expressed protein							217.0	228.0	224.0					11																	46829658		2201	4299	6500	SO:0001583	missense	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46829658C>G		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.901G>C	11.37:g.46829658C>G	ENSP00000432768:p.Glu301Gln		Somatic				CKAP5_uc009ylg.1_Missense_Mutation_p.E187Q|CKAP5_uc001ndj.1_Missense_Mutation_p.E301Q	p.E301Q	NM_001008938	NP_001008938	WXS	Illumina HiSeq	Unspecified	Q14008	CKAP5_HUMAN			8	1011	-			301					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.901G>C	CCDS31477.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.061753|5.061753	0.93846|0.93846	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558|ENST00000378629	T;T;T;T|.	0.39787|.	1.06;1.06;1.06;1.06|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73869|0.73869	0.3642|0.3642	L|L	0.56340|0.56340	1.77|1.77	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.993;0.993;1.0|.	D;D;D|.	0.76575|.	0.964;0.964;0.988|.	T|T	0.75485|0.75485	-0.3301|-0.3301	10|6	0.54805|0.87932	T|D	0.06|0	-1.9289|-1.9289	19.5041|19.5041	0.95108|0.95108	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	301;301;301|.	Q14008-3;Q14008-2;Q14008|.	.;.;CKAP5_HUMAN|.	Q|C	301|299	ENSP00000432768:E301Q;ENSP00000395302:E301Q;ENSP00000310227:E301Q;ENSP00000346566:E301Q|.	ENSP00000310227:E301Q|ENSP00000367895:W299C	E|W	-|-	1|3	0|0	CKAP5|CKAP5	46786234|46786234	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	7.818000|7.818000	0.86416|0.86416	2.614000|2.614000	0.88457|0.88457	0.561000|0.561000	0.74099|0.74099	GAG|TGG		0.368	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		6	471	0	0	0	0.001984	0	6	471				
CKAP5	9793	broad.mit.edu	37	11	46829676	46829676	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr11:46829676C>G	ENST00000529230.1	-	8	929	c.883G>C	c.(883-885)Gag>Cag	p.E295Q	CKAP5_ENST00000354558.3_Missense_Mutation_p.E295Q|CKAP5_ENST00000415402.1_Missense_Mutation_p.E295Q|CKAP5_ENST00000312055.5_Missense_Mutation_p.E295Q			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	295					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TCTTTTCTCTCTTGCCATTTT	0.363																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	0				ovary(1)|skin(1)	2						c.(883-885)GAG>CAG		colonic and hepatic tumor over-expressed protein							177.0	188.0	184.0					11																	46829676		2201	4299	6500	SO:0001583	missense	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46829676C>G		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.883G>C	11.37:g.46829676C>G	ENSP00000432768:p.Glu295Gln		Somatic				CKAP5_uc009ylg.1_Missense_Mutation_p.E181Q|CKAP5_uc001ndj.1_Missense_Mutation_p.E295Q	p.E295Q	NM_001008938	NP_001008938	WXS	Illumina HiSeq	Unspecified	Q14008	CKAP5_HUMAN			8	993	-			295					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.883G>C	CCDS31477.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.670967|4.670967	0.88348|0.88348	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558|ENST00000378629	T;T;T;T|.	0.65178|.	-0.14;-0.14;-0.14;-0.14|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85809|0.85809	0.5783|0.5783	M|M	0.90542|0.90542	3.125|3.125	0.80722|0.80722	D|D	1|1	D;D;P|.	0.67145|.	0.996;0.996;0.85|.	D;D;B|.	0.78314|.	0.991;0.991;0.432|.	D|D	0.88163|0.88163	0.2859|0.2859	10|6	0.41790|0.72032	T|D	0.15|0.01	-12.2963|-12.2963	19.5041|19.5041	0.95108|0.95108	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	295;295;295|.	Q14008-3;Q14008-2;Q14008|.	.;.;CKAP5_HUMAN|.	Q|N	295|293	ENSP00000432768:E295Q;ENSP00000395302:E295Q;ENSP00000310227:E295Q;ENSP00000346566:E295Q|.	ENSP00000310227:E295Q|ENSP00000367895:K293N	E|K	-|-	1|3	0|2	CKAP5|CKAP5	46786252|46786252	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.614000|2.614000	0.88457|0.88457	0.561000|0.561000	0.74099|0.74099	GAG|AAG		0.363	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		5	440	0	0	0	0.014758	0	5	440				
ATG16L2	89849	broad.mit.edu	37	11	72535874	72535874	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr11:72535874C>T	ENST00000321297.5	+	9	1121	c.983C>T	c.(982-984)gCt>gTt	p.A328V	ATG16L2_ENST00000534905.1_Intron	NM_033388.1	NP_203746.1	Q8NAA4	A16L2_HUMAN	autophagy related 16-like 2 (S. cerevisiae)	328					autophagy (GO:0006914)|negative stranded viral RNA replication (GO:0039689)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A328V(2)		breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	14			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			CCTACCCGGGCTCAGGATGTG	0.612																																							uc001otd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(982-984)GCT>GTT		ATG16 autophagy related 16-like 2							56.0	49.0	52.0					11																	72535874		2200	4293	6493	SO:0001583	missense	89849				autophagy|protein transport	cytoplasm	protein binding	g.chr11:72535874C>T	AK024423	CCDS31634.1	11q13.4	2014-02-12	2012-06-06		ENSG00000168010	ENSG00000168010		"""WD repeat domain containing"""	25464	protein-coding gene	gene with protein product			"""ATG16 autophagy related 16-like 2 (S. cerevisiae)"""			11214971	Standard	XM_005274378		Approved	FLJ00012, WDR80, ATG16B	uc001otd.3	Q8NAA4	OTTHUMG00000167961	ENST00000321297.5:c.983C>T	11.37:g.72535874C>T	ENSP00000326340:p.Ala328Val		Somatic				ATG16L2_uc010rrf.1_3'UTR|ATG16L2_uc001ote.2_Missense_Mutation_p.A222V|ATG16L2_uc009ytj.1_Intron|ATG16L2_uc001otf.2_Missense_Mutation_p.A83V|ATG16L2_uc001otg.2_Missense_Mutation_p.A62V|ATG16L2_uc009ytk.2_Missense_Mutation_p.A83V	p.A328V	NM_033388	NP_203746	WXS	Illumina HiSeq	Unspecified	Q8NAA4	A16L2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.73e-06)		9	1023	+			328					A5PL30|B2RPK5|Q658V4|Q6PID3|Q8NBG0	Missense_Mutation	SNP	ENST00000321297.5	37	c.983C>T	CCDS31634.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641448	0.29157	.	.	ENSG00000168010	ENST00000321297;ENST00000538973;ENST00000541367	T;T;T	0.80653	-1.4;-1.4;-1.4	4.82	2.89	0.33648	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	16.298900	0.01073	U	0.004858	T	0.73583	0.3605	L	0.28344	0.845	0.80722	D	1	B;B;B	0.14805	0.006;0.005;0.011	B;B;B	0.27887	0.009;0.019;0.084	T	0.55153	-0.8185	10	0.35671	T	0.21	.	6.6425	0.22917	0.0:0.7755:0.0:0.2245	.	222;48;328	Q8NAA4-2;Q9H7Q5;Q8NAA4	.;.;A16L2_HUMAN	V	328;159;159	ENSP00000326340:A328V;ENSP00000441989:A159V;ENSP00000437412:A159V	ENSP00000326340:A328V	A	+	2	0	ATG16L2	72213522	0.333000	0.24731	0.887000	0.34795	0.248000	0.25809	0.848000	0.27710	0.597000	0.29811	0.555000	0.69702	GCT		0.612	ATG16L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397305.1	NM_033388		12	47	0	0	0	0.016723	0	12	47				
INTS4	92105	broad.mit.edu	37	11	77618831	77618831	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr11:77618831G>A	ENST00000534064.1	-	16	1982	c.1948C>T	c.(1948-1950)Caa>Taa	p.Q650*	INTS4_ENST00000535943.1_Nonsense_Mutation_p.Q25*|AAMDC_ENST00000532481.1_Intron	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	650					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			AATTCAGATTGAAGTTCTCCA	0.408																																							uc001oys.2		NA																	0				ovary(2)	2						c.(1948-1950)CAA>TAA		integrator complex subunit 4							119.0	119.0	119.0					11																	77618831		2200	4292	6492	SO:0001587	stop_gained	92105				snRNA processing	integrator complex	protein binding	g.chr11:77618831G>A	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1948C>T	11.37:g.77618831G>A	ENSP00000434466:p.Gln650*		Somatic				C11orf67_uc001oyp.2_Intron|INTS4_uc001oyt.2_RNA	p.Q650*	NM_033547	NP_291025	WXS	Illumina HiSeq	Unspecified	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		16	1976	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		650					Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Nonsense_Mutation	SNP	ENST00000534064.1	37	c.1948C>T	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	G	36	5.733432	0.96865	.	.	ENSG00000149262	ENST00000534064;ENST00000535943	.	.	.	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-6.9168	17.3244	0.87243	0.0:0.0:1.0:0.0	.	.	.	.	X	650;25	.	ENSP00000434466:Q650X	Q	-	1	0	INTS4	77296479	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.294000	0.89934	2.497000	0.84241	0.655000	0.94253	CAA		0.408	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		4	89	0	0	0	0.00308	0	4	89				
TRPC6	7225	broad.mit.edu	37	11	101353717	101353717	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr11:101353717G>C	ENST00000344327.3	-	5	1897	c.1473C>G	c.(1471-1473)ttC>ttG	p.F491L	TRPC6_ENST00000532133.1_Missense_Mutation_p.F491L|TRPC6_ENST00000360497.4_Missense_Mutation_p.F436L|TRPC6_ENST00000348423.4_Missense_Mutation_p.F375L	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	491					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CCATCCATGAGAAGCAGGATG	0.403																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1471-1473)TTC>TTG		transient receptor potential cation channel,							182.0	156.0	165.0					11																	101353717		2203	4299	6502	SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101353717G>C	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1473C>G	11.37:g.101353717G>C	ENSP00000340913:p.Phe491Leu		Somatic				TRPC6_uc009ywy.2_Missense_Mutation_p.F375L|TRPC6_uc009ywz.1_Missense_Mutation_p.F436L	p.F491L	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	5	1898	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	491			Helical; (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	c.1473C>G	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448812	0.26074	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;D;T;T	0.98602	-1.02;-5.02;-0.9;-1.18	5.78	5.78	0.91487	.	0.096414	0.64402	D	0.000001	D	0.96706	0.8925	L	0.52905	1.665	0.51482	D	0.999922	P;P;P	0.49358	0.906;0.923;0.848	P;P;B	0.48454	0.539;0.578;0.338	D	0.95236	0.8347	10	0.05351	T	0.99	-9.7588	13.2413	0.59997	0.0724:0.0:0.9276:0.0	.	436;375;491	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	L	491;491;375;436	ENSP00000340913:F491L;ENSP00000435574:F491L;ENSP00000343672:F375L;ENSP00000353687:F436L	ENSP00000340913:F491L	F	-	3	2	TRPC6	100858927	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.849000	0.62882	2.733000	0.93635	0.591000	0.81541	TTC		0.403	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		4	211	0	0	0	0.009096	0	4	211				
RAD52	5893	broad.mit.edu	37	12	1022604	1022604	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:1022604G>C	ENST00000358495.3	-	12	1348	c.1210C>G	c.(1210-1212)Cat>Gat	p.H404D	RAD52_ENST00000535376.1_5'UTR|RAD52_ENST00000539046.1_Missense_Mutation_p.H327D|RAD52_ENST00000430095.2_Missense_Mutation_p.H404D	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	404					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			CTCTTCCTATGAGATTCCCAG	0.368								Homologous recombination																															uc001qis.1		NA																	0				central_nervous_system(1)	1						c.(1210-1212)CAT>GAT	Homologous_recombination	RAD52 homolog							178.0	168.0	171.0					12																	1022604		1827	4077	5904	SO:0001583	missense	5893				DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding	g.chr12:1022604G>C		CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.1210C>G	12.37:g.1022604G>C	ENSP00000351284:p.His404Asp		Somatic				RAD52_uc001qit.1_RNA|RAD52_uc010sdt.1_Missense_Mutation_p.H327D|RAD52_uc001qiu.1_Missense_Mutation_p.H404D	p.H404D	NM_134424	NP_602296	WXS	Illumina HiSeq	Unspecified	P43351	RAD52_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)		12	1324	-	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		404					Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Missense_Mutation	SNP	ENST00000358495.3	37	c.1210C>G	CCDS8507.2	.	.	.	.	.	.	.	.	.	.	G	11.12	1.544656	0.27563	.	.	ENSG00000002016	ENST00000358495;ENST00000430095;ENST00000539046	T;T;T	0.32515	1.87;1.87;1.45	4.71	-0.152	0.13407	.	0.612796	0.17495	N	0.172217	T	0.13756	0.0333	N	0.19112	0.55	0.09310	N	1	P	0.38922	0.651	B	0.32805	0.153	T	0.12630	-1.0540	10	0.42905	T	0.14	-15.5054	4.8573	0.13566	0.2918:0.3365:0.3717:0.0	.	404	P43351	RAD52_HUMAN	D	404;404;327	ENSP00000351284:H404D;ENSP00000387901:H404D;ENSP00000445245:H327D	ENSP00000351284:H404D	H	-	1	0	RAD52	892865	0.007000	0.16637	0.001000	0.08648	0.957000	0.61999	0.191000	0.17076	-0.094000	0.12374	0.561000	0.74099	CAT		0.368	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	NM_134424		6	262	0	0	0	0.001168	0	6	262				
Unknown	0	broad.mit.edu	37	12	9447488	9447488	+	IGR	SNP	C	C	T	rs75114985		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:9447488C>T								SNORA75 (8070 upstream) : RP13-735L24.1 (72571 downstream)																							GGAGGCCGAGCGGCTGGAGCA	0.622																																							uc010sgq.1		NA																	0					0						c.(478-480)CGG>TGG		SubName: Full=cDNA FLJ60032, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-);																																				SO:0001628	intergenic_variant	642846							g.chr12:9447488C>T																													12.37:g.9447488C>T			Somatic				LOC642846_uc010sgp.1_RNA|LOC642846_uc009zgn.1_Missense_Mutation_p.R10W|LOC642846_uc001qvo.2_Missense_Mutation_p.R10W	p.R160W			WXS	Illumina HiSeq	Unspecified					5	569	+									Missense_Mutation	SNP		37	c.478C>T																																																																																				0	0.622									3	7	0	0	0	0.014758	0	3	7				
CMAS	55907	broad.mit.edu	37	12	22208509	22208509	+	Missense_Mutation	SNP	G	G	A	rs199957467		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:22208509G>A	ENST00000229329.2	+	3	654	c.524G>A	c.(523-525)cGc>cAc	p.R175H		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	175					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GTTGTGAGACGCCATCAGTTT	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		17151	0.0		0.001	False		,,,				2504	0.0						uc001rfm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(523-525)CGC>CAC		cytidine monophospho-N-acetylneuraminic acid		G	HIS/ARG	0,4406		0,0,2203	125.0	117.0	120.0		524	4.7	1.0	12		120	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CMAS	NM_018686.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	175/435	22208509	1,13005	2203	4300	6503	SO:0001583	missense	55907				lipopolysaccharide biosynthetic process	nucleus	N-acylneuraminate cytidylyltransferase activity	g.chr12:22208509G>A	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.524G>A	12.37:g.22208509G>A	ENSP00000229329:p.Arg175His		Somatic				CMAS_uc001rfn.2_RNA	p.R175H	NM_018686	NP_061156	WXS	Illumina HiSeq	Unspecified	Q8NFW8	NEUA_HUMAN			3	603	+			175					Q96AX5|Q9NQZ0	Missense_Mutation	SNP	ENST00000229329.2	37	c.524G>A	CCDS8696.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.19	3.052188	0.55218	0.0	1.16E-4	ENSG00000111726	ENST00000229329;ENST00000538498	.	.	.	5.59	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.35341	1.055	0.42852	D	0.994086	P	0.35155	0.487	B	0.32980	0.156	T	0.32079	-0.9920	9	0.39692	T	0.17	-23.7323	11.086	0.48086	0.1427:0.0:0.8573:0.0	.	175	Q8NFW8	NEUA_HUMAN	H	175;16	.	ENSP00000229329:R175H	R	+	2	0	CMAS	22099776	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.780000	0.75063	2.633000	0.89246	0.591000	0.81541	CGC		0.323	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686		5	171	0	0	0	0.001984	0	5	171				
PKP2	5318	broad.mit.edu	37	12	32955458	32955458	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:32955458C>T	ENST00000070846.6	-	11	2202	c.2178G>A	c.(2176-2178)caG>caA	p.Q726Q	PKP2_ENST00000340811.4_Silent_p.Q682Q	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	726					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CACTTTCCTTCTGGACAACTG	0.453																																							uc001rlj.3		NA																	0				ovary(1)|pancreas(1)	2						c.(2176-2178)CAG>CAA		plakophilin 2 isoform 2b							133.0	121.0	125.0					12																	32955458		2203	4300	6503	SO:0001819	synonymous_variant	5318				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding	g.chr12:32955458C>T	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.2178G>A	12.37:g.32955458C>T			Somatic				PKP2_uc001rlk.3_Silent_p.Q682Q|PKP2_uc010skj.1_Silent_p.Q679Q	p.Q726Q	NM_004572	NP_004563	WXS	Illumina HiSeq	Unspecified	Q99959	PKP2_HUMAN			11	2293	-	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		726			ARM 6.		A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	ENST00000070846.6	37	c.2178G>A	CCDS8731.1																																																																																				0.453	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572		8	251	0	0	0	0.004482	0	8	251				
PLEKHG7	440107	broad.mit.edu	37	12	93135270	93135270	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:93135270A>G	ENST00000344636.3	+	4	287	c.103A>G	c.(103-105)Agc>Ggc	p.S35G	PLEKHG7_ENST00000549856.1_Missense_Mutation_p.S35G	NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	35	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						TCCCTAGACAAGCCTTGGTTT	0.403																																							uc001tcj.2		NA																	0				ovary(1)	1						c.(103-105)AGC>GGC		pleckstrin homology domain containing, family G							138.0	128.0	132.0					12																	93135270		2203	4300	6503	SO:0001583	missense	440107				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr12:93135270A>G	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.103A>G	12.37:g.93135270A>G	ENSP00000344961:p.Ser35Gly		Somatic					p.S35G	NM_001004330	NP_001004330	WXS	Illumina HiSeq	Unspecified	Q6ZR37	PKHG7_HUMAN			4	333	+			35			DH.		B2RNR7	Missense_Mutation	SNP	ENST00000344636.3	37	c.103A>G	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.295296	0.81025	.	.	ENSG00000187510	ENST00000344636	T	0.70282	-0.47	5.81	5.81	0.92471	Dbl homology (DH) domain (4);	0.038521	0.85682	D	0.000000	D	0.82688	0.5091	M	0.75777	2.31	0.51482	D	0.999928	D	0.76494	0.999	D	0.70227	0.968	D	0.84408	0.0564	10	0.62326	D	0.03	-13.5705	13.5174	0.61549	1.0:0.0:0.0:0.0	.	35	Q6ZR37	PKHG7_HUMAN	G	35	ENSP00000344961:S35G	ENSP00000344961:S35G	S	+	1	0	PLEKHG7	91659401	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.865000	0.62998	2.214000	0.71695	0.459000	0.35465	AGC		0.403	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330		4	228	0	0	0	0.009096	0	4	228				
N4BP2L1	90634	broad.mit.edu	37	13	32972777	32972777	+	IGR	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr13:32972777C>G	ENST00000380130.2	-	0	3046				BRCA2_ENST00000380152.3_Nonsense_Mutation_p.S3376*|BRCA2_ENST00000544455.1_Nonsense_Mutation_p.S3376*	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1									p.S3376*(2)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		CCCACCAGTTCAGAAGATTAT	0.413																																						Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA								D|Mis|N|F|S						breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		2	Substitution - Nonsense(2)		lung(2)	ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64						c.(10126-10128)TCA>TGA	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							74.0	75.0	74.0					13																	32972777		2203	4300	6503	SO:0001628	intergenic_variant	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome			cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32972777C>G	U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972777C>G		TCGA Ovarian(8;0.087)	Somatic					p.S3376*	NM_000059	NP_000050	WXS	Illumina HiSeq	Unspecified	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	27	10354	+		Lung SC(185;0.0262)	3376					A4QN21|Q5TBK0	Nonsense_Mutation	SNP	ENST00000380130.2	37	c.10127C>G	CCDS9345.2	.	.	.	.	.	.	.	.	.	.	C	51	17.647787	0.99890	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.72	5.72	0.89469	.	0.779521	0.11148	N	0.594421	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	10.166	0.42879	0.0:0.9059:0.0:0.0941	.	.	.	.	X	3376	.	ENSP00000369497:S3376X	S	+	2	0	BRCA2	31870777	0.007000	0.16637	0.008000	0.14137	0.035000	0.12851	1.638000	0.37165	2.704000	0.92352	0.467000	0.42956	TCA		0.413	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052818		5	91	0	0	0	0.014758	0	5	91				
PSME2	5721	broad.mit.edu	37	14	24614335	24614335	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:24614335C>A	ENST00000216802.5	-	6	931	c.292G>T	c.(292-294)Gag>Tag	p.E98*	PSME2_ENST00000471700.2_5'UTR|PSME2_ENST00000560410.1_Nonsense_Mutation_p.E87*|RNF31_ENST00000324103.6_5'Flank|RNF31_ENST00000559275.1_5'Flank	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)	98					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		AGGACTTTCTCATTCCCAGGG	0.507																																							uc001wmj.2		NA																	0					0						c.(292-294)GAG>TAG		proteasome activator subunit 2							159.0	160.0	160.0					14																	24614335		2203	4300	6503	SO:0001587	stop_gained	5721				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome activator complex		g.chr14:24614335C>A		CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.292G>T	14.37:g.24614335C>A	ENSP00000216802:p.Glu98*		Somatic				PSME2_uc001wmk.2_Nonsense_Mutation_p.E21*|RNF31_uc001wml.1_5'Flank|RNF31_uc001wmm.1_5'Flank|RNF31_uc001wmn.1_5'Flank|RNF31_uc010alg.1_5'Flank	p.E98*	NM_002818	NP_002809	WXS	Illumina HiSeq	Unspecified	Q9UL46	PSME2_HUMAN		GBM - Glioblastoma multiforme(265;0.00839)	6	357	-			98					Q15129	Nonsense_Mutation	SNP	ENST00000216802.5	37	c.292G>T	CCDS9614.1	.	.	.	.	.	.	.	.	.	.	C	40	8.203086	0.98704	.	.	ENSG00000100911	ENST00000216802	.	.	.	5.29	5.29	0.74685	.	0.111615	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-26.7102	14.4257	0.67215	0.0:1.0:0.0:0.0	.	.	.	.	X	98	.	ENSP00000216802:E98X	E	-	1	0	PSME2	23684175	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.586000	0.67503	2.459000	0.83118	0.655000	0.94253	GAG		0.507	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071918.3	NM_002818		7	335	1	0	0.00198382	0.001984	0.00208231	7	335				
IPO4	79711	broad.mit.edu	37	14	24648000	24648000	+	IGR	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:24648000G>A	ENST00000354464.6	-	0	3646				REC8_ENST00000311457.3_Missense_Mutation_p.E360K|REC8_ENST00000559919.1_Missense_Mutation_p.E360K	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		GCTACCCCCTGAACTACTGGG	0.582																																						NSCLC(139;1764 2537 12868 49041)	uc001wmr.2		NA																	0					0						c.(1081-1083)GAA>AAA		REC8 homolog							190.0	210.0	203.0					14																	24648000		1969	4145	6114	SO:0001628	intergenic_variant	9985				mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm		g.chr14:24648000G>A	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24648000G>A			Somatic				REC8_uc001wms.2_Missense_Mutation_p.E361K	p.E361K	NM_005132	NP_005123	WXS	Illumina HiSeq	Unspecified	O95072	REC8_HUMAN		GBM - Glioblastoma multiforme(265;0.00839)	16	1508	+			361			Glu-rich.		B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	c.1081G>A	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265129	0.59431	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.26223	1.75	5.18	4.26	0.50523	.	0.276018	0.33670	N	0.004674	T	0.23171	0.0560	L	0.36672	1.1	0.32719	N	0.510584	P;P	0.45957	0.869;0.793	P;B	0.45276	0.475;0.283	T	0.22730	-1.0208	10	0.27082	T	0.32	-5.5838	11.3632	0.49655	0.0:0.1826:0.8174:0.0	.	344;361	O95072-2;O95072	.;REC8_HUMAN	K	360;343	ENSP00000308699:E360K	ENSP00000308699:E360K	E	+	1	0	REC8	23717840	0.998000	0.40836	0.934000	0.37439	0.291000	0.27294	3.083000	0.50136	1.351000	0.45789	0.462000	0.41574	GAA		0.582	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658		8	559	0	0	0	0.004482	0	8	559				
TTLL5	23093	broad.mit.edu	37	14	76149969	76149969	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:76149969C>T	ENST00000298832.9	+	5	546	c.341C>T	c.(340-342)tCt>tTt	p.S114F	TTLL5_ENST00000286650.5_Missense_Mutation_p.S114F|TTLL5_ENST00000556977.1_Missense_Mutation_p.S114F|TTLL5_ENST00000557636.1_Missense_Mutation_p.S114F	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	114	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		CGCACCCTCTCTGAAGCACAA	0.468																																							uc001xrx.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(340-342)TCT>TTT		tubulin tyrosine ligase-like family, member 5							155.0	133.0	141.0					14																	76149969		2203	4300	6503	SO:0001583	missense	23093				protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity	g.chr14:76149969C>T	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.341C>T	14.37:g.76149969C>T	ENSP00000298832:p.Ser114Phe		Somatic				TTLL5_uc001xrw.1_Missense_Mutation_p.S114F|TTLL5_uc010ask.1_Missense_Mutation_p.S114F|TTLL5_uc001xrv.2_Missense_Mutation_p.S114F	p.S114F	NM_015072	NP_055887	WXS	Illumina HiSeq	Unspecified	Q6EMB2	TTLL5_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.029)	5	546	+			114			TTL.		B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	ENST00000298832.9	37	c.341C>T	CCDS32124.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464734	0.84425	.	.	ENSG00000119685	ENST00000557003;ENST00000556977;ENST00000557636;ENST00000286650;ENST00000298832	T;T;T	0.07800	3.94;3.16;4.03	5.53	5.53	0.82687	.	0.301114	0.37623	N	0.002011	T	0.10594	0.0259	L	0.27975	0.815	0.80722	D	1	B;B;P	0.44478	0.23;0.272;0.836	B;B;P	0.44477	0.064;0.105;0.451	T	0.03493	-1.1031	10	0.59425	D	0.04	.	18.2244	0.89913	0.0:1.0:0.0:0.0	.	114;114;114	G3V2J9;Q6EMB2;Q6EMB2-3	.;TTLL5_HUMAN;.	F	114	ENSP00000450713:S114F;ENSP00000286650:S114F;ENSP00000298832:S114F	ENSP00000286650:S114F	S	+	2	0	TTLL5	75219722	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.442000	0.59988	2.595000	0.87683	0.655000	0.94253	TCT		0.468	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072		4	188	0	0	0	0.009096	0	4	188				
KCNK13	56659	broad.mit.edu	37	14	90650993	90650993	+	Silent	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:90650993G>C	ENST00000282146.4	+	2	1314	c.873G>C	c.(871-873)ctG>ctC	p.L291L		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	291					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				ACTGGATCCTGAGGAAAATGG	0.537																																							uc001xye.1		NA																	0				skin(1)	1						c.(871-873)CTG>CTC		potassium channel, subfamily K, member 13							76.0	82.0	80.0					14																	90650993		2203	4300	6503	SO:0001819	synonymous_variant	56659					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:90650993G>C	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.873G>C	14.37:g.90650993G>C			Somatic					p.L291L	NM_022054	NP_071337	WXS	Illumina HiSeq	Unspecified	Q9HB14	KCNKD_HUMAN			2	1315	+		all_cancers(154;0.186)	291			Cytoplasmic (Potential).		B5TJL8|Q96E79	Silent	SNP	ENST00000282146.4	37	c.873G>C	CCDS9889.1																																																																																				0.537	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054		3	191	0	0	0	0.004672	0	3	191				
LGMN	5641	broad.mit.edu	37	14	93183754	93183754	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:93183754G>C	ENST00000393218.2	-	5	626	c.289C>G	c.(289-291)Cag>Gag	p.Q97E	LGMN_ENST00000557434.1_Missense_Mutation_p.Q97E|LGMN_ENST00000334869.4_Missense_Mutation_p.Q97E|LGMN_ENST00000555699.1_Missense_Mutation_p.Q97E	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	97					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		GGGACTCCCTGATAGACATCT	0.458																																							uc001yav.2		NA																	0				skin(1)	1						c.(289-291)CAG>GAG		legumain preproprotein							139.0	134.0	136.0					14																	93183754		2203	4300	6503	SO:0001583	missense	5641				hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity	g.chr14:93183754G>C	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.289C>G	14.37:g.93183754G>C	ENSP00000376911:p.Gln97Glu		Somatic				LGMN_uc001yat.2_Missense_Mutation_p.Q97E|LGMN_uc001yau.2_Missense_Mutation_p.Q97E|LGMN_uc001yaw.2_Missense_Mutation_p.Q97E|LGMN_uc010aul.2_Missense_Mutation_p.I6M|LGMN_uc001yax.2_Missense_Mutation_p.Q97E|LGMN_uc001yay.2_Missense_Mutation_p.Q97E	p.Q97E	NM_001008530	NP_001008530	WXS	Illumina HiSeq	Unspecified	Q99538	LGMN_HUMAN		COAD - Colon adenocarcinoma(157;0.224)	5	615	-		all_cancers(154;0.0706)	97					O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	ENST00000393218.2	37	c.289C>G	CCDS9904.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.025|0.025	-1.380639|-1.380639	0.01204|0.01204	.|.	.|.	ENSG00000100600|ENSG00000100600	ENST00000555169|ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000553802	.|T;T;T;T;T	.|0.39592	.|1.07;1.09;1.08;1.09;1.07	5.51|5.51	-7.73|-7.73	0.01245|0.01245	.|.	.|1.548580	.|0.03118	.|N	.|0.163415	T|T	0.14787|0.14787	0.0357|0.0357	N|N	0.02286|0.02286	-0.61|-0.61	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.09377	.|0.002;0.004;0.002	T|T	0.33137|0.33137	-0.9880|-0.9880	5|10	.|0.07175	.|T	.|0.84	-2.6366|-2.6366	9.7104|9.7104	0.40243|0.40243	0.0:0.2537:0.4694:0.2768|0.0:0.2537:0.4694:0.2768	.|.	.|97;97;97	.|Q99538;Q86TV2;Q86TV3	.|LGMN_HUMAN;.;.	M|E	17|97;97;97;97;97;97;74;88	.|ENSP00000451861:Q97E;ENSP00000334052:Q97E;ENSP00000452572:Q97E;ENSP00000376911:Q97E;ENSP00000450854:Q88E	.|ENSP00000262004:Q97E	I|Q	-|-	3|1	3|0	LGMN|LGMN	92253507|92253507	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.104000|0.104000	0.19210|0.19210	-1.181000|-1.181000	0.03085|0.03085	-1.231000|-1.231000	0.02557|0.02557	-0.266000|-0.266000	0.10368|0.10368	ATC|CAG		0.458	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606		4	231	0	0	0	0.009096	0	4	231				
HERC2P3	283755	broad.mit.edu	37	15	20644850	20644850	+	RNA	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr15:20644850G>A	ENST00000428453.1	-	0	3097							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.A803V(4)		central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CATGTCCCTCGCCCTTTCGGT	0.463																																							uc001ytg.2		NA																	4	Substitution - Missense(4)		lung(3)|endometrium(1)		NA						c.(2407-2409)GCG>GTG		RecName: Full=Putative HERC2-like protein 3;							116.0	62.0	82.0					15																	20644850		1509	2699	4208			0							g.chr15:20644850G>A	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644850G>A			Somatic				uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.A803V|uc010tyy.1_Missense_Mutation_p.A803V	p.A803V			WXS	Illumina HiSeq	Unspecified					21	3117	-									Missense_Mutation	SNP	ENST00000428453.1	37	c.2408C>T																																																																																					0.463	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269		3	43	0	0	0	0.004672	0	3	43				
LEO1	123169	broad.mit.edu	37	15	52258273	52258273	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr15:52258273C>T	ENST00000299601.5	-	2	547	c.487G>A	c.(487-489)Gat>Aat	p.D163N	LEO1_ENST00000315141.5_Missense_Mutation_p.D163N	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	163	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)		p.D163N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TCCTCATCATCAGAATTTTGT	0.413																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	uc002abo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(487-489)GAT>AAT		Leo1, Paf1/RNA polymerase II complex component,							210.0	212.0	211.0					15																	52258273		2195	4293	6488	SO:0001583	missense	123169				histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding	g.chr15:52258273C>T	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.487G>A	15.37:g.52258273C>T	ENSP00000299601:p.Asp163Asn		Somatic				LEO1_uc010bfd.2_Missense_Mutation_p.D163N	p.D163N	NM_138792	NP_620147	WXS	Illumina HiSeq	Unspecified	Q8WVC0	LEO1_HUMAN		all cancers(107;0.00264)	2	503	-			163			Asp-rich.		Q96N99	Missense_Mutation	SNP	ENST00000299601.5	37	c.487G>A	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577754	0.86645	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.59	5.59	0.84812	.	0.188375	0.46145	D	0.000317	T	0.65238	0.2672	L	0.27053	0.805	0.80722	D	1	D;D	0.63880	0.987;0.993	P;D	0.74674	0.811;0.984	T	0.62831	-0.6771	9	0.34782	T	0.22	.	17.7769	0.88511	0.0:1.0:0.0:0.0	.	163;163	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	N	163	.	ENSP00000299601:D163N	D	-	1	0	LEO1	50045565	1.000000	0.71417	0.932000	0.37286	0.816000	0.46133	7.205000	0.77881	2.627000	0.88993	0.655000	0.94253	GAT		0.413	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792		14	431	0	0	0	0.020292	0	14	431				
ICE2	79664	broad.mit.edu	37	15	60720680	60720680	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr15:60720680C>G	ENST00000261520.4	-	15	3002	c.2768G>C	c.(2767-2769)aGa>aCa	p.R923T	NARG2_ENST00000439632.1_Missense_Mutation_p.R786T	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						ACAAGGTATTCTTCCATGATG	0.398																																							uc002agp.2		NA																	0				ovary(1)|lung(1)	2						c.(2767-2769)AGA>ACA		NMDA receptor regulated 2 isoform a							129.0	123.0	125.0					15																	60720680		2203	4300	6503	SO:0001583	missense	79664					nucleus		g.chr15:60720680C>G																												ENST00000261520.4:c.2768G>C	15.37:g.60720680C>G	ENSP00000261520:p.Arg923Thr		Somatic				NARG2_uc002ago.2_Missense_Mutation_p.R786T	p.R923T	NM_024611	NP_078887	WXS	Illumina HiSeq	Unspecified	Q659A1	NARG2_HUMAN			15	3003	-			923						Missense_Mutation	SNP	ENST00000261520.4	37	c.2768G>C	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469815	0.84533	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.57	5.57	0.84162	NMDA receptor-regulated gene protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.61703	1.905	0.43874	D	0.996482	D	0.89917	1.0	D	0.91635	0.999	T	0.79045	-0.1964	9	0.87932	D	0	-22.3762	18.0954	0.89488	0.0:1.0:0.0:0.0	.	923	Q659A1	NARG2_HUMAN	T	923;786	.	ENSP00000261520:R923T	R	-	2	0	NARG2	58507972	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.801000	0.62532	2.784000	0.95788	0.585000	0.79938	AGA		0.398	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1			4	177	0	0	0	0.009096	0	4	177				
IFT140	9742	broad.mit.edu	37	16	1616277	1616277	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:1616277C>G	ENST00000426508.2	-	16	2149	c.1786G>C	c.(1786-1788)Gat>Cat	p.D596H	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	596					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				ATTTTGGAATCAGGGCTGTTG	0.507																																							uc002cmb.2		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1786-1788)GAT>CAT		intraflagellar transport 140							113.0	107.0	109.0					16																	1616277		2199	4300	6499	SO:0001583	missense	9742							g.chr16:1616277C>G	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1786G>C	16.37:g.1616277C>G	ENSP00000406012:p.Asp596His		Somatic				IFT140_uc002clz.2_Missense_Mutation_p.D247H	p.D596H	NM_014714	NP_055529	WXS	Illumina HiSeq	Unspecified	Q96RY7	IF140_HUMAN			16	2148	-		Hepatocellular(780;0.219)	596					A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	c.1786G>C	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673236	0.47781	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.77489	-1.1	5.29	4.34	0.51931	.	0.115441	0.64402	D	0.000020	D	0.87442	0.6178	M	0.82630	2.6	0.58432	D	0.999997	D;D	0.64830	0.99;0.994	P;D	0.65684	0.898;0.937	D	0.88825	0.3301	10	0.62326	D	0.03	.	13.7838	0.63097	0.0:0.9247:0.0:0.0753	.	596;321	Q96RY7;B4DR58	IF140_HUMAN;.	H	596	ENSP00000406012:D596H	ENSP00000380562:D596H	D	-	1	0	IFT140	1556278	1.000000	0.71417	0.545000	0.28153	0.550000	0.35303	5.290000	0.65661	1.238000	0.43771	-0.216000	0.12614	GAT		0.507	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714		4	183	0	0	0	0.009096	0	4	183				
NSMCE1	197370	broad.mit.edu	37	16	27245538	27245538	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:27245538C>G	ENST00000361439.4	-	4	406	c.307G>C	c.(307-309)Gag>Cag	p.E103Q		NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	103					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						AGTTCATTCTCTGCAAAATCC	0.433																																							uc002doi.1		NA																	0					0						c.(307-309)GAG>CAG		non-SMC element 1 homolog							151.0	144.0	146.0					16																	27245538		1917	4136	6053	SO:0001583	missense	197370				DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding	g.chr16:27245538C>G	AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.307G>C	16.37:g.27245538C>G	ENSP00000355077:p.Glu103Gln		Somatic				NSMCE1_uc002doj.1_RNA	p.E103Q	NM_145080	NP_659547	WXS	Illumina HiSeq	Unspecified	Q8WV22	NSE1_HUMAN			4	405	-			103					D3DWF6|Q9P045|Q9P049	Missense_Mutation	SNP	ENST00000361439.4	37	c.307G>C	CCDS10628.2	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709118	0.68615	.	.	ENSG00000169189	ENST00000361439	T	0.31247	1.5	5.76	4.81	0.61882	.	0.100812	0.64402	D	0.000002	T	0.31734	0.0806	L	0.35854	1.095	0.52501	D	0.999954	P	0.48162	0.906	P	0.50754	0.649	T	0.03157	-1.1066	10	0.15066	T	0.55	.	12.5106	0.56003	0.0:0.9195:0.0:0.0805	.	103	Q8WV22	NSE1_HUMAN	Q	103	ENSP00000355077:E103Q	ENSP00000355077:E103Q	E	-	1	0	NSMCE1	27153039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.541000	0.67212	1.426000	0.47256	0.655000	0.94253	GAG		0.433	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254577.3	NM_145080		4	191	0	0	0	0.009096	0	4	191				
KIF22	3835	broad.mit.edu	37	16	29816619	29816619	+	Silent	SNP	T	T	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:29816619T>C	ENST00000160827.4	+	14	2026	c.1986T>C	c.(1984-1986)tgT>tgC	p.C662C	KIF22_ENST00000400751.5_Silent_p.C594C|MAZ_ENST00000545521.1_5'Flank|MAZ_ENST00000562337.1_5'Flank|MAZ_ENST00000322945.6_5'Flank|KIF22_ENST00000569382.2_Silent_p.C608C|MAZ_ENST00000568544.1_5'Flank|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000568282.1_5'Flank|MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000561482.1_Silent_p.C594C	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	662					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)	p.C662C(2)		endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GCCAGCGCTGTGGCGCCTCCT	0.592																																							uc002dts.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1984-1986)TGT>TGC		kinesin family member 22							111.0	125.0	120.0					16																	29816619		2197	4295	6492	SO:0001819	synonymous_variant	3835				blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chr16:29816619T>C	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1986T>C	16.37:g.29816619T>C			Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Silent_p.C594C|KIF22_uc010vdw.1_Silent_p.C594C|KIF22_uc010bzf.2_Silent_p.C608C|KIF22_uc002dtt.1_3'UTR|KIF22_uc002frc.1_RNA|MAZ_uc002dtv.1_5'Flank|MAZ_uc010vdx.1_5'Flank|MAZ_uc002dtw.2_5'Flank|MAZ_uc002dtx.2_5'Flank|MAZ_uc002dty.2_5'Flank|MAZ_uc010bzg.2_5'Flank|MAZ_uc002dtz.1_5'Flank|MAZ_uc002dua.2_5'Flank|MAZ_uc010vdy.1_5'Flank	p.C662C	NM_007317	NP_015556	WXS	Illumina HiSeq	Unspecified	Q14807	KIF22_HUMAN			14	2010	+			662					B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Silent	SNP	ENST00000160827.4	37	c.1986T>C	CCDS10653.1																																																																																				0.592	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2			59	250	0	0	0	0.01441	0	59	250				
HEATR3	55027	broad.mit.edu	37	16	50112902	50112902	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:50112902G>A	ENST00000299192.7	+	7	1205	c.1014G>A	c.(1012-1014)agG>agA	p.R338R	HEATR3_ENST00000285767.4_Silent_p.R252R	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	338										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						GAGTCAGAAGGAAAACTTTCG	0.368																																							uc002efw.2		NA																	0				ovary(1)|skin(1)	2						c.(1012-1014)AGG>AGA		HEAT repeat containing 3							68.0	73.0	71.0					16																	50112902		2198	4299	6497	SO:0001819	synonymous_variant	55027						binding	g.chr16:50112902G>A	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1014G>A	16.37:g.50112902G>A			Somatic				HEATR3_uc002efx.2_Silent_p.R252R	p.R338R	NM_182922	NP_891552	WXS	Illumina HiSeq	Unspecified	Q7Z4Q2	HEAT3_HUMAN			7	1176	+			338					A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Silent	SNP	ENST00000299192.7	37	c.1014G>A	CCDS10739.1																																																																																				0.368	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922		4	169	0	0	0	0.009096	0	4	169				
NLRC5	84166	broad.mit.edu	37	16	57054780	57054780	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:57054780G>C	ENST00000262510.6	+	3	381	c.156G>C	c.(154-156)caG>caC	p.Q52H	NLRC5_ENST00000308149.7_Missense_Mutation_p.Q52H|NLRC5_ENST00000539144.1_Missense_Mutation_p.Q52H|NLRC5_ENST00000436936.1_Missense_Mutation_p.Q52H	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	52					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.Q52H(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				ACCCTGAACAGAGAGTCATCC	0.547																																							uc002ekk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|breast(1)	7						c.(154-156)CAG>CAC		nucleotide-binding oligomerization domains 27							110.0	93.0	99.0					16																	57054780		2198	4300	6498	SO:0001583	missense	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57054780G>C	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.156G>C	16.37:g.57054780G>C	ENSP00000262510:p.Gln52His		Somatic				NLRC5_uc010ccq.1_RNA	p.Q52H	NM_032206	NP_115582	WXS	Illumina HiSeq	Unspecified	Q86WI3	NLRC5_HUMAN			3	381	+		all_neural(199;0.225)	52					B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	c.156G>C	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.838857	0.51057	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000544641;ENST00000539144	T;T;T;T	0.74632	-0.67;-0.69;-0.86;-0.69	4.45	4.45	0.53987	.	.	.	.	.	T	0.79197	0.4405	M	0.67953	2.075	0.09310	N	1	P	0.48911	0.917	P	0.51487	0.671	T	0.71497	-0.4575	9	0.72032	D	0.01	.	11.732	0.51744	0.0892:0.0:0.9108:0.0	.	52	Q86WI3	NLRC5_HUMAN	H	52	ENSP00000262510:Q52H;ENSP00000308886:Q52H;ENSP00000389739:Q52H;ENSP00000441727:Q52H	ENSP00000262510:Q52H	Q	+	3	2	NLRC5	55612281	0.074000	0.21230	0.025000	0.17156	0.014000	0.08584	1.150000	0.31639	2.023000	0.59567	0.455000	0.32223	CAG		0.547	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		4	99	0	0	0	0.014758	0	4	99				
GLG1	2734	broad.mit.edu	37	16	74496473	74496473	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr16:74496473G>T	ENST00000422840.2	-	21	2846	c.2847C>A	c.(2845-2847)ttC>ttA	p.F949L	Y_RNA_ENST00000384794.1_RNA|GLG1_ENST00000447066.2_Missense_Mutation_p.F938L|GLG1_ENST00000205061.5_Missense_Mutation_p.F949L	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	949					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.F949L(2)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TACCGTGACAGAATTTAGGAA	0.433																																							uc002fcy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(2845-2847)TTC>TTA		golgi apparatus protein 1 isoform 3							104.0	98.0	100.0					16																	74496473		2198	4300	6498	SO:0001583	missense	2734					Golgi membrane|integral to membrane	receptor binding	g.chr16:74496473G>T		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2847C>A	16.37:g.74496473G>T	ENSP00000405984:p.Phe949Leu		Somatic				GLG1_uc002fcx.2_Missense_Mutation_p.F949L|GLG1_uc002fcw.3_Missense_Mutation_p.F938L|GLG1_uc002fcz.3_Missense_Mutation_p.F366L	p.F949L	NM_001145667	NP_001139139	WXS	Illumina HiSeq	Unspecified	Q92896	GSLG1_HUMAN			21	2897	-			949			Cys-rich GLG1 14.|Extracellular (Potential).		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	c.2847C>A	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	G	34	5.324162	0.95708	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.66	5.66	0.87406	.	0.045522	0.85682	D	0.000000	T	0.75744	0.3891	L	0.46157	1.445	0.80722	D	1	D;P;B;P	0.76494	0.999;0.95;0.383;0.587	D;P;B;P	0.85130	0.997;0.835;0.348;0.479	T	0.75628	-0.3252	9	0.56958	D	0.05	-18.6459	19.736	0.96205	0.0:0.0:1.0:0.0	.	79;949;949;938	Q6ZMF1;Q92896;Q92896-2;B7Z8Y4	.;GSLG1_HUMAN;.;.	L	949;938;949	.	ENSP00000205061:F949L	F	-	3	2	GLG1	73053974	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.838000	0.62803	2.669000	0.90835	0.591000	0.81541	TTC		0.433	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		29	91	1	0	4.59853e-10	0.005443	4.93176e-10	29	91				
PLD2	5338	broad.mit.edu	37	17	4719995	4719995	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:4719995C>G	ENST00000263088.6	+	15	1667	c.1536C>G	c.(1534-1536)agC>agG	p.S512R	PLD2_ENST00000572940.1_Missense_Mutation_p.S512R	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	512	Catalytic.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.S512R(4)		autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	AGGACTACAGCAATCTTATCA	0.607																																							uc002fzc.2		NA																	4	Substitution - Missense(4)		lung(4)	breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(1534-1536)AGC>AGG		phospholipase D2	Choline(DB00122)						143.0	135.0	138.0					17																	4719995		2203	4300	6503	SO:0001583	missense	5338				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity	g.chr17:4719995C>G	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1536C>G	17.37:g.4719995C>G	ENSP00000263088:p.Ser512Arg		Somatic				PLD2_uc010vsj.1_Missense_Mutation_p.S369R|PLD2_uc002fzd.2_Missense_Mutation_p.S512R	p.S512R	NM_002663	NP_002654	WXS	Illumina HiSeq	Unspecified	O14939	PLD2_HUMAN			15	1637	+			512			Catalytic.		I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	ENST00000263088.6	37	c.1536C>G	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498095	0.64186	.	.	ENSG00000129219	ENST00000263088	T	0.08102	3.13	4.62	3.65	0.41850	.	0.126160	0.64402	N	0.000001	T	0.25005	0.0607	M	0.90977	3.165	0.58432	D	0.999999	P;P;P	0.43826	0.818;0.702;0.74	B;P;B	0.50490	0.277;0.642;0.342	T	0.04090	-1.0978	10	0.52906	T	0.07	-29.3643	10.5117	0.44866	0.0:0.9037:0.0:0.0963	.	369;512;512	B7Z905;O14939-2;O14939	.;.;PLD2_HUMAN	R	512	ENSP00000263088:S512R	ENSP00000263088:S512R	S	+	3	2	PLD2	4666961	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.871000	0.48459	1.164000	0.42652	-0.258000	0.10820	AGC		0.607	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663		45	141	0	0	0	0.013114	0	45	141				
MYO18A	399687	broad.mit.edu	37	17	27413574	27413574	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:27413574C>G	ENST00000527372.1	-	39	5914	c.5734G>C	c.(5734-5736)Gag>Cag	p.E1912Q	MYO18A_ENST00000354329.4_Missense_Mutation_p.E1912Q|MYO18A_ENST00000533112.1_Missense_Mutation_p.E1875Q|MYO18A_ENST00000531253.1_Missense_Mutation_p.E1912Q|MYO18A_ENST00000529578.1_5'UTR|TIAF1_ENST00000408971.2_5'UTR	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1912					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.E1912Q(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TTAGCAGCCTCCAGGCTTTCT	0.557																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	Esophageal Squamous(182;472 2015 7001 15270 22562)	uc002hdt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(5734-5736)GAG>CAG		myosin 18A isoform a							35.0	34.0	34.0					17																	27413574		1955	4140	6095	SO:0001583	missense	399687				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity	g.chr17:27413574C>G	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5734G>C	17.37:g.27413574C>G	ENSP00000437073:p.Glu1912Gln		Somatic				MYO18A_uc010wbc.1_Missense_Mutation_p.E1445Q|MYO18A_uc002hds.2_Missense_Mutation_p.E1454Q|MYO18A_uc010csa.1_Missense_Mutation_p.E1875Q|MYO18A_uc002hdu.1_Missense_Mutation_p.E1912Q	p.E1912Q	NM_078471	NP_510880	WXS	Illumina HiSeq	Unspecified	Q92614	MY18A_HUMAN	Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		39	5892	-			1912			Potential.		Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	c.5734G>C	CCDS45642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.338428|5.338428	0.95783|0.95783	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105|ENST00000527859	D;D;D;D|.	0.89050|.	-2.38;-2.46;-2.37;-2.38|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68705|0.68705	0.3030|0.3030	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.987;0.998;0.999;0.998|.	P;D;D;P|.	0.80764|.	0.821;0.994;0.93;0.889|.	T|T	0.62506|0.62506	-0.6840|-0.6840	10|5	0.12430|.	T|.	0.62|.	.|.	20.0086|20.0086	0.97443|0.97443	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1515;1875;1912;1912|.	F8W6Y3;Q92614-3;Q92614-4;Q92614|.	.;.;.;MY18A_HUMAN|.	Q|C	1912;1875;1875;1912;1912;808;808;1515;193|174	ENSP00000346291:E1912Q;ENSP00000435932:E1875Q;ENSP00000434228:E1912Q;ENSP00000437073:E1912Q|.	ENSP00000346291:E1912Q|.	E|W	-|-	1|3	0|0	MYO18A|MYO18A	24437700|24437700	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.210000|7.210000	0.77924|0.77924	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GAG|TGG		0.557	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		3	49	0	0	0	0.009096	0	3	49				
WIPF2	147179	broad.mit.edu	37	17	38430162	38430162	+	Nonsense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:38430162C>G	ENST00000323571.4	+	6	1331	c.1091C>G	c.(1090-1092)tCa>tGa	p.S364*	WIPF2_ENST00000394103.3_Nonsense_Mutation_p.S106*|WIPF2_ENST00000536600.1_Nonsense_Mutation_p.S106*|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Nonsense_Mutation_p.S364*|WIPF2_ENST00000583130.1_Nonsense_Mutation_p.S364*	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	364					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						CCTCCACCCTCAAGGACGCCA	0.622										HNSCC(43;0.11)																													uc002hug.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(1090-1092)TCA>TGA		WIRE protein							93.0	83.0	86.0					17																	38430162		2203	4300	6503	SO:0001587	stop_gained	147179					cytoplasm|cytoskeleton	actin binding	g.chr17:38430162C>G	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.1091C>G	17.37:g.38430162C>G	ENSP00000320924:p.Ser364*	HNSCC(43;0.11)	Somatic				WIPF2_uc002huh.1_Nonsense_Mutation_p.S214*|WIPF2_uc010cww.1_Nonsense_Mutation_p.S214*|WIPF2_uc002hui.1_Nonsense_Mutation_p.S364*|WIPF2_uc010cwx.1_Nonsense_Mutation_p.S106*|WIPF2_uc010cwy.1_Nonsense_Mutation_p.S364*	p.S364*	NM_133264	NP_573571	WXS	Illumina HiSeq	Unspecified	Q8TF74	WIPF2_HUMAN			6	1331	+			364					A8K0L3|Q658J8|Q71RE1|Q8TE44	Nonsense_Mutation	SNP	ENST00000323571.4	37	c.1091C>G	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	C	39	7.332280	0.98217	.	.	ENSG00000171475	ENST00000323571;ENST00000394103;ENST00000536600	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-15.1649	18.9492	0.92635	0.0:1.0:0.0:0.0	.	.	.	.	X	364;106;106	.	ENSP00000320924:S364X	S	+	2	0	WIPF2	35683688	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	4.157000	0.58144	2.646000	0.89796	0.561000	0.74099	TCA		0.622	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264		4	169	0	0	0	0.001984	0	4	169				
KRT15	3866	broad.mit.edu	37	17	39675033	39675033	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:39675033C>T	ENST00000254043.3	-	1	3632	c.47G>A	c.(46-48)gGc>gAc	p.G16D	KRT15_ENST00000393974.3_5'UTR|KRT15_ENST00000393981.3_5'Flank|KRT15_ENST00000393976.2_Missense_Mutation_p.G16D	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	16	Gly-rich.|Head.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				TCGGGTTGAGCCACCCCCAAA	0.597																																							uc002hwy.2		NA																	0					0						c.(46-48)GGC>GAC		keratin 15							57.0	70.0	65.0					17																	39675033		2202	4294	6496	SO:0001583	missense	3866				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39675033C>T		CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.47G>A	17.37:g.39675033C>T	ENSP00000254043:p.Gly16Asp		Somatic				KRT15_uc002hwz.2_5'UTR|KRT15_uc002hxa.2_5'UTR|KRT15_uc002hxb.1_Intron	p.G16D	NM_002275	NP_002266	WXS	Illumina HiSeq	Unspecified	P19012	K1C15_HUMAN			1	238	-		Breast(137;0.000286)	16			Gly-rich.|Head.		B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	ENST00000254043.3	37	c.47G>A	CCDS11398.1	.	.	.	.	.	.	.	.	.	.	C	9.621	1.133961	0.21123	.	.	ENSG00000171346	ENST00000254043;ENST00000393976	D;D	0.94931	-3.56;-3.56	4.79	2.72	0.32119	.	0.515673	0.16313	N	0.219904	D	0.86924	0.6050	N	0.22421	0.69	0.58432	D	0.999994	P	0.38195	0.622	B	0.31686	0.134	T	0.83125	-0.0116	10	0.72032	D	0.01	.	7.1433	0.25568	0.0:0.5692:0.3173:0.1135	.	16	P19012	K1C15_HUMAN	D	16	ENSP00000254043:G16D;ENSP00000377546:G16D	ENSP00000254043:G16D	G	-	2	0	KRT15	36928559	0.001000	0.12720	0.873000	0.34254	0.157000	0.22087	0.110000	0.15437	0.580000	0.29522	0.511000	0.50034	GGC		0.597	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257301.1	NM_002275		4	217	0	0	0	0.009096	0	4	217				
ITGA2B	3674	broad.mit.edu	37	17	42453323	42453323	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:42453323C>T	ENST00000262407.5	-	25	2510	c.2479G>A	c.(2479-2481)Ggt>Agt	p.G827S	ITGA2B_ENST00000353281.4_Missense_Mutation_p.G827S	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	827					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.G827S(1)		biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	AGGTGAAGACCATTCACAGTC	0.622											OREG0024460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002igt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(2479-2481)GGT>AGT		integrin alpha 2b preproprotein	Tirofiban(DB00775)						74.0	75.0	75.0					17																	42453323		2203	4300	6503	SO:0001583	missense	3674				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity	g.chr17:42453323C>T		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2479G>A	17.37:g.42453323C>T	ENSP00000262407:p.Gly827Ser		Somatic	OREG0024460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	908	ITGA2B_uc002igu.1_Missense_Mutation_p.G308S	p.G827S	NM_000419	NP_000410	WXS	Illumina HiSeq	Unspecified	P08514	ITA2B_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.191)	25	2511	-		Prostate(33;0.0181)	827			Extracellular (Potential).		B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	c.2479G>A	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827375	0.50845	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.42900	0.96;0.96	4.58	4.58	0.56647	Integrin alpha-2 (1);	0.000000	0.35708	N	0.003029	T	0.59252	0.2180	M	0.70275	2.135	0.32159	N	0.583142	D;D	0.76494	0.978;0.999	P;D	0.68943	0.8;0.961	T	0.64558	-0.6379	10	0.30078	T	0.28	.	12.7169	0.57119	0.0:1.0:0.0:0.0	.	425;827	Q59FA8;P08514	.;ITA2B_HUMAN	S	827	ENSP00000262407:G827S;ENSP00000340536:G827S	ENSP00000262407:G827S	G	-	1	0	ITGA2B	39808849	0.782000	0.28689	0.052000	0.19188	0.562000	0.35680	2.960000	0.49161	2.372000	0.80975	0.561000	0.74099	GGT		0.622	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1			4	67	0	0	0	0.009096	0	4	67				
RNF213	57674	broad.mit.edu	37	17	78321357	78321357	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:78321357C>T	ENST00000582970.1	+	29	9365	c.9222C>T	c.(9220-9222)ttC>ttT	p.F3074F	RNF213_ENST00000508628.2_Silent_p.F3123F|RNF213_ENST00000336301.6_Silent_p.F1147F	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3074					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTTCTGGTTTCCCCAAGGACC	0.502																																							uc002jyh.1		NA																	0				ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(3439-3441)TTC>TTT		ring finger protein 213							75.0	75.0	75.0					17																	78321357		2203	4300	6503	SO:0001819	synonymous_variant	57674							g.chr17:78321357C>T	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9222C>T	17.37:g.78321357C>T			Somatic					p.F1147F	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	3664	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	c.3441C>T	CCDS58606.1																																																																																				0.502	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		6	209	0	0	0	0.001984	0	6	209				
ANKRD12	23253	broad.mit.edu	37	18	9275652	9275652	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr18:9275652C>T	ENST00000262126.4	+	11	6134	c.5894C>T	c.(5893-5895)cCa>cTa	p.P1965L	ANKRD12_ENST00000400020.3_Missense_Mutation_p.P1942L|ANKRD12_ENST00000383440.2_Missense_Mutation_p.P1942L|snoU13_ENST00000459594.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1965						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P1965L(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TACAATGTACCATTGGACTCT	0.358																																							uc002knv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(5893-5895)CCA>CTA		ankyrin repeat domain 12 isoform 1							151.0	137.0	141.0					18																	9275652		2203	4300	6503	SO:0001583	missense	23253					nucleus		g.chr18:9275652C>T	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5894C>T	18.37:g.9275652C>T	ENSP00000262126:p.Pro1965Leu		Somatic				ANKRD12_uc002knw.2_Missense_Mutation_p.P1942L|ANKRD12_uc002knx.2_Missense_Mutation_p.P1942L	p.P1965L	NM_015208	NP_056023	WXS	Illumina HiSeq	Unspecified	Q6UB98	ANR12_HUMAN			11	6151	+			1965					O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	c.5894C>T	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	C	32	5.177592	0.94846	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.67865	-0.29;-0.29	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.79787	0.4506	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.80256	-0.1458	10	0.87932	D	0	-10.1851	20.0011	0.97409	0.0:1.0:0.0:0.0	.	1942;1965	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	L	1942;1965	ENSP00000372932:P1942L;ENSP00000262126:P1965L	ENSP00000262126:P1965L	P	+	2	0	ANKRD12	9265652	1.000000	0.71417	0.917000	0.36280	0.980000	0.70556	7.792000	0.85828	2.727000	0.93392	0.585000	0.79938	CCA		0.358	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		42	154	0	0	0	0.010771	0	42	154				
TWSG1	57045	broad.mit.edu	37	18	9396396	9396396	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr18:9396396G>A	ENST00000262120.5	+	4	533	c.342G>A	c.(340-342)ttG>ttA	p.L114L	TWSG1_ENST00000581641.1_Silent_p.L114L	NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	114					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						ATACTCAGTTGAATTGGAACA	0.448																																							uc002knz.2		NA																	0				ovary(1)|pancreas(1)	2						c.(340-342)TTG>TTA		twisted gastrulation precursor							127.0	120.0	122.0					18																	9396396		2203	4300	6503	SO:0001819	synonymous_variant	57045							g.chr18:9396396G>A	AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.342G>A	18.37:g.9396396G>A			Somatic				TWSG1_uc002koa.2_Silent_p.L39L	p.L114L	NM_020648	NP_065699	WXS	Illumina HiSeq	Unspecified	Q9GZX9	TWSG1_HUMAN			4	533	+			114					B2RE08|D3DUH9|Q8NBI7|Q96K46	Silent	SNP	ENST00000262120.5	37	c.342G>A	CCDS11844.1																																																																																				0.448	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2			5	234	0	0	0	0.014758	0	5	234				
MC5R	4161	broad.mit.edu	37	18	13826656	13826656	+	Missense_Mutation	SNP	C	C	T	rs201991586		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr18:13826656C>T	ENST00000324750.3	+	1	1114	c.892C>T	c.(892-894)Cgc>Tgc	p.R298C	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	298					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)	p.R298C(2)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						ATATGCCTTCCGCAGCCAAGA	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22191	0.0		0.0	False		,,,				2504	0.0						uc010xaf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|breast(1)	6						c.(892-894)CGC>TGC		melanocortin 5 receptor							123.0	122.0	122.0					18																	13826656		2203	4300	6503	SO:0001583	missense	4161				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding	g.chr18:13826656C>T	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.892C>T	18.37:g.13826656C>T	ENSP00000318077:p.Arg298Cys		Somatic					p.R298C	NM_005913	NP_005904	WXS	Illumina HiSeq	Unspecified	P33032	MC5R_HUMAN			1	892	+			298			Cytoplasmic (Potential).		B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	c.892C>T	CCDS11868.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	9.114	1.007196	0.19199	.	.	ENSG00000176136	ENST00000324750	T	0.40476	1.03	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	M	0.80332	2.49	0.80722	D	1	B	0.31174	0.311	B	0.20955	0.032	T	0.57551	-0.7792	10	0.87932	D	0	.	17.7216	0.88353	0.0:1.0:0.0:0.0	.	298	P33032	MC5R_HUMAN	C	298	ENSP00000318077:R298C	ENSP00000318077:R298C	R	+	1	0	MC5R	13816656	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	2.271000	0.43364	2.246000	0.74042	0.305000	0.20034	CGC		0.483	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913		55	178	0	0	0	0.01441	0	55	178				
NETO1	81832	broad.mit.edu	37	18	70416305	70416305	+	Silent	SNP	A	A	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr18:70416305A>G	ENST00000327305.6	-	10	2217	c.1560T>C	c.(1558-1560)tcT>tcC	p.S520S	NETO1_ENST00000583169.1_Silent_p.S520S|NETO1_ENST00000299430.2_Silent_p.S519S|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	520					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.S520S(2)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GTTTGCTTAGAGACCCAATGA	0.343																																							uc002lkw.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(1558-1560)TCT>TCC		neuropilin- and tolloid-like protein 1 isoform 3							240.0	204.0	216.0					18																	70416305		2203	4300	6503	SO:0001819	synonymous_variant	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70416305A>G	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1560T>C	18.37:g.70416305A>G			Somatic				NETO1_uc002lkx.1_Silent_p.S519S|NETO1_uc002lky.1_Silent_p.S520S	p.S520S	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	10	1844	-		Esophageal squamous(42;0.129)	520			Cytoplasmic (Potential).		Q86W85|Q8ND78|Q8TDF4	Silent	SNP	ENST00000327305.6	37	c.1560T>C	CCDS12000.1																																																																																				0.343	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		34	168	0	0	0	0.007835	0	34	168				
CACTIN	58509	broad.mit.edu	37	19	3612168	3612168	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:3612168T>A	ENST00000429344.2	-	10	2082	c.2030A>T	c.(2029-2031)aAg>aTg	p.K677M	CACTIN_ENST00000221899.3_Missense_Mutation_p.K609M|CACTIN_ENST00000248420.5_Missense_Mutation_p.K677M|CACTIN-AS1_ENST00000592274.1_RNA	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	677					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K609M(1)|p.K677M(1)									GATGTTGAACTTGTATCCCTG	0.572																																							uc002lyh.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2029-2031)AAG>ATG		chromosome 19 open reading frame 29							149.0	168.0	162.0					19																	3612168		2153	4248	6401	SO:0001583	missense	58509					catalytic step 2 spliceosome	protein binding	g.chr19:3612168T>A	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.2030A>T	19.37:g.3612168T>A	ENSP00000415078:p.Lys677Met		Somatic				C19orf29_uc010xho.1_Missense_Mutation_p.K136M|C19orf29_uc010dtn.2_Missense_Mutation_p.K525M|C19orf29_uc002lyi.3_Missense_Mutation_p.K677M|C19orf29_uc010dto.2_RNA	p.K677M	NM_001080543	NP_001074012	WXS	Illumina HiSeq	Unspecified	Q8WUQ7	CS029_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	10	2083	-		Hepatocellular(1079;0.137)	677					A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	c.2030A>T	CCDS45920.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.6|22.6	4.314762|4.314762	0.81358|0.81358	.|.	.|.	ENSG00000105298|ENSG00000226800	ENST00000429344;ENST00000248420;ENST00000221899|ENST00000447295	.|.	.|.	.|.	4.31|4.31	4.31|4.31	0.51392|0.51392	Cactin protein, cactus-binding domain, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79173|0.79173	0.4401|0.4401	M|M	0.89353|0.89353	3.025|3.025	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.83631|0.83631	0.0145|0.0145	9|6	0.87932|0.87932	D|D	0|0	.|.	12.7183|12.7183	0.57127|0.57127	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	677;677|.	Q8WUQ7-2;Q8WUQ7|.	.;CS029_HUMAN|.	M|H	677;677;609|147	.|.	ENSP00000221899:K609M|ENSP00000412459:L147H	K|L	-|+	2|2	0|0	C19orf29|C19orf29OS	3563168|3563168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.788000|0.788000	0.44548|0.44548	7.464000|7.464000	0.80887|0.80887	1.941000|1.941000	0.56285|0.56285	0.523000|0.523000	0.50628|0.50628	AAG|CTT		0.572	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2			8	265	0	0	0	0.00308	0	8	265				
ZNF558	148156	broad.mit.edu	37	19	8922322	8922322	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:8922322G>A	ENST00000601372.1	-	10	1555	c.844C>T	c.(844-846)Cac>Tac	p.H282Y	ZNF558_ENST00000301475.1_Missense_Mutation_p.H282Y|ZNF558_ENST00000444186.2_Missense_Mutation_p.H211Y			Q96NG5	ZN558_HUMAN	zinc finger protein 558	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H282Y(2)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						ATGCTATTGTGCCCAGTGAGA	0.453																																							uc002mkn.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(844-846)CAC>TAC		zinc finger protein 558							139.0	131.0	134.0					19																	8922322		2203	4300	6503	SO:0001583	missense	148156				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:8922322G>A	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.844C>T	19.37:g.8922322G>A	ENSP00000471277:p.His282Tyr		Somatic				ZNF558_uc010xkh.1_Missense_Mutation_p.H211Y|ZNF558_uc010dwg.1_Missense_Mutation_p.H282Y	p.H282Y	NM_144693	NP_653294	WXS	Illumina HiSeq	Unspecified	Q96NG5	ZN558_HUMAN			6	1074	-			282			C2H2-type 5.		A8K5F0|B7Z798	Missense_Mutation	SNP	ENST00000601372.1	37	c.844C>T	CCDS12208.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438239	0.83885	.	.	ENSG00000167785	ENST00000301475;ENST00000444186	D;D	0.86769	-2.17;-2.17	5.07	5.07	0.68467	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000344	D	0.95924	0.8673	H	0.97214	3.96	0.46823	D	0.999218	D	0.89917	1.0	D	0.91635	0.999	D	0.97195	0.9860	10	0.87932	D	0	-12.9584	15.9729	0.80034	0.0:0.0:1.0:0.0	.	282	Q96NG5	ZN558_HUMAN	Y	282;211	ENSP00000301475:H282Y;ENSP00000410703:H211Y	ENSP00000301475:H282Y	H	-	1	0	ZNF558	8783322	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	8.818000	0.91991	2.636000	0.89361	0.591000	0.81541	CAC		0.453	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693		65	221	0	0	0	0.01441	0	65	221				
EID2	163126	broad.mit.edu	37	19	40030139	40030139	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:40030139G>A	ENST00000390658.2	-	1	731	c.581C>T	c.(580-582)gCc>gTc	p.A194V		NM_153232.3	NP_694964.3			EP300 interacting inhibitor of differentiation 2											large_intestine(2)|lung(1)|urinary_tract(1)	4	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;3.2e-25)|all cancers(26;8.83e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			CTGATATTCGGCATCAAACGC	0.488																																							uc002oma.2		NA																	0					0						c.(580-582)GCC>GTC		CREBBP/EP300 inhibitor 2							127.0	128.0	127.0					19																	40030139		1980	4164	6144	SO:0001583	missense	163126				cell differentiation|muscle organ development|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|regulation of cell proliferation|SMAD protein complex assembly|transcription, DNA-dependent|transforming growth factor beta receptor complex assembly	nucleus	SMAD binding	g.chr19:40030139G>A	BC030137	CCDS12540.2	19q13.2	2008-10-24	2006-10-12	2006-10-12	ENSG00000176396	ENSG00000176396			28292	protein-coding gene	gene with protein product		609773	"""CREBBP/EP300 inhibitory protein 2"", ""CREBBP/EP300 inhibitor 2"""	CRI2		14585496	Standard	NM_153232		Approved	EID-2, MGC20452	uc002oma.3	Q8N6I1	OTTHUMG00000074073	ENST00000390658.2:c.581C>T	19.37:g.40030139G>A	ENSP00000375073:p.Ala194Val		Somatic					p.A194V	NM_153232	NP_694964	WXS	Illumina HiSeq	Unspecified	Q8N6I1	EID2_HUMAN	Epithelial(26;3.2e-25)|all cancers(26;8.83e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)		1	700	-	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		194						Missense_Mutation	SNP	ENST00000390658.2	37	c.581C>T	CCDS12540.2	.	.	.	.	.	.	.	.	.	.	.	12.25	1.882434	0.33255	.	.	ENSG00000176396	ENST00000390658;ENST00000539700	T	0.37235	1.21	3.72	2.68	0.31781	.	0.351923	0.20701	N	0.087280	T	0.32164	0.0820	L	0.53249	1.67	0.09310	N	1	P	0.39920	0.695	B	0.40375	0.327	T	0.21075	-1.0256	10	0.66056	D	0.02	.	6.545	0.22400	0.1357:0.0:0.8643:0.0	.	194	Q8N6I1	EID2_HUMAN	V	194;145	ENSP00000375073:A194V	ENSP00000375073:A194V	A	-	2	0	EID2	44721979	0.088000	0.21588	0.007000	0.13788	0.896000	0.52359	1.617000	0.36943	1.132000	0.42129	0.639000	0.83563	GCC		0.488	EID2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157251.1	NM_153232		4	232	0	0	0	0.001168	0	4	232				
RTN2	6253	broad.mit.edu	37	19	45998365	45998365	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:45998365C>G	ENST00000245923.4	-	2	302	c.67G>C	c.(67-69)Gat>Cat	p.D23H	RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000344680.4_Missense_Mutation_p.D23H|RTN2_ENST00000589384.1_5'UTR|PPM1N_ENST00000396737.2_5'Flank|RTN2_ENST00000590526.1_5'UTR|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000456399.2_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	23					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.D23H(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		TCTGTGGAATCAGGAGTTGAG	0.547																																							uc002pcb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(67-69)GAT>CAT		reticulon 2 isoform A							85.0	84.0	84.0					19																	45998365		2203	4300	6503	SO:0001583	missense	6253					integral to endoplasmic reticulum membrane	signal transducer activity	g.chr19:45998365C>G	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.67G>C	19.37:g.45998365C>G	ENSP00000245923:p.Asp23His		Somatic				RTN2_uc002pcc.2_Missense_Mutation_p.D23H|RTN2_uc002pcd.2_RNA	p.D23H	NM_005619	NP_005610	WXS	Illumina HiSeq	Unspecified	O75298	RTN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)	2	295	-		Ovarian(192;0.051)|all_neural(266;0.112)	23					O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	c.67G>C	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.982080	0.53827	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.70749	-0.49;-0.51	5.01	5.01	0.66863	.	0.000000	0.53938	D	0.000051	T	0.76456	0.3990	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.78513	-0.2175	10	0.87932	D	0	-21.6167	13.6897	0.62537	0.0:1.0:0.0:0.0	.	23;23	O75298-2;O75298	.;RTN2_HUMAN	H	23	ENSP00000345127:D23H;ENSP00000245923:D23H	ENSP00000245923:D23H	D	-	1	0	RTN2	50690205	0.996000	0.38824	0.998000	0.56505	0.398000	0.30690	3.794000	0.55492	2.618000	0.88619	0.462000	0.41574	GAT		0.547	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		6	171	0	0	0	0.001168	0	6	171				
GRWD1	83743	broad.mit.edu	37	19	48949420	48949420	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:48949420C>T	ENST00000253237.5	+	1	391	c.158C>T	c.(157-159)gCc>gTc	p.A53V		NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	53						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A53V(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		GACGAGGAGGCCTATGTGCTC	0.677											OREG0025607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002pjd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(157-159)GCC>GTC		glutamate-rich WD repeat containing 1							14.0	18.0	17.0					19																	48949420		2203	4299	6502	SO:0001583	missense	83743					nucleolus		g.chr19:48949420C>T	AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.158C>T	19.37:g.48949420C>T	ENSP00000253237:p.Ala53Val		Somatic	OREG0025607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	958		p.A53V	NM_031485	NP_113673	WXS	Illumina HiSeq	Unspecified	Q9BQ67	GRWD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)	1	391	+		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)	53					Q8TF59	Missense_Mutation	SNP	ENST00000253237.5	37	c.158C>T	CCDS12720.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545556	0.86022	.	.	ENSG00000105447	ENST00000253237	T	0.72615	-0.67	4.17	4.17	0.49024	.	0.188209	0.43919	D	0.000504	T	0.78572	0.4304	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76030	-0.3108	10	0.30078	T	0.28	.	15.7673	0.78138	0.0:1.0:0.0:0.0	.	53	Q9BQ67	GRWD1_HUMAN	V	53	ENSP00000253237:A53V	ENSP00000253237:A53V	A	+	2	0	GRWD1	53641232	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.777000	0.47717	2.322000	0.78497	0.462000	0.41574	GCC		0.677	GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466122.1	NM_031485		4	13	0	0	0	0.009096	0	4	13				
ZNF761	388561	broad.mit.edu	37	19	53959208	53959208	+	RNA	SNP	A	A	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:53959208A>G	ENST00000454407.1	+	0	1900							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AAACCTTGAAAGACATAGGAG	0.413																																							uc010eqp.2		NA																	0				ovary(1)	1						c.(1447-1449)AGA>GGA		zinc finger protein 761							73.0	77.0	76.0					19																	53959208		2203	4300	6503			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53959208A>G	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959208A>G			Somatic				ZNF761_uc010ydy.1_Missense_Mutation_p.R429G|ZNF761_uc002qbt.1_Missense_Mutation_p.R429G	p.R483G	NM_001008401	NP_001008401	WXS	Illumina HiSeq	Unspecified	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	7	1905	+			483			C2H2-type 10.		Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37	c.1447A>G																																																																																					0.413	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		3	147	0	0	0	0.004672	0	3	147				
NLRP4	147945	broad.mit.edu	37	19	56382256	56382256	+	Missense_Mutation	SNP	C	C	G	rs145998081		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:56382256C>G	ENST00000301295.6	+	7	2840	c.2418C>G	c.(2416-2418)aaC>aaG	p.N806K	NLRP4_ENST00000346986.5_Missense_Mutation_p.N750K|NLRP4_ENST00000587891.1_Missense_Mutation_p.N731K	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	806					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.N806K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTCTGCGTAACAAGAGCGTGC	0.517																																							uc002qmd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2416-2418)AAC>AAG		NLR family, pyrin domain containing 4							176.0	147.0	157.0					19																	56382256		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56382256C>G	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2418C>G	19.37:g.56382256C>G	ENSP00000301295:p.Asn806Lys		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.N731K|NLRP4_uc010etf.2_Missense_Mutation_p.N581K	p.N806K	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	7	2840	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	806			LRR 5.		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2418C>G	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220939	0.39201	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.57273	0.41;2.59	3.75	-0.868	0.10652	.	.	.	.	.	T	0.68586	0.3017	M	0.88450	2.955	0.09310	N	1	D;D;D	0.76494	0.983;0.999;0.999	P;D;D	0.77557	0.835;0.983;0.99	T	0.55309	-0.8161	9	0.41790	T	0.15	.	3.0679	0.06220	0.1954:0.4915:0.0:0.3132	.	750;731;806	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	K	806;750	ENSP00000301295:N806K;ENSP00000344787:N750K	ENSP00000301295:N806K	N	+	3	2	NLRP4	61074068	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.178000	0.16820	-0.076000	0.12775	-0.188000	0.12872	AAC		0.517	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		4	123	0	0	0	0.009096	0	4	123				
PEG3	5178	broad.mit.edu	37	19	57325423	57325423	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr19:57325423C>T	ENST00000326441.9	-	10	4750	c.4387G>A	c.(4387-4389)Gaa>Aaa	p.E1463K	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.E1339K|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.E1337K|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.E1463K	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1463	Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E1463K(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCAGCTCTTTCTTCTGGGTCT	0.547																																							uc002qnu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4387-4389)GAA>AAA		paternally expressed 3 isoform 1							115.0	105.0	108.0					19																	57325423		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57325423C>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4387G>A	19.37:g.57325423C>T	ENSP00000326581:p.Glu1463Lys		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.E1434K|PEG3_uc002qnv.2_Missense_Mutation_p.E1463K|PEG3_uc002qnw.2_Missense_Mutation_p.E1339K|PEG3_uc002qnx.2_Missense_Mutation_p.E1337K|PEG3_uc010etr.2_Missense_Mutation_p.E1463K	p.E1463K	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	4738	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	1463			Glu-rich.		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.4387G>A	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711379	0.68730	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02787	4.16;4.16	4.07	3.04	0.35103	.	0.147344	0.31747	N	0.007130	T	0.02230	0.0069	L	0.27053	0.805	.	.	.	B;B;B	0.24043	0.096;0.096;0.096	B;B;B	0.21708	0.036;0.036;0.036	T	0.24693	-1.0153	9	0.27082	T	0.32	-20.3325	7.4355	0.27154	0.0:0.8849:0.0:0.1151	.	1339;1463;1398	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	K	1463	ENSP00000326581:E1463K;ENSP00000403051:E1463K	ENSP00000326581:E1463K	E	-	1	0	ZIM2	62017235	0.017000	0.18338	0.515000	0.27774	0.961000	0.63080	0.892000	0.28322	1.297000	0.44761	0.650000	0.86243	GAA		0.547	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			6	218	0	0	0	0.001984	0	6	218				
FAM49A	81553	broad.mit.edu	37	2	16740826	16740826	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:16740826C>T	ENST00000381323.3	-	10	959	c.739G>A	c.(739-741)Gag>Aag	p.E247K	FAM49A_ENST00000406434.1_Missense_Mutation_p.E247K|FAM49A_ENST00000355549.2_Missense_Mutation_p.E247K	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	247						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			ATCAGGGTCTCTTCACTCGTA	0.502																																							uc010exm.1		NA																	0					0						c.(739-741)GAG>AAG		family with sequence similarity 49, member A							150.0	137.0	141.0					2																	16740826		2203	4300	6503	SO:0001583	missense	81553					intracellular		g.chr2:16740826C>T	AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.739G>A	2.37:g.16740826C>T	ENSP00000370724:p.Glu247Lys		Somatic				FAM49A_uc002rck.1_Missense_Mutation_p.E247K	p.E247K	NM_030797	NP_110424	WXS	Illumina HiSeq	Unspecified	Q9H0Q0	FA49A_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)		9	887	-	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		247					B3KNZ1|Q53QW2	Missense_Mutation	SNP	ENST00000381323.3	37	c.739G>A	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952236	0.92660	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.52526	0.66;0.66;0.66	5.35	5.35	0.76521	.	0.094697	0.64402	D	0.000001	T	0.68081	0.2962	M	0.81341	2.54	0.80722	D	1	D	0.54397	0.966	P	0.59643	0.861	T	0.68830	-0.5305	10	0.44086	T	0.13	-17.3863	18.431	0.90625	0.0:1.0:0.0:0.0	.	247	Q9H0Q0	FA49A_HUMAN	K	247	ENSP00000370724:E247K;ENSP00000384771:E247K;ENSP00000347744:E247K	ENSP00000347744:E247K	E	-	1	0	FAM49A	16604307	1.000000	0.71417	0.902000	0.35471	0.542000	0.35054	6.079000	0.71291	2.676000	0.91093	0.655000	0.94253	GAG		0.502	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	NM_030797		4	187	0	0	0	0.001168	0	4	187				
PREPL	9581	broad.mit.edu	37	2	44571027	44571027	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:44571027A>G	ENST00000409936.1	-	5	910	c.473T>C	c.(472-474)aTt>aCt	p.I158T	PREPL_ENST00000409411.1_Missense_Mutation_p.I69T|PREPL_ENST00000409957.1_Missense_Mutation_p.I69T|PREPL_ENST00000260648.6_Missense_Mutation_p.I158T|PREPL_ENST00000410081.1_Missense_Mutation_p.I158T|PREPL_ENST00000409272.1_Missense_Mutation_p.I158T|PREPL_ENST00000378520.3_Missense_Mutation_p.I158T|PREPL_ENST00000378511.3_Missense_Mutation_p.I158T|PREPL_ENST00000540817.1_5'UTR|PREPL_ENST00000541738.1_Missense_Mutation_p.I69T	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	158						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.I158T(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATACAATCAATGAAGGGCTG	0.343																																							uc002ruf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(472-474)ATT>ACT		prolyl endopeptidase-like isoform C							99.0	103.0	101.0					2																	44571027		2203	4300	6503	SO:0001583	missense	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44571027A>G	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.473T>C	2.37:g.44571027A>G	ENSP00000386543:p.Ile158Thr		Somatic				PREPL_uc002rug.2_Missense_Mutation_p.I158T|PREPL_uc002ruh.2_Missense_Mutation_p.I158T|PREPL_uc010fax.2_Missense_Mutation_p.I158T|PREPL_uc002rui.3_Missense_Mutation_p.I69T|PREPL_uc002ruj.1_Missense_Mutation_p.I69T|PREPL_uc002ruk.1_Missense_Mutation_p.I158T	p.I158T	NM_006036	NP_006027	WXS	Illumina HiSeq	Unspecified	Q4J6C6	PPCEL_HUMAN			4	508	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	158					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	c.473T>C	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.032961	0.75504	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.6	5.6	0.85130	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.235786	0.43416	D	0.000562	T	0.59797	0.2220	L	0.38175	1.15	0.49130	D	0.999757	D;P;D	0.76494	0.984;0.949;0.999	D;P;D	0.72625	0.964;0.57;0.978	T	0.63005	-0.6733	10	0.72032	D	0.01	-14.7579	15.7979	0.78424	1.0:0.0:0.0:0.0	.	158;158;158	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	T	69;69;69;158;158;158;158;158;158	ENSP00000439626:I69T;ENSP00000387095:I69T;ENSP00000387241:I69T;ENSP00000386543:I158T;ENSP00000260648:I158T;ENSP00000386909:I158T;ENSP00000386509:I158T;ENSP00000367781:I158T;ENSP00000367772:I158T	ENSP00000260648:I158T	I	-	2	0	PREPL	44424531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.384000	0.73177	2.122000	0.65172	0.528000	0.53228	ATT		0.343	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		59	151	0	0	0	0.01441	0	59	151				
CLEC4F	165530	broad.mit.edu	37	2	71039638	71039638	+	Missense_Mutation	SNP	C	C	G	rs142013309	byFrequency	TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:71039638C>G	ENST00000272367.2	-	5	1556	c.1480G>C	c.(1480-1482)Gag>Cag	p.E494Q	CLEC4F_ENST00000426626.1_Missense_Mutation_p.E494Q	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	494	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CAGAACTGCTCAGCCTCATGC	0.532																																					Colon(107;10 2157 6841 26035)	Colon(107;10 2157 6841 26035)	uc002shf.2		NA																	0				ovary(5)	5						c.(1480-1482)GAG>CAG		C-type lectin, superfamily member 13							103.0	104.0	104.0					2																	71039638		2203	4300	6503	SO:0001583	missense	165530				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr2:71039638C>G	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1480G>C	2.37:g.71039638C>G	ENSP00000272367:p.Glu494Gln		Somatic				CLEC4F_uc010yqv.1_Missense_Mutation_p.E494Q	p.E494Q	NM_173535	NP_775806	WXS	Illumina HiSeq	Unspecified	Q8N1N0	CLC4F_HUMAN			5	1557	-			494			Extracellular (Potential).|C-type lectin.		A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	c.1480G>C	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	c	12.92	2.081298	0.36758	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.16457	2.34;2.34	4.4	4.4	0.53042	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.431862	0.17371	N	0.176695	T	0.28532	0.0706	L	0.35793	1.09	0.23260	N	0.998024	D;D	0.61697	0.974;0.99	P;D	0.66084	0.857;0.941	T	0.05435	-1.0885	10	0.31617	T	0.26	.	13.2928	0.60280	0.0:1.0:0.0:0.0	.	494;494	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	Q	494	ENSP00000272367:E494Q;ENSP00000390581:E494Q	ENSP00000272367:E494Q	E	-	1	0	CLEC4F	70893146	0.981000	0.34729	0.982000	0.44146	0.089000	0.18198	1.718000	0.38001	2.410000	0.81850	0.291000	0.19559	GAG		0.532	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		3	169	0	0	0	0.014758	0	3	169				
NCAPH	23397	broad.mit.edu	37	2	97039033	97039033	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:97039033C>G	ENST00000240423.4	+	18	2213	c.2170C>G	c.(2170-2172)Cta>Gta	p.L724V	NCAPH_ENST00000427946.1_Missense_Mutation_p.L588V|NCAPH_ENST00000455200.1_Missense_Mutation_p.L713V	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	724					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.L724V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				CCCTCAGAATCTAAAACTGGA	0.433																																							uc002svz.1		NA																	1	Substitution - Missense(1)		lung(1)	urinary_tract(1)|skin(1)	2						c.(2170-2172)CTA>GTA		non-SMC condensin I complex, subunit H							152.0	149.0	150.0					2																	97039033		2203	4300	6503	SO:0001583	missense	23397				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus		g.chr2:97039033C>G	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.2170C>G	2.37:g.97039033C>G	ENSP00000240423:p.Leu724Val		Somatic				NCAPH_uc010yum.1_Missense_Mutation_p.L700V|NCAPH_uc010fhw.1_Missense_Mutation_p.L713V|NCAPH_uc010yun.1_Missense_Mutation_p.L588V|NCAPH_uc002swa.1_Missense_Mutation_p.L319V	p.L724V	NM_015341	NP_056156	WXS	Illumina HiSeq	Unspecified	Q15003	CND2_HUMAN			18	2254	+		Ovarian(717;0.0221)	724					B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	c.2170C>G	CCDS2021.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.67|18.67	3.674347|3.674347	0.67928|0.67928	.|.	.|.	ENSG00000121152|ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000455200|ENST00000435349	T;T;T|.	0.75260|.	-0.92;-0.92;-0.92|.	5.53|5.53	3.36|3.36	0.38483|0.38483	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67059|0.67059	0.2853|0.2853	M|M	0.83223|0.83223	2.63|2.63	0.49915|0.49915	D|D	0.999833|0.999833	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.91635|.	0.976;0.999|.	T|T	0.67787|0.67787	-0.5580|-0.5580	10|5	0.66056|.	D|.	0.02|.	-10.4871|-10.4871	5.484|5.484	0.16739|0.16739	0.0:0.6697:0.0:0.3303|0.0:0.6697:0.0:0.3303	.|.	700;724|.	B4DRG7;Q15003|.	.;CND2_HUMAN|.	V|C	724;588;713|164	ENSP00000240423:L724V;ENSP00000400774:L588V;ENSP00000407308:L713V|.	ENSP00000240423:L724V|.	L|S	+|+	1|2	2|0	NCAPH|NCAPH	96402760|96402760	0.999000|0.999000	0.42202|0.42202	0.993000|0.993000	0.49108|0.49108	0.988000|0.988000	0.76386|0.76386	1.387000|1.387000	0.34430|0.34430	1.476000|1.476000	0.48215|0.48215	0.655000|0.655000	0.94253|0.94253	CTA|TCT		0.433	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341		6	214	0	0	0	0.00308	0	6	214				
TYW5	129450	broad.mit.edu	37	2	200800672	200800672	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:200800672C>T	ENST00000354611.4	-	7	938	c.673G>A	c.(673-675)Gat>Aat	p.D225N	TYW5_ENST00000452512.2_5'UTR|C2orf69_ENST00000491721.1_Intron	NM_001039693.2	NP_001034782.1	A2RUC4	TYW5_HUMAN	tRNA-yW synthesizing protein 5	225	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				wybutosine biosynthetic process (GO:0031591)		iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(1)	8						AATAATACATCACCAGCTTCA	0.333																																							uc002uvi.3		NA																	0					0						c.(673-675)GAT>AAT		hypothetical protein LOC129450							136.0	129.0	131.0					2																	200800672		1829	4079	5908	SO:0001583	missense	129450				wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding	g.chr2:200800672C>T	AK095272	CCDS42795.1	2q33.1	2011-05-09	2011-05-09	2011-05-09	ENSG00000162971	ENSG00000162971			26754	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 60"""	C2orf60		20739293	Standard	NM_001039693		Approved	FLJ37953	uc002uvi.4	A2RUC4	OTTHUMG00000132770	ENST00000354611.4:c.673G>A	2.37:g.200800672C>T	ENSP00000346627:p.Asp225Asn		Somatic				C2orf60_uc002uvj.3_Missense_Mutation_p.D62N|C2orf60_uc002uvk.3_RNA|C2orf60_uc010fss.2_Missense_Mutation_p.D62N	p.D225N	NM_001039693	NP_001034782	WXS	Illumina HiSeq	Unspecified	A2RUC4	TYW5_HUMAN			7	939	-			225			JmjC.		B2RNE3|Q8N1R2	Missense_Mutation	SNP	ENST00000354611.4	37	c.673G>A	CCDS42795.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019601	0.93462	.	.	ENSG00000162971	ENST00000354611	T	0.81163	-1.46	5.57	5.57	0.84162	Cupin, JmjC-type (1);Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.168539	0.51477	D	0.000098	D	0.93478	0.7919	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95030	0.8168	10	0.72032	D	0.01	-12.3231	19.5388	0.95266	0.0:1.0:0.0:0.0	.	225	A2RUC4	TYW5_HUMAN	N	225	ENSP00000346627:D225N	ENSP00000346627:D225N	D	-	1	0	TYW5	200508917	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.368000	0.66133	2.597000	0.87782	0.585000	0.79938	GAT		0.333	TYW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256144.3	NM_001039693		4	192	0	0	0	0.009096	0	4	192				
UGT1A3	54659	broad.mit.edu	37	2	234638177	234638177	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:234638177G>T	ENST00000482026.1	+	1	424	c.405G>T	c.(403-405)gaG>gaT	p.E135D	UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.E135D|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000480628.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	135					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.E135D(2)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	TACATAATGAGGCCCTGATCA	0.428																																							uc002vuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(403-405)GAG>GAT		UDP glycosyltransferase 1 family, polypeptide A3							190.0	195.0	193.0					2																	234638177		2203	4300	6503	SO:0001583	missense	54659				flavonoid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding	g.chr2:234638177G>T	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.405G>T	2.37:g.234638177G>T	ENSP00000418532:p.Glu135Asp		Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Missense_Mutation_p.E135D	p.E135D	NM_019093	NP_061966	WXS	Illumina HiSeq	Unspecified	P35503	UD13_HUMAN		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	1	405	+		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)	135					B8K287	Missense_Mutation	SNP	ENST00000482026.1	37	c.405G>T	CCDS2509.1	.	.	.	.	.	.	.	.	.	.	g	11.71	1.720454	0.30503	.	.	ENSG00000243135	ENST00000482026	T	0.60171	0.21	4.53	0.381	0.16228	.	.	.	.	.	T	0.48750	0.1517	L	0.35644	1.08	0.09310	N	1	B;B	0.29671	0.254;0.254	B;B	0.39465	0.3;0.3	T	0.50294	-0.8845	9	0.62326	D	0.03	.	4.9009	0.13773	0.3883:0.0:0.4734:0.1383	.	135;135	Q5DT01;P35503	.;UD13_HUMAN	D	135	ENSP00000418532:E135D	ENSP00000418532:E135D	E	+	3	2	UGT1A3	234302916	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.268000	0.18571	-0.270000	0.09285	0.585000	0.79938	GAG		0.428	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093		101	326	1	0	1.70349e-48	0.01441	1.88147e-48	101	326				
COL6A3	1293	broad.mit.edu	37	2	238277314	238277314	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:238277314C>G	ENST00000295550.4	-	10	5244	c.4792G>C	c.(4792-4794)Gag>Cag	p.E1598Q	COL6A3_ENST00000409809.1_Missense_Mutation_p.E1392Q|COL6A3_ENST00000353578.4_Missense_Mutation_p.E1392Q|COL6A3_ENST00000346358.4_Missense_Mutation_p.E1398Q|COL6A3_ENST00000347401.3_Missense_Mutation_p.E1397Q|COL6A3_ENST00000472056.1_Missense_Mutation_p.E991Q	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1598	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCTCTGAACTCTCGCACTGTG	0.547																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(4792-4794)GAG>CAG		alpha 3 type VI collagen isoform 1 precursor							180.0	163.0	169.0					2																	238277314		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238277314C>G	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4792G>C	2.37:g.238277314C>G	ENSP00000295550:p.Glu1598Gln		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.E1392Q|COL6A3_uc010znj.1_Missense_Mutation_p.E991Q	p.E1598Q	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	10	5077	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	1598			VWFA 8.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.4792G>C	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032481	0.54790	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.36	4.48	0.54585	von Willebrand factor, type A (3);	0.137541	0.35615	N	0.003097	D	0.86944	0.6055	M	0.79011	2.435	0.42845	D	0.994063	D;D;D	0.89917	0.998;1.0;0.97	D;D;P	0.74023	0.982;0.979;0.761	D	0.86988	0.2108	10	0.40728	T	0.16	.	14.3281	0.66534	0.0:0.9277:0.0:0.0723	.	991;1392;1598	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	Q	1598;1397;1392;991;1392;1398	ENSP00000295550:E1598Q;ENSP00000315609:E1397Q;ENSP00000315873:E1392Q;ENSP00000418285:E991Q;ENSP00000386844:E1392Q;ENSP00000295546:E1398Q	ENSP00000295550:E1598Q	E	-	1	0	COL6A3	237942053	0.255000	0.24002	0.105000	0.21289	0.936000	0.57629	2.435000	0.44811	1.237000	0.43756	0.655000	0.94253	GAG		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		5	385	0	0	0	0.014758	0	5	385				
PAX1	5075	broad.mit.edu	37	20	21689285	21689285	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:21689285G>T	ENST00000398485.2	+	3	1060	c.1006G>T	c.(1006-1008)Gca>Tca	p.A336S	PAX1_ENST00000444366.2_Missense_Mutation_p.A312S|PAX1_ENST00000460221.1_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	336					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A242S(2)|p.A336S(2)		autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CGCCACCCCCGCAGTGAATGG	0.602																																							uc002wsj.2		NA																	4	Substitution - Missense(4)		lung(4)	upper_aerodigestive_tract(1)|kidney(1)	2						c.(1006-1008)GCA>TCA		paired box 1							37.0	42.0	40.0					20																	21689285		2202	4300	6502	SO:0001583	missense	5075				regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr20:21689285G>T		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1006G>T	20.37:g.21689285G>T	ENSP00000381499:p.Ala336Ser		Somatic				PAX1_uc010zsl.1_Missense_Mutation_p.A336S|PAX1_uc010zsm.1_Missense_Mutation_p.A312S	p.A336S	NM_006192	NP_006183	WXS	Illumina HiSeq	Unspecified	P15863	PAX1_HUMAN			3	1060	+			336					B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	c.1006G>T	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	G	6.814	0.519349	0.13005	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98280	-4.35;-4.84	5.41	1.33	0.21861	.	0.675815	0.15101	N	0.280504	D	0.94152	0.8124	N	0.21142	0.635	0.09310	N	1	B;B;B	0.23735	0.017;0.033;0.09	B;B;B	0.25987	0.065;0.006;0.037	D	0.86973	0.2099	10	0.22109	T	0.4	.	9.0692	0.36482	0.3383:0.0:0.6617:0.0	.	312;242;336	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	S	336;312	ENSP00000381499:A336S;ENSP00000410355:A312S	ENSP00000381499:A336S	A	+	1	0	PAX1	21637285	0.000000	0.05858	0.001000	0.08648	0.123000	0.20343	0.494000	0.22467	0.274000	0.22072	-1.490000	0.00973	GCA		0.602	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			60	85	1	0	3.66258e-25	0.01441	3.98575e-25	60	85				
BPIFB4	149954	broad.mit.edu	37	20	31685500	31685500	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:31685500G>A	ENST00000375483.3	+	11	1476	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	492						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGATGCTGCAGAAGGACAAAG	0.582																																							uc010zue.1		NA																	0					0						c.(1474-1476)CAG>CAA		antimicrobial peptide RY2G5 precursor							150.0	118.0	129.0					20																	31685500		2203	4300	6503	SO:0001819	synonymous_variant	149954					cytoplasm|extracellular region	lipid binding	g.chr20:31685500G>A	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1476G>A	20.37:g.31685500G>A			Somatic					p.Q492Q	NM_182519	NP_872325	WXS	Illumina HiSeq	Unspecified	P59827	LPLC4_HUMAN			11	1491	+			492					Q5TDX6	Silent	SNP	ENST00000375483.3	37	c.1476G>A	CCDS13213.2																																																																																				0.582	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519		6	284	0	0	0	0.001984	0	6	284				
MYH7B	57644	broad.mit.edu	37	20	33575404	33575404	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:33575404C>A	ENST00000262873.7	+	15	1410	c.1318C>A	c.(1318-1320)Ctc>Atc	p.L440I	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	398	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L440I(2)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CAGTGGGGACCTCCTCAAAGG	0.637																																							uc002xbi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(1318-1320)CTC>ATC		myosin, heavy polypeptide 7B, cardiac muscle,							94.0	105.0	101.0					20																	33575404		2076	4204	6280	SO:0001583	missense	57644					membrane|myosin filament	actin binding|ATP binding|motor activity	g.chr20:33575404C>A	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1318C>A	20.37:g.33575404C>A	ENSP00000262873:p.Leu440Ile		Somatic				MIR499_hsa-mir-499|MI0003183_5'Flank	p.L440I	NM_020884	NP_065935	WXS	Illumina HiSeq	Unspecified	A7E2Y1	MYH7B_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00691)		15	1410	+			398			Myosin head-like.		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	c.1318C>A	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834233	0.71373	.	.	ENSG00000078814	ENST00000262873	T	0.80738	-1.41	3.53	3.53	0.40419	Myosin head, motor domain (2);	0.000000	0.32218	N	0.006403	D	0.90273	0.6958	M	0.92691	3.335	0.40832	D	0.983595	P	0.43542	0.81	P	0.58520	0.84	D	0.92629	0.6114	10	0.87932	D	0	.	13.1087	0.59261	0.1607:0.8393:0.0:0.0	.	398	A7E2Y1	MYH7B_HUMAN	I	440	ENSP00000262873:L440I	ENSP00000262873:L440I	L	+	1	0	MYH7B	33039065	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.943000	0.56621	2.279000	0.76181	0.561000	0.74099	CTC		0.637	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884		121	194	1	0	3.68091e-61	0.01441	4.09605e-61	121	194				
CABLES2	81928	broad.mit.edu	37	20	60967531	60967531	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:60967531C>T	ENST00000279101.5	-	8	1013	c.1005G>A	c.(1003-1005)gtG>gtA	p.V335V		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	335					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CTGAGGGCTTCACGTATTCTA	0.557																																							uc002ycv.2		NA																	0				pancreas(1)	1						c.(1003-1005)GTG>GTA		Cdk5 and Abl enzyme substrate 2							215.0	190.0	198.0					20																	60967531		2203	4300	6503	SO:0001819	synonymous_variant	81928				cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity	g.chr20:60967531C>T	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1005G>A	20.37:g.60967531C>T			Somatic					p.V335V	NM_031215	NP_112492	WXS	Illumina HiSeq	Unspecified	Q9BTV7	CABL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		8	1012	-	Breast(26;2.05e-08)		335					Q5JWL0|Q9BYK0	Silent	SNP	ENST00000279101.5	37	c.1005G>A	CCDS33503.1																																																																																				0.557	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265		7	273	0	0	0	0.00308	0	7	273				
TCFL5	10732	broad.mit.edu	37	20	61488962	61488962	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:61488962C>G	ENST00000335351.3	-	4	1115	c.1023G>C	c.(1021-1023)aaG>aaC	p.K341N	TCFL5_ENST00000217162.5_Missense_Mutation_p.K293N	NM_006602.2	NP_006593.2	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 (basic helix-loop-helix)	341					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K341N(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|urinary_tract(1)	9	Breast(26;5.68e-08)					TCCGATTCCTCTTCAGTGCTT	0.438																																							uc002ydp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1021-1023)AAG>AAC		transcription factor-like 5 protein							90.0	80.0	84.0					20																	61488962		2203	4300	6503	SO:0001583	missense	10732				cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:61488962C>G	AB012124	CCDS13506.1	20q13.33	2013-09-19			ENSG00000101190	ENSG00000101190		"""Basic helix-loop-helix proteins"""	11646	protein-coding gene	gene with protein product	"""HPV-16 E2 binding protein 1"""	604745				9763657	Standard	XM_005260185		Approved	Figlb, E2BP-1, CHA, bHLHe82	uc002ydp.3	Q9UL49	OTTHUMG00000032939	ENST00000335351.3:c.1023G>C	20.37:g.61488962C>G	ENSP00000334294:p.Lys341Asn		Somatic				TCFL5_uc002ydo.2_Missense_Mutation_p.K114N|TCFL5_uc002ydq.2_Missense_Mutation_p.K340N	p.K341N	NM_006602	NP_006593	WXS	Illumina HiSeq	Unspecified	Q9UL49	TCFL5_HUMAN			4	1116	-	Breast(26;5.68e-08)		341					O94771|Q9BYW0	Missense_Mutation	SNP	ENST00000335351.3	37	c.1023G>C	CCDS13506.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841136	0.51057	.	.	ENSG00000101190	ENST00000335351;ENST00000217162	T;T	0.38560	1.15;1.13	5.18	1.65	0.23941	.	0.238171	0.30003	N	0.010647	T	0.41190	0.1148	L	0.34521	1.04	0.27306	N	0.957453	B;D	0.71674	0.017;0.998	B;P	0.60682	0.014;0.878	T	0.15435	-1.0437	10	0.49607	T	0.09	-10.9742	4.1383	0.10181	0.0:0.4955:0.1974:0.3071	.	293;341	F8W9A4;Q9UL49	.;TCFL5_HUMAN	N	341;293	ENSP00000334294:K341N;ENSP00000217162:K293N	ENSP00000217162:K293N	K	-	3	2	TCFL5	60959407	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	1.732000	0.38146	0.546000	0.28920	0.485000	0.47835	AAG		0.438	TCFL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080079.2	NM_006602		5	181	0	0	0	0.001168	0	5	181				
SLC17A9	63910	broad.mit.edu	37	20	61598814	61598814	+	Missense_Mutation	SNP	C	C	G	rs112598584		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr20:61598814C>G	ENST00000370351.4	+	13	1404	c.1273C>G	c.(1273-1275)Cag>Gag	p.Q425E	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.Q419E	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	425					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						TGGACAGGCTCAGAGGGTGGA	0.612																																							uc002yea.3		NA																	0				ovary(1)|skin(1)	2						c.(1273-1275)CAG>GAG		vesicular nucleotide transporter SLC17A9							143.0	153.0	149.0					20																	61598814		2075	4200	6275	SO:0001583	missense	63910				exocytosis|transmembrane transport	integral to membrane	transporter activity	g.chr20:61598814C>G	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.1273C>G	20.37:g.61598814C>G	ENSP00000359376:p.Gln425Glu		Somatic				SLC17A9_uc002ydz.3_Missense_Mutation_p.Q419E|SLC17A9_uc011aap.1_3'UTR	p.Q425E	NM_022082	NP_071365	WXS	Illumina HiSeq	Unspecified	Q9BYT1	S17A9_HUMAN			13	1457	+			425					B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	c.1273C>G	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	C	7.869	0.727815	0.15507	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.56103	0.48;0.48	4.9	1.71	0.24356	Major facilitator superfamily domain (1);	0.301676	0.38111	N	0.001814	T	0.28928	0.0718	N	0.17564	0.495	0.40263	D	0.978209	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.26467	-1.0102	10	0.02654	T	1	.	10.8755	0.46909	0.135:0.485:0.3801:0.0	.	425;419	Q9BYT1;Q9BYT1-2	S17A9_HUMAN;.	E	425;419	ENSP00000359376:Q425E;ENSP00000359374:Q419E	ENSP00000359374:Q419E	Q	+	1	0	SLC17A9	61069259	0.998000	0.40836	0.530000	0.27963	0.913000	0.54294	2.187000	0.42602	0.084000	0.17077	0.561000	0.74099	CAG		0.612	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082		4	230	0	0	0	0.014758	0	4	230				
ITSN1	6453	broad.mit.edu	37	21	35260596	35260596	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr21:35260596G>A	ENST00000381318.3	+	40	5446	c.5158G>A	c.(5158-5160)Gag>Aag	p.E1720K	ITSN1_ENST00000399367.3_Missense_Mutation_p.E1715K|ITSN1_ENST00000437442.2_Missense_Mutation_p.E1659K|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381285.4_Missense_Mutation_p.E1720K|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1720					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E1720K(2)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GTTGTTTGATGAGCCGTAGGC	0.547																																							uc002yta.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(5158-5160)GAG>AAG		intersectin 1 isoform ITSN-l							53.0	48.0	50.0					21																	35260596		2203	4300	6503	SO:0001583	missense	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35260596G>A	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.5158G>A	21.37:g.35260596G>A	ENSP00000370719:p.Glu1720Lys		Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Missense_Mutation_p.E1715K|ITSN1_uc002ytj.2_Missense_Mutation_p.E1659K|ITSN1_uc010gmm.1_RNA	p.E1720K	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			40	5426	+			1720					A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	c.5158G>A	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353103	0.95830	.	.	ENSG00000205726	ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442	T;T;T;T	0.44881	0.91;0.91;1.02;1.09	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.53722	0.1814	N	0.22421	0.69	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.78314	0.991;0.98;0.98	T	0.56902	-0.7902	10	0.62326	D	0.03	.	19.7272	0.96168	0.0:0.0:1.0:0.0	.	1659;1715;1720	A8CTY3;A8CTX8;Q15811	.;.;ITSN1_HUMAN	K	1720;1720;1649;1715;1659	ENSP00000370719:E1720K;ENSP00000370685:E1720K;ENSP00000382301:E1715K;ENSP00000387377:E1659K	ENSP00000370685:E1720K	E	+	1	0	ITSN1	34182466	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	9.441000	0.97557	2.646000	0.89796	0.655000	0.94253	GAG		0.547	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		12	31	0	0	0	0.010729	0	12	31				
KRTAP10-10	353333	broad.mit.edu	37	21	46057394	46057394	+	Silent	SNP	C	C	T	rs587616727		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr21:46057394C>T	ENST00000380095.1	+	1	122	c.60C>T	c.(58-60)gtC>gtT	p.V20V	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	20			V -> D (in dbSNP:rs2838602).			keratin filament (GO:0045095)		p.V20V(1)		NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GGCGGGTAGTCGACTGCCCAG	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16285	0.0		0.0	False		,,,				2504	0.0						uc002zfq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(58-60)GTC>GTT		keratin associated protein 10-10							87.0	92.0	90.0					21																	46057394		2203	4300	6503	SO:0001819	synonymous_variant	353333					keratin filament		g.chr21:46057394C>T	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.60C>T	21.37:g.46057394C>T			Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.V20V	NM_181688	NP_859016	WXS	Illumina HiSeq	Unspecified	P60014	KR10A_HUMAN			1	122	+			20						Silent	SNP	ENST00000380095.1	37	c.60C>T	CCDS33585.1																																																																																				0.672	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688		7	126	0	0	0	0.013726	0	7	126				
POTEH	23784	broad.mit.edu	37	22	16267027	16267027	+	Silent	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr22:16267027G>C	ENST00000343518.6	-	9	1473	c.1422C>G	c.(1420-1422)gcC>gcG	p.A474A		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	474								p.A474A(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TGTCAGCAGTGGCACCGTTAG	0.408																																							uc010gqp.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1420-1422)GCC>GCG		ANKRD26-like family C, member 3							530.0	432.0	462.0					22																	16267027		692	1591	2283	SO:0001819	synonymous_variant	23784							g.chr22:16267027G>C	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1422C>G	22.37:g.16267027G>C			Somatic				POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Silent_p.A193A|POTEH_uc002zlj.1_Silent_p.A309A	p.A474A	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			9	1474	-			474					A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	c.1422C>G	CCDS46658.1																																																																																				0.408	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		13	572	0	0	0	0.016723	0	13	572				
C22orf29	79680	broad.mit.edu	37	22	19839364	19839364	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr22:19839364C>A	ENST00000405640.1	-	2	1089	c.421G>T	c.(421-423)Gag>Tag	p.E141*	GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000403325.1_Intron|GNB1L_ENST00000460402.1_Intron|C22orf29_ENST00000407472.1_Nonsense_Mutation_p.E141*|GNB1L_ENST00000329517.6_Intron|C22orf29_ENST00000484072.1_Intron|C22orf29_ENST00000328554.4_Nonsense_Mutation_p.E141*			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	141					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)		p.E141*(1)		NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					CTGAGGATCTCGCAGACACGG	0.612																																							uc002zqg.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(421-423)GAG>TAG		hypothetical protein LOC79680							82.0	88.0	86.0					22																	19839364		2203	4300	6503	SO:0001587	stop_gained	79680							g.chr22:19839364C>A	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.421G>T	22.37:g.19839364C>A	ENSP00000384924:p.Glu141*		Somatic				GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqe.1_Intron|GNB1L_uc002zqf.1_Intron|C22orf29_uc002zqh.2_Nonsense_Mutation_p.E141*|C22orf29_uc002zqi.2_Nonsense_Mutation_p.E141*|C22orf29_uc010grt.1_Intron	p.E141*	NM_024627	NP_078903	WXS	Illumina HiSeq	Unspecified	Q7L3V2	CV029_HUMAN			2	1020	-	Colorectal(54;0.0993)		141					A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Nonsense_Mutation	SNP	ENST00000405640.1	37	c.421G>T	CCDS13769.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771291	0.90108	.	.	ENSG00000215012	ENST00000407472;ENST00000328554;ENST00000405640	.	.	.	3.06	2.04	0.26737	.	0.879742	0.09130	U	0.844496	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	6.1112	0.20102	0.0:0.858:0.0:0.142	.	.	.	.	X	141	.	ENSP00000330596:E141X	E	-	1	0	C22orf29	18219364	0.020000	0.18652	0.003000	0.11579	0.001000	0.01503	0.267000	0.18552	0.859000	0.35456	-0.136000	0.14681	GAG		0.612	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317290.2	NM_024627		8	204	1	0	9.70103e-10	0.008291	1.03292e-09	8	204				
ZDHHC8	29801	broad.mit.edu	37	22	20128410	20128410	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr22:20128410C>T	ENST00000334554.7	+	7	910	c.769C>T	c.(769-771)Ccc>Tcc	p.P257S	ZDHHC8_ENST00000405930.3_Missense_Mutation_p.P257S|ZDHHC8_ENST00000468112.1_3'UTR|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.P165S	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	257					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P257S(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GGTGGAGCCACCCCGGCTGCC	0.627																																							uc002zrq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(769-771)CCC>TCC		zinc finger, DHHC domain containing 8																																				SO:0001583	missense	29801					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding	g.chr22:20128410C>T	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.769C>T	22.37:g.20128410C>T	ENSP00000334490:p.Pro257Ser		Somatic				ZDHHC8_uc002zrr.1_Missense_Mutation_p.P257S|ZDHHC8_uc010gsa.2_Missense_Mutation_p.P63S	p.P257S	NM_013373	NP_037505	WXS	Illumina HiSeq	Unspecified	Q9ULC8	ZDHC8_HUMAN			7	875	+	Colorectal(54;0.0993)		257			Cytoplasmic (Potential).		Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	c.769C>T	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	C	6.431	0.447623	0.12223	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.71579	1.39;-0.58;1.35	5.08	5.08	0.68730	.	0.804538	0.11515	N	0.556298	T	0.48677	0.1513	N	0.08118	0	0.09310	N	1	B;B;B	0.30824	0.22;0.02;0.296	B;B;B	0.25614	0.062;0.03;0.041	T	0.13602	-1.0503	10	0.09590	T	0.72	.	14.3527	0.66713	0.0:1.0:0.0:0.0	.	165;257;257	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	S	257;165;257	ENSP00000334490:P257S;ENSP00000317804:P165S;ENSP00000384716:P257S	ENSP00000317804:P165S	P	+	1	0	ZDHHC8	18508410	0.976000	0.34144	0.924000	0.36721	0.075000	0.17131	3.433000	0.52834	2.515000	0.84797	0.655000	0.94253	CCC		0.627	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373		12	58	0	0	0	0.003163	0	12	58				
TMPRSS6	164656	broad.mit.edu	37	22	37462203	37462203	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr22:37462203G>A	ENST00000346753.3	-	18	2469	c.2353C>T	c.(2353-2355)Ctg>Ttg	p.L785L	TMPRSS6_ENST00000381792.2_Silent_p.L798L|TMPRSS6_ENST00000406725.1_Silent_p.L776L|TMPRSS6_ENST00000406856.1_Silent_p.L798L	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	785	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.L785L(1)		breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CCACAGCCCAGGCCCCAGCTG	0.632																																							uc003aqs.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(4)|ovary(1)|skin(1)	6						c.(2353-2355)CTG>TTG		transmembrane protease, serine 6							34.0	35.0	35.0					22																	37462203		2203	4299	6502	SO:0001819	synonymous_variant	164656				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity	g.chr22:37462203G>A	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2353C>T	22.37:g.37462203G>A			Somatic				TMPRSS6_uc003aqt.1_Silent_p.L798L	p.L785L	NM_153609	NP_705837	WXS	Illumina HiSeq	Unspecified	Q8IU80	TMPS6_HUMAN			18	2467	-			785			Peptidase S1.|Extracellular (Potential).		B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	ENST00000346753.3	37	c.2353C>T	CCDS13941.1																																																																																				0.632	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609		9	26	0	0	0	0.020292	0	9	26				
APOBEC3G	60489	broad.mit.edu	37	22	39477517	39477517	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr22:39477517G>C	ENST00000407997.3	+	4	865	c.508G>C	c.(508-510)Gag>Cag	p.E170Q	APOBEC3G_ENST00000452957.2_Missense_Mutation_p.E170Q|APOBEC3G_ENST00000461827.1_3'UTR	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	170					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E170Q(2)|p.E170K(1)		central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					CAGCCAAAGAGAGCTATTTGA	0.478																																							uc003awx.2		NA																	3	Substitution - Missense(3)	p.E170K(1)	lung(2)|central_nervous_system(1)	central_nervous_system(1)|skin(1)	2						c.(508-510)GAG>CAG		apolipoprotein B mRNA editing enzyme, catalytic							121.0	126.0	124.0					22																	39477517		2203	4300	6503	SO:0001583	missense	60489				base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding	g.chr22:39477517G>C	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.508G>C	22.37:g.39477517G>C	ENSP00000385057:p.Glu170Gln		Somatic				APOBEC3G_uc003awy.2_Missense_Mutation_p.E103Q	p.E170Q	NM_021822	NP_068594	WXS	Illumina HiSeq	Unspecified	Q9HC16	ABC3G_HUMAN			4	850	+	Melanoma(58;0.04)		170					B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	ENST00000407997.3	37	c.508G>C	CCDS13984.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.976762	0.00452	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.65364	-0.15;-0.15	1.73	-3.46	0.04767	APOBEC-like, C-terminal (1);	.	.	.	.	T	0.29588	0.0738	N	0.02181	-0.65	0.09310	N	1	P	0.38863	0.65	B	0.44315	0.446	T	0.16424	-1.0403	9	0.13470	T	0.59	.	0.6689	0.00855	0.4559:0.1757:0.1938:0.1745	.	170	Q9HC16	ABC3G_HUMAN	Q	170	ENSP00000413376:E170Q;ENSP00000385057:E170Q	ENSP00000385057:E170Q	E	+	1	0	APOBEC3G	37807463	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.630000	0.02028	-2.432000	0.00556	-0.513000	0.04457	GAG		0.478	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822		7	283	0	0	0	0.00308	0	7	283				
NCKIPSD	51517	broad.mit.edu	37	3	48716054	48716054	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:48716054C>G	ENST00000294129.2	-	12	2027	c.1908G>C	c.(1906-1908)atG>atC	p.M636I	NCKIPSD_ENST00000416649.2_Missense_Mutation_p.M629I|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.M636I	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	636					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGAGAGCCATCATGTCTGTGT	0.572																																							uc003cun.2		NA																	0					0						c.(1906-1908)ATG>ATC		NCK interacting protein with SH3 domain isoform							124.0	113.0	117.0					3																	48716054		2203	4300	6503	SO:0001583	missense	51517				cytoskeleton organization|NLS-bearing substrate import into nucleus|signal transduction	intermediate filament|nucleus	cytoskeletal protein binding|SH3 domain binding	g.chr3:48716054C>G	AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.1908G>C	3.37:g.48716054C>G	ENSP00000294129:p.Met636Ile		Somatic				NCKIPSD_uc003cum.2_Missense_Mutation_p.M629I	p.M636I	NM_016453	NP_057537	WXS	Illumina HiSeq	Unspecified	Q9NZQ3	SPN90_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	12	2002	-			636					B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	ENST00000294129.2	37	c.1908G>C	CCDS2776.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711848	0.68730	.	.	ENSG00000213672	ENST00000341520;ENST00000416649;ENST00000294129;ENST00000413374	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.37	5.37	0.77165	Domain of unknown function DUF2013 (1);	0.000000	0.85682	U	0.000000	T	0.50735	0.1633	L	0.43923	1.385	0.58432	D	0.999996	P;P	0.49447	0.924;0.907	P;P	0.52957	0.714;0.591	T	0.41466	-0.9507	10	0.38643	T	0.18	.	19.1064	0.93296	0.0:1.0:0.0:0.0	.	636;629	Q9NZQ3;Q9NZQ3-3	SPN90_HUMAN;.	I	636;629;636;92	ENSP00000342621:M636I;ENSP00000389059:M629I;ENSP00000294129:M636I;ENSP00000396683:M92I	ENSP00000294129:M636I	M	-	3	0	NCKIPSD	48691058	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.465000	0.80898	2.499000	0.84300	0.563000	0.77884	ATG		0.572	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	NM_016453		4	116	0	0	0	0.009096	0	4	116				
CEP97	79598	broad.mit.edu	37	3	101476618	101476618	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:101476618G>A	ENST00000341893.3	+	9	1920	c.1168G>A	c.(1168-1170)Gat>Aat	p.D390N	CEP97_ENST00000327230.4_Missense_Mutation_p.D390N|CEP97_ENST00000494050.1_Intron			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	390	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)		p.D390N(4)		cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						CATACAGACGGATGAGGACAA	0.418																																							uc003dvk.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(1168-1170)GAT>AAT		centrosomal protein 97kDa							127.0	109.0	115.0					3																	101476618		2203	4300	6503	SO:0001583	missense	79598					centrosome|nucleus	protein binding	g.chr3:101476618G>A	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1168G>A	3.37:g.101476618G>A	ENSP00000342510:p.Asp390Asn		Somatic				CEP97_uc010hpm.1_Missense_Mutation_p.D356N|CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Missense_Mutation_p.D86N|CEP97_uc003dvm.1_Missense_Mutation_p.D228N	p.D390N	NM_024548	NP_078824	WXS	Illumina HiSeq	Unspecified	Q8IW35	CEP97_HUMAN			9	1195	+			390			CEP110 binding.		B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	37	c.1168G>A	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979038	0.92982	.	.	ENSG00000182504	ENST00000341893;ENST00000327230	T;T	0.63255	-0.03;0.17	5.04	5.04	0.67666	.	0.164432	0.53938	D	0.000057	T	0.76666	0.4019	M	0.65498	2.005	0.54753	D	0.99998	D;D	0.89917	1.0;0.999	D;D	0.68039	0.955;0.928	T	0.75300	-0.3366	10	0.34782	T	0.22	-20.2031	18.3773	0.90439	0.0:0.0:1.0:0.0	.	390;390	Q8IW35-2;Q8IW35	.;CEP97_HUMAN	N	390	ENSP00000342510:D390N;ENSP00000325881:D390N	ENSP00000325881:D390N	D	+	1	0	CEP97	102959308	1.000000	0.71417	0.949000	0.38748	0.939000	0.58152	9.543000	0.98089	2.328000	0.79073	0.313000	0.20887	GAT		0.418	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548		28	123	0	0	0	0.008361	0	28	123				
NFKBIZ	64332	broad.mit.edu	37	3	101572387	101572387	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:101572387C>G	ENST00000326172.5	+	5	1132	c.1017C>G	c.(1015-1017)agC>agG	p.S339R	NFKBIZ_ENST00000326151.5_Intron|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.S239R	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	339	Required for transcriptional activity. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						CAAACCAAAGCTTAGTTTCCC	0.458																																							uc003dvp.2		NA																	0				ovary(2)	2						c.(1015-1017)AGC>AGG		nuclear factor of kappa light polypeptide gene							123.0	124.0	124.0					3																	101572387		2203	4300	6503	SO:0001583	missense	64332				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:101572387C>G	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1017C>G	3.37:g.101572387C>G	ENSP00000325663:p.Ser339Arg		Somatic				NFKBIZ_uc003dvo.2_Missense_Mutation_p.S239R|NFKBIZ_uc010hpo.2_Missense_Mutation_p.S239R|NFKBIZ_uc003dvq.2_Intron	p.S339R	NM_031419	NP_113607	WXS	Illumina HiSeq	Unspecified	Q9BYH8	IKBZ_HUMAN			5	1132	+			339			Required for transcriptional activity (By similarity).		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	37	c.1017C>G	CCDS2946.1	.	.	.	.	.	.	.	.	.	.	C	9.867	1.197811	0.22037	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326172	T;T;T	0.57595	0.43;0.39;0.44	5.66	-1.45	0.08828	.	0.315682	0.34291	N	0.004089	T	0.46425	0.1392	M	0.61703	1.905	0.33234	D	0.556279	P	0.43477	0.808	B	0.41860	0.368	T	0.58589	-0.7610	10	0.30854	T	0.27	-2.567	11.8869	0.52608	0.0:0.6101:0.0:0.3899	.	339	Q9BYH8	IKBZ_HUMAN	R	239;239;339	ENSP00000419800:S239R;ENSP00000377618:S239R;ENSP00000325663:S339R	ENSP00000325663:S339R	S	+	3	2	NFKBIZ	103055077	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	0.445000	0.21677	-0.130000	0.11599	-0.440000	0.05779	AGC		0.458	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419		6	196	0	0	0	0.001168	0	6	196				
DPPA2	151871	broad.mit.edu	37	3	109027921	109027921	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:109027921G>A	ENST00000478945.1	-	5	594	c.348C>T	c.(346-348)atC>atT	p.I116I		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	116	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)	p.I116I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GATAAACTTCGATTTTCTTAG	0.408																																							uc003dxo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(346-348)ATC>ATT		developmental pluripotency associated 2							178.0	171.0	173.0					3																	109027921		2203	4300	6503	SO:0001819	synonymous_variant	151871					nucleus	nucleic acid binding	g.chr3:109027921G>A	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.348C>T	3.37:g.109027921G>A			Somatic					p.I116I	NM_138815	NP_620170	WXS	Illumina HiSeq	Unspecified	Q7Z7J5	DPPA2_HUMAN			5	595	-			116			SAP.		Q8WVF0	Silent	SNP	ENST00000478945.1	37	c.348C>T	CCDS2956.1																																																																																				0.408	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815		11	316	0	0	0	0.008291	0	11	316				
CFAP44	55779	broad.mit.edu	37	3	113120482	113120482	+	Silent	SNP	G	G	A	rs143438550	byFrequency	TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:113120482G>A	ENST00000295868.2	-	10	1437	c.1275C>T	c.(1273-1275)ctC>ctT	p.L425L	WDR52-AS1_ENST00000498480.1_RNA|WDR52-AS1_ENST00000473329.1_RNA|WDR52_ENST00000393845.2_Silent_p.L425L	NM_018338.3	NP_060808.2												p.L425L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TCATAGAGAAGAGATTCACAT	0.363													G|||	3	0.000599042	0.0	0.0014	5008	,	,		14853	0.0		0.002	False		,,,				2504	0.0						uc003eae.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1273-1275)CTC>CTT		WD repeat domain 52 isoform 2		G	,	0,4406		0,0,2203	123.0	121.0	122.0		1275,1275	2.5	1.0	3	dbSNP_134	122	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	WDR52	NM_001164496.1,NM_018338.3	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	425/1855,425/983	113120482	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	55779							g.chr3:113120482G>A																												ENST00000295868.2:c.1275C>T	3.37:g.113120482G>A			Somatic					p.L425L	NM_018338	NP_060808	WXS	Illumina HiSeq	Unspecified	Q96MT7	WDR52_HUMAN			10	1321	-			425						Silent	SNP	ENST00000295868.2	37	c.1275C>T	CCDS2972.1																																																																																				0.363	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3			4	96	0	0	0	0.009096	0	4	96				
PAQR9	344838	broad.mit.edu	37	3	142681704	142681704	+	Missense_Mutation	SNP	C	C	T	rs376511161		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:142681704C>T	ENST00000340634.3	-	1	474	c.475G>A	c.(475-477)Gcg>Acg	p.A159T	RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	159						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.A159T(2)		endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CTGATGGACGCGTAGTCCAGG	0.612																																							uc003evg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(475-477)GCG>ACG		progestin and adipoQ receptor family member IX							40.0	37.0	38.0					3																	142681704		2203	4300	6503	SO:0001583	missense	344838					integral to membrane	receptor activity	g.chr3:142681704C>T	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.475G>A	3.37:g.142681704C>T	ENSP00000341564:p.Ala159Thr		Somatic				PAQR9_uc003evf.1_5'Flank	p.A159T	NM_198504	NP_940906	WXS	Illumina HiSeq	Unspecified	Q6ZVX9	PAQR9_HUMAN			1	475	-			159			Cytoplasmic (Potential).		Q147T6	Missense_Mutation	SNP	ENST00000340634.3	37	c.475G>A	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497154	0.85069	.	.	ENSG00000188582	ENST00000340634	T	0.34275	1.37	4.93	4.04	0.47022	.	0.143965	0.46145	D	0.000312	T	0.54581	0.1867	M	0.74467	2.265	0.43793	D	0.996335	D	0.61080	0.989	P	0.60415	0.874	T	0.55237	-0.8172	10	0.30078	T	0.28	-15.1284	14.9255	0.70875	0.1443:0.8557:0.0:0.0	.	159	Q6ZVX9	PAQR9_HUMAN	T	159	ENSP00000341564:A159T	ENSP00000341564:A159T	A	-	1	0	PAQR9	144164394	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.570000	0.82390	1.188000	0.43014	0.561000	0.74099	GCG		0.612	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504		3	16	0	0	0	0.001168	0	3	16				
CPA3	1359	broad.mit.edu	37	3	148586705	148586705	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr3:148586705G>C	ENST00000296046.3	+	3	200	c.148G>C	c.(148-150)Gac>Cac	p.D50H	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	50					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D50H(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TCTGCAGCTTGACTTCTGGTA	0.428																																							uc003ewm.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(148-150)GAC>CAC		carboxypeptidase A3 precursor							142.0	122.0	129.0					3																	148586705		2203	4300	6503	SO:0001583	missense	1359				proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding	g.chr3:148586705G>C		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.148G>C	3.37:g.148586705G>C	ENSP00000296046:p.Asp50His		Somatic					p.D50H	NM_001870	NP_001861	WXS	Illumina HiSeq	Unspecified	P15088	CBPA3_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)		3	200	+			50					Q96E94	Missense_Mutation	SNP	ENST00000296046.3	37	c.148G>C	CCDS3138.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852740	0.71719	.	.	ENSG00000163751	ENST00000296046	T	0.21932	1.98	5.45	5.45	0.79879	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.054132	0.64402	D	0.000001	T	0.51092	0.1654	M	0.81942	2.565	0.49915	D	0.999833	D	0.89917	1.0	D	0.91635	0.999	T	0.54629	-0.8265	10	0.66056	D	0.02	.	18.0543	0.89360	0.0:0.0:1.0:0.0	.	50	P15088	CBPA3_HUMAN	H	50	ENSP00000296046:D50H	ENSP00000296046:D50H	D	+	1	0	CPA3	150069395	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.255000	0.58804	2.542000	0.85734	0.655000	0.94253	GAC		0.428	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870		5	132	0	0	0	0.014758	0	5	132				
FRYL	285527	broad.mit.edu	37	4	48636353	48636353	+	Silent	SNP	A	A	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:48636353A>C	ENST00000503238.1	-	1	74	c.75T>G	c.(73-75)gcT>gcG	p.A25A	FRYL_ENST00000537810.1_Silent_p.A25A|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Silent_p.A25A|FRYL_ENST00000514783.1_5'Flank|FRYL_ENST00000507711.1_Silent_p.A25A			O94915	FRYL_HUMAN	FRY-like	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.A25A(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CAGCTTGAACAGCAAATTCTG	0.368																																							uc003gyh.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(73-75)GCT>GCG		furry-like							115.0	108.0	110.0					4																	48636353		1854	4091	5945	SO:0001819	synonymous_variant	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48636353A>C	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.75T>G	4.37:g.48636353A>C			Somatic				FRYL_uc003gyk.2_Silent_p.A25A|FRYL_uc003gyl.1_Silent_p.A76A|FRYL_uc003gym.1_Silent_p.A25A	p.A25A	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			4	680	-			25					O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	c.75T>G	CCDS43227.1																																																																																				0.368	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			46	128	0	0	0	0.01441	0	46	128				
THAP6	152815	broad.mit.edu	37	4	76452395	76452395	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:76452395G>C	ENST00000311638.3	+	5	708	c.640G>C	c.(640-642)Gag>Cag	p.E214Q	THAP6_ENST00000514480.1_Missense_Mutation_p.E214Q|THAP6_ENST00000380837.3_Missense_Mutation_p.E172Q|THAP6_ENST00000507885.1_Intron|THAP6_ENST00000504190.1_Intron|THAP6_ENST00000507556.1_Intron|THAP6_ENST00000502620.1_Intron|THAP6_ENST00000507557.1_Intron	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	214						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E214Q(1)		lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CTGTTGTCAGGAGAGCATAGA	0.348																																							uc003him.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(640-642)GAG>CAG		THAP domain containing 6							130.0	134.0	133.0					4																	76452395		2203	4300	6503	SO:0001583	missense	152815					microtubule cytoskeleton	DNA binding|metal ion binding	g.chr4:76452395G>C	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.640G>C	4.37:g.76452395G>C	ENSP00000309007:p.Glu214Gln		Somatic				THAP6_uc003hin.2_Missense_Mutation_p.E172Q|THAP6_uc011cbm.1_Intron|THAP6_uc010iiu.1_Intron|THAP6_uc003hio.1_Intron|THAP6_uc010iiv.2_Missense_Mutation_p.E214Q	p.E214Q	NM_144721	NP_653322	WXS	Illumina HiSeq	Unspecified	Q8TBB0	THAP6_HUMAN	Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)		5	737	+			214					B4E146|Q5HYJ7|Q5JPC6	Missense_Mutation	SNP	ENST00000311638.3	37	c.640G>C	CCDS3568.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756689	0.31137	.	.	ENSG00000174796	ENST00000311638;ENST00000380837;ENST00000514480	D;D;D	0.98876	-4.62;-5.2;-4.62	4.67	2.92	0.33932	.	0.759172	0.11887	N	0.519963	D	0.95478	0.8531	N	0.19112	0.55	0.18873	N	0.999987	B;B	0.09022	0.0;0.002	B;B	0.08055	0.002;0.003	D	0.90349	0.4365	10	0.36615	T	0.2	-16.1821	11.4006	0.49868	0.0:0.3527:0.6473:0.0	.	172;214	Q8TBB0-2;Q8TBB0	.;THAP6_HUMAN	Q	214;172;214	ENSP00000309007:E214Q;ENSP00000370217:E172Q;ENSP00000423720:E214Q	ENSP00000309007:E214Q	E	+	1	0	THAP6	76671419	1.000000	0.71417	0.392000	0.26245	0.838000	0.47535	2.967000	0.49216	0.873000	0.35799	-0.165000	0.13383	GAG		0.348	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721		6	201	0	0	0	0.00308	0	6	201				
CCNI	10983	broad.mit.edu	37	4	77969418	77969418	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:77969418C>T	ENST00000237654.4	-	7	1664	c.1088G>A	c.(1087-1089)gGa>gAa	p.G363E	CCNI_ENST00000537948.1_Missense_Mutation_p.G349E	NM_006835.2	NP_006826.1	Q14094	CCNI_HUMAN	cyclin I	363					regulation of cell cycle (GO:0051726)|spermatogenesis (GO:0007283)			p.G363E(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9						GGAAGCATGTCCCTCTTGTCT	0.418																																							uc003hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1087-1089)GGA>GAA		cyclin I							123.0	119.0	120.0					4																	77969418		2203	4300	6503	SO:0001583	missense	10983				spermatogenesis			g.chr4:77969418C>T	D50310	CCDS3580.1	4q21.1	2014-07-03			ENSG00000118816	ENSG00000118816			1595	protein-coding gene	gene with protein product						7493655	Standard	NM_006835		Approved	CCNI1	uc003hkm.3	Q14094	OTTHUMG00000130106	ENST00000237654.4:c.1088G>A	4.37:g.77969418C>T	ENSP00000237654:p.Gly363Glu		Somatic				CCNI_uc011ccb.1_Missense_Mutation_p.G349E	p.G363E	NM_006835	NP_006826	WXS	Illumina HiSeq	Unspecified	Q14094	CCNI_HUMAN			7	1632	-			363					B2R6M0|B7Z6X4	Missense_Mutation	SNP	ENST00000237654.4	37	c.1088G>A	CCDS3580.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971088	0.74246	.	.	ENSG00000118816	ENST00000237654;ENST00000537948	T;T	0.35789	1.29;1.29	5.57	5.57	0.84162	.	0.096535	0.64402	D	0.000001	T	0.28134	0.0694	L	0.29908	0.895	0.80722	D	1	P;P	0.44281	0.7;0.831	B;B	0.33568	0.133;0.166	T	0.08911	-1.0699	10	0.51188	T	0.08	-15.2107	19.5565	0.95351	0.0:1.0:0.0:0.0	.	349;363	B7Z6X4;Q14094	.;CCNI_HUMAN	E	363;349	ENSP00000237654:G363E;ENSP00000441001:G349E	ENSP00000237654:G363E	G	-	2	0	CCNI	78188442	0.995000	0.38212	1.000000	0.80357	0.971000	0.66376	3.076000	0.50081	2.614000	0.88457	0.563000	0.77884	GGA		0.418	CCNI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252412.2	NM_006835		9	169	0	0	0	0.008291	0	9	169				
CENPE	1062	broad.mit.edu	37	4	104027379	104027379	+	Nonstop_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:104027379C>G	ENST00000265148.3	-	49	8195	c.8106G>C	c.(8104-8106)taG>taC	p.*2702Y	CENPE_ENST00000380026.3_Nonstop_Mutation_p.*2581Y	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	0					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AAAGAGGAGTCTACTGAGTTT	0.468																																							uc003hxb.1		NA																	0				ovary(5)|breast(4)	9						c.(8104-8106)TAG>TAC		centromere protein E							88.0	81.0	83.0					4																	104027379		2203	4300	6503	SO:0001578	stop_lost	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104027379C>G	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.8106G>C	4.37:g.104027379C>G			Somatic				CENPE_uc003hxc.1_Nonstop_Mutation_p.*2581Y	p.*2702Y	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	49	8196	-			2702					A6NKY9|A8K2U7|Q4LE75	Nonstop_Mutation	SNP	ENST00000265148.3	37	c.8106G>C	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.958531	0.34565	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	.	.	.	4.44	1.17	0.20885	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3879	0.16227	0.0:0.5754:0.0:0.4245	.	.	.	.	Y	2702;2581	.	.	X	-	3	2	CENPE	104246828	0.133000	0.22466	0.275000	0.24674	0.874000	0.50279	0.133000	0.15912	0.447000	0.26695	-0.157000	0.13467	TAG		0.468	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				3	139	0	0	0	0.009096	0	3	139				
LRIT3	345193	broad.mit.edu	37	4	110790984	110790984	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:110790984G>A	ENST00000594814.1	+	4	1079	c.1079G>A	c.(1078-1080)aGa>aAa	p.R360K	LRIT3_ENST00000327908.3_Missense_Mutation_p.R177K|LRIT3_ENST00000409621.2_Missense_Mutation_p.R177K|LRIT3_ENST00000379920.3_Missense_Mutation_p.R315K	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	360					regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		ACTTCTGAAAGAACTGGAGAT	0.478																																							uc003hzx.3		NA																	0					0						c.(943-945)AGA>AAA		leucine-rich repeat, immunoglobulin-like and							207.0	195.0	199.0					4																	110790984		2203	4300	6503	SO:0001583	missense	345193					integral to membrane		g.chr4:110790984G>A	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1079G>A	4.37:g.110790984G>A	ENSP00000469759:p.Arg360Lys		Somatic				LRIT3_uc003hzw.3_Missense_Mutation_p.R177K	p.R315K	NM_198506	NP_940908	WXS	Illumina HiSeq	Unspecified	Q3SXY7	LRIT3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0011)	3	1137	+			315					C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	c.944G>A	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	G	4.175	0.031099	0.08101	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.58358	0.34;0.53;0.34	4.92	3.0	0.34707	.	0.839595	0.10736	N	0.640006	T	0.35189	0.0923	L	0.36672	1.1	0.09310	N	1	B;B	0.13145	0.002;0.007	B;B	0.12156	0.002;0.007	T	0.35251	-0.9796	10	0.06625	T	0.88	.	6.1379	0.20243	0.1763:0.1756:0.6481:0.0	.	315;177	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	K	177;315;177	ENSP00000328222:R177K;ENSP00000369252:R315K;ENSP00000386734:R177K	ENSP00000328222:R177K	R	+	2	0	LRIT3	111010433	0.994000	0.37717	0.031000	0.17742	0.005000	0.04900	1.355000	0.34068	2.259000	0.74868	0.655000	0.94253	AGA		0.478	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506		5	404	0	0	0	0.014758	0	5	404				
MAML3	55534	broad.mit.edu	37	4	140641170	140641170	+	Silent	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:140641170C>G	ENST00000509479.2	-	5	3580	c.2724G>C	c.(2722-2724)ggG>ggC	p.G908G	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.G908G(4)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CCATTCCAACCCCCTGCCCAG	0.557																																							uc003ihz.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(1)	1						c.(2707-2709)GGG>GGC		mastermind-like 3							184.0	189.0	187.0					4																	140641170		2006	4185	6191	SO:0001819	synonymous_variant	55534				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity	g.chr4:140641170C>G	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2724G>C	4.37:g.140641170C>G			Somatic				MGST2_uc010ioi.1_Intron|MAML3_uc011chd.1_Silent_p.G371G	p.G903G	NM_018717	NP_061187	WXS	Illumina HiSeq	Unspecified	Q96JK9	MAML3_HUMAN			7	3461	-	all_hematologic(180;0.162)		904			Gln-rich.			Silent	SNP	ENST00000509479.2	37	c.2709G>C	CCDS54805.1																																																																																				0.557	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			96	356	0	0	0	0.01441	0	96	356				
FAM218A	152756	broad.mit.edu	37	4	165878524	165878524	+	Nonsense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr4:165878524C>G	ENST00000513876.2	+	1	425	c.350C>G	c.(349-351)tCa>tGa	p.S117*	TRIM61_ENST00000329314.5_Intron	NM_153027.1	NP_694572.1	Q96MZ4	F218A_HUMAN	family with sequence similarity 218, member A	117								p.S117*(1)									CACTCCAAGTCAGAAGGACCA	0.567																																							uc003iqx.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(349-351)TCA>TGA		hypothetical protein LOC152756							66.0	63.0	64.0					4																	165878524		2203	4300	6503	SO:0001587	stop_gained	152756							g.chr4:165878524C>G	AK056221	CCDS3807.1	4q32.3	2012-03-01	2012-03-01	2012-03-01	ENSG00000250486	ENSG00000250486			26466	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 39"""	C4orf39		12477932	Standard	NM_153027		Approved	FLJ31659	uc003iqx.1	Q96MZ4	OTTHUMG00000161252	ENST00000513876.2:c.350C>G	4.37:g.165878524C>G	ENSP00000427428:p.Ser117*		Somatic				TRIM61_uc003iqw.2_Intron	p.S117*	NM_153027	NP_694572	WXS	Illumina HiSeq	Unspecified	Q96MZ4	CD039_HUMAN		GBM - Glioblastoma multiforme(119;0.146)	1	425	+	all_hematologic(180;0.221)	Prostate(90;0.109)	117						Nonsense_Mutation	SNP	ENST00000513876.2	37	c.350C>G	CCDS3807.1	.	.	.	.	.	.	.	.	.	.	c	17.84	3.488670	0.64074	.	.	ENSG00000250486	ENST00000513876	.	.	.	1.38	-0.933	0.10431	.	.	.	.	.	.	.	.	.	.	.	0.38194	D	0.940007	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.1469	0.06474	0.2987:0.4054:0.296:0.0	.	.	.	.	X	117	.	ENSP00000427428:S117X	S	+	2	0	C4orf39	166097974	0.000000	0.05858	0.000000	0.03702	0.502000	0.33828	-1.772000	0.01787	-0.333000	0.08476	0.187000	0.17357	TCA		0.567	FAM218A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364308.1	NM_153027		5	100	0	0	0	0.001168	0	5	100				
ADAMTS16	170690	broad.mit.edu	37	5	5191834	5191834	+	Missense_Mutation	SNP	G	G	A	rs200827136		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:5191834G>A	ENST00000274181.7	+	8	1382	c.1244G>A	c.(1243-1245)cGc>cAc	p.R415H	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.R415H	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	415	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R415H(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AGTAAATATCGCAGCTGCACG	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		19913	0.001		0.0	False		,,,				2504	0.0						uc003jdl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(1243-1245)CGC>CAC		ADAM metallopeptidase with thrombospondin type 1		G	HIS/ARG	1,3903		0,1,1951	167.0	160.0	162.0		1244	4.7	1.0	5		162	0,8312		0,0,4156	yes	missense	ADAMTS16	NM_139056.2	29	0,1,6107	AA,AG,GG		0.0,0.0256,0.0082	probably-damaging	415/1225	5191834	1,12215	1952	4156	6108	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5191834G>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1244G>A	5.37:g.5191834G>A	ENSP00000274181:p.Arg415His		Somatic				ADAMTS16_uc003jdk.1_Missense_Mutation_p.R415H|ADAMTS16_uc003jdj.1_Missense_Mutation_p.R415H	p.R415H	NM_139056	NP_620687	WXS	Illumina HiSeq	Unspecified	Q8TE57	ATS16_HUMAN			8	1382	+			415			Peptidase M12B.		C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.1244G>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	32	5.167945	0.94768	2.56E-4	0.0	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.87887	-2.31;-2.31	4.74	4.74	0.60224	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	M	0.62209	1.925	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.93291	0.6668	10	0.87932	D	0	.	16.5194	0.84309	0.0:0.0:1.0:0.0	.	415;415;415	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	H	415	ENSP00000274181:R415H;ENSP00000421631:R415H	ENSP00000274181:R415H	R	+	2	0	ADAMTS16	5244834	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.225000	0.95219	2.186000	0.69663	0.655000	0.94253	CGC		0.423	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		10	305	0	0	0	0.008291	0	10	305				
CDH12	1010	broad.mit.edu	37	5	22078683	22078683	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:22078683G>T	ENST00000382254.1	-	5	1189	c.103C>A	c.(103-105)Cca>Aca	p.P35T	CDH12_ENST00000504376.2_Missense_Mutation_p.P35T|CDH12_ENST00000522262.1_Missense_Mutation_p.P35T	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	35					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TTTTCTCTTGGCTCTGTGGCT	0.458										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(103-105)CCA>ACA		cadherin 12, type 2 preproprotein							214.0	211.0	212.0					5																	22078683		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:22078683G>T	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.103C>A	5.37:g.22078683G>T	ENSP00000371689:p.Pro35Thr	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Missense_Mutation_p.P35T|CDH12_uc003jgk.2_Missense_Mutation_p.P35T	p.P35T	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			2	561	-			35					B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.103C>A	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067942	0.36470	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.55760	0.56;0.56;0.5	5.51	2.35	0.29111	.	0.454150	0.25549	N	0.029919	T	0.28200	0.0696	N	0.08118	0	0.32441	N	0.546754	B;B	0.20052	0.001;0.041	B;B	0.16722	0.002;0.016	T	0.23404	-1.0189	10	0.26408	T	0.33	.	8.8582	0.35240	0.3039:0.0:0.6961:0.0	.	35;35	B7Z2U6;P55289	.;CAD12_HUMAN	T	35	ENSP00000423577:P35T;ENSP00000371689:P35T;ENSP00000428786:P35T	ENSP00000371689:P35T	P	-	1	0	CDH12	22114440	0.729000	0.28090	0.996000	0.52242	0.993000	0.82548	0.372000	0.20467	0.700000	0.31782	0.650000	0.86243	CCA		0.458	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		10	371	1	0	0.00244969	0.020292	0.0025532	10	371				
C5orf42	65250	broad.mit.edu	37	5	37169141	37169141	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:37169141G>C	ENST00000508244.1	-	33	7078	c.6985C>G	c.(6985-6987)Caa>Gaa	p.Q2329E	C5orf42_ENST00000425232.2_Missense_Mutation_p.Q2329E|C5orf42_ENST00000274258.7_Missense_Mutation_p.Q1209E			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2329						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GAGTCCTGTTGAGGTGTCAAA	0.383																																							uc011cpa.1		NA																	0				ovary(4)|breast(2)|skin(1)	7						c.(6985-6987)CAA>GAA		hypothetical protein LOC65250							139.0	144.0	142.0					5																	37169141		2203	4300	6503	SO:0001583	missense	65250							g.chr5:37169141G>C		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6985C>G	5.37:g.37169141G>C	ENSP00000421690:p.Gln2329Glu		Somatic				C5orf42_uc011coy.1_Missense_Mutation_p.Q829E|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.Q1404E|C5orf42_uc003jkr.1_Missense_Mutation_p.Q362E	p.Q2329E	NM_023073	NP_075561	WXS	Illumina HiSeq	Unspecified	E9PH94	E9PH94_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)		34	7216	-	all_lung(31;0.000616)		2329					A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	c.6985C>G	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	G	8.726	0.915405	0.17907	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.24723	1.87;1.87;1.84;1.86	5.43	5.43	0.79202	.	0.531660	0.15916	N	0.238395	T	0.21801	0.0525	L	0.43152	1.355	0.09310	N	1	B;B	0.22414	0.004;0.069	B;B	0.17098	0.007;0.017	T	0.07927	-1.0747	10	0.38643	T	0.18	.	9.1689	0.37069	0.0789:0.1478:0.7733:0.0	.	2329;1209	E9PH94;Q9H799	.;CE042_HUMAN	E	2329;2329;1209;1377;1209	ENSP00000421690:Q2329E;ENSP00000389014:Q2329E;ENSP00000274258:Q1209E;ENSP00000424223:Q1377E	ENSP00000274258:Q1209E	Q	-	1	0	C5orf42	37204898	0.723000	0.28027	0.307000	0.25127	0.010000	0.07245	2.835000	0.48175	2.530000	0.85305	0.655000	0.94253	CAA		0.383	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		5	348	0	0	0	0.014758	0	5	348				
ARHGEF28	64283	broad.mit.edu	37	5	73163796	73163796	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:73163796G>A	ENST00000426542.2	+	18	2268	c.2248G>A	c.(2248-2250)Gga>Aga	p.G750R	ARHGEF28_ENST00000296799.4_Missense_Mutation_p.G437R|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.G750R|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.G750R|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.G750R|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.G750R|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.G750R			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	750					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.G750R(4)									GGAGACTGTGGGACAGGTCCA	0.522																																							uc011csq.1		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(2248-2250)GGA>AGA		Rho-guanine nucleotide exchange factor							104.0	99.0	101.0					5																	73163796		1962	4159	6121	SO:0001583	missense	64283				cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding	g.chr5:73163796G>A		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2248G>A	5.37:g.73163796G>A	ENSP00000412175:p.Gly750Arg		Somatic				RGNEF_uc003kcx.2_Missense_Mutation_p.G750R|RGNEF_uc010izf.2_Missense_Mutation_p.G750R|RGNEF_uc011csr.1_Missense_Mutation_p.G437R	p.G750R	NM_001080479	NP_001073948	WXS	Illumina HiSeq	Unspecified	Q8N1W1	RGNEF_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)	18	2259	+		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)	750					B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	c.2248G>A	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	3.051	-0.195442	0.06259	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.10192	3.16;3.16;3.15;2.9;3.16;3.15;3.0	5.67	4.72	0.59763	.	.	.	.	.	T	0.10208	0.0250	L	0.44542	1.39	0.09310	N	1	B;B;B;P	0.36282	0.014;0.027;0.015;0.546	B;B;B;B	0.36244	0.005;0.005;0.019;0.22	T	0.18209	-1.0344	9	0.20519	T	0.43	.	10.1606	0.42849	0.0:0.175:0.6902:0.1348	.	437;750;750;750	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	R	750;750;750;750;750;750;437	ENSP00000296794:G750R;ENSP00000441913:G750R;ENSP00000441436:G750R;ENSP00000287898:G750R;ENSP00000411459:G750R;ENSP00000412175:G750R;ENSP00000296799:G437R	ENSP00000287898:G750R	G	+	1	0	RP11-428C6.1	73199552	0.004000	0.15560	0.021000	0.16686	0.002000	0.02628	1.469000	0.35343	2.671000	0.90904	0.585000	0.79938	GGA		0.522	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1			15	35	0	0	0	0.00499	0	15	35				
DMXL1	1657	broad.mit.edu	37	5	118482991	118482991	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:118482991G>A	ENST00000311085.8	+	17	2817	c.2737G>A	c.(2737-2739)Gaa>Aaa	p.E913K	DMXL1_ENST00000539542.1_Missense_Mutation_p.E913K	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	913								p.E913K(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCAGCCAGAAGAACATTATTC	0.393																																							uc003ksd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2737-2739)GAA>AAA		Dmx-like 1							63.0	68.0	66.0					5																	118482991		2201	4300	6501	SO:0001583	missense	1657							g.chr5:118482991G>A	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2737G>A	5.37:g.118482991G>A	ENSP00000309690:p.Glu913Lys		Somatic				DMXL1_uc010jcl.1_Missense_Mutation_p.E913K	p.E913K	NM_005509	NP_005500	WXS	Illumina HiSeq	Unspecified	Q9Y485	DMXL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)	17	2918	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)	913						Missense_Mutation	SNP	ENST00000311085.8	37	c.2737G>A	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	G	1.516	-0.548232	0.04024	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.30448	1.53;1.53	5.73	3.85	0.44370	.	0.538855	0.21880	N	0.067750	T	0.10380	0.0254	N	0.01874	-0.695	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.26467	-1.0102	10	0.07325	T	0.83	-8.0715	10.4691	0.44626	0.07:0.2354:0.6946:0.0	.	913;913	F5H269;Q9Y485	.;DMXL1_HUMAN	K	913	ENSP00000309690:E913K;ENSP00000439479:E913K	ENSP00000309690:E913K	E	+	1	0	DMXL1	118510890	1.000000	0.71417	0.995000	0.50966	0.124000	0.20399	3.970000	0.56824	1.422000	0.47177	0.591000	0.81541	GAA		0.393	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509		5	117	0	0	0	0.014758	0	5	117				
PCDHB11	56125	broad.mit.edu	37	5	140581561	140581561	+	Silent	SNP	C	C	T	rs372415356		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:140581561C>T	ENST00000354757.3	+	1	2214	c.2214C>T	c.(2212-2214)gaC>gaT	p.D738D	PCDHB11_ENST00000536699.1_Silent_p.D373D	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	738					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D738D(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCTGGTGGACGTGAGCGGCA	0.612																																							uc003liy.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(2212-2214)GAC>GAT		protocadherin beta 11 precursor							111.0	123.0	119.0					5																	140581561		2203	4300	6503	SO:0001819	synonymous_variant	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140581561C>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2214C>T	5.37:g.140581561C>T			Somatic				PCDHB11_uc011daj.1_Silent_p.D373D	p.D738D	NM_018931	NP_061754	WXS	Illumina HiSeq	Unspecified	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2214	+			738			Cytoplasmic (Potential).		B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	c.2214C>T	CCDS4253.1																																																																																				0.612	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		9	264	0	0	0	0.008291	0	9	264				
DOCK2	1794	broad.mit.edu	37	5	169108878	169108878	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:169108878G>C	ENST00000256935.8	+	7	681	c.601G>C	c.(601-603)Gaa>Caa	p.E201Q		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	201					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TATCAAAGAAGAAATGGTGAG	0.373																																							uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(601-603)GAA>CAA		dedicator of cytokinesis 2							110.0	107.0	108.0					5																	169108878		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169108878G>C	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.601G>C	5.37:g.169108878G>C	ENSP00000256935:p.Glu201Gln		Somatic				DOCK2_uc011der.1_RNA	p.E201Q	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	681	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	201					Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.601G>C	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129303	0.77549	.	.	ENSG00000134516	ENST00000256935	T	0.48522	0.81	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.63593	0.2524	L	0.53671	1.685	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	T	0.59726	-0.7400	10	0.28530	T	0.3	.	18.0283	0.89275	0.0:0.0:1.0:0.0	.	201	Q92608	DOCK2_HUMAN	Q	201	ENSP00000256935:E201Q	ENSP00000256935:E201Q	E	+	1	0	DOCK2	169041456	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.412000	0.97347	2.323000	0.78572	0.655000	0.94253	GAA		0.373	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		3	156	0	0	0	0.009096	0	3	156				
KCNIP1	30820	broad.mit.edu	37	5	170159839	170159839	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:170159839G>A	ENST00000411494.1	+	7	504	c.504G>A	c.(502-504)atG>atA	p.M168I	KCNIP1_ENST00000434108.1_Missense_Mutation_p.M182I|KCNIP1_ENST00000328939.4_Missense_Mutation_p.M157I|KCNIP1_ENST00000390656.4_Missense_Mutation_p.M157I|KCNIP1_ENST00000520740.1_Missense_Mutation_p.M129I|KCNIP1_ENST00000377360.4_Missense_Mutation_p.M166I			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	168	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTATGACATGATGGGGAAAT	0.488																																							uc003mas.2		NA																	0				skin(2)	2						c.(502-504)ATG>ATA		Kv channel interacting protein 1 isoform 1							175.0	137.0	150.0					5																	170159839		2203	4300	6503	SO:0001583	missense	30820				detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity	g.chr5:170159839G>A	AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.504G>A	5.37:g.170159839G>A	ENSP00000395323:p.Met168Ile		Somatic				KCNIP1_uc003map.2_Missense_Mutation_p.M166I|KCNIP1_uc003mat.2_Missense_Mutation_p.M157I|KCNIP1_uc010jjp.2_Missense_Mutation_p.M129I|KCNIP1_uc010jjq.2_Missense_Mutation_p.M182I	p.M168I	NM_001034837	NP_001030009	WXS	Illumina HiSeq	Unspecified	Q9NZI2	KCIP1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	1033	+	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	168			EF-hand 3.		B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	ENST00000411494.1	37	c.504G>A	CCDS34286.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918698	0.92249	.	.	ENSG00000182132	ENST00000377360;ENST00000328939;ENST00000390656;ENST00000520740;ENST00000434108;ENST00000411494	T;T;T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53;-0.53;-0.53	5.55	5.55	0.83447	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83096	0.5180	M	0.74546	2.27	0.80722	D	1	D;D;D;D	0.59767	0.986;0.968;0.986;0.972	D;P;P;P	0.67103	0.949;0.908;0.896;0.823	T	0.83152	-0.0103	9	.	.	.	.	17.0026	0.86384	0.0:0.0:1.0:0.0	.	182;157;168;166	Q3YAD0;Q3YAD2;Q9NZI2;Q3YAD3	.;.;KCIP1_HUMAN;.	I	166;157;157;129;182;168	ENSP00000366577:M166I;ENSP00000329686:M157I;ENSP00000375071:M157I;ENSP00000431102:M129I;ENSP00000414886:M182I;ENSP00000395323:M168I	.	M	+	3	0	KCNIP1	170092417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.405000	0.97313	2.591000	0.87537	0.650000	0.86243	ATG		0.488	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371760.1			4	137	0	0	0	0.014758	0	4	137				
SH3PXD2B	285590	broad.mit.edu	37	5	171765853	171765853	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:171765853C>T	ENST00000311601.5	-	13	2426	c.2256G>A	c.(2254-2256)caG>caA	p.Q752Q	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	752	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.Q752Q(2)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGGTCTCTGCTGGGGAGCCT	0.602																																							uc003mbr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(1)	4						c.(2254-2256)CAG>CAA		SH3 and PX domains 2B							41.0	45.0	44.0					5																	171765853		2203	4300	6503	SO:0001819	synonymous_variant	285590				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding	g.chr5:171765853C>T	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2256G>A	5.37:g.171765853C>T			Somatic					p.Q752Q	NM_001017995	NP_001017995	WXS	Illumina HiSeq	Unspecified	A1X283	SPD2B_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		13	2427	-	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	752			Pro-rich.		B6F0V2|Q9P2Q1	Silent	SNP	ENST00000311601.5	37	c.2256G>A	CCDS34291.1																																																																																				0.602	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963		18	108	0	0	0	0.007413	0	18	108				
RNF44	22838	broad.mit.edu	37	5	175959120	175959120	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr5:175959120C>T	ENST00000274811.4	-	3	706	c.182G>A	c.(181-183)cGa>cAa	p.R61Q	RNF44_ENST00000537487.1_5'UTR|RNF44_ENST00000509404.1_5'Flank	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	61	Pro-rich.						zinc ion binding (GO:0008270)	p.R61Q(2)		endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGTGGAGGTCGGGACGGCGG	0.726																																							uc003mek.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(181-183)CGA>CAA		ring finger protein 44							17.0	22.0	21.0					5																	175959120		2193	4288	6481	SO:0001583	missense	22838						zinc ion binding	g.chr5:175959120C>T	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.182G>A	5.37:g.175959120C>T	ENSP00000274811:p.Arg61Gln		Somatic				RNF44_uc011dfo.1_5'UTR|RNF44_uc003mel.1_5'Flank	p.R61Q	NM_014901	NP_055716	WXS	Illumina HiSeq	Unspecified	Q7L0R7	RNF44_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	707	-	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	61			Pro-rich.		B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	37	c.182G>A	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	C	0.228	-1.023528	0.02061	.	.	ENSG00000146083	ENST00000274811	T	0.30981	1.51	3.98	-0.896	0.10557	.	0.185025	0.36303	U	0.002679	T	0.14527	0.0351	N	0.22421	0.69	0.80722	D	1	B	0.10296	0.003	B	0.01281	0.0	T	0.25537	-1.0129	10	0.07813	T	0.8	-3.348	8.8659	0.35286	0.0:0.4573:0.0:0.5427	.	61	Q7L0R7	RNF44_HUMAN	Q	61	ENSP00000274811:R61Q	ENSP00000274811:R61Q	R	-	2	0	RNF44	175891726	0.999000	0.42202	0.002000	0.10522	0.036000	0.12997	0.681000	0.25320	-0.098000	0.12285	-0.254000	0.11334	CGA		0.726	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2			3	18	0	0	0	0.001984	0	3	18				
BTN3A3	10384	broad.mit.edu	37	6	26444280	26444280	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:26444280G>A	ENST00000244519.2	+	4	424	c.181G>A	c.(181-183)Gag>Aag	p.E61K	BTN3A3_ENST00000339789.4_Missense_Mutation_p.E19K|BTN3A3_ENST00000361232.3_Missense_Mutation_p.E19K	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	61	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						CATGAGTGCAGAGACCATGGA	0.572																																							uc003nhz.2		NA																	0					0						c.(181-183)GAG>AAG		butyrophilin, subfamily 3, member A3 isoform a							219.0	185.0	196.0					6																	26444280		2201	4298	6499	SO:0001583	missense	10384					integral to membrane		g.chr6:26444280G>A	U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.181G>A	6.37:g.26444280G>A	ENSP00000244519:p.Glu61Lys		Somatic				BTN3A3_uc003nia.2_Missense_Mutation_p.E19K|BTN3A3_uc011dkn.1_Missense_Mutation_p.E19K	p.E61K	NM_006994	NP_008925	WXS	Illumina HiSeq	Unspecified	O00478	BT3A3_HUMAN			4	361	+			61			Extracellular (Potential).|Ig-like V-type 1.		B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000244519.2	37	c.181G>A	CCDS4611.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898585	0.72639	.	.	ENSG00000111801	ENST00000494393;ENST00000482451;ENST00000244519;ENST00000339789;ENST00000471353;ENST00000361232;ENST00000487627;ENST00000496719;ENST00000490254;ENST00000476281;ENST00000487272	T;T;T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	2.74	0.827	0.18835	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57140	0.2033	L	0.59436	1.845	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.41752	-0.9491	9	0.45353	T	0.12	.	5.4592	0.16607	0.1285:0.2082:0.6634:0.0	.	19;61	E9PCP5;O00478	.;BT3A3_HUMAN	K	61;43;61;19;19;19;19;61;19;19;19	ENSP00000417234:E61K;ENSP00000419312:E43K;ENSP00000244519:E61K;ENSP00000344968:E19K;ENSP00000417717:E19K;ENSP00000355238:E19K;ENSP00000420339:E19K;ENSP00000420147:E61K;ENSP00000419736:E19K;ENSP00000419445:E19K	ENSP00000244519:E61K	E	+	1	0	BTN3A3	26552259	0.000000	0.05858	0.000000	0.03702	0.816000	0.46133	-0.013000	0.12678	0.190000	0.20209	0.555000	0.69702	GAG		0.572	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040116.2	NM_006994		5	252	0	0	0	0.001168	0	5	252				
STK19	8859	broad.mit.edu	37	6	31940210	31940210	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:31940210C>G	ENST00000375333.2	+	2	405	c.352C>G	c.(352-354)Ctg>Gtg	p.L118V	STK19_ENST00000375331.2_Missense_Mutation_p.L118V|DXO_ENST00000375349.3_5'Flank|DXO_ENST00000337523.5_5'Flank|DXO_ENST00000375356.3_5'Flank|DXO_ENST00000478221.1_5'Flank|STK19_ENST00000463823.1_3'UTR	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	118					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			skin(5)|upper_aerodigestive_tract(2)	7						GAGGCATCACCTGATCCCGGA	0.592																																							uc003nyv.2		NA																	0				skin(4)	4						c.(352-354)CTG>GTG		serine/threonine kinase 19 isoform 2							67.0	76.0	73.0					6																	31940210		1511	2709	4220	SO:0001583	missense	8859					nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:31940210C>G	X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.352C>G	6.37:g.31940210C>G	ENSP00000364482:p.Leu118Val		Somatic				DOM3Z_uc003nyo.1_5'Flank|DOM3Z_uc003nyp.1_5'Flank|DOM3Z_uc003nyq.1_5'Flank|DOM3Z_uc003nyr.1_5'Flank|DOM3Z_uc003nys.1_5'Flank|DOM3Z_uc010jtl.1_5'Flank|STK19_uc003nyt.2_Missense_Mutation_p.L75V|DOM3Z_uc003nyu.1_5'Flank|STK19_uc011dow.1_Missense_Mutation_p.L118V|STK19_uc011dox.1_Missense_Mutation_p.L75V|STK19_uc003nyw.2_Missense_Mutation_p.L118V|STK19_uc010jtn.1_RNA	p.L118V	NM_032454	NP_115830	WXS	Illumina HiSeq	Unspecified	P49842	STK19_HUMAN			2	480	+			118					A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Missense_Mutation	SNP	ENST00000375333.2	37	c.352C>G	CCDS4733.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089471	0.36855	.	.	ENSG00000204344	ENST00000375331;ENST00000375333	T;T	0.39787	1.06;1.06	4.51	0.514	0.17007	.	0.000000	0.64402	D	0.000009	T	0.26448	0.0646	L	0.32530	0.975	0.23645	N	0.99722	P;D;D;P;P	0.64830	0.793;0.994;0.98;0.793;0.908	B;D;P;B;B	0.63877	0.35;0.919;0.701;0.35;0.368	T	0.09250	-1.0683	10	0.66056	D	0.02	-10.994	4.3457	0.11131	0.1651:0.616:0.0:0.2189	.	75;118;118;118;75	C9IZ87;B4E0M4;P49842-2;P49842;B7ZLI8	.;.;.;STK19_HUMAN;.	V	118	ENSP00000364480:L118V;ENSP00000364482:L118V	ENSP00000364480:L118V	L	+	1	2	STK19	32048189	0.277000	0.24220	0.003000	0.11579	0.051000	0.14879	0.430000	0.21428	-0.023000	0.13963	0.655000	0.94253	CTG		0.592	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076484.3			4	183	0	0	0	0.009096	0	4	183				
FILIP1	27145	broad.mit.edu	37	6	76063272	76063272	+	Silent	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:76063272C>T	ENST00000237172.7	-	4	942	c.612G>A	c.(610-612)ctG>ctA	p.L204L	FILIP1_ENST00000393004.2_Silent_p.L204L|FILIP1_ENST00000370020.1_Silent_p.L105L	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	204								p.L204L(2)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GCTCCTGCTCCAGCAGGTTGG	0.527																																							uc003pia.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|ovary(1)	4						c.(610-612)CTG>CTA		filamin A interacting protein 1							225.0	204.0	211.0					6																	76063272		2203	4300	6503	SO:0001819	synonymous_variant	27145							g.chr6:76063272C>T	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.612G>A	6.37:g.76063272C>T			Somatic				FILIP1_uc003phy.1_Silent_p.L204L|FILIP1_uc003phz.2_Silent_p.L105L|FILIP1_uc010kbe.2_Silent_p.L207L	p.L204L	NM_015687	NP_056502	WXS	Illumina HiSeq	Unspecified	Q7Z7B0	FLIP1_HUMAN			4	985	-			204			Potential.		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	c.612G>A	CCDS4984.1																																																																																				0.527	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179		86	312	0	0	0	0.01441	0	86	312				
AHI1	54806	broad.mit.edu	37	6	135787398	135787398	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:135787398C>G	ENST00000367800.4	-	5	519	c.303G>C	c.(301-303)ttG>ttC	p.L101F	AHI1_ENST00000457866.2_Missense_Mutation_p.L101F|AHI1_ENST00000327035.6_Missense_Mutation_p.L101F	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	101					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		GTGTGTTCCTCAATTTGTTTT	0.398																																							uc003qgi.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(301-303)TTG>TTC		Abelson helper integration site 1 isoform a							250.0	228.0	235.0					6																	135787398		1894	4123	6017	SO:0001583	missense	54806					adherens junction|cilium|microtubule basal body		g.chr6:135787398C>G	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.303G>C	6.37:g.135787398C>G	ENSP00000356774:p.Leu101Phe		Somatic				AHI1_uc003qgh.2_Missense_Mutation_p.L101F|AHI1_uc003qgj.2_Missense_Mutation_p.L101F|AHI1_uc003qgk.3_RNA|AHI1_uc003qgl.3_Missense_Mutation_p.L101F	p.L101F	NM_001134831	NP_001128303	WXS	Illumina HiSeq	Unspecified	Q8N157	AHI1_HUMAN		GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)	7	687	-	Breast(56;0.239)|Colorectal(23;0.24)		101					E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	c.303G>C	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	C	4.472	0.087415	0.08583	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	T;T;T;T;T	0.51574	0.96;0.96;0.96;0.96;0.7	5.36	0.642	0.17765	.	0.730259	0.11444	N	0.563408	T	0.20901	0.0503	L	0.47716	1.5	0.09310	N	0.999999	B;B	0.33857	0.429;0.303	B;B	0.40228	0.323;0.172	T	0.35425	-0.9789	10	0.56958	D	0.05	0.9082	2.3253	0.04222	0.1225:0.2773:0.3726:0.2275	.	101;101	Q8N157-2;Q8N157	.;AHI1_HUMAN	F	101;101;101;101;101;83	ENSP00000356774:L101F;ENSP00000388650:L101F;ENSP00000265602:L101F;ENSP00000322478:L101F;ENSP00000433063:L83F	ENSP00000265602:L101F	L	-	3	2	AHI1	135829091	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.234000	0.09028	-0.046000	0.13446	0.585000	0.79938	TTG		0.398	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651		8	416	0	0	0	0.004482	0	8	416				
NMBR	4829	broad.mit.edu	37	6	142409491	142409491	+	Missense_Mutation	SNP	G	G	C	rs556376921		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:142409491G>C	ENST00000258042.1	-	1	445	c.305C>G	c.(304-306)tCg>tGg	p.S102W	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	102					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.S102W(1)|p.S102L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GAAGTAGCGCGAGGCGTCCAC	0.592																																							uc003qiu.2		NA																	2	Substitution - Missense(2)		ovary(1)|lung(1)	central_nervous_system(3)|breast(1)	4						c.(304-306)TCG>TGG		neuromedin B receptor							74.0	63.0	67.0					6																	142409491		2203	4300	6503	SO:0001583	missense	4829				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity	g.chr6:142409491G>C		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.305C>G	6.37:g.142409491G>C	ENSP00000258042:p.Ser102Trp		Somatic					p.S102W	NM_002511	NP_002502	WXS	Illumina HiSeq	Unspecified	P28336	NMBR_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)	1	446	-	Breast(32;0.155)		102			Extracellular (Potential).		E9KL38|Q5VUK8	Missense_Mutation	SNP	ENST00000258042.1	37	c.305C>G	CCDS5196.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827746	0.71143	.	.	ENSG00000135577	ENST00000258042	T	0.73152	-0.72	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.051799	0.85682	D	0.000000	T	0.77751	0.4177	M	0.73217	2.22	0.58432	D	0.999994	D	0.71674	0.998	D	0.71184	0.972	T	0.76418	-0.2966	10	0.40728	T	0.16	-14.389	13.2433	0.60010	0.0728:0.0:0.9272:0.0	.	102	P28336	NMBR_HUMAN	W	102	ENSP00000258042:S102W	ENSP00000258042:S102W	S	-	2	0	NMBR	142451184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.552000	0.53705	2.813000	0.96785	0.655000	0.94253	TCG		0.592	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1			4	75	0	0	0	0.009096	0	4	75				
MLLT4	4301	broad.mit.edu	37	6	168349093	168349093	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr6:168349093T>C	ENST00000447894.2	+	28	3745	c.3745T>C	c.(3745-3747)Tgg>Cgg	p.W1249R	MLLT4_ENST00000392108.3_Missense_Mutation_p.W1249R|MLLT4_ENST00000400822.3_Missense_Mutation_p.W1248R|MLLT4_ENST00000366806.2_Missense_Mutation_p.W1249R|MLLT4_ENST00000392112.1_Missense_Mutation_p.W1232R|MLLT4_ENST00000351017.4_Missense_Mutation_p.W1256R|MLLT4_ENST00000344191.4_Missense_Mutation_p.W1249R			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1249					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.W1249G(1)|p.W1233G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCAGAACCAGTGGCCAAATTA	0.458			T	MLL	AL																																		uc003qwd.2		NA		Dom	yes		6	6q27	4301	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""			L	MLL		AL		2	Substitution - Missense(2)		kidney(2)	ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5						c.(3742-3744)TGG>CGG		myeloid/lymphoid or mixed-lineage leukemia							90.0	85.0	87.0					6																	168349093		2203	4300	6503	SO:0001583	missense	4301				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding	g.chr6:168349093T>C	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3745T>C	6.37:g.168349093T>C	ENSP00000404595:p.Trp1249Arg		Somatic				MLLT4_uc003qwb.1_Missense_Mutation_p.W1233R|MLLT4_uc003qwc.1_Missense_Mutation_p.W1249R|MLLT4_uc003qwg.1_Missense_Mutation_p.W558R	p.W1248R	NM_001040001	NP_001035090	WXS	Illumina HiSeq	Unspecified	P55196	AFAD_HUMAN		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	28	3884	+		Breast(66;1.07e-05)|Ovarian(120;0.024)	1249					O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37	c.3742T>C		.	.	.	.	.	.	.	.	.	.	T	20.1	3.937220	0.73557	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04917	3.74;3.62;3.74;3.72;3.53;3.62;3.62	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.16471	0.0396	M	0.72479	2.2	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.998;0.999;0.999;0.985	T	0.00605	-1.1648	10	0.54805	T	0.06	-2.0E-4	15.6454	0.77046	0.0:0.0:0.0:1.0	.	1249;1248;1249;1233	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	R	1249;1256;1249;1249;1232;1249;1248;1249	ENSP00000341118:W1249R;ENSP00000252692:W1256R;ENSP00000375956:W1249R;ENSP00000355771:W1249R;ENSP00000375960:W1232R;ENSP00000383623:W1248R;ENSP00000404595:W1249R	ENSP00000345834:W1249R	W	+	1	0	MLLT4	168091942	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.491000	0.66887	2.084000	0.62774	0.533000	0.62120	TGG		0.458	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936		4	89	0	0	0	0.009096	0	4	89				
ABCA13	154664	broad.mit.edu	37	7	48312734	48312734	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:48312734C>G	ENST00000435803.1	+	17	3495	c.3471C>G	c.(3469-3471)atC>atG	p.I1157M		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1157					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GGACTGAAATCTGGGAAACCA	0.363																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(3469-3471)ATC>ATG		ATP binding cassette, sub-family A (ABC1),							99.0	95.0	96.0					7																	48312734		1838	4087	5925	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48312734C>G	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3471C>G	7.37:g.48312734C>G	ENSP00000411096:p.Ile1157Met		Somatic				ABCA13_uc010kyr.2_Missense_Mutation_p.I660M	p.I1157M	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			17	3496	+			1157					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.3471C>G	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	8.010	0.757377	0.15846	.	.	ENSG00000179869	ENST00000435803	D	0.89875	-2.58	5.64	2.69	0.31865	.	0.275521	0.25068	N	0.033386	D	0.85128	0.5626	L	0.55481	1.735	0.34171	D	0.669759	P	0.38250	0.624	B	0.43360	0.417	D	0.83630	0.0144	9	.	.	.	.	3.7959	0.08738	0.1708:0.5585:0.0:0.2707	.	1157	Q86UQ4	ABCAD_HUMAN	M	1157	ENSP00000411096:I1157M	.	I	+	3	3	ABCA13	48283280	1.000000	0.71417	0.162000	0.22713	0.379000	0.30106	1.349000	0.33998	0.853000	0.35312	-0.253000	0.11424	ATC		0.363	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		4	152	0	0	0	0.014758	0	4	152				
AKAP9	10142	broad.mit.edu	37	7	91709069	91709069	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:91709069T>C	ENST00000359028.2	+	32	7883	c.7658T>C	c.(7657-7659)gTa>gCa	p.V2553A	AKAP9_ENST00000356239.3_Missense_Mutation_p.V2541A|AKAP9_ENST00000358100.2_Missense_Mutation_p.V2553A			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2553	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAGAAGATTGTAAACCTACAG	0.358			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		0				breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(7621-7623)GTA>GCA		A-kinase anchor protein 9 isoform 2							45.0	46.0	46.0					7																	91709069		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91709069T>C	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7658T>C	7.37:g.91709069T>C	ENSP00000351922:p.Val2553Ala		Somatic				AKAP9_uc003ulf.2_Missense_Mutation_p.V2533A|AKAP9_uc003uli.2_Missense_Mutation_p.V2164A|AKAP9_uc003ulj.2_Missense_Mutation_p.V311A	p.V2541A	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		31	7847	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		2553			Potential.|Glu-rich.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.7622T>C		.	.	.	.	.	.	.	.	.	.	T	2.955	-0.215875	0.06101	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03272	4.08;4.08;4.08;3.99	4.65	0.735	0.18300	.	1.303160	0.05823	N	0.616158	T	0.02230	0.0069	N	0.20685	0.6	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.002;0.002	T	0.45673	-0.9245	10	0.06891	T	0.86	.	2.2871	0.04129	0.1244:0.1565:0.1278:0.5913	.	2545;2553;2541;2533	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	A	2541;2553;2553;2545;387	ENSP00000348573:V2541A;ENSP00000351922:V2553A;ENSP00000350813:V2553A;ENSP00000378042:V387A	ENSP00000348573:V2541A	V	+	2	0	AKAP9	91547005	0.000000	0.05858	0.943000	0.38184	0.322000	0.28314	0.154000	0.16343	0.391000	0.25143	0.482000	0.46254	GTA		0.358	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		3	89	0	0	0	0.014758	0	3	89				
ZKSCAN1	7586	broad.mit.edu	37	7	99631162	99631162	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:99631162G>C	ENST00000324306.6	+	6	1268	c.1034G>C	c.(1033-1035)aGa>aCa	p.R345T	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.R132T|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.R309T	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R345T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ACAGGAGAGAGAGGTCCAAGG	0.483																																							uc003usk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1033-1035)AGA>ACA		zinc finger protein 36							72.0	78.0	76.0					7																	99631162		2203	4300	6503	SO:0001583	missense	7586				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99631162G>C	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1034G>C	7.37:g.99631162G>C	ENSP00000323148:p.Arg345Thr		Somatic				ZKSCAN1_uc003usl.1_Missense_Mutation_p.R309T|ZKSCAN1_uc003usm.1_Missense_Mutation_p.R132T	p.R345T	NM_003439	NP_003430	WXS	Illumina HiSeq	Unspecified	P17029	ZKSC1_HUMAN	STAD - Stomach adenocarcinoma(171;0.129)		6	1253	+	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		345					A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	c.1034G>C	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104542	0.37145	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.08282	3.21;3.18;3.11	5.57	3.66	0.41972	.	0.000000	0.56097	D	0.000026	T	0.08268	0.0206	L	0.42529	1.33	0.31886	N	0.617786	P	0.52842	0.956	B	0.44224	0.444	T	0.09930	-1.0652	10	0.62326	D	0.03	.	5.5609	0.17144	0.1715:0.164:0.6644:0.0	.	345	P17029	ZKSC1_HUMAN	T	345;309;132	ENSP00000323148:R345T;ENSP00000409172:R309T;ENSP00000443508:R132T	ENSP00000323148:R345T	R	+	2	0	ZKSCAN1	99469098	0.295000	0.24389	0.672000	0.29872	0.117000	0.20001	-0.725000	0.04942	1.501000	0.48654	-0.145000	0.13849	AGA		0.483	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439		4	69	0	0	0	0.009096	0	4	69				
ZKSCAN1	7586	broad.mit.edu	37	7	99631261	99631261	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:99631261G>A	ENST00000324306.6	+	6	1367	c.1133G>A	c.(1132-1134)aGa>aAa	p.R378K	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.R165K|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.R342K	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R378K(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			AAGTCTCACAGATGTGATGAA	0.473																																							uc003usk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1132-1134)AGA>AAA		zinc finger protein 36							76.0	77.0	77.0					7																	99631261		2203	4300	6503	SO:0001583	missense	7586				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99631261G>A	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1133G>A	7.37:g.99631261G>A	ENSP00000323148:p.Arg378Lys		Somatic				ZKSCAN1_uc003usl.1_Missense_Mutation_p.R342K|ZKSCAN1_uc003usm.1_Missense_Mutation_p.R165K	p.R378K	NM_003439	NP_003430	WXS	Illumina HiSeq	Unspecified	P17029	ZKSC1_HUMAN	STAD - Stomach adenocarcinoma(171;0.129)		6	1352	+	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		378			C2H2-type 1.		A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	c.1133G>A	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104273	0.20632	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.13307	2.6;2.6;2.6	5.18	4.3	0.51218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.094112	0.44483	D	0.000448	T	0.03651	0.0104	N	0.01686	-0.76	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46596	-0.9180	10	0.02654	T	1	.	6.812	0.23809	0.0916:0.1792:0.7292:0.0	.	378	P17029	ZKSC1_HUMAN	K	378;342;165	ENSP00000323148:R378K;ENSP00000409172:R342K;ENSP00000443508:R165K	ENSP00000323148:R378K	R	+	2	0	ZKSCAN1	99469197	0.002000	0.14202	0.873000	0.34254	0.987000	0.75469	0.085000	0.14912	2.868000	0.98415	0.557000	0.71058	AGA		0.473	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439		6	120	0	0	0	0.00308	0	6	120				
SLC26A3	1811	broad.mit.edu	37	7	107416986	107416986	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:107416986A>G	ENST00000340010.5	-	15	1772	c.1588T>C	c.(1588-1590)Tat>Cat	p.Y530H	SLC26A3_ENST00000422236.2_Missense_Mutation_p.Y495H	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	530	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.Y530H(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TCTGGCTCATACATCTGTAAG	0.378																																							uc003ver.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(1588-1590)TAT>CAT		solute carrier family 26, member 3							118.0	109.0	112.0					7																	107416986		2203	4300	6503	SO:0001583	missense	1811				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr7:107416986A>G	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1588T>C	7.37:g.107416986A>G	ENSP00000345873:p.Tyr530His		Somatic				SLC26A3_uc003ves.2_Missense_Mutation_p.Y495H	p.Y530H	NM_000111	NP_000102	WXS	Illumina HiSeq	Unspecified	P40879	S26A3_HUMAN			15	1799	-			530			STAS.			Missense_Mutation	SNP	ENST00000340010.5	37	c.1588T>C	CCDS5748.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683486	0.29872	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.88277	-2.36;-2.36	5.82	5.82	0.92795	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.376195	0.30959	N	0.008521	D	0.93216	0.7839	M	0.67953	2.075	0.46167	D	0.998908	D;D	0.71674	0.998;0.994	D;D	0.70487	0.969;0.942	D	0.92212	0.5777	10	0.33940	T	0.23	.	16.1726	0.81828	1.0:0.0:0.0:0.0	.	495;530	G5E9U3;P40879	.;S26A3_HUMAN	H	495;530	ENSP00000415817:Y495H;ENSP00000345873:Y530H	ENSP00000345873:Y530H	Y	-	1	0	SLC26A3	107204222	1.000000	0.71417	0.984000	0.44739	0.071000	0.16799	5.793000	0.69060	2.232000	0.73038	0.482000	0.46254	TAT		0.378	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		36	80	0	0	0	0.00623	0	36	80				
CAPZA2	830	broad.mit.edu	37	7	116546335	116546335	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:116546335G>C	ENST00000361183.3	+	6	584	c.445G>C	c.(445-447)Gat>Cat	p.D149H	CAPZA2_ENST00000458284.2_Intron	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2	149					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.D149H(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			CAAAAAAATAGATGGACAGCA	0.323																																							uc003vil.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(445-447)GAT>CAT		capping protein (actin filament) muscle Z-line,							70.0	73.0	72.0					7																	116546335		2203	4300	6503	SO:0001583	missense	830				actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex	actin binding	g.chr7:116546335G>C		CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.445G>C	7.37:g.116546335G>C	ENSP00000354947:p.Asp149His		Somatic				CAPZA2_uc011knk.1_Intron	p.D149H	NM_006136	NP_006127	WXS	Illumina HiSeq	Unspecified	P47755	CAZA2_HUMAN	GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)		6	548	+	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		149					B4DG50	Missense_Mutation	SNP	ENST00000361183.3	37	c.445G>C	CCDS5768.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593772	0.86953	.	.	ENSG00000198898	ENST00000361183	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.79203	0.4406	M	0.72894	2.215	0.80722	D	1	D	0.53151	0.958	D	0.65684	0.937	T	0.79276	-0.1870	9	0.66056	D	0.02	-7.7333	20.1553	0.98111	0.0:0.0:1.0:0.0	.	149	P47755	CAZA2_HUMAN	H	149	.	ENSP00000354947:D149H	D	+	1	0	CAPZA2	116333571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.519000	0.98025	2.838000	0.97847	0.591000	0.81541	GAT		0.323	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059506.4	NM_006136		5	100	0	0	0	0.001984	0	5	100				
KCND2	3751	broad.mit.edu	37	7	119914821	119914821	+	Silent	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:119914821G>C	ENST00000331113.4	+	1	1100	c.135G>C	c.(133-135)ctG>ctC	p.L45L		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	45					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.L45L(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCATTGTGCTGAATGTGAGTG	0.602																																							uc003vjj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(133-135)CTG>CTC		potassium voltage-gated channel, Shal-related							130.0	140.0	136.0					7																	119914821		2203	4300	6503	SO:0001819	synonymous_variant	3751				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding	g.chr7:119914821G>C	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.135G>C	7.37:g.119914821G>C			Somatic					p.L45L	NM_012281	NP_036413	WXS	Illumina HiSeq	Unspecified	Q9NZV8	KCND2_HUMAN			1	1100	+	all_neural(327;0.117)		45			Cytoplasmic (Potential).		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	c.135G>C	CCDS5776.1																																																																																				0.602	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		8	463	0	0	0	0.00308	0	8	463				
WDR91	29062	broad.mit.edu	37	7	134896244	134896244	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:134896244G>A	ENST00000354475.4	-	1	42	c.11C>T	c.(10-12)gCc>gTc	p.A4V	WDR91_ENST00000423565.1_5'Flank|WDR91_ENST00000344400.5_Missense_Mutation_p.A4V	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	4								p.A4V(2)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GCGCTCCACGGCCTCCGCCAT	0.706																																							uc003vsp.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|ovary(1)|skin(1)	4						c.(10-12)GCC>GTC		WD repeat domain 91							36.0	37.0	37.0					7																	134896244		2203	4299	6502	SO:0001583	missense	29062							g.chr7:134896244G>A	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.11C>T	7.37:g.134896244G>A	ENSP00000346466:p.Ala4Val		Somatic					p.A4V	NM_014149	NP_054868	WXS	Illumina HiSeq	Unspecified	A4D1P6	WDR91_HUMAN			1	73	-			4					A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	c.11C>T	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	G	37	6.008108	0.97195	.	.	ENSG00000105875	ENST00000344400;ENST00000354475	T;T	0.68331	1.22;-0.32	4.98	4.98	0.66077	.	0.248834	0.39615	N	0.001318	T	0.61337	0.2339	L	0.45698	1.435	0.80722	D	1	P	0.36144	0.539	B	0.33568	0.166	T	0.63829	-0.6548	10	0.44086	T	0.13	-5.92	18.0315	0.89286	0.0:0.0:1.0:0.0	.	4	A4D1P6	WDR91_HUMAN	V	4	ENSP00000340877:A4V;ENSP00000346466:A4V	ENSP00000340877:A4V	A	-	2	0	WDR91	134546784	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	6.294000	0.72738	2.593000	0.87608	0.655000	0.94253	GCC		0.706	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149		12	57	0	0	0	0.003163	0	12	57				
PTN	5764	broad.mit.edu	37	7	136938242	136938242	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:136938242C>A	ENST00000348225.2	-	3	685	c.258G>T	c.(256-258)aaG>aaT	p.K86N	PTN_ENST00000393083.2_Missense_Mutation_p.K86N	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	86					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)	p.K86N(2)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						TGCAGGGGATCTTACATCTCT	0.502																																							uc003vtq.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(256-258)AAG>AAT		pleiotrophin							151.0	127.0	135.0					7																	136938242		2203	4300	6503	SO:0001583	missense	5764				nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity	g.chr7:136938242C>A	M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.258G>T	7.37:g.136938242C>A	ENSP00000341170:p.Lys86Asn		Somatic				PTN_uc010lmx.2_Missense_Mutation_p.K86N|PTN_uc003vtr.1_Missense_Mutation_p.K86N	p.K86N	NM_002825	NP_002816	WXS	Illumina HiSeq	Unspecified	P21246	PTN_HUMAN			3	621	-			86					Q5U0B0|Q6ICQ5|Q9UCC6	Missense_Mutation	SNP	ENST00000348225.2	37	c.258G>T	CCDS5844.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388753	0.82902	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	5.65	5.65	0.86999	Midkine heparin-binding growth factor, N-terminal (3);Midkine heparin-binding growth factor, conserved site (1);Midkine heparin-binding growth factor, disulphide-rich domain (1);	0.042575	0.85682	D	0.000000	T	0.75199	0.3817	L	0.46157	1.445	0.58432	D	0.999993	D;D	0.76494	0.999;0.998	D;D	0.72982	0.979;0.945	T	0.74694	-0.3579	9	0.52906	T	0.07	-16.9889	19.733	0.96192	0.0:1.0:0.0:0.0	.	86;86	C9JR52;P21246	.;PTN_HUMAN	N	86	.	ENSP00000341170:K86N	K	-	3	2	PTN	136588782	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.850000	0.55918	2.665000	0.90641	0.585000	0.79938	AAG		0.502	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825		43	128	1	0	2.46787e-29	0.01441	2.70552e-29	43	128				
KMT2C	58508	broad.mit.edu	37	7	152012354	152012354	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:152012354G>A	ENST00000262189.6	-	4	677	c.459C>T	c.(457-459)ttC>ttT	p.F153F	KMT2C_ENST00000355193.2_Silent_p.F153F	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	153					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCGTTATTCTGAATTGTTTTA	0.383																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(457-459)TTC>TTT		myeloid/lymphoid or mixed-lineage leukemia 3							199.0	182.0	187.0					7																	152012354		2203	4300	6503	SO:0001819	synonymous_variant	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:152012354G>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.459C>T	7.37:g.152012354G>A			Somatic					p.F153F	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	4	678	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	153					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	c.459C>T	CCDS5931.1																																																																																				0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			5	228	0	0	0	0.001168	0	5	228				
ESYT2	57488	broad.mit.edu	37	7	158552780	158552780	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:158552780G>T	ENST00000251527.5	-	12	1501	c.1436C>A	c.(1435-1437)aCg>aAg	p.T479K		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	507					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.T479K(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TGGCATTAACGTGAGCCACTC	0.458																																							uc003wob.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|kidney(1)	3						c.(1435-1437)ACG>AAG		family with sequence similarity 62 (C2 domain							169.0	137.0	148.0					7																	158552780		2203	4300	6503	SO:0001583	missense	57488					integral to membrane|plasma membrane		g.chr7:158552780G>T	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1436C>A	7.37:g.158552780G>T	ENSP00000251527:p.Thr479Lys		Somatic				ESYT2_uc003woc.1_Missense_Mutation_p.T303K|ESYT2_uc003wod.1_Missense_Mutation_p.T479K|ESYT2_uc003woa.1_Missense_Mutation_p.T35K	p.T479K	NM_020728	NP_065779	WXS	Illumina HiSeq	Unspecified	A0FGR8	ESYT2_HUMAN			12	1502	-			507					A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	c.1436C>A	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053089	0.75960	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000429474	T;T	0.19669	2.13;2.14	4.9	4.9	0.64082	.	0.152021	0.64402	D	0.000013	T	0.36635	0.0974	L	0.36672	1.1	0.80722	D	1	D;D	0.64830	0.994;0.985	D;P	0.65987	0.94;0.813	T	0.13548	-1.0505	10	0.72032	D	0.01	-15.6991	17.4304	0.87538	0.0:0.0:1.0:0.0	.	507;479	A0FGR8-6;A0FGR8-2	.;.	K	479;507;449;303	ENSP00000251527:T479K;ENSP00000275418:T449K	ENSP00000251527:T479K	T	-	2	0	ESYT2	158245541	1.000000	0.71417	0.101000	0.21167	0.342000	0.28953	9.112000	0.94314	2.420000	0.82092	0.585000	0.79938	ACG		0.458	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728		20	104	1	0	2.70639e-06	0.014323	2.86104e-06	20	104				
PPP1R42	286187	broad.mit.edu	37	8	67923043	67923043	+	Silent	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr8:67923043G>A	ENST00000324682.5	-	5	603	c.459C>T	c.(457-459)atC>atT	p.I153I	PPP1R42_ENST00000517834.1_5'Flank|PPP1R42_ENST00000522909.1_Silent_p.I153I	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	153					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										TATTATTGCTGATATTCAATA	0.323																																							uc003xxc.2		NA																	0					0						c.(457-459)ATC>ATT		leucine rich repeat containing 67							61.0	63.0	62.0					8																	67923043		2203	4288	6491	SO:0001819	synonymous_variant	286187							g.chr8:67923043G>A	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.459C>T	8.37:g.67923043G>A			Somatic					p.I153I	NM_001013626	NP_001013648	WXS	Illumina HiSeq	Unspecified	Q7Z4L9	LRC67_HUMAN			5	604	-			153			LRR 6.			Silent	SNP	ENST00000324682.5	37	c.459C>T	CCDS34902.1																																																																																				0.323	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626		5	133	0	0	0	0.001984	0	5	133				
TRPA1	8989	broad.mit.edu	37	8	72948555	72948555	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr8:72948555G>C	ENST00000262209.4	-	21	2730	c.2523C>G	c.(2521-2523)ttC>ttG	p.F841L	TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000524152.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	841					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TCATCCAATAGAAGTAAACAG	0.343																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(2521-2523)TTC>TTG		ankyrin-like protein 1	Menthol(DB00825)						61.0	61.0	61.0					8																	72948555		2203	4300	6503	SO:0001583	missense	8989					integral to plasma membrane		g.chr8:72948555G>C	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2523C>G	8.37:g.72948555G>C	ENSP00000262209:p.Phe841Leu		Somatic				uc011lff.1_Intron|uc003xyy.2_Intron	p.F841L	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		21	2698	-			841			Helical; Name=4; (Potential).		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.2523C>G	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.936644	0.00484	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.14640	2.49;2.49	5.09	-4.88	0.03113	Ion transport (1);	1.337370	0.04278	N	0.343409	T	0.02848	0.0085	N	0.01197	-0.965	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	10	0.02654	T	1	-1.0024	1.44	0.02352	0.1595:0.3159:0.1634:0.3613	.	841	O75762	TRPA1_HUMAN	L	693;841	ENSP00000428151:F693L;ENSP00000262209:F841L	ENSP00000262209:F841L	F	-	3	2	TRPA1	73111109	0.129000	0.22400	0.000000	0.03702	0.071000	0.16799	-0.840000	0.04363	-0.621000	0.05633	-0.218000	0.12543	TTC		0.343	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		3	115	0	0	0	0.004672	0	3	115				
COL14A1	7373	broad.mit.edu	37	8	121313043	121313043	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr8:121313043C>G	ENST00000297848.3	+	36	4657	c.4387C>G	c.(4387-4389)Cca>Gca	p.P1463A	COL14A1_ENST00000247781.3_Missense_Mutation_p.P1368A|COL14A1_ENST00000309791.4_Missense_Mutation_p.P1463A	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.P1463A(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGCTCTGGGACCAGCGGGCCC	0.418																																							uc003yox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4387-4389)CCA>GCA		collagen, type XIV, alpha 1 precursor							178.0	179.0	179.0					8																	121313043		2203	4299	6502	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121313043C>G		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4387C>G	8.37:g.121313043C>G	ENSP00000297848:p.Pro1463Ala		Somatic				COL14A1_uc003yoz.2_Missense_Mutation_p.P428A	p.P1463A	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		36	4652	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1463			Triple-helical region 1 (COL2).			Missense_Mutation	SNP	ENST00000297848.3	37	c.4387C>G	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189268	0.78789	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.96745	-4.11;-4.11;-4.11	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.97776	0.9270	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97615	1.0132	10	0.46703	T	0.11	.	18.686	0.91563	0.0:1.0:0.0:0.0	.	1463	Q05707	COEA1_HUMAN	A	1463;1463;1368	ENSP00000311809:P1463A;ENSP00000297848:P1463A;ENSP00000247781:P1368A	ENSP00000247781:P1368A	P	+	1	0	COL14A1	121382224	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.962000	0.70364	2.709000	0.92574	0.655000	0.94253	CCA		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		11	353	0	0	0	0.010729	0	11	353				
MAF1	84232	broad.mit.edu	37	8	145160793	145160793	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr8:145160793G>C	ENST00000322428.5	+	3	509	c.105G>C	c.(103-105)aaG>aaC	p.K35N	SHARPIN_ENST00000398712.2_5'Flank|KIAA1875_ENST00000323662.8_5'Flank|SHARPIN_ENST00000533948.1_5'Flank|MAF1_ENST00000532522.1_Missense_Mutation_p.K35N|MAF1_ENST00000534585.1_Missense_Mutation_p.K35N	NM_032272.4	NP_115648.2	Q9H063	MAF1_HUMAN	MAF1 homolog (S. cerevisiae)	35					negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)	p.K35N(1)		central_nervous_system(1)|lung(8)|urinary_tract(1)	10	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACTCATGTAAGATGGCAGGAG	0.562																																							uc003zbc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)AAG>AAC		MAF1 protein							89.0	85.0	86.0					8																	145160793		2203	4299	6502	SO:0001583	missense	84232				negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	cytoplasm|nucleus		g.chr8:145160793G>C		CCDS6416.1	8q24.3	2012-10-29			ENSG00000179632	ENSG00000179632			24966	protein-coding gene	gene with protein product		610210				11230166, 11438659	Standard	NM_032272		Approved	DKFZp586G1123	uc003zbc.1	Q9H063	OTTHUMG00000165244	ENST00000322428.5:c.105G>C	8.37:g.145160793G>C	ENSP00000318604:p.Lys35Asn		Somatic				SHARPIN_uc003zba.2_5'Flank|SHARPIN_uc003zbb.2_5'Flank|KIAA1875_uc003zbd.3_5'Flank	p.K35N	NM_032272	NP_115648	WXS	Illumina HiSeq	Unspecified	Q9H063	MAF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		3	606	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		35					D3DWL4	Missense_Mutation	SNP	ENST00000322428.5	37	c.105G>C	CCDS6416.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080606	0.76528	.	.	ENSG00000179632	ENST00000322428;ENST00000534585;ENST00000532522;ENST00000527572;ENST00000527058	T;T;T	0.69175	-0.2;-0.38;-0.2	5.29	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.85270	0.5658	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87278	0.2290	10	0.87932	D	0	-41.1138	9.5011	0.39017	0.0968:0.0:0.9032:0.0	.	35	Q9H063	MAF1_HUMAN	N	35	ENSP00000318604:K35N;ENSP00000433979:K35N;ENSP00000436720:K35N	ENSP00000318604:K35N	K	+	3	2	MAF1	145232781	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.772000	0.68889	1.231000	0.43661	0.462000	0.41574	AAG		0.562	MAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382910.1	NM_032272		9	249	0	0	0	0.006214	0	9	249				
PHKA2	5256	broad.mit.edu	37	X	18926043	18926043	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:18926043C>T	ENST00000379942.4	-	22	3157	c.2492G>A	c.(2491-2493)aGg>aAg	p.R831K		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	831	Calmodulin-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R831K(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					CACTTTCTTCCTGAGAAGGCC	0.572																																							uc004cyv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2491-2493)AGG>AAG		phosphorylase kinase, alpha 2 (liver)							147.0	125.0	133.0					X																	18926043		2203	4300	6503	SO:0001583	missense	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18926043C>T		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2492G>A	X.37:g.18926043C>T	ENSP00000369274:p.Arg831Lys		Somatic				PHKA2_uc004cyu.3_Missense_Mutation_p.R129K|PHKA2_uc010nfe.1_5'Flank|PHKA2_uc010nff.1_5'Flank	p.R831K	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			22	2922	-	Hepatocellular(33;0.183)		831			Calmodulin-binding (Potential).		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	c.2492G>A	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	C	9.102	1.004502	0.19199	.	.	ENSG00000044446	ENST00000379942	D	0.88509	-2.39	5.78	3.03	0.35002	Glycoside hydrolase 15-related (1);	0.156411	0.64402	D	0.000014	T	0.71400	0.3335	N	0.11927	0.2	0.32706	N	0.51219	B	0.02656	0.0	B	0.09377	0.004	T	0.61446	-0.7061	10	0.06236	T	0.91	-16.5962	4.3029	0.10933	0.0:0.4898:0.1722:0.338	.	831	P46019	KPB2_HUMAN	K	831	ENSP00000369274:R831K	ENSP00000369274:R831K	R	-	2	0	PHKA2	18835964	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.933000	0.40153	0.685000	0.31468	-0.202000	0.12741	AGG		0.572	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		9	277	0	0	0	0.004482	0	9	277				
USP9X	8239	broad.mit.edu	37	X	41073863	41073863	+	Silent	SNP	T	T	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:41073863T>A	ENST00000324545.8	+	34	5865	c.5232T>A	c.(5230-5232)atT>atA	p.I1744I	USP9X_ENST00000378308.2_Silent_p.I1744I	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1744	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACGTAGACATTAGAAATCACC	0.308																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	0				lung(3)|breast(2)|ovary(1)	6						c.(5230-5232)ATT>ATA		ubiquitin specific protease 9, X-linked isoform							57.0	56.0	56.0					X																	41073863		2158	4281	6439	SO:0001819	synonymous_variant	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41073863T>A	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5232T>A	X.37:g.41073863T>A			Somatic				USP9X_uc004dfc.2_Silent_p.I1744I	p.I1744I	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			34	5865	+			1744					O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	c.5232T>A	CCDS43930.1																																																																																				0.308	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		4	97	0	0	0	0.014758	0	4	97				
OPHN1	4983	broad.mit.edu	37	X	67430108	67430108	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:67430108G>A	ENST00000355520.5	-	9	1360	c.719C>T	c.(718-720)tCc>tTc	p.S240F	OPHN1_ENST00000540071.1_Missense_Mutation_p.S240F	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	240					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.S240F(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CCGGGTACTGGAGAAATGATT	0.378																																							uc004dww.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(718-720)TCC>TTC		oligophrenin 1							148.0	120.0	130.0					X																	67430108		2203	4300	6503	SO:0001583	missense	4983				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding	g.chrX:67430108G>A	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.719C>T	X.37:g.67430108G>A	ENSP00000347710:p.Ser240Phe		Somatic				OPHN1_uc011mpg.1_Missense_Mutation_p.S240F|OPHN1_uc004dwx.2_Missense_Mutation_p.S240F	p.S240F	NM_002547	NP_002538	WXS	Illumina HiSeq	Unspecified	O60890	OPHN1_HUMAN			9	1013	-			240					B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	c.719C>T	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449851	0.43531	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.04654	3.58;3.58	4.84	3.96	0.45880	.	0.287902	0.35262	N	0.003328	T	0.06600	0.0169	L	0.36672	1.1	0.41025	D	0.98511	D;P;P	0.59767	0.986;0.889;0.697	P;P;B	0.50754	0.649;0.637;0.276	T	0.11842	-1.0571	10	0.87932	D	0	.	5.4875	0.16757	0.1119:0.2024:0.6857:0.0	.	240;240;240	F5H2E3;Q6PCC1;O60890	.;.;OPHN1_HUMAN	F	240	ENSP00000347710:S240F;ENSP00000438617:S240F	ENSP00000347710:S240F	S	-	2	0	OPHN1	67346833	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.509000	0.45459	2.127000	0.65507	0.506000	0.49869	TCC		0.378	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547		28	86	0	0	0	0.004656	0	28	86				
TBC1D8B	54885	broad.mit.edu	37	X	106084060	106084060	+	Silent	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:106084060G>C	ENST00000357242.5	+	10	1839	c.1665G>C	c.(1663-1665)ctG>ctC	p.L555L	TBC1D8B_ENST00000276175.3_Silent_p.L549L|TBC1D8B_ENST00000310452.2_Silent_p.L555L	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	555	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TATCTGCTCTGAGAAGGGTAC	0.448																																							uc004emo.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1663-1665)CTG>CTC		TBC1 domain family, member 8B (with GRAM domain)							143.0	126.0	132.0					X																	106084060		2203	4300	6503	SO:0001819	synonymous_variant	54885					intracellular	calcium ion binding|Rab GTPase activator activity	g.chrX:106084060G>C	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.1665G>C	X.37:g.106084060G>C			Somatic				MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Silent_p.L555L	p.L555L	NM_017752	NP_060222	WXS	Illumina HiSeq	Unspecified	Q0IIM8	TBC8B_HUMAN			10	1830	+			555			Rab-GAP TBC.		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Silent	SNP	ENST00000357242.5	37	c.1665G>C	CCDS14522.1																																																																																				0.448	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752		4	273	0	0	0	0.009096	0	4	273				
MCF2	4168	broad.mit.edu	37	X	138698557	138698557	+	Missense_Mutation	SNP	C	C	A	rs371783595		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:138698557C>A	ENST00000370576.4	-	9	1284	c.1075G>T	c.(1075-1077)Gct>Tct	p.A359S	MCF2_ENST00000536274.1_Missense_Mutation_p.A320S|MCF2_ENST00000483690.1_5'Flank|MCF2_ENST00000414978.1_Missense_Mutation_p.A419S|MCF2_ENST00000519895.1_Missense_Mutation_p.A419S|MCF2_ENST00000370578.4_Missense_Mutation_p.A504S|MCF2_ENST00000338585.6_Missense_Mutation_p.A359S|MCF2_ENST00000370573.4_Missense_Mutation_p.A359S|MCF2_ENST00000520602.1_Missense_Mutation_p.A419S	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	359					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A359S(2)|p.A419S(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					GCTTTCTGAGCATCTTCTTTA	0.343																																							uc004fau.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(1)|pleura(1)	2						c.(1075-1077)GCT>TCT		MCF.2 cell line derived transforming sequence							55.0	54.0	54.0					X																	138698557		2201	4297	6498	SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138698557C>A		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1075G>T	X.37:g.138698557C>A	ENSP00000359608:p.Ala359Ser		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.A359S|MCF2_uc011mwl.1_Missense_Mutation_p.A320S|MCF2_uc010nsh.1_Missense_Mutation_p.A359S|MCF2_uc011mwm.1_Missense_Mutation_p.A320S|MCF2_uc011mwn.1_Missense_Mutation_p.A504S|MCF2_uc004faw.2_Missense_Mutation_p.A419S|MCF2_uc011mwo.1_Missense_Mutation_p.A419S	p.A359S	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			9	1369	-	Acute lymphoblastic leukemia(192;0.000127)		359					B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	c.1075G>T	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455130	0.84209	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.56103	0.67;0.55;0.48;0.62;0.67;0.78;0.65;0.66	5.84	4.98	0.66077	.	0.094551	0.64402	D	0.000001	T	0.72439	0.3460	M	0.83483	2.645	0.37733	D	0.925334	D;D;P;D;D;P;D;D	0.71674	0.96;0.997;0.945;0.96;0.99;0.83;0.998;0.993	D;P;D;D;D;P;D;D	0.67725	0.946;0.899;0.94;0.946;0.94;0.873;0.953;0.946	T	0.79482	-0.1785	10	0.87932	D	0	.	12.8474	0.57837	0.0:0.9203:0.0:0.0797	.	419;504;320;359;359;504;359;359	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	S	419;359;320;504;419;419;359;359	ENSP00000427745:A419S;ENSP00000359608:A359S;ENSP00000438155:A320S;ENSP00000359610:A504S;ENSP00000397055:A419S;ENSP00000430276:A419S;ENSP00000359605:A359S;ENSP00000342204:A359S	ENSP00000342204:A359S	A	-	1	0	MCF2	138526223	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	5.572000	0.67411	1.211000	0.43351	0.544000	0.68410	GCT		0.343	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		27	141	1	0	4.87955e-14	0.005443	5.27134e-14	27	141				
MAGEC3	139081	broad.mit.edu	37	X	140983139	140983139	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chrX:140983139G>C	ENST00000298296.1	+	5	994	c.994G>C	c.(994-996)Gag>Cag	p.E332Q	MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000544766.1_5'UTR|MAGEC3_ENST00000448920.1_Missense_Mutation_p.E84Q|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000409007.1_5'Flank	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	332	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					ATTTTGCGAGGAGTCTGGACT	0.577																																							uc011mwp.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(994-996)GAG>CAG		melanoma antigen family C, 3 isoform 1							124.0	109.0	114.0					X																	140983139		2202	4300	6502	SO:0001583	missense	139081							g.chrX:140983139G>C	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.994G>C	X.37:g.140983139G>C	ENSP00000298296:p.Glu332Gln		Somatic				MAGEC3_uc004fbs.2_5'UTR|MAGEC3_uc010nsj.2_5'Flank	p.E332Q	NM_138702	NP_619647	WXS	Illumina HiSeq	Unspecified	Q8TD91	MAGC3_HUMAN			5	994	+	Acute lymphoblastic leukemia(192;6.56e-05)		332			MAGE 1.		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	c.994G>C	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	N	6.435	0.448335	0.12223	.	.	ENSG00000165509	ENST00000298296;ENST00000448920	T;T	0.41400	3.77;1.0	0.819	0.819	0.18785	.	.	.	.	.	T	0.20659	0.0497	N	0.22421	0.69	0.09310	N	1	P	0.42993	0.797	B	0.28784	0.094	T	0.09443	-1.0674	8	0.46703	T	0.11	.	.	.	.	.	332	Q8TD91	MAGC3_HUMAN	Q	332;84	ENSP00000298296:E332Q;ENSP00000395092:E84Q	ENSP00000298296:E332Q	E	+	1	0	MAGEC3	140810805	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.074000	0.11450	0.691000	0.31592	0.353000	0.21931	GAG		0.577	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		4	240	0	0	0	0.001168	0	4	240				
C12orf74	338809	broad.mit.edu	37	12	93100418	93100423	+	In_Frame_Del	DEL	CAGAGT	CAGAGT	-	rs534692527		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	CAGAGT	CAGAGT	-	-	CAGAGT	CAGAGT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr12:93100418_93100423delCAGAGT	ENST00000397833.3	+	2	462_467	c.11_16delCAGAGT	c.(10-18)acagagtca>aca	p.ES5del	C12orf74_ENST00000544406.2_In_Frame_Del_p.ES5del	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	5										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						ATGGAGAAAACAGAGTCATTCTGTCC	0.529																																							uc001tch.1		NA																	0					0						c.(10-18)ACAGAGTCA>ACA		hypothetical protein LOC338809																																				SO:0001651	inframe_deletion	338809							g.chr12:93100418_93100423delCAGAGT	BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.11_16delCAGAGT	12.37:g.93100418_93100423delCAGAGT	ENSP00000380933:p.Glu5_Ser6del		Somatic				C12orf74_uc001tci.2_In_Frame_Del_p.ES5del	p.ES5del	NM_001037671	NP_001032760	WXS	Illumina HiSeq	Unspecified	Q32Q52	CL074_HUMAN			2	241_246	+			5_6					F5H4P0	In_Frame_Del	DEL	ENST00000397833.3	37	c.11_16delCAGAGT	CCDS41819.1																																																																																				0.529	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1	NM_001037671		16	94	NA	NA	NA	NA	NA	16	94	---	---	---	---
KHNYN	23351	broad.mit.edu	37	14	24901931	24901931	+	Frame_Shift_Del	DEL	T	T	-			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr14:24901931delT	ENST00000251343.5	+	4	1492	c.1353delT	c.(1351-1353)catfs	p.H451fs	KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Frame_Shift_Del_p.H451fs|CBLN3_ENST00000555436.1_5'Flank|KHNYN_ENST00000556842.1_Frame_Shift_Del_p.H451fs			O15037	KHNYN_HUMAN	KH and NYN domain containing	451							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						ACTACAGGCATGGCCTCCAGC	0.612											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001wph.3		NA																	0				ovary(2)|liver(1)	3						c.(1351-1353)CATfs		hypothetical protein LOC23351							87.0	78.0	81.0					14																	24901931		2203	4300	6503	SO:0001589	frameshift_variant	23351							g.chr14:24901931delT	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.1353delT	14.37:g.24901931delT	ENSP00000251343:p.His451fs		Somatic	OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	774	KHNYN_uc010tpc.1_Frame_Shift_Del_p.H492fs|KHNYN_uc010alw.2_Frame_Shift_Del_p.H451fs	p.H451fs	NM_015299	NP_056114	WXS	Illumina HiSeq	Unspecified	O15037	KHNYN_HUMAN			4	1555	+			451					Q86TZ6|Q8IUQ2|Q96BA9	Frame_Shift_Del	DEL	ENST00000251343.5	37	c.1353delT	CCDS32058.1																																																																																				0.612	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1			44	110	NA	NA	NA	NA	NA	44	110	---	---	---	---
VPS33B	26276	broad.mit.edu	37	15	91548651	91548653	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	TTC	TTC	-	-	TTC	TTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr15:91548651_91548653delTTC	ENST00000333371.3	-	14	1415_1417	c.1062_1064delGAA	c.(1060-1065)aagaaa>aaa	p.354_355KK>K	VPS33B_ENST00000535906.1_In_Frame_Del_p.327_328KK>K|VPS33B_ENST00000535843.1_In_Frame_Del_p.263_264KK>K	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	354					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTGCTTGGTTTTCTTCTTCATGA	0.507																																							uc002bqp.1		NA																	0				ovary(2)	2						c.(1060-1065)AAGAAA>AAA		vacuolar protein sorting 33B (yeast homolog))																																				SO:0001651	inframe_deletion	26276				cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding	g.chr15:91548651_91548653delTTC	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1062_1064delGAA	15.37:g.91548657_91548659delTTC	ENSP00000327650:p.Lys355del		Somatic				VPS33B_uc002bqq.1_In_Frame_Del_p.263_264KK>K|VPS33B_uc010uqu.1_In_Frame_Del_p.327_328KK>K	p.354_355KK>K	NM_018668	NP_061138	WXS	Illumina HiSeq	Unspecified	Q9H267	VP33B_HUMAN			14	1416_1418	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		354_355					B3KQF6|Q96K14|Q9NRP6|Q9NSF3	In_Frame_Del	DEL	ENST00000333371.3	37	c.1062_1064delGAA	CCDS10369.1																																																																																				0.507	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668		15	266	NA	NA	NA	NA	NA	15	266	---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37880981	37880982	+	In_Frame_Ins	INS	-	-	GCATACGTGATG	rs397516976|rs397516975		TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr17:37880981_37880982insGCATACGTGATG	ENST00000269571.5	+	20	2469_2470	c.2310_2311insGCATACGTGATG	c.(2311-2313)gca>GCATACGTGATGgca	p.771_771A>AYVMA	ERBB2_ENST00000541774.1_In_Frame_Ins_p.756_756A>AYVMA|ERBB2_ENST00000445658.2_In_Frame_Ins_p.495_495A>AYVMA|ERBB2_ENST00000584601.1_In_Frame_Ins_p.741_741A>AYVMA|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000406381.2_In_Frame_Ins_p.741_741A>AYVMA|ERBB2_ENST00000584450.1_In_Frame_Ins_p.771_771A>AYVMA|ERBB2_ENST00000540147.1_In_Frame_Ins_p.741_741A>AYVMA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	771	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GTCCCCAGGAAGCATACGTGAT	0.594		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													uc002hso.2		1		Dom	yes		17	17q21.1	2064	A|Mis|O	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""			E			breast|ovarian|other tumour types|NSCLC|gastric		0		p.M774_A775insAYVM(24)		lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143						c.(2308-2313)insGCATACGTGATG		erbB-2 isoform a	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)																																			SO:0001652	inframe_insertion	2064				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr17:37880981_37880982insGCATACGTGATG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2311_2322dupGCATACGTGATG	17.37:g.37880981_37880982insGCATACGTGATG	Exception_encountered	TCGA GBM(5;<1E-08)	Somatic				ERBB2_uc002hsm.2_In_Frame_Ins_p.744_745insAYVM|ERBB2_uc010cwa.2_In_Frame_Ins_p.759_760insAYVM|ERBB2_uc002hsp.2_In_Frame_Ins_p.577_578insAYVM|ERBB2_uc010cwb.2_In_Frame_Ins_p.774_775insAYVM|ERBB2_uc010wek.1_In_Frame_Ins_p.498_499insAYVM	p.774_775insAYVM	NM_004448	NP_004439	WXS	Illumina HiSeq	Unspecified	P04626	ERBB2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	20	2548_2549	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	774_775			Cytoplasmic (Potential).|Protein kinase.		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	In_Frame_Ins	INS	ENST00000269571.5	37	c.2310_2311insGCATACGTGATG	CCDS32642.1																																																																																				0.594	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			8	190	NA	NA	NA	NA	NA	8	190	---	---	---	---
UXS1	80146	broad.mit.edu	37	2	106713239	106713239	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr2:106713239delC	ENST00000409501.3	-	14	1123	c.1066delG	c.(1066-1068)gatfs	p.D357fs	UXS1_ENST00000409032.1_Frame_Shift_Del_p.D189fs|UXS1_ENST00000540130.1_Frame_Shift_Del_p.D300fs|UXS1_ENST00000283148.7_Frame_Shift_Del_p.D362fs			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	357					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						TGTGGGTCATCCTGGGCTTCG	0.473																																							uc002tdm.2		NA																	0				ovary(2)	2						c.(1066-1068)GATfs		UDP-glucuronate decarboxylase 1							123.0	110.0	114.0					2																	106713239		1872	4113	5985	SO:0001589	frameshift_variant	80146				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity	g.chr2:106713239delC	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.1066delG	2.37:g.106713239delC	ENSP00000387019:p.Asp357fs		Somatic				UXS1_uc002tdk.2_Frame_Shift_Del_p.D154fs|UXS1_uc002tdl.2_Frame_Shift_Del_p.D188fs|UXS1_uc002tdn.2_Frame_Shift_Del_p.D361fs|UXS1_uc002tdo.2_Frame_Shift_Del_p.D299fs	p.D356fs	NM_025076	NP_079352	WXS	Illumina HiSeq	Unspecified	Q8NBZ7	UXS1_HUMAN			14	1164	-			356			Lumenal (Potential).		Q8NBX3|Q9H5C2	Frame_Shift_Del	DEL	ENST00000409501.3	37	c.1066delG	CCDS46378.1																																																																																				0.473	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3		8	20	NA	NA	NA	NA	NA	8	20	---	---	---	---
MEPCE	56257	broad.mit.edu	37	7	100030533	100030551	+	Splice_Site	DEL	TGCCCTCAGGGTAATTATG	TGCCCTCAGGGTAATTATG	-	rs112447917|rs78298168	byFrequency	TCGA-44-3919-01A-02D-1458-08	TCGA-44-3919-10A-01D-1458-08	TGCCCTCAGGGTAATTATG	TGCCCTCAGGGTAATTATG	-	-	TGCCCTCAGGGTAATTATG	TGCCCTCAGGGTAATTATG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	2c0fe76a-3407-4e57-8a18-816e849c725d	4ef77426-560d-48fb-9adc-334962565c54	g.chr7:100030533_100030551delTGCCCTCAGGGTAATTATG	ENST00000310512.2	+	2	2059_2069	c.1671_1681delTGCCCTCAGGGTAATTATG	c.(1669-1683)actgccctcagggta>acta	p.ALRV558fs	MEPCE_ENST00000414441.1_Splice_Site_p.ALRV89fs|RP11-758P17.2_ENST00000492523.1_RNA|PPP1R35_ENST00000476185.1_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	558	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.V561L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGCCGATTCTTGCCCTCAGGGTAATTATGTGCTGGATCG	0.571																																							uc003uuw.2		NA																	1	Substitution - Missense(1)		prostate(1)	upper_aerodigestive_tract(1)	1						c.e2-1		bin3, bicoid-interacting 3																																				SO:0001630	splice_region_variant	56257						methyltransferase activity	g.chr7:100030533_100030551delTGCCCTCAGGGTAATTATG	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1672-1TGCCCTCAGGGTAATTATG>-	7.37:g.100030533_100030551delTGCCCTCAGGGTAATTATG			Somatic				MEPCE_uc003uuv.2_Splice_Site_p.G89_splice	p.G558_splice	NM_019606	NP_062552	WXS	Illumina HiSeq	Unspecified	Q7L2J0	MEPCE_HUMAN			2	1785	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)							B3KP86|D6W5V7|Q9NPD4	Splice_Site	DEL	ENST00000310512.2	37	c.1672_splice	CCDS5693.1																																																																																				0.571	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		Frame_Shift_Del	18	277	NA	NA	NA	NA	NA	18	277	---	---	---	---
