#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ESPNP	284729	broad.mit.edu	37	1	17033809	17033809	+	RNA	SNP	G	G	T	rs373187758		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:17033809G>T	ENST00000492551.1	-	0	669					NR_026567.1				espin pseudogene																		CGCAGGCAGTGGGTGCAGTGG	0.662																																							uc001azn.1		NA																	0					0						c.(556-558)CAC>AAC		RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;																																						284729							g.chr1:17033809G>T	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17033809G>T			Somatic				ESPNP_uc010ocj.1_3'UTR	p.H186N	NR_026567		WXS	Illumina HiSeq	Unspecified					4	670	-									Missense_Mutation	SNP	ENST00000492551.1	37	c.556C>A																																																																																					0.662	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			4	33	1	0	0.000602214	0.000602	0.000639853	4	33				
SLC9A1	6548	broad.mit.edu	37	1	27480730	27480730	+	Silent	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:27480730G>C	ENST00000263980.3	-	1	671	c.96C>G	c.(94-96)ctC>ctG	p.L32L	SLC9A1_ENST00000374086.3_Silent_p.L32L|SLC9A1_ENST00000545949.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	32					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CATGGCTCCTGAGAACAGGCA	0.607																																							uc001bnm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(94-96)CTC>CTG		solute carrier family 9, isoform A1	Amiloride(DB00594)						91.0	82.0	85.0					1																	27480730		2203	4300	6503	SO:0001819	synonymous_variant	6548				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity	g.chr1:27480730G>C	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.96C>G	1.37:g.27480730G>C			Somatic				SLC9A1_uc010ofk.1_5'UTR|SLC9A1_uc001bnn.2_Silent_p.L32L	p.L32L	NM_003047	NP_003038	WXS	Illumina HiSeq	Unspecified	P19634	SL9A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	1	722	-			32			Helical; Name=M1; (Potential).		B1ALD6|D3DPL4|Q96EM2	Silent	SNP	ENST00000263980.3	37	c.96C>G	CCDS295.1																																																																																				0.607	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047		17	73	0	0	0	0.00499	0	17	73				
GRIK3	2899	broad.mit.edu	37	1	37307529	37307529	+	Silent	SNP	G	G	A	rs201498855		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:37307529G>A	ENST00000373091.3	-	10	1354	c.1338C>T	c.(1336-1338)ttC>ttT	p.F446F	GRIK3_ENST00000373093.4_Silent_p.F446F	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	446					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GAAACATGACGAAGGGCTCCT	0.577													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20915	0.0		0.0	False		,,,				2504	0.0						uc001caz.2		NA																	0				ovary(3)|skin(2)|large_intestine(1)|breast(1)	7						c.(1336-1338)TTC>TTT		glutamate receptor, ionotropic, kainate 3	L-Glutamic Acid(DB00142)						121.0	111.0	114.0					1																	37307529		2203	4300	6503	SO:0001819	synonymous_variant	2899				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity	g.chr1:37307529G>A	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1338C>T	1.37:g.37307529G>A			Somatic				GRIK3_uc001cba.1_Silent_p.F446F	p.F446F	NM_000831	NP_000822	WXS	Illumina HiSeq	Unspecified	Q13003	GRIK3_HUMAN			10	1473	-		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)	446			Extracellular (Potential).		A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	c.1338C>T	CCDS416.1																																																																																				0.577	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831		6	98	0	0	0	0.001984	0	6	98				
EIF2B3	8891	broad.mit.edu	37	1	45323445	45323445	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:45323445C>A	ENST00000360403.2	-	11	1363	c.1237G>T	c.(1237-1239)Gct>Tct	p.A413S		NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	413					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TCGATCACAGCATTGTTGCAG	0.458																																					Colon(26;357 658 2581 11857 12657)	Colon(26;357 658 2581 11857 12657)	uc001cmt.1		NA																	0				ovary(1)	1						c.(1237-1239)GCT>TCT		eukaryotic translation initiation factor 2B,							252.0	203.0	220.0					1																	45323445		2203	4300	6503	SO:0001583	missense	8891				negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity	g.chr1:45323445C>A	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.1237G>T	1.37:g.45323445C>A	ENSP00000353575:p.Ala413Ser		Somatic				EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Missense_Mutation_p.A387S	p.A413S	NM_020365	NP_065098	WXS	Illumina HiSeq	Unspecified	Q9NR50	EI2BG_HUMAN			11	1364	-	Acute lymphoblastic leukemia(166;0.155)		413					B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	c.1237G>T	CCDS517.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871227	0.72065	.	.	ENSG00000070785	ENST00000360403	D	0.94537	-3.45	5.33	5.33	0.75918	.	0.053194	0.85682	D	0.000000	D	0.90960	0.7158	L	0.48174	1.505	0.80722	D	1	B	0.24576	0.106	B	0.25759	0.063	D	0.87059	0.2152	10	0.10636	T	0.68	-12.5507	14.6007	0.68438	0.0:1.0:0.0:0.0	.	413	Q9NR50	EI2BG_HUMAN	S	413	ENSP00000353575:A413S	ENSP00000353575:A413S	A	-	1	0	EIF2B3	45096032	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	6.056000	0.71111	2.492000	0.84095	0.558000	0.71614	GCT		0.458	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365		52	60	1	0	6.56871e-35	0.01441	9.86834e-35	52	60				
INSL5	10022	broad.mit.edu	37	1	67263744	67263744	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:67263744C>A	ENST00000304526.2	-	2	394	c.360G>T	c.(358-360)ttG>ttT	p.L120F		NM_005478.4	NP_005469.2	Q9Y5Q6	INSL5_HUMAN	insulin-like 5	120						extracellular region (GO:0005576)				breast(2)|endometrium(1)|lung(5)	8						CAGTGCAACACAAAGTTTGTA	0.443																																							uc001dcw.2		NA																	0					0						c.(358-360)TTG>TTT		insulin-like 5 precursor							116.0	99.0	105.0					1																	67263744		2203	4300	6503	SO:0001583	missense	10022					extracellular region	hormone activity	g.chr1:67263744C>A	AF133816	CCDS634.1	1p31.3	2013-02-26			ENSG00000172410	ENSG00000172410		"""Endogenous ligands"""	6088	protein-coding gene	gene with protein product	"""prepro-INSL5"""	606413				10458910	Standard	NM_005478		Approved		uc001dcw.3	Q9Y5Q6	OTTHUMG00000009164	ENST00000304526.2:c.360G>T	1.37:g.67263744C>A	ENSP00000302724:p.Leu120Phe		Somatic					p.L120F	NM_005478	NP_005469	WXS	Illumina HiSeq	Unspecified	Q9Y5Q6	INSL5_HUMAN			2	395	-			120					Q3MIY4|Q5VYD8	Missense_Mutation	SNP	ENST00000304526.2	37	c.360G>T	CCDS634.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052341	0.36181	.	.	ENSG00000172410	ENST00000304526	D	0.88124	-2.34	4.26	-0.0278	0.13924	Insulin-like (4);	0.634631	0.12412	N	0.471162	T	0.60495	0.2273	L	0.43152	1.355	0.32711	N	0.511574	B	0.29085	0.232	B	0.24269	0.052	T	0.16988	-1.0384	10	0.13853	T	0.58	-2.1436	4.9547	0.14033	0.0:0.4142:0.3707:0.2151	.	120	Q9Y5Q6	INSL5_HUMAN	F	120	ENSP00000302724:L120F	ENSP00000302724:L120F	L	-	3	2	INSL5	67036332	0.006000	0.16342	0.580000	0.28601	0.007000	0.05969	-0.821000	0.04452	0.105000	0.17753	-0.143000	0.13931	TTG		0.443	INSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025403.1	NM_005478		13	58	1	0	1.05317e-09	0.00245	1.23251e-09	13	58				
ERICH3	127254	broad.mit.edu	37	1	75065541	75065541	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:75065541G>C	ENST00000326665.5	-	11	1782	c.1564C>G	c.(1564-1566)Caa>Gaa	p.Q522E	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.Q325E	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		522	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCATTCATTTGAACATCAGCC	0.383																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(1564-1566)CAA>GAA		hypothetical protein LOC127254							223.0	226.0	225.0					1																	75065541		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75065541G>C																												ENST00000326665.5:c.1564C>G	1.37:g.75065541G>C	ENSP00000322609:p.Gln522Glu		Somatic				uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.Q316E	p.Q522E	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			11	1783	-			522			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.1564C>G	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	7.570	0.666489	0.14710	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.19532	2.55;2.14	6.05	6.05	0.98169	.	.	.	.	.	T	0.28962	0.0719	L	0.55990	1.75	0.35277	D	0.781004	P;D	0.65815	0.925;0.995	P;D	0.64237	0.54;0.923	T	0.01508	-1.1337	9	0.14252	T	0.57	-5.6058	20.1963	0.98243	0.0:0.0:1.0:0.0	.	325;522	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	E	522;325	ENSP00000322609:Q522E;ENSP00000398581:Q325E	ENSP00000322609:Q522E	Q	-	1	0	C1orf173	74838129	1.000000	0.71417	0.927000	0.36925	0.001000	0.01503	4.957000	0.63652	2.878000	0.98634	0.650000	0.86243	CAA		0.383	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			33	140	0	0	0	0.003271	0	33	140				
GBP4	115361	broad.mit.edu	37	1	89662846	89662846	+	Missense_Mutation	SNP	A	A	G	rs375773007		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:89662846A>G	ENST00000355754.6	-	2	279	c.182T>C	c.(181-183)cTa>cCa	p.L61P		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	61	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TGTGCGGTATAGCCCTACAAT	0.478																																							uc001dnb.2		NA																	0					0						c.(181-183)CTA>CCA		guanylate binding protein 4		A	PRO/LEU	0,4406		0,0,2203	145.0	125.0	132.0		182	1.6	0.0	1		132	1,8599	1.2+/-3.3	0,1,4299	no	missense	GBP4	NM_052941.4	98	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	61/641	89662846	1,13005	2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89662846A>G	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.182T>C	1.37:g.89662846A>G	ENSP00000359490:p.Leu61Pro		Somatic					p.L61P	NM_052941	NP_443173	WXS	Illumina HiSeq	Unspecified	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	2	298	-			61			GTP (By similarity).		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.182T>C	CCDS721.1	.	.	.	.	.	.	.	.	.	.	A	4.264	0.048018	0.08243	0.0	1.16E-4	ENSG00000162654	ENST00000355754	T	0.61510	0.1	5.28	1.65	0.23941	Guanylate-binding protein, N-terminal (1);	0.190743	0.33591	N	0.004754	T	0.25382	0.0617	L	0.45581	1.43	0.19575	N	0.999961	P	0.40197	0.706	B	0.42062	0.374	T	0.14448	-1.0472	10	0.29301	T	0.29	.	2.9952	0.05996	0.5243:0.0:0.1689:0.3069	.	61	Q96PP9	GBP4_HUMAN	P	61	ENSP00000359490:L61P	ENSP00000359490:L61P	L	-	2	0	GBP4	89435434	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.983000	0.29552	0.113000	0.18004	0.528000	0.53228	CTA		0.478	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		27	35	0	0	0	0.005443	0	27	35				
SNX7	51375	broad.mit.edu	37	1	99156702	99156702	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:99156702G>A	ENST00000306121.3	+	3	444	c.435G>A	c.(433-435)aaG>aaA	p.K145K	SNX7_ENST00000370189.5_Silent_p.K81K|SNX7_ENST00000529992.1_Silent_p.K145K	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	81	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TTTGGTTGAAGGGAAAACTGG	0.368																																							uc010ouc.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(433-435)AAG>AAA		sorting nexin 7 isoform a							93.0	89.0	91.0					1																	99156702		2203	4300	6503	SO:0001819	synonymous_variant	51375				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr1:99156702G>A	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.435G>A	1.37:g.99156702G>A			Somatic				SNX7_uc001dsa.2_Silent_p.K81K|SNX7_uc010oud.1_Silent_p.K145K	p.K145K	NM_015976	NP_057060	WXS	Illumina HiSeq	Unspecified	Q9UNH6	SNX7_HUMAN		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)	3	487	+		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)	81			PX.		A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Silent	SNP	ENST00000306121.3	37	c.435G>A	CCDS755.2																																																																																				0.368	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2			11	30	0	0	0	0.008291	0	11	30				
SNX7	51375	broad.mit.edu	37	1	99203889	99203889	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:99203889G>T	ENST00000306121.3	+	8	1231	c.1222G>T	c.(1222-1224)Gat>Tat	p.D408Y	SNX7_ENST00000370189.5_Intron|SNX7_ENST00000529992.1_Missense_Mutation_p.D353Y	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	344					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TATGCAAAATGATATCAAGTT	0.338																																							uc010ouc.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(1222-1224)GAT>TAT		sorting nexin 7 isoform a							150.0	148.0	149.0					1																	99203889		2203	4300	6503	SO:0001583	missense	51375				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr1:99203889G>T	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.1222G>T	1.37:g.99203889G>T	ENSP00000304429:p.Asp408Tyr		Somatic				SNX7_uc001dsa.2_Intron|SNX7_uc010oud.1_Missense_Mutation_p.D353Y	p.D408Y	NM_015976	NP_057060	WXS	Illumina HiSeq	Unspecified	Q9UNH6	SNX7_HUMAN		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)	8	1274	+		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)	344					A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	ENST00000306121.3	37	c.1222G>T	CCDS755.2	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781648	0.49891	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	T;T	0.28666	1.6;1.6	5.49	5.49	0.81192	.	0.095469	0.64402	D	0.000001	T	0.51415	0.1673	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.55471	-0.8136	10	0.87932	D	0	-31.2623	18.3649	0.90388	0.0:0.0:1.0:0.0	.	353;408	E9PNL2;Q9UNH6-3	.;.	Y	353;408	ENSP00000434731:D353Y;ENSP00000304429:D408Y	ENSP00000304429:D408Y	D	+	1	0	SNX7	98976477	1.000000	0.71417	1.000000	0.80357	0.170000	0.22686	8.387000	0.90167	2.556000	0.86216	0.591000	0.81541	GAT		0.338	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2			25	79	1	0	4.87955e-14	0.005443	6.25435e-14	25	79				
ANKRD35	148741	broad.mit.edu	37	1	145561641	145561641	+	Silent	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:145561641A>G	ENST00000355594.4	+	10	1416	c.1329A>G	c.(1327-1329)caA>caG	p.Q443Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	443										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAGGACAGCAACTGACTACCA	0.557																																					Melanoma(9;127 754 22988 51047)	Melanoma(9;127 754 22988 51047)	uc001eob.1		NA																	0				ovary(4)|skin(1)	5						c.(1327-1329)CAA>CAG		ankyrin repeat domain 35							63.0	73.0	69.0					1																	145561641		2203	4300	6503	SO:0001819	synonymous_variant	148741							g.chr1:145561641A>G	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1329A>G	1.37:g.145561641A>G			Somatic				NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Silent_p.Q286Q	p.Q443Q	NM_144698	NP_653299	WXS	Illumina HiSeq	Unspecified	Q8N283	ANR35_HUMAN			10	1437	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		443					A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	37	c.1329A>G	CCDS919.1																																																																																				0.557	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698		18	95	0	0	0	0.006122	0	18	95				
PMF1	11243	broad.mit.edu	37	1	156203520	156203520	+	Splice_Site	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:156203520G>T	ENST00000368273.4	+	3	384		c.e3+1		PMF1_ENST00000368279.3_Splice_Site|PMF1_ENST00000567140.1_Splice_Site|PMF1-BGLAP_ENST00000320139.5_Splice_Site|PMF1-BGLAP_ENST00000368276.4_Splice_Site|PMF1_ENST00000565805.1_Splice_Site|PMF1-BGLAP_ENST00000490491.1_Splice_Site|PMF1_ENST00000368277.3_Splice_Site	NM_001199654.1	NP_001186583.1			polyamine-modulated factor 1											kidney(1)|large_intestine(2)|lung(3)	6	Hepatocellular(266;0.158)					AGCCAGCCTGGTGAGAGTGGG	0.468																																					Pancreas(32;764 914 7316 34504 37150)|Ovarian(64;846 1195 21996 34382 40415)	Pancreas(32;764 914 7316 34504 37150)|Ovarian(64;846 1195 21996 34382 40415)	uc001fnq.2		NA																	0					0						c.e3+1		polyamine-modulated factor 1							78.0	84.0	82.0					1																	156203520		2203	4300	6503	SO:0001630	splice_region_variant	11243				cell division|chromosome segregation|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytosol|MIS12/MIND type complex|transcription factor complex	leucine zipper domain binding|transcription coactivator activity	g.chr1:156203520G>T	AF141310	CCDS30886.1, CCDS55648.1, CCDS55649.1	1q22	2013-07-03			ENSG00000160783	ENSG00000160783			9112	protein-coding gene	gene with protein product		609176				10419538	Standard	NM_007221		Approved			Q6P1K2	OTTHUMG00000177123	ENST00000368273.4:c.374+1G>T	1.37:g.156203520G>T			Somatic				PMF1_uc001fnr.2_Splice_Site_p.C123_splice|BGLAP_uc001fns.1_Splice_Site_p.W123_splice	p.W123_splice	NM_007221	NP_009152	WXS	Illumina HiSeq	Unspecified	Q6P1K2	PMF1_HUMAN			3	391	+	Hepatocellular(266;0.158)								Splice_Site	SNP	ENST00000368273.4	37	c.368_splice	CCDS55648.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276503	0.23307	.	.	ENSG00000160783	ENST00000368279;ENST00000368273;ENST00000368277;ENST00000368276;ENST00000320139	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6581	0.62349	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PMF1	154470144	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	5.794000	0.69067	2.300000	0.77407	0.591000	0.81541	.		0.468	PMF1-005	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040864.2	NM_007221	Intron	52	87	1	0	4.10826e-27	0.01441	5.92397e-27	52	87				
ARHGEF11	9826	broad.mit.edu	37	1	156917973	156917973	+	Splice_Site	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:156917973C>A	ENST00000361409.2	-	23	2775	c.2033G>T	c.(2032-2034)aGg>aTg	p.R678M	ARHGEF11_ENST00000368194.3_Splice_Site_p.R718M|ARHGEF11_ENST00000315174.8_Splice_Site_p.R94M|ARHGEF11_ENST00000487682.1_5'Flank	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	678					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CATCACTTACCTGCGGCCCAT	0.587																																							uc001fqo.2		NA																	0				ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(2032-2034)AGG>ATG		Rho guanine nucleotide exchange factor (GEF) 11							90.0	85.0	87.0					1																	156917973		2203	4300	6503	SO:0001630	splice_region_variant	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156917973C>A	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2033+1G>T	1.37:g.156917973C>A			Somatic				ARHGEF11_uc010phu.1_Missense_Mutation_p.R94M|ARHGEF11_uc001fqn.2_Missense_Mutation_p.R718M	p.R678M	NM_014784	NP_055599	WXS	Illumina HiSeq	Unspecified	O15085	ARHGB_HUMAN			23	3073	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		678					D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.2033G>T	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827505	0.90955	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.70164	-0.44;-0.46;-0.35	5.82	4.92	0.64577	.	0.090793	0.47852	D	0.000208	T	0.55049	0.1896	N	0.24115	0.695	0.54753	D	0.999985	D;D;D	0.67145	0.996;0.991;0.991	P;P;P	0.60682	0.878;0.759;0.878	T	0.58364	-0.7649	9	.	.	.	-17.1473	11.9934	0.53188	0.0:0.9196:0.0:0.0804	.	94;678;718	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	M	718;678;94	ENSP00000357177:R718M;ENSP00000354644:R678M;ENSP00000313470:R94M	.	R	-	2	0	ARHGEF11	155184597	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.718000	0.54919	1.479000	0.48272	0.655000	0.94253	AGG		0.587	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	Missense_Mutation	13	33	1	0	4.36969e-10	0.001855	5.20816e-10	13	33				
FCRL2	79368	broad.mit.edu	37	1	157745565	157745565	+	Splice_Site	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:157745565C>G	ENST00000361516.3	-	2	100	c.52G>C	c.(52-54)Gat>Cat	p.D18H	FCRL2_ENST00000392274.3_Splice_Site_p.D18H|FCRL2_ENST00000368181.4_Splice_Site_p.D18H	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	18					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GAGGACTCACCTGCCTGTTCA	0.438																																							uc001fre.2		NA																	0				ovary(1)|pancreas(1)	2						c.(52-54)GAT>CAT		Fc receptor-like 2 precursor							114.0	93.0	100.0					1																	157745565		2203	4300	6503	SO:0001630	splice_region_variant	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157745565C>G	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.52+1G>C	1.37:g.157745565C>G			Somatic				FCRL2_uc010phz.1_Missense_Mutation_p.D18H|FCRL2_uc009wsp.2_Missense_Mutation_p.D18H|FCRL2_uc010pia.1_Missense_Mutation_p.D18H	p.D18H	NM_030764	NP_110391	WXS	Illumina HiSeq	Unspecified	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		2	111	-	all_hematologic(112;0.0378)		18					A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.52G>C	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634985	0.47049	.	.	ENSG00000132704	ENST00000361516;ENST00000368181;ENST00000392274	T;T;T	0.25414	1.9;3.36;1.8	4.27	2.15	0.27550	.	0.944627	0.08556	U	0.928314	T	0.35856	0.0946	M	0.84326	2.69	0.09310	N	1	D;D;D;B	0.89917	1.0;0.999;0.997;0.446	D;P;P;B	0.72338	0.977;0.907;0.823;0.181	T	0.08638	-1.0712	9	.	.	.	.	6.1547	0.20330	0.2324:0.573:0.1946:0.0	.	18;18;18;18	B4E0W2;B4DVJ9;Q96LA5-5;Q96LA5	.;.;.;FCRL2_HUMAN	H	18	ENSP00000355157:D18H;ENSP00000357163:D18H;ENSP00000376100:D18H	.	D	-	1	0	FCRL2	156012189	0.002000	0.14202	0.089000	0.20774	0.136000	0.21042	0.572000	0.23684	0.969000	0.38237	0.655000	0.94253	GAT		0.438	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	Missense_Mutation	7	32	0	0	0	0.001984	0	7	32				
OR6N1	128372	broad.mit.edu	37	1	158736044	158736044	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:158736044C>T	ENST00000335094.2	-	1	448	c.429G>A	c.(427-429)gaG>gaA	p.E143E		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					CAATGGCAATCTCTGCACAAA	0.537																																							uc010piq.1		NA																	0				ovary(1)	1						c.(427-429)GAG>GAA		olfactory receptor, family 6, subfamily N,							39.0	45.0	43.0					1																	158736044		2203	4300	6503	SO:0001819	synonymous_variant	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158736044C>T	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.429G>A	1.37:g.158736044C>T			Somatic					p.E143E	NM_001005185	NP_001005185	WXS	Illumina HiSeq	Unspecified	Q8NGY5	OR6N1_HUMAN			1	429	-	all_hematologic(112;0.0378)		143			Helical; Name=4; (Potential).		Q5VUU8|Q96R35	Silent	SNP	ENST00000335094.2	37	c.429G>A	CCDS30905.1																																																																																				0.537	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		12	34	0	0	0	0.013537	0	12	34				
ITLN1	55600	broad.mit.edu	37	1	160849122	160849122	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:160849122G>T	ENST00000326245.3	-	7	883	c.768C>A	c.(766-768)gtC>gtA	p.V256V	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	256					positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TACATCCGGTGACCCTCATTC	0.507																																							uc001fxc.2		NA																	0				ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7						c.(766-768)GTC>GTA		intelectin precursor							175.0	140.0	152.0					1																	160849122		2203	4300	6503	SO:0001819	synonymous_variant	55600				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding	g.chr1:160849122G>T	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.768C>A	1.37:g.160849122G>T			Somatic					p.V256V	NM_017625	NP_060095	WXS	Illumina HiSeq	Unspecified	Q8WWA0	ITLN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		7	884	-	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		256					Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Silent	SNP	ENST00000326245.3	37	c.768C>A	CCDS1211.1																																																																																				0.507	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625		46	88	1	0	8.72198e-27	0.01441	1.25209e-26	46	88				
NUF2	83540	broad.mit.edu	37	1	163315514	163315514	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:163315514G>T	ENST00000271452.3	+	11	1133	c.854G>T	c.(853-855)tGc>tTc	p.C285F	NUF2_ENST00000524800.1_Intron|NUF2_ENST00000367900.3_Missense_Mutation_p.C285F	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	285	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TCAGTTGACTGCCTGCCTTCA	0.368																																							uc001gcq.1		NA																	0				ovary(3)|skin(1)	4						c.(853-855)TGC>TTC		NUF2, NDC80 kinetochore complex component							108.0	106.0	107.0					1																	163315514		2203	4300	6503	SO:0001583	missense	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163315514G>T	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.854G>T	1.37:g.163315514G>T	ENSP00000271452:p.Cys285Phe		Somatic				NUF2_uc001gcp.2_Missense_Mutation_p.C285F|NUF2_uc001gcr.1_Missense_Mutation_p.C285F|NUF2_uc009wvc.1_Intron	p.C285F	NM_145697	NP_663735	WXS	Illumina HiSeq	Unspecified	Q9BZD4	NUF2_HUMAN			11	1154	+	all_hematologic(923;0.101)		285			Interaction with the N-terminus of NDC80.|Potential.		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	c.854G>T	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.535269	0.00942	.	.	ENSG00000143228	ENST00000367900;ENST00000271452	T;T	0.29917	1.55;1.55	4.88	0.472	0.16758	.	0.690606	0.16052	N	0.231921	T	0.08758	0.0217	L	0.29908	0.895	0.38103	D	0.937335	B	0.02656	0.0	B	0.01281	0.0	T	0.17137	-1.0379	9	0.52906	T	0.07	0.0565	9.3062	0.37876	0.0:0.4476:0.399:0.1534	.	285	Q9BZD4	NUF2_HUMAN	F	285	ENSP00000356875:C285F;ENSP00000271452:C285F	ENSP00000271452:C285F	C	+	2	0	NUF2	161582138	0.021000	0.18746	0.139000	0.22197	0.411000	0.31082	0.835000	0.27531	0.218000	0.20820	-0.282000	0.10007	TGC		0.368	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		33	77	1	0	1.22384e-17	0.013726	1.675e-17	33	77				
DUSP27	92235	broad.mit.edu	37	1	167097826	167097826	+	Missense_Mutation	SNP	A	A	C	rs111745868	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:167097826A>C	ENST00000361200.2	+	6	3624	c.3458A>C	c.(3457-3459)cAg>cCg	p.Q1153P	DUSP27_ENST00000443333.1_Missense_Mutation_p.Q1153P|DUSP27_ENST00000271385.5_Missense_Mutation_p.Q1153P|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1153					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACCAAGCTGCAGAAAAGGAGG	0.527																																							uc001geb.1		NA																	0				ovary(3)	3						c.(3457-3459)CAG>CCG		dual specificity phosphatase 27							31.0	31.0	31.0					1																	167097826		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097826A>C	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3458A>C	1.37:g.167097826A>C	ENSP00000354483:p.Gln1153Pro		Somatic					p.Q1153P	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	3458	+			1153					A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.3458A>C	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.684289	0.29872	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03745	3.82;3.82;3.82	5.6	3.27	0.37495	.	0.325998	0.22651	N	0.057332	T	0.04407	0.0121	M	0.63428	1.95	0.28073	N	0.932512	D	0.71674	0.998	P	0.61940	0.896	T	0.27365	-1.0076	10	0.56958	D	0.05	-21.8628	5.4386	0.16496	0.6087:0.1386:0.2527:0.0	.	1153	Q5VZP5	DUS27_HUMAN	P	1153	ENSP00000354483:Q1153P;ENSP00000271385:Q1153P;ENSP00000404874:Q1153P	ENSP00000271385:Q1153P	Q	+	2	0	DUSP27	165364450	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	1.245000	0.32790	0.411000	0.25702	-0.386000	0.06593	CAG		0.527	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		13	27	0	0	0	0.003163	0	13	27				
SUCO	51430	broad.mit.edu	37	1	172579150	172579150	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:172579150G>C	ENST00000263688.3	+	24	3735	c.3516G>C	c.(3514-3516)caG>caC	p.Q1172H	SUCO_ENST00000367723.4_Missense_Mutation_p.Q1323H|SUCO_ENST00000608151.1_Missense_Mutation_p.Q1324H|SUCO_ENST00000610051.1_Missense_Mutation_p.Q801H	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1172					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											CTTCATCACAGTCAGAAGAGT	0.403																																						Colon(43;174 953 11768 38880 47057)	uc001giq.3		NA																	0				ovary(2)	2						c.(3514-3516)CAG>CAC		chromosome 1 open reading frame 9 protein							106.0	103.0	104.0					1																	172579150		2203	4300	6503	SO:0001583	missense	51430				multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane		g.chr1:172579150G>C	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3516G>C	1.37:g.172579150G>C	ENSP00000263688:p.Gln1172His		Somatic				C1orf9_uc009wwd.2_Missense_Mutation_p.Q1128H|C1orf9_uc010pmn.1_Missense_Mutation_p.Q801H|C1orf9_uc010pmo.1_RNA	p.Q1172H	NM_014283	NP_055098	WXS	Illumina HiSeq	Unspecified	Q9UBS9	OSPT_HUMAN		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)	24	3832	+		Breast(1374;0.212)	1172					B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	c.3516G>C	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341667	0.24339	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.26	1.26	0.21427	.	0.234344	0.44097	D	0.000489	T	0.27967	0.0689	M	0.65975	2.015	0.36886	D	0.889638	B;P;P	0.40302	0.073;0.712;0.553	B;B;B	0.32393	0.066;0.145;0.145	T	0.10753	-1.0616	9	0.62326	D	0.03	-9.184	9.4763	0.38873	0.3692:0.0:0.6308:0.0	.	801;1324;1172	B4DYM4;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	H	1324;1172	.	ENSP00000263688:Q1172H	Q	+	3	2	C1orf9	170845773	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	0.521000	0.22893	0.048000	0.15891	-0.157000	0.13467	CAG		0.403	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		21	139	0	0	0	0.014323	0	21	139				
HMCN1	83872	broad.mit.edu	37	1	185932971	185932971	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:185932971G>T	ENST00000271588.4	+	13	2271	c.2042G>T	c.(2041-2043)tGc>tTc	p.C681F	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Missense_Mutation_p.C681F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	681	Ig-like C2-type 3.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCTATGGTTGCCTAGCAAGT	0.328																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(2041-2043)TGC>TTC		hemicentin 1 precursor							95.0	104.0	101.0					1																	185932971		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:185932971G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2042G>T	1.37:g.185932971G>T	ENSP00000271588:p.Cys681Phe		Somatic				HMCN1_uc001grr.1_Missense_Mutation_p.C22F	p.C681F	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			13	2271	+			681			Ig-like C2-type 3.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.2042G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372256	0.61624	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67345	-0.26;-0.26	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89979	0.6872	H	0.99026	4.405	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.986	D	0.93923	0.7207	10	0.87932	D	0	.	19.2951	0.94118	0.0:0.0:1.0:0.0	.	65;681	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	F	681	ENSP00000271588:C681F;ENSP00000356462:C681F	ENSP00000271588:C681F	C	+	2	0	HMCN1	184199594	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	8.432000	0.90288	2.559000	0.86315	0.591000	0.81541	TGC		0.328	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		57	86	1	0	1.45723e-30	0.01441	2.1298e-30	57	86				
BRINP3	339479	broad.mit.edu	37	1	190067402	190067402	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:190067402G>T	ENST00000367462.3	-	8	2278	c.2047C>A	c.(2047-2049)Ctg>Atg	p.L683M	BRINP3_ENST00000534846.1_Missense_Mutation_p.L581M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	683					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.L683M(1)									TGCAAAATCAGGTCCCGAATT	0.463																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2047-2049)CTG>ATG		family with sequence similarity 5, member C							109.0	109.0	109.0					1																	190067402		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067402G>T	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2047C>A	1.37:g.190067402G>T	ENSP00000356432:p.Leu683Met		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.L581M	p.L683M	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2279	-	Prostate(682;0.198)		683					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2047C>A	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362575	0.41902	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.21361	2.26;2.01	5.62	-2.57	0.06248	.	0.082989	0.49916	D	0.000129	T	0.18923	0.0454	M	0.70275	2.135	0.40961	D	0.984625	B;B	0.12013	0.005;0.003	B;B	0.13407	0.009;0.002	T	0.04090	-1.0978	10	0.62326	D	0.03	.	6.7376	0.23419	0.6783:0.0:0.1792:0.1425	.	581;683	B7Z260;Q76B58	.;FAM5C_HUMAN	M	683;581	ENSP00000356432:L683M;ENSP00000438022:L581M	ENSP00000356432:L683M	L	-	1	2	FAM5C	188334025	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	1.272000	0.33109	-0.334000	0.08463	0.650000	0.86243	CTG		0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		58	84	1	0	7.10663e-31	0.01441	1.05295e-30	58	84				
PTPN14	5784	broad.mit.edu	37	1	214557195	214557195	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:214557195C>G	ENST00000366956.5	-	13	2197	c.2003G>C	c.(2002-2004)cGc>cCc	p.R668P	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	668					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GAGCGTGTTGCGGCGAGCCAT	0.647																																					Colon(92;557 1424 24372 34121 40073)	Colon(92;557 1424 24372 34121 40073)	uc001hkk.1		NA																	0				breast(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2002-2004)CGC>CCC		protein tyrosine phosphatase, non-receptor type							42.0	40.0	41.0					1																	214557195		2203	4300	6503	SO:0001583	missense	5784				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding	g.chr1:214557195C>G	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2003G>C	1.37:g.214557195C>G	ENSP00000355923:p.Arg668Pro		Somatic				PTPN14_uc010pty.1_Missense_Mutation_p.R569P	p.R668P	NM_005401	NP_005392	WXS	Illumina HiSeq	Unspecified	Q15678	PTN14_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)	13	2274	-			668					Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	c.2003G>C	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	8.427	0.847698	0.17034	.	.	ENSG00000152104	ENST00000366956	T	0.69040	-0.37	4.99	4.07	0.47477	.	0.105878	0.64402	D	0.000016	T	0.61640	0.2363	L	0.33137	0.985	0.80722	D	1	P	0.46457	0.878	P	0.47430	0.547	T	0.61118	-0.7127	10	0.40728	T	0.16	.	13.2362	0.59971	0.0:0.9225:0.0:0.0775	.	668	Q15678	PTN14_HUMAN	P	668	ENSP00000355923:R668P	ENSP00000355923:R668P	R	-	2	0	PTPN14	212623818	1.000000	0.71417	0.932000	0.37286	0.470000	0.32858	6.915000	0.75770	1.103000	0.41568	0.557000	0.71058	CGC		0.647	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401		14	29	0	0	0	0.004007	0	14	29				
PRSS38	339501	broad.mit.edu	37	1	228003938	228003938	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:228003938C>A	ENST00000366757.3	+	2	320	c.296C>A	c.(295-297)gCg>gAg	p.A99E		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	99	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						CTGTCAGCTGCGCACTGCTTT	0.672																																							uc001hrh.2		NA																	0				ovary(1)|pancreas(1)	2						c.(295-297)GCG>GAG		marapsin 2 precursor							61.0	67.0	65.0					1																	228003938		2203	4299	6502	SO:0001583	missense	339501				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr1:228003938C>A		CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.296C>A	1.37:g.228003938C>A	ENSP00000355719:p.Ala99Glu		Somatic					p.A99E	NM_183062	NP_898885	WXS	Illumina HiSeq	Unspecified	A1L453	PRS38_HUMAN			2	296	+			99			Peptidase S1.		Q7RTY6	Missense_Mutation	SNP	ENST00000366757.3	37	c.296C>A	CCDS1563.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334113	0.60853	.	.	ENSG00000185888	ENST00000366757	T	0.72835	-0.69	4.24	4.24	0.50183	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42548	D	0.000681	D	0.89167	0.6638	H	0.97365	3.99	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.92730	0.6199	10	0.87932	D	0	.	14.1587	0.65432	0.0:1.0:0.0:0.0	.	99	A1L453	PRS38_HUMAN	E	99	ENSP00000355719:A99E	ENSP00000355719:A99E	A	+	2	0	PRSS38	226070561	0.999000	0.42202	0.945000	0.38365	0.244000	0.25665	4.516000	0.60496	2.197000	0.70478	0.467000	0.42956	GCG		0.672	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1	NM_183062		49	102	1	0	1.30916e-28	0.01441	1.89623e-28	49	102				
RYR2	6262	broad.mit.edu	37	1	237880546	237880547	+	Missense_Mutation	DNP	CG	CG	TC			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:237880546_237880547CG>TC	ENST00000366574.2	+	72	10689_10690	c.10372_10373CG>TC	c.(10372-10374)CGg>TCg	p.R3458S	RYR2_ENST00000360064.6_Missense_Mutation_p.R3456S|RYR2_ENST00000542537.1_Missense_Mutation_p.R3442S|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3458					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R3456L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAAGGAGATCGGTATTCCATG	0.495																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(10372-10374)CGG>TCG		cardiac muscle ryanodine receptor																																				SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237880546_237880547CG>TC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	Exception_encountered	1.37:g.237880546_237880547delinsTC	ENSP00000355533:p.Arg3458Ser		Somatic				RYR2_uc010pxz.1_Missense_Mutation_p.R413S	p.R3458S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		72	10492_10493	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3458					Q15411|Q546N8|Q5T3P2	Missense_Mutation	DNP	ENST00000366574.2	37	c.10372_10373CG>TC	CCDS55691.1																																																																																				0.495	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		19	12	0	0	0	0.004672	0	19	12				
RYR2	6262	broad.mit.edu	37	1	237947838	237947838	+	Missense_Mutation	SNP	G	G	T	rs368599791		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:237947838G>T	ENST00000366574.2	+	90	13143	c.12826G>T	c.(12826-12828)Gtg>Ttg	p.V4276L	RYR2_ENST00000360064.6_Missense_Mutation_p.V4282L|RYR2_ENST00000542537.1_Missense_Mutation_p.V4260L|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4276					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V4274L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAGATGACCGTGAAGGACAT	0.468																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12826-12828)GTG>TTG		cardiac muscle ryanodine receptor							67.0	67.0	67.0					1																	237947838		1878	4124	6002	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947838G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12826G>T	1.37:g.237947838G>T	ENSP00000355533:p.Val4276Leu		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.V691L	p.V4276L	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12946	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4276					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12826G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	5.455	0.269114	0.10349	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96427	-4.01;-3.98;-4.01	5.11	-6.59	0.01830	.	0.693333	0.12852	N	0.433874	D	0.91068	0.7189	L	0.39245	1.2	0.52501	D	0.999957	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.68081	-0.5503	10	0.16420	T	0.52	.	13.0341	0.58860	0.7322:0.0:0.1755:0.0923	.	1250;4276	B4DGV4;Q92736	.;RYR2_HUMAN	L	4276;4282;4260;1250	ENSP00000355533:V4276L;ENSP00000353174:V4282L;ENSP00000443798:V4260L	ENSP00000353174:V4282L	V	+	1	0	RYR2	236014461	0.000000	0.05858	0.001000	0.08648	0.685000	0.39939	-0.114000	0.10757	-1.482000	0.01860	-0.794000	0.03295	GTG		0.468	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		23	26	1	0	1.96895e-08	0.00278	2.25521e-08	23	26				
OR2L13	284521	broad.mit.edu	37	1	248263049	248263049	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:248263049C>A	ENST00000358120.2	+	2	517	c.372C>A	c.(370-372)gcC>gcA	p.A124A	OR2L13_ENST00000366478.2_Silent_p.A124A			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GTTATTTGGCCATCTGCCACT	0.502																																							uc001ids.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(370-372)GCC>GCA		olfactory receptor, family 2, subfamily L,							212.0	200.0	204.0					1																	248263049		2203	4300	6503	SO:0001819	synonymous_variant	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263049C>A	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.372C>A	1.37:g.248263049C>A			Somatic					p.A124A	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	709	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		124			Cytoplasmic (Potential).		Q5VUR5	Silent	SNP	ENST00000358120.2	37	c.372C>A	CCDS1637.1																																																																																				0.502	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		61	273	1	0	3.95532e-38	0.01441	5.99797e-38	61	273				
OR2L13	284521	broad.mit.edu	37	1	248263312	248263312	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:248263312G>T	ENST00000358120.2	+	2	780	c.635G>T	c.(634-636)gGc>gTc	p.G212V	OR2L13_ENST00000366478.2_Missense_Mutation_p.G212V			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G212D(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CCTTTCATTGGCATCACTTCT	0.428																																							uc001ids.2		NA																	2	Substitution - Missense(2)		endometrium(2)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(634-636)GGC>GTC		olfactory receptor, family 2, subfamily L,							170.0	163.0	165.0					1																	248263312		2203	4300	6503	SO:0001583	missense	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263312G>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.635G>T	1.37:g.248263312G>T	ENSP00000350836:p.Gly212Val		Somatic					p.G212V	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	972	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		212			Helical; Name=5; (Potential).		Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	c.635G>T	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.107134	0.00033	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.31769	1.48;1.48	4.21	2.2	0.27929	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000228	T	0.21801	0.0525	N	0.02334	-0.595	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.25398	-1.0133	10	0.02654	T	1	.	11.1934	0.48698	0.0:0.0:0.4492:0.5508	.	212	Q8N349	OR2LD_HUMAN	V	212	ENSP00000355434:G212V;ENSP00000350836:G212V	ENSP00000350836:G212V	G	+	2	0	OR2L13	246329935	0.000000	0.05858	0.065000	0.19835	0.007000	0.05969	-0.366000	0.07563	0.966000	0.38159	-0.127000	0.14921	GGC		0.428	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		35	74	1	0	2.42023e-17	0.003271	3.2846e-17	35	74				
VIM	7431	broad.mit.edu	37	10	17275634	17275634	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:17275634G>T	ENST00000224237.5	+	3	818	c.673G>T	c.(673-675)Gaa>Taa	p.E225*	VIM_ENST00000544301.1_Nonsense_Mutation_p.E225*|RP11-124N14.3_ENST00000456355.1_RNA			P08670	VIME_HUMAN	vimentin	225	Coil 1B.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACGCAAAGTGGAATCTTTGCA	0.458																																							uc001iou.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(673-675)GAA>TAA		vimentin							87.0	80.0	82.0					10																	17275634		2203	4300	6503	SO:0001587	stop_gained	7431				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton	g.chr10:17275634G>T	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.673G>T	10.37:g.17275634G>T	ENSP00000224237:p.Glu225*		Somatic				VIM_uc001iov.1_Nonsense_Mutation_p.E225*|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Nonsense_Mutation_p.E225*|VIM_uc001ioy.1_Nonsense_Mutation_p.E225*|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Nonsense_Mutation_p.E225*|VIM_uc001ipc.1_Nonsense_Mutation_p.E225*	p.E225*	NM_003380	NP_003371	WXS	Illumina HiSeq	Unspecified	P08670	VIME_HUMAN			4	1086	+			225			Rod.|Coil 1B.		B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Nonsense_Mutation	SNP	ENST00000224237.5	37	c.673G>T	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	G	39	7.790595	0.98492	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	.	.	.	6.14	6.14	0.99180	.	0.000000	0.47455	D	0.000223	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.819	0.99723	0.0:0.0:1.0:0.0	.	.	.	.	X	225;225;212;51	.	ENSP00000224237:E225X	E	+	1	0	VIM	17315640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.789000	0.99068	2.927000	0.99377	0.637000	0.83480	GAA		0.458	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380		30	38	1	0	4.74835e-14	0.010818	6.11043e-14	30	38				
SLC39A12	221074	broad.mit.edu	37	10	18270306	18270307	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:18270306_18270307GG>CT	ENST00000377369.2	+	6	1263_1264	c.990_991GG>CT	c.(988-993)aaGGag>aaCTag	p.330_331KE>N*	SLC39A12_ENST00000377374.4_Nonsense_Mutation_p.330_331KE>N*|SLC39A12_ENST00000377371.3_Nonsense_Mutation_p.330_331KE>N*|SLC39A12_ENST00000539911.1_Nonsense_Mutation_p.196_197KE>N*	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	330					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TCATTTCTAAGGAGGACTTTAA	0.485																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(988-993)AAGGAG>AACTAG		solute carrier family 39 (zinc transporter),																																				SO:0001587	stop_gained	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18270306_18270307GG>CT		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	Exception_encountered	10.37:g.18270306_18270307delinsCT	ENSP00000366586:p.K330_E331delinsN*		Somatic				SLC39A12_uc001ipn.2_Nonsense_Mutation_p.330_331KE>N*|SLC39A12_uc001ipp.2_Nonsense_Mutation_p.330_331KE>N*|SLC39A12_uc010qck.1_Nonsense_Mutation_p.196_197KE>N*	p.330_331KE>N*	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			6	1263_1264	+			330_331			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Nonsense_Mutation	DNP	ENST00000377369.2	37	c.990_991GG>CT	CCDS44362.1																																																																																				0.485	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		26	60	0	0	0	0.004672	0	26	60				
ZEB1	6935	broad.mit.edu	37	10	31810827	31810827	+	Missense_Mutation	SNP	A	A	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:31810827A>C	ENST00000320985.10	+	7	2674	c.2564A>C	c.(2563-2565)gAa>gCa	p.E855A	ZEB1_ENST00000542815.3_Missense_Mutation_p.E788A|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000446923.2_Missense_Mutation_p.E839A|ZEB1_ENST00000560721.2_Missense_Mutation_p.E835A|ZEB1_ENST00000361642.5_Missense_Mutation_p.E856A			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	855					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GCAGTCCAAGAACCACCCTTG	0.438																																					Ovarian(40;423 959 14296 36701 49589)	Ovarian(40;423 959 14296 36701 49589)	uc001ivs.3		NA																	0				ovary(3)|central_nervous_system(2)	5						c.(2563-2565)GAA>GCA		zinc finger E-box binding homeobox 1 isoform b							72.0	73.0	73.0					10																	31810827		2203	4300	6503	SO:0001583	missense	6935				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr10:31810827A>C	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2564A>C	10.37:g.31810827A>C	ENSP00000319248:p.Glu855Ala		Somatic				ZEB1_uc001ivr.3_Missense_Mutation_p.E637A|ZEB1_uc010qee.1_Missense_Mutation_p.E637A|ZEB1_uc010qef.1_Missense_Mutation_p.E637A|ZEB1_uc009xlj.1_Missense_Mutation_p.E781A|ZEB1_uc010qeg.1_Missense_Mutation_p.E714A|ZEB1_uc009xlk.1_Missense_Mutation_p.E637A|ZEB1_uc001ivt.3_Missense_Mutation_p.E637A|ZEB1_uc001ivu.3_Missense_Mutation_p.E856A|ZEB1_uc001ivv.3_Missense_Mutation_p.E835A|ZEB1_uc010qeh.1_Missense_Mutation_p.E788A|ZEB1_uc009xlo.1_Missense_Mutation_p.E838A|ZEB1_uc009xlp.2_Missense_Mutation_p.E839A	p.E855A	NM_030751	NP_110378	WXS	Illumina HiSeq	Unspecified	P37275	ZEB1_HUMAN			7	2627	+		Prostate(175;0.0156)	855					B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	c.2564A>C	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.869798	0.51588	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T;T	0.12774	2.96;2.65;2.7;2.65;2.82;2.7	5.68	5.68	0.88126	.	0.213489	0.32401	N	0.006148	T	0.28134	0.0694	L	0.36672	1.1	0.58432	D	0.999997	B;P;D;D;D;B;D;D	0.69078	0.178;0.952;0.996;0.988;0.997;0.374;0.996;0.988	B;B;P;P;D;B;P;P	0.73380	0.051;0.337;0.874;0.76;0.98;0.113;0.874;0.76	T	0.00822	-1.1552	10	0.41790	T	0.15	-15.478	16.2322	0.82352	1.0:0.0:0.0:0.0	.	788;855;839;855;855;835;856;855	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	A	637;855;856;850;788;855;835;746;839	ENSP00000444282:E637A;ENSP00000354487:E856A;ENSP00000444891:E788A;ENSP00000319248:E855A;ENSP00000405958:E835A;ENSP00000391612:E839A	ENSP00000319248:E855A	E	+	2	0	ZEB1	31850833	1.000000	0.71417	0.980000	0.43619	0.716000	0.41182	8.639000	0.91023	2.288000	0.76882	0.528000	0.53228	GAA		0.438	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		26	52	0	0	0	0.00632	0	26	52				
NPY4R	5540	broad.mit.edu	37	10	47087797	47087797	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:47087797G>T	ENST00000395716.1	+	2	1099	c.1014G>T	c.(1012-1014)ctG>ctT	p.L338L	NPY4R_ENST00000374312.1_Silent_p.L338L			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	338					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										CCCTGGTGCTGACTTGCCAGC	0.567																																							uc001jee.2		NA																	0				ovary(1)|skin(1)	2						c.(1012-1014)CTG>CTT		pancreatic polypeptide receptor 1							146.0	145.0	146.0					10																	47087797		2203	4300	6503	SO:0001819	synonymous_variant	5540				blood circulation|digestion|feeding behavior	integral to plasma membrane		g.chr10:47087797G>T		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.1014G>T	10.37:g.47087797G>T			Somatic				ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Silent_p.L338L	p.L338L	NM_005972	NP_005963	WXS	Illumina HiSeq	Unspecified	P50391	NPY4R_HUMAN			3	1433	+			338			Cytoplasmic (Potential).		Q13456|Q5ISU3|Q5T2X9|Q6FH06	Silent	SNP	ENST00000395716.1	37	c.1014G>T	CCDS31193.1																																																																																				0.567	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1			21	83	1	0	5.26018e-13	0.012319	6.61104e-13	21	83				
GDF2	2658	broad.mit.edu	37	10	48413967	48413967	+	Missense_Mutation	SNP	C	C	G	rs41314469		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:48413967C>G	ENST00000249598.1	-	2	1060	c.901G>C	c.(901-903)Gag>Cag	p.E301Q		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	301					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GTGTCCTCCTCGTGACTGCTC	0.622																																							uc001jfa.1		NA																	0				ovary(2)|skin(1)	3						c.(901-903)GAG>CAG		growth differentiation factor 2 precursor							82.0	69.0	73.0					10																	48413967		2203	4300	6503	SO:0001583	missense	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48413967C>G	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.901G>C	10.37:g.48413967C>G	ENSP00000249598:p.Glu301Gln		Somatic					p.E301Q	NM_016204	NP_057288	WXS	Illumina HiSeq	Unspecified	Q9UK05	GDF2_HUMAN			2	1064	-			301					Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	c.901G>C	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	C	2.702	-0.270701	0.05716	.	.	ENSG00000128802	ENST00000249598	T	0.78246	-1.16	4.53	2.59	0.31030	.	0.775855	0.12061	N	0.503182	T	0.69115	0.3075	M	0.62723	1.935	0.09310	N	1	B	0.17465	0.022	B	0.18263	0.021	T	0.53056	-0.8492	10	0.17369	T	0.5	.	4.5719	0.12214	0.1536:0.6119:0.1491:0.0854	.	301	Q9UK05	GDF2_HUMAN	Q	301	ENSP00000249598:E301Q	ENSP00000249598:E301Q	E	-	1	0	GDF2	48033973	0.001000	0.12720	0.001000	0.08648	0.057000	0.15508	0.882000	0.28186	0.873000	0.35799	0.467000	0.42956	GAG		0.622	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		29	47	0	0	0	0.008361	0	29	47				
ADAMTS14	140766	broad.mit.edu	37	10	72434578	72434578	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:72434578C>T	ENST00000373207.1	+	2	349	c.349C>T	c.(349-351)Ctg>Ttg	p.L117L	ADAMTS14_ENST00000373208.1_Silent_p.L117L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	117					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CGGGAAGGAACTGCACTTGCG	0.637																																							uc001jrh.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(349-351)CTG>TTG		ADAM metallopeptidase with thrombospondin type 1							50.0	43.0	45.0					10																	72434578		2203	4300	6503	SO:0001819	synonymous_variant	140766				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr10:72434578C>T	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.349C>T	10.37:g.72434578C>T			Somatic				ADAMTS14_uc001jrg.2_Silent_p.L117L	p.L117L	NM_080722	NP_542453	WXS	Illumina HiSeq	Unspecified	Q8WXS8	ATS14_HUMAN			2	349	+			117					Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	ENST00000373207.1	37	c.349C>T	CCDS7306.1																																																																																				0.637	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		18	23	0	0	0	0.006122	0	18	23				
LDB3	11155	broad.mit.edu	37	10	88441336	88441336	+	Silent	SNP	C	C	T	rs45516997		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:88441336C>T	ENST00000361373.4	+	4	486	c.465C>T	c.(463-465)ctC>ctT	p.L155L	LDB3_ENST00000310944.6_Silent_p.L155L|LDB3_ENST00000429277.2_Silent_p.L155L|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000372056.4_Silent_p.L155L|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000542786.1_Silent_p.L155L|LDB3_ENST00000458213.2_Intron	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TCTCCTCACTCGCCGAGGCCT	0.736													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14425	0.0		0.0	False		,,,				2504	0.0						uc001kdv.2		NA																	0				ovary(1)	1						c.(463-465)CTC>CTT		LIM domain binding 3 isoform 1		C	,,,,,	0,4402		0,0,2201	22.0	23.0	23.0		,465,,465,465,465	2.9	0.0	10	dbSNP_127	23	23,8569		0,23,4273	no	intron,coding-synonymous,intron,coding-synonymous,coding-synonymous,coding-synonymous	LDB3	NM_001080114.1,NM_001080115.1,NM_001080116.1,NM_001171610.1,NM_001171611.1,NM_007078.2	,,,,,	0,23,6474	TT,TC,CC		0.2677,0.0,0.177	,,,,,	,155/331,,155/733,155/399,155/728	88441336	23,12971	2201	4296	6497	SO:0001819	synonymous_variant	11155					cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding	g.chr10:88441336C>T	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.465C>T	10.37:g.88441336C>T			Somatic				LDB3_uc010qml.1_Silent_p.L155L|LDB3_uc010qmm.1_Silent_p.L155L|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron|LDB3_uc001kdr.2_Intron|LDB3_uc009xsy.2_Silent_p.L155L|LDB3_uc001kds.2_Silent_p.L155L|LDB3_uc001kdt.2_RNA	p.L155L	NM_007078	NP_009009	WXS	Illumina HiSeq	Unspecified	O75112	LDB3_HUMAN			4	488	+			155						Silent	SNP	ENST00000361373.4	37	c.465C>T	CCDS7377.1																																																																																				0.736	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			3	42	0	0	0	0.004672	0	3	42				
PANK1	53354	broad.mit.edu	37	10	91404709	91404709	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:91404709C>T	ENST00000307534.4	-	1	506	c.351G>A	c.(349-351)gaG>gaA	p.E117E	PANK1_ENST00000322191.6_5'Flank|RP11-80H5.2_ENST00000451733.1_RNA|RP11-80H5.2_ENST00000454174.1_RNA|PANK1_ENST00000371774.2_5'Flank|PANK1_ENST00000342512.3_5'Flank|RP11-80H5.6_ENST00000428166.1_lincRNA|PANK1_ENST00000488482.1_5'Flank	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	117					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						GGAGGTCATTCTCCGGCGTCT	0.741																																							uc001kgp.1		NA																	0					0						c.(349-351)GAG>GAA		pantothenate kinase 1 isoform alpha	Bezafibrate(DB01393)						8.0	11.0	10.0					10																	91404709		1973	4187	6160	SO:0001819	synonymous_variant	53354				coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity	g.chr10:91404709C>T	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.351G>A	10.37:g.91404709C>T			Somatic				PANK1_uc001kgn.1_5'Flank|PANK1_uc001kgo.1_5'Flank|PANK1_uc009xtu.1_5'Flank	p.E117E	NM_148977	NP_683878	WXS	Illumina HiSeq	Unspecified	Q8TE04	PANK1_HUMAN			1	507	-			117					A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Silent	SNP	ENST00000307534.4	37	c.351G>A	CCDS31244.1																																																																																				0.741	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				8	18	0	0	0	0.00308	0	8	18				
HPSE2	60495	broad.mit.edu	37	10	100374727	100374727	+	Silent	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:100374727C>G	ENST00000370552.3	-	9	1313	c.1254G>C	c.(1252-1254)gtG>gtC	p.V418V	HPSE2_ENST00000370546.1_Silent_p.V418V|HPSE2_ENST00000404542.1_Silent_p.V306V|HPSE2_ENST00000370549.1_Silent_p.V360V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	418					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		AGTGCCGTATCACGACATCAA	0.388																																							uc001kpn.1		NA																	0				ovary(1)	1						c.(1252-1254)GTG>GTC		heparanase 2							196.0	168.0	178.0					10																	100374727		2203	4300	6503	SO:0001819	synonymous_variant	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100374727C>G	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1254G>C	10.37:g.100374727C>G			Somatic				HPSE2_uc009xwc.1_Silent_p.V408V|HPSE2_uc001kpo.1_Silent_p.V350V|HPSE2_uc009xwd.1_Silent_p.V296V	p.V418V	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	9	1314	-			418					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	c.1254G>C	CCDS7477.1																																																																																				0.388	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		53	113	0	0	0	0.01441	0	53	113				
GSTO2	119391	broad.mit.edu	37	10	106037800	106037800	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:106037800C>T	ENST00000338595.2	+	4	612	c.292C>T	c.(292-294)Cca>Tca	p.P98S	GSTO2_ENST00000369707.2_Missense_Mutation_p.P70S|GSTO2_ENST00000477078.2_3'UTR|GSTO2_ENST00000429569.2_Missense_Mutation_p.P70S|GSTO2_ENST00000401888.2_Missense_Mutation_p.P98S|GSTO2_ENST00000450629.2_Missense_Mutation_p.P98S	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	98	GST N-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	TGATGCTTATCCAGGAAGGAA	0.408																																							uc001kyb.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(292-294)CCA>TCA		glutathione S-transferase omega 2	Glutathione(DB00143)						191.0	157.0	168.0					10																	106037800		2203	4300	6503	SO:0001583	missense	119391				water-soluble vitamin metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr10:106037800C>T	AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.292C>T	10.37:g.106037800C>T	ENSP00000345023:p.Pro98Ser		Somatic				GSTO2_uc010qqw.1_Missense_Mutation_p.P98S|GSTO2_uc010qqx.1_Missense_Mutation_p.P98S|GSTO2_uc001kyc.2_Missense_Mutation_p.P70S|GSTO2_uc010qqy.1_Missense_Mutation_p.P70S	p.P98S	NM_183239	NP_899062	WXS	Illumina HiSeq	Unspecified	Q9H4Y5	GSTO2_HUMAN		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	4	920	+		Colorectal(252;0.178)	98			GST N-terminal.		A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	ENST00000338595.2	37	c.292C>T	CCDS7556.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539867	0.85917	.	.	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000450629;ENST00000401888;ENST00000369707;ENST00000429569	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.48	5.48	0.80851	Glutathione S-transferase, N-terminal (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.49304	0.1549	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.69078	0.99;0.994;0.997;0.962	P;D;P;P	0.64595	0.859;0.927;0.893;0.762	T	0.54774	-0.8243	10	0.54805	T	0.06	-14.6998	19.7157	0.96119	0.0:1.0:0.0:0.0	.	70;98;98;98	B4DML4;B4DJW6;B4DU59;Q9H4Y5	.;.;.;GSTO2_HUMAN	S	98;98;98;98;70;70	ENSP00000345023:P98S;ENSP00000390986:P98S;ENSP00000386011:P98S;ENSP00000358721:P70S;ENSP00000407381:P70S	ENSP00000345023:P98S	P	+	1	0	GSTO2	106027790	1.000000	0.71417	0.392000	0.26245	0.734000	0.41952	7.046000	0.76592	2.749000	0.94314	0.655000	0.94253	CCA		0.408	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050210.2	NM_183239		26	42	0	0	0	0.003954	0	26	42				
NHLRC2	374354	broad.mit.edu	37	10	115636548	115636548	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:115636548C>T	ENST00000369301.3	+	3	812	c.600C>T	c.(598-600)gaC>gaT	p.D200D		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	200	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.									breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		ATTACAAAGACAGGGGGCAGA	0.343																																							uc001lax.1		NA																	0				ovary(1)	1						c.(598-600)GAC>GAT		NHL repeat containing 2							47.0	51.0	50.0					10																	115636548		2201	4299	6500	SO:0001819	synonymous_variant	374354				cell redox homeostasis			g.chr10:115636548C>T	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.600C>T	10.37:g.115636548C>T			Somatic					p.D200D	NM_198514	NP_940916	WXS	Illumina HiSeq	Unspecified	Q8NBF2	NHLC2_HUMAN		Epithelial(162;0.017)|all cancers(201;0.0187)	3	812	+			200			Thioredoxin.		Q8N1H1|Q8N5A6	Silent	SNP	ENST00000369301.3	37	c.600C>T	CCDS7585.1																																																																																				0.343	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514		23	39	0	0	0	0.014323	0	23	39				
SLC18A2	6571	broad.mit.edu	37	10	119013583	119013584	+	Missense_Mutation	DNP	CC	CC	AA	rs11568719		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:119013583_119013584CC>AA	ENST00000298472.5	+	5	691_692	c.548_549CC>AA	c.(547-549)gCC>gAA	p.A183E	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	183					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	AGCAGCTATGCCTTCCTGCTGA	0.594																																							uc001ldd.1		NA																	0					0						c.(547-549)GCC>GAA		solute carrier family 18 (vesicular monoamine),	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)																																			SO:0001583	missense	6571				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity	g.chr10:119013583_119013584CC>AA	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	Exception_encountered	10.37:g.119013583_119013584delinsAA	ENSP00000298472:p.Ala183Glu		Somatic				SLC18A2_uc009xyy.1_5'UTR	p.A183E	NM_003054	NP_003045	WXS	Illumina HiSeq	Unspecified	Q05940	VMAT2_HUMAN		all cancers(201;0.029)	5	579_580	+		Colorectal(252;0.19)	183			Lumenal, vesicle (Potential).		B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	DNP	ENST00000298472.5	37	c.548_549CC>AA	CCDS7599.1																																																																																				0.594	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054		65	104	0	0	0	0.004672	0	65	104				
RGS10	6001	broad.mit.edu	37	10	121275037	121275037	+	Missense_Mutation	SNP	T	T	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:121275037T>C	ENST00000369101.3	-	3	386	c.359A>G	c.(358-360)cAg>cGg	p.Q120R	RGS10_ENST00000469575.1_Intron|RGS10_ENST00000392865.1_Missense_Mutation_p.Q114R|RGS10_ENST00000369103.2_Missense_Mutation_p.Q128R			O43665	RGS10_HUMAN	regulator of G-protein signaling 10	120	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|large_intestine(1)|lung(3)	6		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)		CTGGAGTTTCTGGAACATCAG	0.512																																							uc001lee.2		NA																	0					0						c.(358-360)CAG>CGG		regulator of G-protein signaling 10 isoform b							166.0	140.0	149.0					10																	121275037		2203	4300	6503	SO:0001583	missense	6001				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|protein binding|signal transducer activity	g.chr10:121275037T>C	AF045229	CCDS31294.1, CCDS41572.1	10q25	2007-08-14	2007-08-14		ENSG00000148908	ENSG00000148908		"""Regulators of G-protein signaling"""	9992	protein-coding gene	gene with protein product		602856	"""regulator of G-protein signalling 10"""			8774883	Standard	NM_002925		Approved		uc001leg.3	O43665	OTTHUMG00000019150	ENST00000369101.3:c.359A>G	10.37:g.121275037T>C	ENSP00000358097:p.Gln120Arg		Somatic				RGS10_uc001lef.2_Missense_Mutation_p.Q114R|RGS10_uc001leg.2_Missense_Mutation_p.Q128R	p.Q120R	NM_002925	NP_002916	WXS	Illumina HiSeq	Unspecified	O43665	RGS10_HUMAN		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)	3	359	-		Lung NSC(174;0.094)|all_lung(145;0.123)	120			RGS.		A8K408|B1AMR8|Q6IAZ6|Q96GN0	Missense_Mutation	SNP	ENST00000369101.3	37	c.359A>G		.	.	.	.	.	.	.	.	.	.	T	15.85	2.953893	0.53293	.	.	ENSG00000148908	ENST00000392865;ENST00000369103;ENST00000369101	T;T;T	0.02216	4.39;4.39;4.39	5.35	5.35	0.76521	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.64402	D	0.000002	T	0.07593	0.0191	L	0.39633	1.23	0.46981	D	0.999275	P;P;P	0.48694	0.914;0.805;0.913	P;P;D	0.64687	0.711;0.8;0.928	T	0.43782	-0.9370	10	0.37606	T	0.19	-1.8633	15.0164	0.71588	0.0:0.0:0.0:1.0	.	128;114;120	O43665-3;O43665-2;O43665	.;.;RGS10_HUMAN	R	114;128;120	ENSP00000376605:Q114R;ENSP00000358099:Q128R;ENSP00000358097:Q120R	ENSP00000358097:Q120R	Q	-	2	0	RGS10	121265027	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	6.499000	0.73683	2.017000	0.59298	0.374000	0.22700	CAG		0.512	RGS10-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050655.1	NM_002925		15	33	0	0	0	0.003163	0	15	33				
MKI67	4288	broad.mit.edu	37	10	129907447	129907447	+	Missense_Mutation	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:129907447T>G	ENST00000368654.3	-	13	3032	c.2657A>C	c.(2656-2658)aAg>aCg	p.K886T	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Missense_Mutation_p.K526T	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	886					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CACAGGTAGCTTCTGTATATT	0.403																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(2656-2658)AAG>ACG		antigen identified by monoclonal antibody Ki-67							226.0	215.0	219.0					10																	129907447		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129907447T>G	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.2657A>C	10.37:g.129907447T>G	ENSP00000357643:p.Lys886Thr		Somatic				MKI67_uc001lkf.2_Missense_Mutation_p.K526T|MKI67_uc009yav.1_Missense_Mutation_p.K461T|MKI67_uc009yaw.1_Missense_Mutation_p.K36T	p.K886T	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	2852	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	886					Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.2657A>C	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	1.678	-0.507196	0.04231	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01246	5.16;5.11	2.97	-3.31	0.04988	.	1.756690	0.03258	N	0.182883	T	0.00998	0.0033	N	0.14661	0.345	0.09310	N	1	B;B;B	0.20988	0.017;0.05;0.01	B;B;B	0.17722	0.008;0.019;0.004	T	0.47433	-0.9118	10	0.13853	T	0.58	.	4.3929	0.11350	0.2939:0.0:0.4947:0.2114	.	885;526;886	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	T	886;526;885	ENSP00000357643:K886T;ENSP00000357642:K526T	ENSP00000357642:K526T	K	-	2	0	MKI67	129797437	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.368000	0.07543	-0.708000	0.05015	0.460000	0.39030	AAG		0.403	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		9	214	0	0	0	0.006214	0	9	214				
PPP2R2D	55844	broad.mit.edu	37	10	133753657	133753657	+	5'UTR	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr10:133753657G>A	ENST00000422256.2	+	0	125							Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B, delta						exit from mitosis (GO:0010458)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|large_intestine(3)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)		AAATTAGGTGGTTACCACAAC	0.313																																							uc001lks.2		NA																	0				skin(1)	1						c.(220-222)TGG>TGA		protein phosphatase 2, regulatory subunit B,							47.0	47.0	47.0					10																	133753657		1884	4153	6037	SO:0001623	5_prime_UTR_variant	55844				cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity	g.chr10:133753657G>A	AF220046	CCDS73224.1	10q26.3	2013-01-10	2010-06-18		ENSG00000175470	ENSG00000175470		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	23732	protein-coding gene	gene with protein product	"""PP2A subunit B isoform delta"""	613992	"""protein phosphatase 2, regulatory subunit B, delta isoform"""			10819331	Standard	XM_005277927		Approved	MDS026	uc001lks.3	Q66LE6	OTTHUMG00000019277	ENST00000422256.2:c.-361G>A	10.37:g.133753657G>A			Somatic				PPP2R2D_uc001lkr.2_5'UTR|PPP2R2D_uc001lkt.2_5'UTR|PPP2R2D_uc009yay.2_5'UTR	p.W74*	NM_018461	NP_060931	WXS	Illumina HiSeq	Unspecified	Q66LE6	2ABD_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)	2	465	+		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)	107			WD 2.		A8KAK0|Q5SQJ2|Q9P1Y7	Nonsense_Mutation	SNP	ENST00000422256.2	37	c.222G>A		.	.	.	.	.	.	.	.	.	.	G	37	6.385247	0.97524	.	.	ENSG00000175470	ENST00000455566	.	.	.	3.99	3.99	0.46301	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4662	16.6727	0.85271	0.0:0.0:1.0:0.0	.	.	.	.	X	76	.	ENSP00000399970:W76X	W	+	3	0	PPP2R2D	133603647	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.722000	0.91452	2.223000	0.72356	0.655000	0.94253	TGG		0.313	PPP2R2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_018461		17	17	0	0	0	0.00499	0	17	17				
MUC5B	727897	broad.mit.edu	37	11	1267214	1267214	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:1267214C>T	ENST00000529681.1	+	31	9162	c.9104C>T	c.(9103-9105)aCc>aTc	p.T3035I	MUC5B_ENST00000447027.1_Missense_Mutation_p.T3038I|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3035	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCACAGCCACCAGTTCCAAA	0.612																																							uc009ycr.1		NA																	0					0						c.(10852-10854)ACC>ATC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							125.0	152.0	143.0					11																	1267214		2107	4214	6321	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1267214C>T	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9104C>T	11.37:g.1267214C>T	ENSP00000436812:p.Thr3035Ile		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.T3038I	p.T3618I	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	49	10979	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	3035	Missing (in Ref. 6; AAB61398).		7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.10853C>T	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	4.633	0.117658	0.08881	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21932	1.98;2.17	1.85	1.85	0.25348	.	.	.	.	.	T	0.35128	0.0921	L	0.59436	1.845	0.09310	N	1	B;D	0.64830	0.077;0.994	B;P	0.62885	0.069;0.908	T	0.06607	-1.0817	9	0.87932	D	0	.	7.1177	0.25427	0.0:1.0:0.0:0.0	.	3618;3038	A7Y9J9;E9PBJ0	.;.	I	3035;3038;3007;2995	ENSP00000436812:T3035I;ENSP00000415793:T3038I	ENSP00000343037:T3007I	T	+	2	0	MUC5B	1223790	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-1.130000	0.03241	1.014000	0.39417	0.423000	0.28283	ACC		0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		63	110	0	0	0	0.01441	0	63	110				
SYT8	90019	broad.mit.edu	37	11	1858580	1858580	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:1858580C>T	ENST00000381968.3	+	9	1253	c.1125C>T	c.(1123-1125)ccC>ccT	p.P375P	TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381905.3_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000341958.3_Silent_p.P361P	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	375					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGCGGCACCCCCTGCGGCCAG	0.726																																							uc001lue.1		NA																	0				ovary(1)	1						c.(1123-1125)CCC>CCT		synaptotagmin VIII							13.0	15.0	14.0					11																	1858580		2178	4253	6431	SO:0001819	synonymous_variant	90019					acrosomal vesicle|integral to membrane|plasma membrane|synaptic vesicle	transporter activity	g.chr11:1858580C>T	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1125C>T	11.37:g.1858580C>T			Somatic				SYT8_uc001lud.2_Silent_p.P375P|SYT8_uc001luf.1_Silent_p.P361P|TNNI2_uc010qxc.1_5'Flank|TNNI2_uc010qxd.1_5'Flank|TNNI2_uc010qxe.1_5'Flank	p.P375P	NM_138567	NP_612634	WXS	Illumina HiSeq	Unspecified	Q8NBV8	SYT8_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	9	1253	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	375			Cytoplasmic (Potential).		A6NFJ4|Q9NSV9	Silent	SNP	ENST00000381968.3	37	c.1125C>T	CCDS7726.2	.	.	.	.	.	.	.	.	.	.	c	2.218	-0.378979	0.05000	.	.	ENSG00000149043	ENST00000381978	T	0.08984	3.03	3.61	0.216	0.15258	.	.	.	.	.	T	0.05823	0.0152	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.45293	-0.9271	6	0.15952	T	0.53	.	4.4069	0.11414	0.1411:0.4963:0.2764:0.0862	.	.	.	.	S	374	ENSP00000371406:P374S	ENSP00000371406:P374S	P	+	1	0	SYT8	1815156	0.002000	0.14202	0.663000	0.29738	0.265000	0.26407	-0.040000	0.12104	0.311000	0.23014	-0.541000	0.04245	CCT		0.726	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4			4	11	0	0	0	0.009096	0	4	11				
IGF2	3481	broad.mit.edu	37	11	2167657	2167657	+	Intron	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:2167657C>T	ENST00000300632.5	-	2	720				IGF2-AS_ENST00000445504.2_RNA|IGF2-AS_ENST00000381361.3_RNA|IGF2-AS_ENST00000381363.4_RNA|INS-IGF2_ENST00000481781.1_5'Flank	NM_001007139.4	NP_001007140.2	P01344	IGF2_HUMAN	insulin-like growth factor 2						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)			central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		CTGGCGTCAGCCCGGCCGGCC	0.657																																							uc010qxi.1		NA																	0					0						c.(487-489)CCC>TCC		RecName: Full=Putative insulin-like growth factor 2 antisense gene protein;          Short=IGF2-AS; AltName: Full=PEG8/IGF2AS protein;							26.0	32.0	31.0					11																	2167657		2009	4162	6171	SO:0001627	intron_variant	51214							g.chr11:2167657C>T	M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000300632.5:c.5+1138G>A	11.37:g.2167657C>T			Somatic				IGF2_uc001lvh.2_Intron|INS-IGF2_uc001lvi.2_Intron|IGF2AS_uc001lvk.1_RNA|IGF2AS_uc001lvl.1_RNA	p.P163S	NM_016412	NP_057496	WXS	Illumina HiSeq	Unspecified			Colorectal(5;0.00388)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)	2	624	+		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)						B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Missense_Mutation	SNP	ENST00000300632.5	37	c.487C>T	CCDS7728.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867804	0.32977	.	.	ENSG00000099869	ENST00000381363	.	.	.	2.47	0.164	0.14990	.	.	.	.	.	T	0.29652	0.0740	.	.	.	0.09310	N	1	P	0.40282	0.711	B	0.42030	0.373	T	0.20174	-1.0283	7	0.87932	D	0	.	4.8354	0.13462	0.2002:0.3834:0.4164:0.0	.	163	Q6U949	IG2AS_HUMAN	S	163	.	ENSP00000370766:P163S	P	+	1	0	IGF2AS	2124233	0.000000	0.05858	0.000000	0.03702	0.316000	0.28119	-0.121000	0.10643	0.036000	0.15547	0.407000	0.27541	CCC		0.657	IGF2-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000612		3	21	0	0	0	0.004672	0	3	21				
NUP98	4928	broad.mit.edu	37	11	3714511	3714511	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:3714511G>T	ENST00000324932.7	-	27	4682	c.4262C>A	c.(4261-4263)cCa>cAa	p.P1421Q	snoU13_ENST00000458786.1_RNA|NUP98_ENST00000488828.1_5'Flank|NUP98_ENST00000355260.3_Missense_Mutation_p.P1421Q|NUP98_ENST00000359171.4_Missense_Mutation_p.P1421Q	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1438					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GGAGGCTGTTGGTGGAAGCAA	0.463			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		uc001lyh.2		NA		Dom	yes		11	11p15	4928	T	nucleoporin 98kDa			L	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11		AML		0				breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12						c.(4261-4263)CCA>CAA		nucleoporin 98kD isoform 1							177.0	174.0	175.0					11																	3714511		2201	4298	6499	SO:0001583	missense	4928				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity	g.chr11:3714511G>T	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4262C>A	11.37:g.3714511G>T	ENSP00000316032:p.Pro1421Gln		Somatic				NUP98_uc001lyi.2_Missense_Mutation_p.P1421Q|NUP98_uc001lyg.2_Missense_Mutation_p.P386Q	p.P1421Q	NM_016320	NP_057404	WXS	Illumina HiSeq	Unspecified	P52948	NUP98_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)	27	4553	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	1438					Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	c.4262C>A	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686907	0.88639	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.76018	0.3929	M	0.64676	1.99	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.992;0.999	T	0.69161	-0.5218	9	0.15066	T	0.55	-13.0374	18.7621	0.91856	0.0:0.0:1.0:0.0	.	1421;1421;1335	P52948-2;P52948-5;P52948-6	.;.;.	Q	1421	.	ENSP00000316032:P1421Q	P	-	2	0	NUP98	3671087	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.334000	0.96470	2.673000	0.90976	0.558000	0.71614	CCA		0.463	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320		50	115	1	0	7.77372e-23	0.01441	1.10128e-22	50	115				
OR51D1	390038	broad.mit.edu	37	11	4661103	4661103	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:4661103G>A	ENST00000357605.2	+	1	159	c.83G>A	c.(82-84)gGt>gAt	p.G28D		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTTTGGTGGGTATCCCTGGC	0.512																																							uc010qyk.1		NA																	0					0						c.(82-84)GGT>GAT		olfactory receptor, family 51, subfamily D,							171.0	147.0	155.0					11																	4661103		2201	4298	6499	SO:0001583	missense	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661103G>A	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.83G>A	11.37:g.4661103G>A	ENSP00000350222:p.Gly28Asp		Somatic					p.G28D	NM_001004751	NP_001004751	WXS	Illumina HiSeq	Unspecified	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	83	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	28			Extracellular (Potential).		B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	c.83G>A	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017492	0.35606	.	.	ENSG00000197428	ENST00000357605	T	0.00655	5.95	4.84	4.84	0.62591	.	0.000000	0.45867	D	0.000327	T	0.08403	0.0209	H	0.96269	3.795	0.40476	D	0.980398	D	0.89917	1.0	D	0.81914	0.995	T	0.01436	-1.1355	10	0.87932	D	0	.	17.0512	0.86519	0.0:0.0:1.0:0.0	.	28	Q8NGF3	O51D1_HUMAN	D	28	ENSP00000350222:G28D	ENSP00000350222:G28D	G	+	2	0	OR51D1	4617679	0.994000	0.37717	0.997000	0.53966	0.031000	0.12232	3.261000	0.51530	2.667000	0.90743	0.563000	0.77884	GGT		0.512	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		63	68	0	0	0	0.01441	0	63	68				
OR51A7	119687	broad.mit.edu	37	11	4929367	4929367	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:4929367C>A	ENST00000359350.4	+	1	768	c.768C>A	c.(766-768)acC>acA	p.T256T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCATCATCACCCTGGCTGCCA	0.493																																							uc010qyq.1		NA																	0				ovary(1)|skin(1)	2						c.(766-768)ACC>ACA		olfactory receptor, family 51, subfamily A,							223.0	214.0	217.0					11																	4929367		2201	4298	6499	SO:0001819	synonymous_variant	119687				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4929367C>A	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.768C>A	11.37:g.4929367C>A			Somatic					p.T256T	NM_001004749	NP_001004749	WXS	Illumina HiSeq	Unspecified	Q8NH64	O51A7_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	768	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	256			Helical; Name=6; (Potential).		Q6IFH8	Silent	SNP	ENST00000359350.4	37	c.768C>A	CCDS31364.1																																																																																				0.493	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749		90	113	1	0	1.13762e-57	0.01441	1.75814e-57	90	113				
DCDC1	341019	broad.mit.edu	37	11	31312227	31312227	+	Missense_Mutation	SNP	A	A	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:31312227A>C	ENST00000452803.1	-	7	1128	c.927T>G	c.(925-927)caT>caG	p.H309Q	DCDC1_ENST00000597505.1_Missense_Mutation_p.H309Q	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	309					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CTGTAATCTCATGCCCATCCT	0.348																																							uc001msv.2		NA																	0				skin(1)	1						c.(925-927)CAT>CAG		doublecortin domain containing 1							76.0	76.0	76.0					11																	31312227		2202	4299	6501	SO:0001583	missense	341019				intracellular signal transduction			g.chr11:31312227A>C	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.927T>G	11.37:g.31312227A>C	ENSP00000389792:p.His309Gln		Somatic				DCDC1_uc001msu.1_Intron	p.H309Q	NM_181807	NP_861523	WXS	Illumina HiSeq	Unspecified	P59894	DCDC1_HUMAN			7	1129	-	Lung SC(675;0.225)		309					A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	c.927T>G	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	A	9.568	1.120288	0.20877	.	.	ENSG00000188682	ENST00000452803	D	0.93133	-3.17	5.31	4.15	0.48705	Doublecortin domain (2);	0.923423	0.09127	N	0.844948	D	0.88477	0.6447	L	0.38531	1.155	0.23459	N	0.997631	B	0.09022	0.002	B	0.10450	0.005	T	0.75929	-0.3144	10	0.26408	T	0.33	-26.7748	6.5269	0.22307	0.7858:0.0:0.076:0.1381	.	309	P59894	DCDC1_HUMAN	Q	309	ENSP00000389792:H309Q	ENSP00000389792:H309Q	H	-	3	2	DCDC1	31268803	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	3.598000	0.54038	0.908000	0.36671	0.533000	0.62120	CAT		0.348	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807		32	41	0	0	0	0.012213	0	32	41				
LOC440040	440040	broad.mit.edu	37	11	49597924	49597924	+	RNA	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:49597924G>T	ENST00000527477.1	+	0	528																											TCTCTTTTCTGTTCATCACCA	0.512																																							uc010rhy.1		NA																	0					0						c.(37-39)GTT>TTT		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49597924G>T																													11.37:g.49597924G>T			Somatic				LOC440040_uc009ymb.2_Missense_Mutation_p.V13F	p.V13F	NR_027044		WXS	Illumina HiSeq	Unspecified					2	515	+									Missense_Mutation	SNP	ENST00000527477.1	37	c.37G>T																																																																																					0.512	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			8	32	1	0	0.000157383	0.00308	0.000168886	8	32				
OR4C12	283093	broad.mit.edu	37	11	50003155	50003155	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:50003155C>T	ENST00000335238.4	-	1	916	c.883G>A	c.(883-885)Gca>Aca	p.A295T		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TTCCTTATTGCACTTTTTACC	0.368																																							uc010ria.1		NA																	0				ovary(2)|skin(1)	3						c.(883-885)GCA>ACA		olfactory receptor, family 4, subfamily C,							64.0	59.0	61.0					11																	50003155		2201	4296	6497	SO:0001583	missense	283093				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:50003155C>T	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.883G>A	11.37:g.50003155C>T	ENSP00000334418:p.Ala295Thr		Somatic					p.A295T	NM_001005270	NP_001005270	WXS	Illumina HiSeq	Unspecified	Q96R67	OR4CC_HUMAN			1	883	-			295			Cytoplasmic (Potential).		B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	c.883G>A	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	11.20	1.569850	0.28003	.	.	ENSG00000221954	ENST00000335238	T	0.42131	0.98	2.98	2.98	0.34508	.	0.000000	0.41712	U	0.000825	T	0.34745	0.0908	L	0.48218	1.51	0.09310	N	0.999998	P	0.35714	0.517	B	0.37833	0.259	T	0.31308	-0.9948	10	0.66056	D	0.02	.	7.5738	0.27924	0.2549:0.7451:0.0:0.0	.	295	Q96R67	OR4CC_HUMAN	T	295	ENSP00000334418:A295T	ENSP00000334418:A295T	A	-	1	0	OR4C12	49959731	0.991000	0.36638	0.245000	0.24217	0.930000	0.56654	3.473000	0.53122	1.698000	0.51180	0.398000	0.26397	GCA		0.368	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270		13	51	0	0	0	0.001855	0	13	51				
OR5F1	338674	broad.mit.edu	37	11	55762023	55762023	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:55762023G>C	ENST00000278409.1	-	1	78	c.79C>G	c.(79-81)Ctc>Gtc	p.L27V		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	27					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AACAAAAAGAGGATAATCTGT	0.383																																							uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(79-81)CTC>GTC		olfactory receptor, family 5, subfamily F,							62.0	63.0	63.0					11																	55762023		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55762023G>C	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.79C>G	11.37:g.55762023G>C	ENSP00000278409:p.Leu27Val		Somatic					p.L27V	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	79	-	Esophageal squamous(21;0.00448)		27			Helical; Name=1; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.79C>G	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950595	0.34377	.	.	ENSG00000149133	ENST00000278409	T	0.16743	2.32	3.03	0.987	0.19790	.	.	.	.	.	T	0.20047	0.0482	M	0.82056	2.57	0.09310	N	1	B	0.34200	0.441	B	0.28232	0.087	T	0.14364	-1.0475	9	0.87932	D	0	.	8.2781	0.31885	0.2327:0.0:0.7673:0.0	.	27	O95221	OR5F1_HUMAN	V	27	ENSP00000278409:L27V	ENSP00000278409:L27V	L	-	1	0	OR5F1	55518599	0.077000	0.21312	0.002000	0.10522	0.037000	0.13140	0.408000	0.21065	0.392000	0.25172	0.297000	0.19635	CTC		0.383	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		34	45	0	0	0	0.012213	0	34	45				
OR5M3	219482	broad.mit.edu	37	11	56237637	56237637	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:56237637G>C	ENST00000312240.2	-	1	377	c.337C>G	c.(337-339)Ctt>Gtt	p.L113V		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					ATCGCAGCAAGAATAAAAATT	0.373																																							uc010rjk.1		NA																	0				ovary(2)	2						c.(337-339)CTT>GTT		olfactory receptor, family 5, subfamily M,							84.0	80.0	82.0					11																	56237637		2201	4295	6496	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237637G>C	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.337C>G	11.37:g.56237637G>C	ENSP00000312208:p.Leu113Val		Somatic					p.L113V	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	337	-	Esophageal squamous(21;0.00448)		113			Helical; Name=3; (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.337C>G	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379277	0.61735	.	.	ENSG00000174937	ENST00000312240	T	0.03553	3.89	5.13	4.22	0.49857	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41938	D	0.000788	T	0.30008	0.0751	H	0.97983	4.12	0.30586	N	0.762029	D	0.89917	1.0	D	0.87578	0.998	T	0.56541	-0.7962	10	0.87932	D	0	-19.675	12.3405	0.55091	0.0832:0.0:0.9168:0.0	.	113	Q8NGP4	OR5M3_HUMAN	V	113	ENSP00000312208:L113V	ENSP00000312208:L113V	L	-	1	0	OR5M3	55994213	0.485000	0.25972	0.917000	0.36280	0.974000	0.67602	0.793000	0.26944	1.155000	0.42497	0.478000	0.44815	CTT		0.373	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		43	90	0	0	0	0.009718	0	43	90				
SMTNL1	219537	broad.mit.edu	37	11	57317484	57317484	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:57317484G>A	ENST00000399154.2	+	8	1273	c.1273G>A	c.(1273-1275)Gtg>Atg	p.V425M	SMTNL1_ENST00000457912.1_Missense_Mutation_p.V480M|SMTNL1_ENST00000527972.1_Missense_Mutation_p.V462M			A8MU46	SMTL1_HUMAN	smoothelin-like 1	425	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GGATGACATGGTGCGGTTGGC	0.537																																							uc009ymh.1		NA																	0				ovary(1)	1						c.(1438-1440)GTG>ATG		smoothelin-like 1							83.0	84.0	83.0					11																	57317484		2158	4251	6409	SO:0001583	missense	219537							g.chr11:57317484G>A	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.1273G>A	11.37:g.57317484G>A	ENSP00000382108:p.Val425Met		Somatic					p.V480M	NM_001105565	NP_001099035	WXS	Illumina HiSeq	Unspecified	E9PPJ3	E9PPJ3_HUMAN			8	1438	+			462						Missense_Mutation	SNP	ENST00000399154.2	37	c.1438G>A		.	.	.	.	.	.	.	.	.	.	G	18.97	3.735986	0.69189	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	D;D;D	0.95853	-3.83;-3.83;-3.83	4.73	4.73	0.59995	.	.	.	.	.	D	0.94318	0.8174	L	0.28344	0.845	0.41316	D	0.987148	P	0.46706	0.883	P	0.54100	0.742	D	0.93508	0.6850	9	0.31617	T	0.26	-19.7345	16.6451	0.85174	0.0:0.0:1.0:0.0	.	480	C9J621	.	M	480;462;425	ENSP00000406485:V480M;ENSP00000432651:V462M;ENSP00000382108:V425M	ENSP00000382108:V425M	V	+	1	0	SMTNL1	57074060	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.625000	0.37029	2.474000	0.83562	0.555000	0.69702	GTG		0.537	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203		12	27	0	0	0	0.013537	0	12	27				
PPP2R5B	5526	broad.mit.edu	37	11	64694309	64694309	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:64694309G>A	ENST00000164133.2	+	3	947	c.325G>A	c.(325-327)Gag>Aag	p.E109K		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	109					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						AGCCCTCAACGAGCTGGTGGA	0.642																																							uc001oby.2		NA																	0				ovary(2)	2						c.(325-327)GAG>AAG		beta isoform of regulatory subunit B56, protein							119.0	107.0	111.0					11																	64694309		2201	4297	6498	SO:0001583	missense	5526				signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr11:64694309G>A	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.325G>A	11.37:g.64694309G>A	ENSP00000164133:p.Glu109Lys		Somatic				PPP2R5B_uc001obz.2_Missense_Mutation_p.E109K	p.E109K	NM_006244	NP_006235	WXS	Illumina HiSeq	Unspecified	Q15173	2A5B_HUMAN			3	910	+			109					Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	c.325G>A	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	G	35	5.470785	0.96274	.	.	ENSG00000068971	ENST00000526559;ENST00000164133;ENST00000359279;ENST00000532850;ENST00000527441	.	.	.	3.94	3.94	0.45596	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85678	0.5752	H	0.96861	3.895	0.80722	D	1	D	0.61080	0.989	P	0.61533	0.89	D	0.90354	0.4368	9	0.87932	D	0	-28.0076	14.2826	0.66224	0.0:0.0:1.0:0.0	.	109	Q15173	2A5B_HUMAN	K	109;109;136;23;109	.	ENSP00000164133:E109K	E	+	1	0	PPP2R5B	64450885	1.000000	0.71417	0.991000	0.47740	0.980000	0.70556	9.024000	0.93689	2.485000	0.83878	0.655000	0.94253	GAG		0.642	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244		14	67	0	0	0	0.003163	0	14	67				
DPP3	10072	broad.mit.edu	37	11	66264796	66264796	+	Silent	SNP	C	C	T	rs567600069		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:66264796C>T	ENST00000360510.2	+	16	1791	c.1726C>T	c.(1726-1728)Ctg>Ttg	p.L576L	DPP3_ENST00000530165.1_Silent_p.L546L|DPP3_ENST00000453114.1_Silent_p.L576L|DPP3_ENST00000532677.1_Silent_p.L595L|DPP3_ENST00000541961.1_Silent_p.L576L|DPP3_ENST00000531863.1_Silent_p.L596L			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	576					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GTTTGTGATCCTGAGAGTCTT	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17851	0.0		0.0	False		,,,				2504	0.001						uc001oig.1		NA																	0				ovary(1)|skin(1)	2						c.(1726-1728)CTG>TTG		dipeptidyl peptidase III							56.0	58.0	57.0					11																	66264796		2200	4295	6495	SO:0001819	synonymous_variant	10072				proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity	g.chr11:66264796C>T	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1726C>T	11.37:g.66264796C>T			Somatic				DPP3_uc001oif.1_Silent_p.L576L|DPP3_uc010rpe.1_Silent_p.L565L|DPP3_uc001oih.1_5'UTR	p.L576L	NM_005700	NP_005691	WXS	Illumina HiSeq	Unspecified	Q9NY33	DPP3_HUMAN			16	1788	+			576					B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	c.1726C>T	CCDS8141.1																																																																																				0.617	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2			18	40	0	0	0	0.006122	0	18	40				
MYO7A	4647	broad.mit.edu	37	11	76853808	76853808	+	Silent	SNP	C	C	A	rs397516334		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:76853808C>A	ENST00000409709.3	+	3	344	c.72C>A	c.(70-72)atC>atA	p.I24I	MYO7A_ENST00000458637.2_Silent_p.I24I|MYO7A_ENST00000409893.1_Silent_p.I24I|MYO7A_ENST00000409619.2_Silent_p.I13I	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	24					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ACGTGCCCATCGGGGCGGTGG	0.622																																							uc001oyb.2		NA																	0				ovary(3)|breast(1)	4						c.(70-72)ATC>ATA		myosin VIIA isoform 1							84.0	97.0	93.0					11																	76853808		2104	4212	6316	SO:0001819	synonymous_variant	4647				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr11:76853808C>A	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.72C>A	11.37:g.76853808C>A			Somatic				MYO7A_uc010rsl.1_Silent_p.I24I|MYO7A_uc010rsm.1_Silent_p.I13I|MYO7A_uc001oyc.2_Silent_p.I24I	p.I24I	NM_000260	NP_000251	WXS	Illumina HiSeq	Unspecified	Q13402	MYO7A_HUMAN			3	344	+			24			Myosin head-like.		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	c.72C>A	CCDS53683.1																																																																																				0.622	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		3	11	1	0	0.00909568	0.009096	0.00935638	3	11				
GRM5	2915	broad.mit.edu	37	11	88338066	88338066	+	Missense_Mutation	SNP	T	T	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:88338066T>C	ENST00000305447.4	-	4	1363	c.1214A>G	c.(1213-1215)tAt>tGt	p.Y405C	GRM5_ENST00000393297.1_Missense_Mutation_p.Y405C|GRM5_ENST00000418177.2_Missense_Mutation_p.Y405C|GRM5_ENST00000305432.5_Missense_Mutation_p.Y405C|GRM5_ENST00000455756.2_Missense_Mutation_p.Y405C	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	405					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GGCCATCGAATAGATGGCGTT	0.458																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(1213-1215)TAT>TGT		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						100.0	86.0	91.0					11																	88338066		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88338066T>C	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1214A>G	11.37:g.88338066T>C	ENSP00000306138:p.Tyr405Cys		Somatic				GRM5_uc009yvm.2_Missense_Mutation_p.Y405C	p.Y405C	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			4	1414	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	405			Extracellular (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.1214A>G	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424290	0.83667	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.59	5.59	0.84812	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93429	0.7904	M	0.89214	3.015	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94313	0.7547	9	.	.	.	.	16.0705	0.80922	0.0:0.0:0.0:1.0	.	405;405	P41594-2;P41594	.;GRM5_HUMAN	C	405	ENSP00000402912:Y405C;ENSP00000405690:Y405C;ENSP00000305905:Y405C;ENSP00000306138:Y405C;ENSP00000376975:Y405C	.	Y	-	2	0	GRM5	87977714	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.997000	0.88414	2.258000	0.74832	0.445000	0.29226	TAT		0.458	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		12	59	0	0	0	0.010729	0	12	59				
CNTN5	53942	broad.mit.edu	37	11	99941210	99941210	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:99941210C>A	ENST00000524871.1	+	11	1507	c.1217C>A	c.(1216-1218)cCt>cAt	p.P406H	CNTN5_ENST00000418526.2_Missense_Mutation_p.P332H|CNTN5_ENST00000279463.3_Missense_Mutation_p.P406H|CNTN5_ENST00000528682.1_Missense_Mutation_p.P406H|CNTN5_ENST00000527185.1_Missense_Mutation_p.P406H	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	406	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGTGGGAGCCCTCTCCGATGG	0.458																																							uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(1216-1218)CCT>CAT		contactin 5 isoform long							86.0	83.0	84.0					11																	99941210		1883	4108	5991	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:99941210C>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1217C>A	11.37:g.99941210C>A	ENSP00000435637:p.Pro406His		Somatic				CNTN5_uc009ywv.1_Missense_Mutation_p.P406H|CNTN5_uc001pfz.2_Missense_Mutation_p.P406H|CNTN5_uc001pgb.2_Missense_Mutation_p.P332H	p.P406H	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	11	1556	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	406			Ig-like C2-type 4.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.1217C>A	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103595	0.76983	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	5.97	5.04	0.67666	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.160977	0.56097	D	0.000035	T	0.70894	0.3276	L	0.39692	1.235	0.32729	N	0.509233	P;B;P	0.41978	0.767;0.23;0.767	P;B;P	0.54590	0.756;0.168;0.701	T	0.79210	-0.1897	10	0.66056	D	0.02	.	12.8257	0.57718	0.4118:0.5882:0.0:0.0	.	406;332;406	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	H	406;406;406;332;406	ENSP00000433575:P406H;ENSP00000436185:P406H;ENSP00000435637:P406H;ENSP00000393229:P332H;ENSP00000279463:P406H	ENSP00000279463:P406H	P	+	2	0	CNTN5	99446420	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	2.140000	0.42159	1.491000	0.48482	0.650000	0.86243	CCT		0.458	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		6	24	1	0	0.00116845	0.001168	0.00123336	6	24				
TRPC6	7225	broad.mit.edu	37	11	101375428	101375429	+	Missense_Mutation	DNP	CG	CG	GA	rs200186406		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:101375428_101375429CG>GA	ENST00000344327.3	-	2	695_696	c.271_272CG>TC	c.(271-273)CGc>TCc	p.R91S	TRPC6_ENST00000348423.4_Missense_Mutation_p.R91S|TRPC6_ENST00000532133.1_Missense_Mutation_p.R91S|TRPC6_ENST00000360497.4_Missense_Mutation_p.R91S|TRPC6_ENST00000526713.1_5'Flank	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	91					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GCTTGTGGAGCGATCACTAAAC	0.51																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(271-273)CGC>TCC		transient receptor potential cation channel,																																				SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101375428_101375429CG>GA	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.271_272delinsGA	11.37:g.101375428_101375429delinsGA	ENSP00000340913:p.Arg91Ser		Somatic				TRPC6_uc009ywy.2_Missense_Mutation_p.R91S|TRPC6_uc009ywz.1_Missense_Mutation_p.R91S	p.R91S	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	2	696_697	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	91			Cytoplasmic (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	DNP	ENST00000344327.3	37	c.271_272CG>TC	CCDS8311.1																																																																																				0.510	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		32	108	0	0	0	0.004672	0	32	108				
DRD2	1813	broad.mit.edu	37	11	113295259	113295259	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:113295259T>A	ENST00000362072.3	-	2	459	c.115A>T	c.(115-117)Aca>Tca	p.T39S	DRD2_ENST00000544518.1_Missense_Mutation_p.T39S|DRD2_ENST00000538967.1_Missense_Mutation_p.T39S|DRD2_ENST00000542968.1_Missense_Mutation_p.T39S|DRD2_ENST00000355319.2_Missense_Mutation_p.T39S|DRD2_ENST00000346454.3_Missense_Mutation_p.T39S|DRD2_ENST00000535984.1_5'Flank	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	39					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTGAGCAGTGTGGCATAGTAG	0.587																																							uc001pnz.2		NA																	0				pancreas(1)|skin(1)	2						c.(115-117)ACA>TCA		dopamine receptor D2 isoform long	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)						266.0	202.0	224.0					11																	113295259		2201	4296	6497	SO:0001583	missense	1813				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding	g.chr11:113295259T>A	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.115A>T	11.37:g.113295259T>A	ENSP00000354859:p.Thr39Ser		Somatic				DRD2_uc010rwv.1_Missense_Mutation_p.T39S|DRD2_uc001poa.3_Missense_Mutation_p.T39S|DRD2_uc001pob.3_Missense_Mutation_p.T39S|DRD2_uc009yyr.1_Missense_Mutation_p.T39S	p.T39S	NM_000795	NP_000786	WXS	Illumina HiSeq	Unspecified	P14416	DRD2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	1	436	-		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)	39			Helical; Name=1; (By similarity).		Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	37	c.115A>T	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669888	0.47677	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967;ENST00000543292	T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;2.14	5.51	4.38	0.52667	.	0.181464	0.64402	D	0.000002	T	0.21387	0.0515	N	0.08118	0	0.24768	N	0.992883	B;B;B;B	0.18461	0.028;0.028;0.028;0.008	B;B;B;B	0.26693	0.072;0.072;0.072;0.033	T	0.22243	-1.0222	10	0.87932	D	0	.	10.1588	0.42838	0.0:0.1399:0.0:0.8601	.	39;39;39;39	F8VUV1;P14416-3;P14416-2;P14416	.;.;.;DRD2_HUMAN	S	39	ENSP00000347474:T39S;ENSP00000278597:T39S;ENSP00000354859:T39S;ENSP00000441068:T39S;ENSP00000442172:T39S;ENSP00000438215:T39S;ENSP00000438419:T39S	ENSP00000278597:T39S	T	-	1	0	DRD2	112800469	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	2.793000	0.47845	0.913000	0.36797	-0.451000	0.05528	ACA		0.587	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795		30	54	0	0	0	0.009535	0	30	54				
DDX25	29118	broad.mit.edu	37	11	125778353	125778353	+	Silent	SNP	G	G	A	rs571626979		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr11:125778353G>A	ENST00000263576.6	+	6	617	c.462G>A	c.(460-462)gtG>gtA	p.V154V	DDX25_ENST00000525943.1_3'UTR|RP11-680F20.9_ENST00000533033.2_RNA	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	154	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		CGGCATTTGTGTTGGCAATGT	0.463																																							uc001qcz.3		NA																	0				ovary(1)	1						c.(460-462)GTG>GTA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 25							186.0	179.0	181.0					11																	125778353		1941	4146	6087	SO:0001819	synonymous_variant	29118				mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding	g.chr11:125778353G>A	AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.462G>A	11.37:g.125778353G>A			Somatic				DDX25_uc010sbk.1_Silent_p.V154V	p.V154V	NM_013264	NP_037396	WXS	Illumina HiSeq	Unspecified	Q9UHL0	DDX25_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)	6	603	+	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	154			Helicase ATP-binding.		B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Silent	SNP	ENST00000263576.6	37	c.462G>A	CCDS44766.1	.	.	.	.	.	.	.	.	.	.	G	4.039	0.004797	0.07866	.	.	ENSG00000109832	ENST00000530129	.	.	.	5.09	2.17	0.27698	.	0.000000	0.64402	D	0.000011	T	0.59362	0.2188	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56685	-0.7938	6	0.66056	D	0.02	1.8605	5.3634	0.16101	0.2559:0.5457:0.1278:0.0706	.	.	.	.	I	166	.	ENSP00000432800:V166I	V	+	1	0	DDX25	125283563	0.012000	0.17670	1.000000	0.80357	0.518000	0.34316	-0.772000	0.04694	0.250000	0.21479	-1.297000	0.01338	GTT		0.463	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264		68	95	0	0	0	0.01441	0	68	95				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		10	5	1	0	0.00621372	0.006214	0.00643279	10	5				
KIF21A	55605	broad.mit.edu	37	12	39734815	39734815	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:39734815T>A	ENST00000361418.5	-	15	2018	c.2003A>T	c.(2002-2004)cAg>cTg	p.Q668L	KIF21A_ENST00000544797.2_Missense_Mutation_p.Q655L|KIF21A_ENST00000541463.2_Missense_Mutation_p.Q655L|KIF21A_ENST00000361961.3_Missense_Mutation_p.Q655L|KIF21A_ENST00000395670.3_Missense_Mutation_p.Q668L			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	668					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				CAGTCTTTTCTGGCTGTTTTC	0.363																																							uc001rly.2		NA																	0				ovary(4)|pancreas(1)|lung(1)|skin(1)	7						c.(2002-2004)CAG>CTG		kinesin family member 21A							110.0	99.0	103.0					12																	39734815		2202	4299	6501	SO:0001583	missense	55605				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr12:39734815T>A	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2003A>T	12.37:g.39734815T>A	ENSP00000354878:p.Gln668Leu		Somatic				KIF21A_uc001rlw.2_5'UTR|KIF21A_uc001rlx.2_Missense_Mutation_p.Q655L|KIF21A_uc001rlz.2_Missense_Mutation_p.Q655L|KIF21A_uc010skl.1_Missense_Mutation_p.Q655L	p.Q668L	NM_017641	NP_060111	WXS	Illumina HiSeq	Unspecified	Q7Z4S6	KI21A_HUMAN			15	2149	-		Lung NSC(34;0.179)|all_lung(34;0.213)	668					A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	c.2003A>T	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.1|27.1	4.804263|4.804263	0.90623|0.90623	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	T;T;T;T;T|.	0.18657|.	2.2;2.2;2.2;2.2;2.2|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.000000|.	0.46758|.	D|.	0.000262|.	T|.	0.78861|.	0.4350|.	M|M	0.84948|0.84948	2.725|2.725	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	0.992;0.992;1.0;0.992|.	D;D;D;D|.	0.85130|.	0.979;0.979;0.997;0.979|.	T|.	0.81491|.	-0.0909|.	10|.	0.72032|.	D|.	0.01|.	.|.	15.6126|15.6126	0.76737|0.76737	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	655;655;668;655|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2|.	.;.;KI21A_HUMAN;.|.	L|X	655;668;668;655;668;655|16	ENSP00000354851:Q655L;ENSP00000379029:Q668L;ENSP00000445606:Q655L;ENSP00000354878:Q668L;ENSP00000438075:Q655L|.	ENSP00000344501:Q668L|.	Q|R	-|-	2|1	0|2	KIF21A|KIF21A	38021082|38021082	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.538000|7.538000	0.82048|0.82048	2.077000|2.077000	0.62373|0.62373	0.377000|0.377000	0.23210|0.23210	CAG|AGA		0.363	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641		14	12	0	0	0	0.00245	0	14	12				
KRT6A	3853	broad.mit.edu	37	12	52885323	52885323	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:52885323C>T	ENST00000330722.6	-	2	806	c.738G>A	c.(736-738)gtG>gtA	p.V246V		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	246	Coil 1B.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGAAGTCCTCCACCAGGTCCT	0.542																																							uc001sam.2		NA																	0				ovary(4)|skin(1)	5						c.(736-738)GTG>GTA		keratin 6A							105.0	103.0	104.0					12																	52885323		2203	4300	6503	SO:0001819	synonymous_variant	3853				cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:52885323C>T	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.738G>A	12.37:g.52885323C>T			Somatic					p.V246V	NM_005554	NP_005545	WXS	Illumina HiSeq	Unspecified	P02538	K2C6A_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	2	947	-			246			Coil 1B.|Rod.		A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Silent	SNP	ENST00000330722.6	37	c.738G>A	CCDS41786.1																																																																																				0.542	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554		42	43	0	0	0	0.007835	0	42	43				
AMDHD1	144193	broad.mit.edu	37	12	96350688	96350688	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:96350688G>A	ENST00000266736.2	+	4	641	c.535G>A	c.(535-537)Gag>Aag	p.E179K		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	179					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGCCCGGCGGGAGCTGGACAT	0.602																																							uc001tel.1		NA																	0				central_nervous_system(1)	1						c.(535-537)GAG>AAG		amidohydrolase domain containing 1							92.0	100.0	97.0					12																	96350688		2203	4300	6503	SO:0001583	missense	144193				histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding	g.chr12:96350688G>A	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.535G>A	12.37:g.96350688G>A	ENSP00000266736:p.Glu179Lys		Somatic				AMDHD1_uc009zth.1_Missense_Mutation_p.E70K	p.E179K	NM_152435	NP_689648	WXS	Illumina HiSeq	Unspecified	Q96NU7	HUTI_HUMAN			4	641	+			179					A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	c.535G>A	CCDS9057.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.471319	0.26423	.	.	ENSG00000139344	ENST00000266736	T	0.44482	0.92	5.57	2.66	0.31614	Metal-dependent hydrolase, composite domain (1);	0.536745	0.21700	N	0.070440	T	0.27629	0.0679	L	0.37561	1.115	0.22728	N	0.998806	B	0.06786	0.001	B	0.11329	0.006	T	0.22800	-1.0206	10	0.16420	T	0.52	-5.8301	6.7652	0.23562	0.0664:0.2496:0.5642:0.1198	.	179	Q96NU7	HUTI_HUMAN	K	179	ENSP00000266736:E179K	ENSP00000266736:E179K	E	+	1	0	AMDHD1	94874819	0.023000	0.18921	0.912000	0.35992	0.946000	0.59487	0.241000	0.18065	0.268000	0.21939	0.491000	0.48974	GAG		0.602	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435		6	137	0	0	0	0.001168	0	6	137				
GLT8D2	83468	broad.mit.edu	37	12	104393232	104393232	+	Silent	SNP	C	C	T	rs564549205		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:104393232C>T	ENST00000360814.4	-	6	750	c.345G>A	c.(343-345)ccG>ccA	p.P115P	GLT8D2_ENST00000546436.1_Silent_p.P115P|GLT8D2_ENST00000548660.1_Silent_p.P115P	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	115						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						TGAGGACCATCGGGTTGAATT	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18055	0.0		0.0	False		,,,				2504	0.0						uc001tkh.1		NA																	0				ovary(1)|skin(1)	2						c.(343-345)CCG>CCA		glycosyltransferase 8 domain containing 2							194.0	182.0	186.0					12																	104393232		2203	4300	6503	SO:0001819	synonymous_variant	83468					integral to membrane	transferase activity, transferring glycosyl groups	g.chr12:104393232C>T	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.345G>A	12.37:g.104393232C>T			Somatic				GLT8D2_uc001tki.1_Silent_p.P115P	p.P115P	NM_031302	NP_112592	WXS	Illumina HiSeq	Unspecified	Q9H1C3	GL8D2_HUMAN			6	751	-			115			Lumenal (Potential).		Q96KA2	Silent	SNP	ENST00000360814.4	37	c.345G>A	CCDS9096.1																																																																																				0.438	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1	NM_031302		66	43	0	0	0	0.01441	0	66	43				
NAA25	80018	broad.mit.edu	37	12	112516501	112516501	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr12:112516501C>A	ENST00000261745.4	-	6	770	c.522G>T	c.(520-522)ctG>ctT	p.L174L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	174						cytoplasm (GO:0005737)		p.L174L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CAGCAAGGGGCAGAAACATTG	0.368																																							uc001ttm.2		NA																	1	Substitution - coding silent(1)	p.L174L(1)	ovary(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(520-522)CTG>CTT		mitochondrial distribution and morphology 20							170.0	154.0	159.0					12																	112516501		2203	4300	6503	SO:0001819	synonymous_variant	80018					cytoplasm	protein binding	g.chr12:112516501C>A	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.522G>T	12.37:g.112516501C>A			Somatic				NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.L146L|NAA25_uc009zwa.1_Silent_p.L174L	p.L174L	NM_024953	NP_079229	WXS	Illumina HiSeq	Unspecified	Q14CX7	NAA25_HUMAN			6	542	-			174					A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	ENST00000261745.4	37	c.522G>T	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	C	8.407	0.843349	0.16963	.	.	ENSG00000111300	ENST00000547133	.	.	.	6.05	-1.67	0.08238	.	.	.	.	.	T	0.41373	0.1156	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	-7.5836	2.3184	0.04204	0.3124:0.411:0.1011:0.1754	.	.	.	.	S	136	.	.	A	-	1	0	NAA25	111000884	0.984000	0.35163	0.986000	0.45419	0.998000	0.95712	0.242000	0.18087	-0.326000	0.08564	0.650000	0.86243	GCC		0.368	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953		55	42	1	0	7.37877e-41	0.01441	1.12955e-40	55	42				
MTUS2	23281	broad.mit.edu	37	13	30062124	30062124	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:30062124C>A	ENST00000380808.2	+	4	640	c.424C>A	c.(424-426)Cac>Aac	p.H142N	MTUS2_ENST00000542829.1_Missense_Mutation_p.H52N|MTUS2-AS1_ENST00000323380.5_RNA|MTUS2-AS1_ENST00000587588.1_RNA|MTUS2_ENST00000431530.3_Missense_Mutation_p.H1173N	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1163						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GCAGGATGACCACGACCACAA	0.577																																							uc001usl.3		NA																	0					0						c.(3517-3519)CAC>AAC		hypothetical protein LOC23281 isoform a							96.0	98.0	98.0					13																	30062124		2091	4236	6327	SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:30062124C>A	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.424C>A	13.37:g.30062124C>A	ENSP00000370186:p.His142Asn		Somatic				MTUS2_uc001usm.3_Missense_Mutation_p.H142N|MTUS2_uc010aau.2_Missense_Mutation_p.H52N|uc001usn.2_5'Flank	p.H1173N	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			9	3575	+			1163			Potential.		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000380808.2	37	c.3517C>A	CCDS41874.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.581213	0.46006	.	.	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000542829;ENST00000417109	T;T;T	0.22539	2.53;1.95;3.03	4.82	3.95	0.45737	.	0.096296	0.64402	D	0.000001	T	0.44414	0.1292	M	0.77103	2.36	0.49687	D	0.999818	B;D	0.71674	0.056;0.998	B;D	0.74674	0.046;0.984	T	0.39781	-0.9597	9	.	.	.	.	11.3178	0.49403	0.1825:0.8175:0.0:0.0	.	142;1163	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	N	1173;142;52;99	ENSP00000392057:H1173N;ENSP00000370186:H142N;ENSP00000445403:H52N	.	H	+	1	0	MTUS2	28960124	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	2.205000	0.42770	1.202000	0.43218	0.561000	0.74099	CAC		0.577	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270		23	63	1	0	1.33986e-20	0.004656	1.88163e-20	23	63				
FRY	10129	broad.mit.edu	37	13	32745188	32745188	+	Silent	SNP	A	A	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:32745188A>C	ENST00000380250.3	+	18	2428	c.1932A>C	c.(1930-1932)gcA>gcC	p.A644A		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	644						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GACATATTGCACAAAATTCTC	0.363																																							uc001utx.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(1930-1932)GCA>GCC		furry homolog							148.0	137.0	141.0					13																	32745188		1855	4095	5950	SO:0001819	synonymous_variant	10129				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane		g.chr13:32745188A>C	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1932A>C	13.37:g.32745188A>C			Somatic				FRY_uc010tdw.1_RNA	p.A644A	NM_023037	NP_075463	WXS	Illumina HiSeq	Unspecified	Q5TBA9	FRY_HUMAN		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)	18	2428	+		Lung SC(185;0.0271)	644					Q9Y3N6	Silent	SNP	ENST00000380250.3	37	c.1932A>C	CCDS41875.1																																																																																				0.363	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		41	85	0	0	0	0.010771	0	41	85				
PDS5B	23047	broad.mit.edu	37	13	33247430	33247430	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:33247430G>A	ENST00000315596.10	+	8	969	c.783G>A	c.(781-783)gaG>gaA	p.E261E		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	261					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TAATTTTGGAGCTCTACAATA	0.338																																							uc010abf.2		NA																	0				ovary(2)|lung(1)|pancreas(1)	4						c.(781-783)GAG>GAA		PDS5, regulator of cohesion maintenance, homolog							125.0	111.0	115.0					13																	33247430		1807	4082	5889	SO:0001819	synonymous_variant	23047				cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding	g.chr13:33247430G>A	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.783G>A	13.37:g.33247430G>A			Somatic				PDS5B_uc001uuo.2_Silent_p.E261E|PDS5B_uc010abg.2_RNA|PDS5B_uc010teb.1_5'Flank	p.E261E	NM_015032	NP_055847	WXS	Illumina HiSeq	Unspecified	Q9NTI5	PDS5B_HUMAN		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)	8	941	+		Lung SC(185;0.0367)	261					Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Silent	SNP	ENST00000315596.10	37	c.783G>A	CCDS41878.1																																																																																				0.338	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032		27	54	0	0	0	0.00632	0	27	54				
TSC22D1	8848	broad.mit.edu	37	13	45149475	45149475	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:45149475T>A	ENST00000458659.2	-	1	1226	c.736A>T	c.(736-738)Agt>Tgt	p.S246C	TSC22D1_ENST00000460842.1_5'Flank|TSC22D1_ENST00000501704.2_Missense_Mutation_p.S246C	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	246					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		ATGGATGCACTGGCCACAGCA	0.517																																							uc001uzn.3		NA																	0					0						c.(736-738)AGT>TGT		TSC22 domain family, member 1 isoform 1							116.0	80.0	92.0					13																	45149475		2203	4300	6503	SO:0001583	missense	8848				transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr13:45149475T>A	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.736A>T	13.37:g.45149475T>A	ENSP00000397435:p.Ser246Cys		Somatic				TSC22D1_uc001uzo.1_Missense_Mutation_p.S246C	p.S246C	NM_183422	NP_904358	WXS	Illumina HiSeq	Unspecified	Q15714	T22D1_HUMAN		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)	1	1227	-		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)	246					B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	37	c.736A>T	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597399	0.46318	.	.	ENSG00000102804	ENST00000458659;ENST00000501704	T;T	0.31769	1.48;1.48	4.95	1.02	0.19986	.	0.202461	0.33631	N	0.004705	T	0.20618	0.0496	N	0.24115	0.695	0.21499	N	0.999666	P;P	0.43169	0.8;0.698	B;B	0.42798	0.398;0.224	T	0.09862	-1.0655	10	0.59425	D	0.04	.	8.3707	0.32412	0.0:0.2398:0.0:0.7602	.	246;246	B3KRL7;Q15714	.;T22D1_HUMAN	C	246	ENSP00000397435:S246C;ENSP00000437414:S246C	ENSP00000397435:S246C	S	-	1	0	TSC22D1	44047475	1.000000	0.71417	0.381000	0.26106	0.924000	0.55760	0.748000	0.26305	0.043000	0.15746	0.459000	0.35465	AGT		0.517	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022		26	23	0	0	0	0.003954	0	26	23				
KLHL1	57626	broad.mit.edu	37	13	70535565	70535565	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:70535565C>T	ENST00000377844.4	-	3	1451	c.692G>A	c.(691-693)aGt>aAt	p.S231N	KLHL1_ENST00000545028.1_Missense_Mutation_p.S38N	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	231	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGAGACTGAACTCAGAACAAG	0.438																																							uc001vip.2		NA																	0					0						c.(691-693)AGT>AAT		kelch-like 1 protein							108.0	95.0	100.0					13																	70535565		2203	4300	6503	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70535565C>T	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.692G>A	13.37:g.70535565C>T	ENSP00000367075:p.Ser231Asn		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.S170N	p.S231N	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	3	1486	-		Breast(118;0.000162)	231			BTB.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.692G>A	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446446	0.84101	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.70749	-0.51;-0.51	5.07	5.07	0.68467	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.89308	0.6678	H	0.95504	3.68	0.41999	D	0.990884	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.92619	0.6106	10	0.87932	D	0	.	18.8307	0.92137	0.0:1.0:0.0:0.0	.	231;231	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	N	231;38	ENSP00000367075:S231N;ENSP00000439602:S38N	ENSP00000367075:S231N	S	-	2	0	KLHL1	69433566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.866000	0.56040	2.527000	0.85204	0.557000	0.71058	AGT		0.438	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		31	41	0	0	0	0.013726	0	31	41				
SPRY2	10253	broad.mit.edu	37	13	80911269	80911269	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:80911269T>A	ENST00000377102.1	-	2	1549	c.572A>T	c.(571-573)tAc>tTc	p.Y191F	SPRY2_ENST00000377104.3_Missense_Mutation_p.Y191F|SPRY2_ENST00000540649.1_Missense_Mutation_p.Y191F			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	191	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		AGGCCTTGGGTAGGTGCACTC	0.537																																							uc001vli.2		NA																	0				ovary(1)|lung(1)	2						c.(571-573)TAC>TTC		sprouty 2							104.0	89.0	94.0					13																	80911269		2203	4300	6503	SO:0001583	missense	10253				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene expression|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein kinase B signaling cascade	cytosol|microtubule|ruffle membrane	protein serine/threonine kinase activator activity	g.chr13:80911269T>A	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.572A>T	13.37:g.80911269T>A	ENSP00000366306:p.Tyr191Phe		Somatic				SPRY2_uc001vlj.2_Missense_Mutation_p.Y191F	p.Y191F	NM_005842	NP_005833	WXS	Illumina HiSeq	Unspecified	O43597	SPY2_HUMAN		GBM - Glioblastoma multiforme(99;0.0318)	2	1550	-	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)	191			SPR.|Cys-rich.		B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	37	c.572A>T	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.509546	0.44660	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.55052	0.54;0.54;0.54	5.03	3.81	0.43845	.	0.123969	0.56097	D	0.000029	T	0.49029	0.1533	N	0.08118	0	0.36124	D	0.845672	D	0.57257	0.979	D	0.71414	0.973	T	0.55296	-0.8163	10	0.27785	T	0.31	.	11.7573	0.51882	0.0:0.0:0.1476:0.8524	.	191	O43597	SPY2_HUMAN	F	191	ENSP00000366308:Y191F;ENSP00000366306:Y191F;ENSP00000439027:Y191F	ENSP00000366306:Y191F	Y	-	2	0	SPRY2	79809270	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.916000	0.48813	0.736000	0.32559	0.454000	0.30748	TAC		0.537	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1			32	48	0	0	0	0.008361	0	32	48				
SLITRK1	114798	broad.mit.edu	37	13	84453805	84453805	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:84453805C>A	ENST00000377084.2	-	1	2723	c.1838G>T	c.(1837-1839)aGc>aTc	p.S613I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	613					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGACACCCTGCTGGTGTCTAG	0.582																																							uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1837-1839)AGC>ATC		slit and trk like 1 protein precursor							85.0	73.0	77.0					13																	84453805		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84453805C>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1838G>T	13.37:g.84453805C>A	ENSP00000366288:p.Ser613Ile		Somatic					p.S613I	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2724	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	613			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.1838G>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833993	0.50951	.	.	ENSG00000178235	ENST00000377084	T	0.60299	0.2	5.51	4.67	0.58626	.	0.042629	0.85682	D	0.000000	T	0.58466	0.2124	L	0.52011	1.625	0.58432	D	0.999991	P	0.43857	0.819	P	0.46362	0.514	T	0.61936	-0.6960	10	0.56958	D	0.05	-12.9501	13.5834	0.61915	0.0:0.924:0.0:0.076	.	613	Q96PX8	SLIK1_HUMAN	I	613	ENSP00000366288:S613I	ENSP00000366288:S613I	S	-	2	0	SLITRK1	83351806	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.971000	0.70440	1.468000	0.48064	0.655000	0.94253	AGC		0.582	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		14	29	1	0	1.49906e-05	0.00245	1.64134e-05	14	29				
ING1	3621	broad.mit.edu	37	13	111372015	111372015	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:111372015C>T	ENST00000375774.3	+	2	1467	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	ING1_ENST00000338450.7_Silent_p.A148A|ING1_ENST00000375775.3_Silent_p.A123A|ING1_ENST00000333219.7_Silent_p.A192A	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	335			A -> D (in HNSCC). {ECO:0000269|PubMed:10866301}.		cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GCTCCAAGGCCAAGGCGGAGC	0.627																																							uc001vri.2		NA																	0				ovary(1)	1						c.(1003-1005)GCC>GCT		inhibitor of growth family, member 1 isoform D							95.0	67.0	76.0					13																	111372015		2203	4300	6503	SO:0001819	synonymous_variant	3621				cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding	g.chr13:111372015C>T		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.1005C>T	13.37:g.111372015C>T			Somatic				ING1_uc001vrf.2_Silent_p.A148A|ING1_uc001vrg.2_Silent_p.A123A|ING1_uc001vrh.2_Silent_p.A192A	p.A335A	NM_005537	NP_005528	WXS	Illumina HiSeq	Unspecified	Q9UK53	ING1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.188)		2	1437	+	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		335		A -> D (in HNSCC).			O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	c.1005C>T	CCDS9517.1																																																																																				0.627	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537		21	34	0	0	0	0.010504	0	21	34				
ATP11A	23250	broad.mit.edu	37	13	113439475	113439475	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:113439475C>T	ENST00000487903.1	+	2	154	c.66C>T	c.(64-66)gaC>gaT	p.D22D	ATP11A_ENST00000375645.3_Silent_p.D22D|ATP11A_ENST00000283558.8_Silent_p.D22D|ATP11A_ENST00000375630.2_Silent_p.D22D			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	22					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ATTGGGTGGACAGCAGGACCA	0.567											OREG0003855	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc001vsi.3		NA																	0				large_intestine(2)|ovary(2)	4						c.(64-66)GAC>GAT		ATPase, class VI, type 11A isoform a							144.0	133.0	137.0					13																	113439475		2203	4300	6503	SO:0001819	synonymous_variant	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113439475C>T	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.66C>T	13.37:g.113439475C>T			Somatic	OREG0003855	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1450	ATP11A_uc001vsj.3_Silent_p.D22D|ATP11A_uc001vsm.1_5'UTR	p.D22D	NM_015205	NP_056020	WXS	Illumina HiSeq	Unspecified	P98196	AT11A_HUMAN			2	154	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	22			Cytoplasmic (Potential).		Q5VXT2	Silent	SNP	ENST00000487903.1	37	c.66C>T	CCDS32011.1																																																																																				0.567	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		42	73	0	0	0	0.006999	0	42	73				
TFDP1	7027	broad.mit.edu	37	13	114288852	114288852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr13:114288852G>T	ENST00000375370.5	+	8	834	c.622G>T	c.(622-624)Gaa>Taa	p.E208*	TFDP1_ENST00000544902.1_Nonsense_Mutation_p.E113*|TFDP1_ENST00000538138.1_Nonsense_Mutation_p.E113*	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	208	Dimerization. {ECO:0000255}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E208*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			TTTGAAGGTGGAAAGACAGAG	0.398										TSP Lung(29;0.18)																													uc001vtw.2		NA																	1	Substitution - Nonsense(1)	p.E208*(1)	ovary(1)	lung(4)|ovary(2)|skin(1)	7						c.(622-624)GAA>TAA		transcription factor Dp-1							135.0	143.0	140.0					13																	114288852		2203	4300	6503	SO:0001587	stop_gained	7027				cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr13:114288852G>T	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.622G>T	13.37:g.114288852G>T	ENSP00000364519:p.Glu208*	TSP Lung(29;0.18)	Somatic				TFDP1_uc010tkd.1_Nonsense_Mutation_p.E113*|TFDP1_uc010tke.1_Nonsense_Mutation_p.E113*|TFDP1_uc001vty.3_Nonsense_Mutation_p.E208*|TFDP1_uc001vtx.2_Nonsense_Mutation_p.E88*	p.E208*	NM_007111	NP_009042	WXS	Illumina HiSeq	Unspecified	Q14186	TFDP1_HUMAN	all cancers(43;0.0576)		8	834	+	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	208			Dimerization (Potential).		B4DLQ9|Q5JSB4|Q8IZL5	Nonsense_Mutation	SNP	ENST00000375370.5	37	c.622G>T	CCDS9538.1	.	.	.	.	.	.	.	.	.	.	G	36	5.614558	0.96649	.	.	ENSG00000198176	ENST00000538138;ENST00000375370;ENST00000544902;ENST00000408980	.	.	.	4.07	4.07	0.47477	.	0.104805	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.6316	0.85035	0.0:0.0:1.0:0.0	.	.	.	.	X	113;208;113;208	.	ENSP00000364519:E208X	E	+	1	0	TFDP1	113336853	1.000000	0.71417	0.996000	0.52242	0.733000	0.41908	8.833000	0.92089	1.994000	0.58287	0.491000	0.48974	GAA		0.398	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	NM_007111		30	56	1	0	3.99451e-17	0.009535	5.39844e-17	30	56				
RNASE3	6037	broad.mit.edu	37	14	21360027	21360027	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:21360027G>A	ENST00000304639.3	+	2	240	c.182G>A	c.(181-183)cGa>cAa	p.R61Q		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	61	Required for nearly all of the bactericidal activity; partially involved in LPS-binding and bacterial membrane depolarization.				antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	AACAATTATCGATGGCGTTGC	0.443																																							uc001vyj.2		NA																	0					0						c.(181-183)CGA>CAA		ribonuclease, RNase A family, 3 (eosinophil	Pranlukast(DB01411)						122.0	125.0	124.0					14																	21360027		2191	4300	6491	SO:0001583	missense	6037				defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21360027G>A	X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.182G>A	14.37:g.21360027G>A	ENSP00000302324:p.Arg61Gln		Somatic					p.R61Q	NM_002935	NP_002926	WXS	Illumina HiSeq	Unspecified	P12724	ECP_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	2	236	+	all_cancers(95;0.00453)		61					Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Missense_Mutation	SNP	ENST00000304639.3	37	c.182G>A	CCDS9560.1	.	.	.	.	.	.	.	.	.	.	g	0.849	-0.739119	0.03088	.	.	ENSG00000169397	ENST00000304639	T	0.22336	1.96	2.56	-5.11	0.02901	Ribonuclease A, domain (4);	2.563050	0.03856	N	0.273220	T	0.04861	0.0131	N	0.00656	-1.285	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16689	-1.0394	10	0.12766	T	0.61	.	2.8661	0.05602	0.1587:0.2796:0.4579:0.1037	.	61	P12724	ECP_HUMAN	Q	61	ENSP00000302324:R61Q	ENSP00000302324:R61Q	R	+	2	0	RNASE3	20429867	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.544000	0.00436	-3.606000	0.00133	-2.007000	0.00441	CGA		0.443	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935		26	25	0	0	0	0.003954	0	26	25				
RNF31	55072	broad.mit.edu	37	14	24624848	24624848	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:24624848G>C	ENST00000324103.6	+	14	2760	c.2440G>C	c.(2440-2442)Gag>Cag	p.E814Q	RNF31_ENST00000382687.3_Missense_Mutation_p.E663Q|RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.E289Q|RNF31_ENST00000559275.1_Missense_Mutation_p.E663Q|RNA5SP383_ENST00000362934.1_RNA	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	814					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		TGAGCAGCTGGAGGCAACTTG	0.532																																							uc001wmn.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(2440-2442)GAG>CAG		ring finger protein 31							127.0	127.0	127.0					14																	24624848		1999	4176	6175	SO:0001583	missense	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24624848G>C	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.2440G>C	14.37:g.24624848G>C	ENSP00000315112:p.Glu814Gln		Somatic				RNF31_uc001wml.1_Missense_Mutation_p.E663Q|RNF31_uc010alg.1_Missense_Mutation_p.E573Q|RNF31_uc001wmo.1_Missense_Mutation_p.E281Q|RNF31_uc001wmp.2_RNA|RNF31_uc010alh.1_Missense_Mutation_p.W6C	p.E814Q	NM_017999	NP_060469	WXS	Illumina HiSeq	Unspecified	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	14	2689	+			814			IBR-type 1.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	c.2440G>C	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827479	0.71143	.	.	ENSG00000092098	ENST00000382682;ENST00000324103;ENST00000382687	T;T	0.62941	-0.01;-0.01	5.14	5.14	0.70334	Zinc finger, C6HC-type (2);	0.059638	0.64402	D	0.000003	T	0.65291	0.2677	N	0.14661	0.345	0.41665	D	0.989202	P;D;D	0.71674	0.719;0.998;0.998	P;D;D	0.69307	0.467;0.963;0.91	T	0.69727	-0.5067	10	0.51188	T	0.08	-19.413	17.528	0.87807	0.0:0.0:1.0:0.0	.	573;814;663	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	Q	256;814;663	ENSP00000315112:E814Q;ENSP00000372134:E663Q	ENSP00000315112:E814Q	E	+	1	0	RNF31	23694688	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.541000	0.67212	2.670000	0.90874	0.563000	0.77884	GAG		0.532	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		33	78	0	0	0	0.012213	0	33	78				
PELI2	57161	broad.mit.edu	37	14	56746457	56746457	+	Missense_Mutation	SNP	G	G	A	rs151092148		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:56746457G>A	ENST00000267460.4	+	3	557	c.271G>A	c.(271-273)Gtg>Atg	p.V91M		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	91	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GACTGTGGTGGTGGAGTACAC	0.303																																							uc001xch.2		NA																	0				ovary(1)	1						c.(271-273)GTG>ATG		pellino 2							148.0	148.0	148.0					14																	56746457		2203	4300	6503	SO:0001583	missense	57161				innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding	g.chr14:56746457G>A	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.271G>A	14.37:g.56746457G>A	ENSP00000267460:p.Val91Met		Somatic					p.V91M	NM_021255	NP_067078	WXS	Illumina HiSeq	Unspecified	Q9HAT8	PELI2_HUMAN			3	557	+			91					B2RDY5	Missense_Mutation	SNP	ENST00000267460.4	37	c.271G>A	CCDS9726.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533272	0.85812	.	.	ENSG00000139946	ENST00000267460	T	0.57595	0.39	4.84	4.84	0.62591	.	0.252983	0.38778	N	0.001564	T	0.74764	0.3759	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.77362	-0.2616	10	0.56958	D	0.05	-27.1666	18.5132	0.90925	0.0:0.0:1.0:0.0	.	91	Q9HAT8	PELI2_HUMAN	M	91	ENSP00000267460:V91M	ENSP00000267460:V91M	V	+	1	0	PELI2	55816210	1.000000	0.71417	0.995000	0.50966	0.947000	0.59692	9.601000	0.98297	2.673000	0.90976	0.557000	0.71058	GTG		0.303	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			38	63	0	0	0	0.010771	0	38	63				
SYNE2	23224	broad.mit.edu	37	14	64634321	64634322	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:64634321_64634322CC>AT	ENST00000344113.4	+	92	17081_17082	c.16869_16870CC>AT	c.(16867-16872)agCCtt>agATtt	p.5623_5624SL>RF	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.2257_2258SL>RF|SYNE2_ENST00000358025.3_Missense_Mutation_p.5623_5624SL>RF|SYNE2_ENST00000357395.3_Missense_Mutation_p.2008_2009SL>RF|SYNE2_ENST00000394768.2_Missense_Mutation_p.2008_2009SL>RF|SYNE2_ENST00000554584.1_Missense_Mutation_p.5498_5499SL>RF	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5623					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGGCTAACAGCCTTCCTGAGCT	0.455																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(16867-16872)AGCCTT>AGATTT		spectrin repeat containing, nuclear envelope 2																																				SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64634321_64634322CC>AT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	Exception_encountered	14.37:g.64634321_64634322delinsAT	ENSP00000341781:p.S5623_L5624delinsRF		Somatic				SYNE2_uc001xgl.2_Missense_Mutation_p.5623_5624SL>RF|SYNE2_uc010apy.2_Missense_Mutation_p.2008_2009SL>RF|SYNE2_uc001xgn.2_Missense_Mutation_p.585_586SL>RF|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR|SYNE2_uc001xgq.2_5'UTR	p.5623_5624SL>RF	NM_015180	NP_055995	WXS	Illumina HiSeq	Unspecified	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	92	17099_17100	+			5623_5624			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	DNP	ENST00000344113.4	37	c.16869_16870CC>AT	CCDS41963.1																																																																																				0.455	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		17	46	0	0	0	0.004672	0	17	46				
NRXN3	9369	broad.mit.edu	37	14	79175866	79175866	+	Missense_Mutation	SNP	G	G	C	rs200274508		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:79175866G>C	ENST00000554719.1	+	4	900	c.409G>C	c.(409-411)Gtg>Ctg	p.V137L	RP11-232C2.2_ENST00000555680.1_RNA|NRXN3_ENST00000335750.5_Missense_Mutation_p.V137L	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	141	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.V137M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTTCTTTGCCGTGGAACTCCT	0.507																																							uc001xun.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(409-411)GTG>CTG		neurexin 3 isoform 1 precursor							139.0	142.0	141.0					14																	79175866		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79175866G>C	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.409G>C	14.37:g.79175866G>C	ENSP00000451648:p.Val137Leu		Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.V271L	p.V137L	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	4	900	+		Renal(4;0.00876)	510			Extracellular (Potential).|Laminin G-like 3.		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	c.409G>C	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362354	0.41902	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557081	T;T;T	0.71103	-0.54;-0.54;-0.44	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.065942	0.64402	D	0.000012	T	0.72700	0.3493	N	0.16833	0.445	0.53688	D	0.999974	D;B	0.60160	0.987;0.03	D;B	0.64595	0.927;0.03	T	0.71692	-0.4516	9	.	.	.	.	19.1251	0.93380	0.0:0.0:1.0:0.0	.	510;137	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	L	510;508;137;137;81	ENSP00000451648:V137L;ENSP00000338349:V137L;ENSP00000450462:V81L	.	V	+	1	0	NRXN3	78245619	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	6.781000	0.75068	2.518000	0.84900	0.563000	0.77884	GTG		0.507	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		27	73	0	0	0	0.004656	0	27	73				
STON2	85439	broad.mit.edu	37	14	81743750	81743750	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:81743750G>T	ENST00000267540.2	-	4	2105	c.1905C>A	c.(1903-1905)acC>acA	p.T635T	STON2_ENST00000555447.1_Silent_p.T635T|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	635	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		ACTTTGTGGTGGTGGTGGGCA	0.517																																							uc010tvu.1		NA																	0				skin(3)|pancreas(2)	5						c.(1903-1905)ACC>ACA		stonin 2							67.0	56.0	60.0					14																	81743750		2203	4300	6503	SO:0001819	synonymous_variant	85439				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding	g.chr14:81743750G>T	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1905C>A	14.37:g.81743750G>T			Somatic				STON2_uc001xvk.1_Silent_p.T635T|STON2_uc010tvt.1_Silent_p.T432T	p.T635T	NM_033104	NP_149095	WXS	Illumina HiSeq	Unspecified	Q8WXE9	STON2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0348)	4	2106	-			635			MHD.		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Silent	SNP	ENST00000267540.2	37	c.1905C>A	CCDS9875.1																																																																																				0.517	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104		19	19	1	0	3.32936e-07	0.006122	3.73397e-07	19	19				
FLRT2	23768	broad.mit.edu	37	14	86088015	86088015	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr14:86088015A>T	ENST00000330753.4	+	2	924	c.157A>T	c.(157-159)Agc>Tgc	p.S53C	FLRT2_ENST00000554746.1_Missense_Mutation_p.S53C	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	53	LRRNT.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TAATGAGCGAAGCTTGACCTC	0.512																																							uc001xvr.2		NA																	0				ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4						c.(157-159)AGC>TGC		fibronectin leucine rich transmembrane protein 2							141.0	128.0	132.0					14																	86088015		2203	4300	6503	SO:0001583	missense	23768				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity	g.chr14:86088015A>T	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.157A>T	14.37:g.86088015A>T	ENSP00000332879:p.Ser53Cys		Somatic				FLRT2_uc010atd.2_Missense_Mutation_p.S53C	p.S53C	NM_013231	NP_037363	WXS	Illumina HiSeq	Unspecified	O43155	FLRT2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0319)	2	924	+			53			Extracellular (Potential).|LRRNT.		A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	c.157A>T	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592329	0.86953	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	D;D	0.96554	-4.05;-4.05	5.73	5.73	0.89815	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	M	0.89840	3.065	0.58432	D	0.999999	D	0.76494	0.999	D	0.74348	0.983	D	0.99406	1.0929	10	0.72032	D	0.01	-28.0441	16.0233	0.80516	1.0:0.0:0.0:0.0	.	53	O43155	FLRT2_HUMAN	C	53	ENSP00000332879:S53C;ENSP00000451050:S53C	ENSP00000332879:S53C	S	+	1	0	FLRT2	85157768	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.398000	0.66308	2.186000	0.69663	0.533000	0.62120	AGC		0.512	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			41	73	0	0	0	0.011902	0	41	73				
Unknown	0	broad.mit.edu	37	15	22440670	22440670	+	IGR	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:22440670C>A								RP11-2F9.4 (4493 upstream) : IGHV1OR15-1 (7711 downstream)																							TCACGTCCAGCCTCAGGGCAC	0.522																																							uc001yug.2		NA																	0					NA						c.(175-177)AGG>AGT		full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr15:22440670C>A																													15.37:g.22440670C>A			Somatic					p.R59S			WXS	Illumina HiSeq	Unspecified					1	196	-									Missense_Mutation	SNP		37	c.177G>T																																																																																				0	0.522									14	42	1	0	1.05317e-09	0.00245	1.23251e-09	14	42				
ARHGAP11A	9824	broad.mit.edu	37	15	32929036	32929036	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:32929036A>G	ENST00000361627.3	+	12	2784	c.2062A>G	c.(2062-2064)Ata>Gta	p.I688V	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.I499V|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.I499V	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	688					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.I688V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AGAAACAACTATAAAATGTTA	0.323																																					Colon(45;757 1134 30003 36652)	Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|breast(2)|urinary_tract(1)	6						c.(2062-2064)ATA>GTA		Rho GTPase activating protein 11A isoform 1							24.0	27.0	26.0					15																	32929036		2181	4272	6453	SO:0001583	missense	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32929036A>G	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2062A>G	15.37:g.32929036A>G	ENSP00000355090:p.Ile688Val		Somatic				ARHGAP11A_uc010ubw.1_Missense_Mutation_p.I499V|ARHGAP11A_uc010ubx.1_Missense_Mutation_p.I499V	p.I688V	NM_014783	NP_055598	WXS	Illumina HiSeq	Unspecified	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	12	2784	+		all_lung(180;1.3e-11)	688					B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	c.2062A>G	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.932201	0.00488	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.09630	2.96	4.72	-4.53	0.03462	.	1.344520	0.04895	N	0.450241	T	0.08088	0.0202	L	0.38531	1.155	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.46048	-0.9219	10	0.06494	T	0.89	.	12.1153	0.53861	0.4143:0.0:0.5857:0.0	.	688	Q6P4F7	RHGBA_HUMAN	V	688;499	ENSP00000355090:I688V	ENSP00000355090:I688V	I	+	1	0	ARHGAP11A	30716328	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.069000	0.11542	-0.963000	0.03600	-0.297000	0.09499	ATA		0.323	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783		12	28	0	0	0	0.010729	0	12	28				
RYR3	6263	broad.mit.edu	37	15	34145788	34145788	+	Silent	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:34145788A>G	ENST00000389232.4	+	96	13774	c.13704A>G	c.(13702-13704)gcA>gcG	p.A4568A	RP11-3D4.3_ENST00000560404.1_RNA|RYR3_ENST00000415757.3_Silent_p.A4563A|RYR3_ENST00000559917.1_3'UTR	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4568					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTACGGAGCAGAACGCATTG	0.488																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(13702-13704)GCA>GCG		ryanodine receptor 3							77.0	77.0	77.0					15																	34145788		1951	4155	6106	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34145788A>G		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.13704A>G	15.37:g.34145788A>G			Somatic				RYR3_uc010bar.2_Silent_p.A4563A	p.A4568A	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	96	13774	+		all_lung(180;7.18e-09)	4568					O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.13704A>G	CCDS45210.1																																																																																				0.488	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			9	32	0	0	0	0.004482	0	9	32				
MGA	23269	broad.mit.edu	37	15	42058514	42058514	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:42058514A>T	ENST00000570161.1	+	23	8234	c.8234A>T	c.(8233-8235)aAa>aTa	p.K2745I	MGA_ENST00000545763.1_Missense_Mutation_p.K2536I|MGA_ENST00000389936.4_Missense_Mutation_p.K2706I|MGA_ENST00000219905.7_Missense_Mutation_p.K2745I|MGA_ENST00000566586.1_Missense_Mutation_p.K2536I			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTCTTACCTAAAAAGATTTCT	0.378																																							uc010ucy.1		NA																	0				ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(8233-8235)AAA>ATA		MAX-interacting protein isoform 1							43.0	40.0	41.0					15																	42058514		1826	4089	5915	SO:0001583	missense	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42058514A>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8234A>T	15.37:g.42058514A>T	ENSP00000457035:p.Lys2745Ile		Somatic				MGA_uc010ucz.1_Missense_Mutation_p.K2536I	p.K2745I	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	24	8415	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	2706					Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	c.8234A>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551244	0.65311	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.86164	-2.07;-2.04;-2.08	5.37	4.23	0.50019	.	0.681194	0.12655	N	0.450122	T	0.81245	0.4782	N	0.19112	0.55	0.23681	N	0.997126	P;P	0.45212	0.853;0.771	P;B	0.47528	0.549;0.347	T	0.72414	-0.4301	10	0.87932	D	0	.	6.5492	0.22423	0.7541:0.159:0.0868:0.0	.	2536;2745	F5H7K2;E7ENI0	.;.	I	2745;2706;2536	ENSP00000219905:K2745I;ENSP00000374586:K2706I;ENSP00000442467:K2536I	ENSP00000219905:K2745I	K	+	2	0	MGA	39845806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.283000	0.43470	2.251000	0.74343	0.528000	0.53228	AAA		0.378	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		13	10	0	0	0	0.00245	0	13	10				
SPTBN5	51332	broad.mit.edu	37	15	42172497	42172497	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:42172497C>A	ENST00000320955.6	-	14	2899	c.2672G>T	c.(2671-2673)cGg>cTg	p.R891L		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	891					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTCCTCCAACCGGGCCCTGCG	0.667																																							uc001zos.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2566-2568)CGG>CTG		spectrin, beta, non-erythrocytic 5							16.0	18.0	17.0					15																	42172497		1895	4104	5999	SO:0001583	missense	51332				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin		g.chr15:42172497C>A	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2672G>T	15.37:g.42172497C>A	ENSP00000317790:p.Arg891Leu		Somatic					p.R856L	NM_016642	NP_057726	WXS	Illumina HiSeq	Unspecified	Q9NRC6	SPTN5_HUMAN		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)	14	2900	-		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	891			Spectrin 6.			Missense_Mutation	SNP	ENST00000320955.6	37	c.2567G>T		.	.	.	.	.	.	.	.	.	.	.	9.714	1.157914	0.21454	.	.	ENSG00000137877	ENST00000320955	T	0.35048	1.33	4.47	-3.79	0.04320	.	0.889113	0.09388	N	0.808910	T	0.20495	0.0493	N	0.14661	0.345	0.09310	N	1	B	0.18461	0.028	B	0.17433	0.018	T	0.19353	-1.0308	10	0.42905	T	0.14	.	11.2913	0.49252	0.0:0.5172:0.0:0.4828	.	891	Q9NRC6	SPTN5_HUMAN	L	891	ENSP00000317790:R891L	ENSP00000317790:R891L	R	-	2	0	SPTBN5	39959789	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.032000	0.01426	-1.106000	0.03008	-0.658000	0.03865	CGG		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642		8	11	1	0	0.000673444	0.008291	0.000713188	8	11				
PPIP5K1	9677	broad.mit.edu	37	15	43827131	43827131	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:43827131T>A	ENST00000396923.3	-	30	4164	c.4043A>T	c.(4042-4044)aAg>aTg	p.K1348M	PPIP5K1_ENST00000420765.1_Missense_Mutation_p.K1348M|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.K1321M|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.K1344M|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.K1324M|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.K1323M|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.K1321M|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.K1323M			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1348					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						ATGGACCAGCTTGCCAACCTC	0.552																																							uc001zrw.2		NA																	0					0						c.(4042-4044)AAG>ATG		histidine acid phosphatase domain containing 2A							88.0	90.0	89.0					15																	43827131		2201	4298	6499	SO:0001583	missense	9677				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr15:43827131T>A	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.4043A>T	15.37:g.43827131T>A	ENSP00000380129:p.Lys1348Met		Somatic				PPIP5K1_uc001zrx.1_Missense_Mutation_p.K1321M|PPIP5K1_uc001zru.2_Missense_Mutation_p.K1323M|PPIP5K1_uc001zry.3_Missense_Mutation_p.K1323M|PPIP5K1_uc001zrv.2_Missense_Mutation_p.K1109M	p.K1348M	NM_001130858	NP_001124330	WXS	Illumina HiSeq	Unspecified	Q6PFW1	VIP1_HUMAN			31	4226	-			1348					O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	ENST00000396923.3	37	c.4043A>T	CCDS45252.1	.	.	.	.	.	.	.	.	.	.	T	5.974	0.363666	0.11296	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.25749	1.83;1.83;2.39;1.83;1.83;1.83;1.78;2.39	4.92	-1.84	0.07809	.	0.756468	0.11803	N	0.527967	T	0.11495	0.0280	N	0.08118	0	0.09310	N	1	P;B;B;B	0.34892	0.474;0.102;0.164;0.164	B;B;B;B	0.39904	0.313;0.078;0.163;0.163	T	0.22452	-1.0216	10	0.72032	D	0.01	0.3945	0.9278	0.01328	0.158:0.313:0.1543:0.3747	.	1321;1348;1345;1323	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	M	1344;1323;1321;1323;1348;1348;1323;1348;1324;1321;1110	ENSP00000371309:K1344M;ENSP00000353446:K1323M;ENSP00000353253:K1321M;ENSP00000334779:K1323M;ENSP00000380129:K1348M;ENSP00000400887:K1348M;ENSP00000371303:K1324M;ENSP00000308773:K1321M	ENSP00000304750:K1348M	K	-	2	0	PPIP5K1	41614423	0.000000	0.05858	0.003000	0.11579	0.314000	0.28054	-0.098000	0.11024	0.017000	0.15025	-0.534000	0.04291	AAG		0.552	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659		66	50	0	0	0	0.01441	0	66	50				
UNC13C	440279	broad.mit.edu	37	15	54685309	54685309	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:54685309C>G	ENST00000260323.11	+	17	4777	c.4777C>G	c.(4777-4779)Ccc>Gcc	p.P1593A	UNC13C_ENST00000537900.1_Missense_Mutation_p.P1591A|UNC13C_ENST00000545554.1_Missense_Mutation_p.P1593A	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1593					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGATTTTTGGCCCCAACTTAT	0.393																																							uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(4777-4779)CCC>GCC		unc-13 homolog C							92.0	90.0	91.0					15																	54685309		1828	4073	5901	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54685309C>G	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4777C>G	15.37:g.54685309C>G	ENSP00000260323:p.Pro1593Ala		Somatic				UNC13C_uc002acl.2_Missense_Mutation_p.P423A	p.P1593A	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	16	4777	+			1593					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.4777C>G	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088350	0.36855	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.78003	-1.14;-1.14;-1.14	5.34	4.39	0.52855	Calcium-dependent secretion activator (1);	0.236721	0.43110	D	0.000612	T	0.67767	0.2928	L	0.45581	1.43	0.41329	D	0.987221	B;B	0.13145	0.001;0.007	B;B	0.14578	0.005;0.011	T	0.60762	-0.7199	10	0.15499	T	0.54	.	10.7576	0.46245	0.1449:0.7148:0.1403:0.0	.	1593;1593	F5H090;Q8NB66	.;UN13C_HUMAN	A	1593;1593;1591	ENSP00000260323:P1593A;ENSP00000438156:P1593A;ENSP00000442569:P1591A	ENSP00000260323:P1593A	P	+	1	0	UNC13C	52472601	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.618000	0.46393	2.525000	0.85131	0.650000	0.86243	CCC		0.393	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		29	35	0	0	0	0.009535	0	29	35				
LDHAL6B	92483	broad.mit.edu	37	15	59499557	59499557	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:59499557C>A	ENST00000307144.4	+	1	516	c.418C>A	c.(418-420)Cta>Ata	p.L140I	MYO1E_ENST00000288235.4_Intron	NM_033195.2	NP_149972.1	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	140					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)	10						AAACTCCAACCTAGTGATTAT	0.428																																							uc002agb.2		NA																	0					0						c.(418-420)CTA>ATA		lactate dehydrogenase A-like 6B	NADH(DB00157)						110.0	108.0	109.0					15																	59499557		2191	4290	6481	SO:0001583	missense	92483				glycolysis	cytoplasm	L-lactate dehydrogenase activity|protein binding	g.chr15:59499557C>A	AY009108	CCDS10171.1	15q21.3	2011-01-27	2004-07-27	2004-07-28	ENSG00000171989	ENSG00000171989			21481	protein-coding gene	gene with protein product			"""lactate dehydrogenase A-like 6"""	LDHAL6		15870898	Standard	NM_033195		Approved	LDHL, LDH6B	uc002agb.4	Q9BYZ2	OTTHUMG00000132714	ENST00000307144.4:c.418C>A	15.37:g.59499557C>A	ENSP00000302393:p.Leu140Ile		Somatic				MYO1E_uc002aga.2_Intron	p.L140I	NM_033195	NP_149972	WXS	Illumina HiSeq	Unspecified	Q9BYZ2	LDH6B_HUMAN			1	516	+			140					Q6DUY4|Q96LI2	Missense_Mutation	SNP	ENST00000307144.4	37	c.418C>A	CCDS10171.1	.	.	.	.	.	.	.	.	.	.	C	7.240	0.601087	0.13939	.	.	ENSG00000171989	ENST00000307144	D	0.91945	-2.94	1.47	1.47	0.22746	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.115504	0.36591	U	0.002516	T	0.80215	0.4582	N	0.11789	0.175	0.36998	D	0.89512	B	0.09022	0.002	B	0.27262	0.078	T	0.67031	-0.5773	10	0.13470	T	0.59	.	4.9066	0.13802	0.3566:0.6434:0.0:0.0	.	140	Q9BYZ2	LDH6B_HUMAN	I	140	ENSP00000302393:L140I	ENSP00000302393:L140I	L	+	1	2	LDHAL6B	57286849	0.999000	0.42202	0.443000	0.26883	0.414000	0.31173	0.567000	0.23608	0.784000	0.33661	0.305000	0.20034	CTA		0.428	LDHAL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256015.1	NM_033195		75	78	1	0	3.41413e-29	0.01441	4.96741e-29	75	78				
NOX5	79400	broad.mit.edu	37	15	69339834	69339834	+	Missense_Mutation	SNP	G	G	A	rs145431252		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:69339834G>A	ENST00000388866.3	+	12	1815	c.1774G>A	c.(1774-1776)Ggc>Agc	p.G592S	NOX5_ENST00000260364.5_Missense_Mutation_p.G574S|NOX5_ENST00000448182.3_Missense_Mutation_p.G546S|NOX5_ENST00000530406.2_Missense_Mutation_p.G564S|NOX5_ENST00000525163.1_3'UTR|NOX5_ENST00000455873.3_Missense_Mutation_p.G557S	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	592					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GGCAGGCATCGGCATCACCCC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		17528	0.001		0.0	False		,,,				2504	0.0						uc002ars.1		NA																	0				breast(1)|pancreas(1)	2						c.(1774-1776)GGC>AGC		NADPH oxidase, EF-hand calcium binding domain 5		G	SER/GLY,SER/GLY,SER/GLY	4,4396	8.1+/-20.4	0,4,2196	117.0	110.0	113.0		1690,1669,1774	3.2	0.8	15	dbSNP_134	113	0,8596		0,0,4298	yes	missense,missense,missense	NOX5	NM_001184779.1,NM_001184780.1,NM_024505.3	56,56,56	0,4,6494	AA,AG,GG		0.0,0.0909,0.0308	probably-damaging,probably-damaging,probably-damaging	564/738,557/731,592/766	69339834	4,12992	2200	4298	6498	SO:0001583	missense	79400				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity	g.chr15:69339834G>A	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1774G>A	15.37:g.69339834G>A	ENSP00000373518:p.Gly592Ser		Somatic				NOX5_uc002arp.1_Missense_Mutation_p.G574S|NOX5_uc002arq.1_Missense_Mutation_p.G546S|NOX5_uc010bid.1_Missense_Mutation_p.G557S|NOX5_uc002arr.1_Missense_Mutation_p.G564S|NOX5_uc010bie.1_Missense_Mutation_p.G392S|NOX5_uc010bif.1_RNA	p.G592S	NM_024505	NP_078781	WXS	Illumina HiSeq	Unspecified	Q96PH1	NOX5_HUMAN			12	1794	+			592			Helical; (Potential).		B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Missense_Mutation	SNP	ENST00000388866.3	37	c.1774G>A	CCDS32276.2	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632910	0.67015	9.09E-4	0.0	ENSG00000255346	ENST00000455873;ENST00000448182;ENST00000388866;ENST00000530406	D;D;D	0.96334	-3.98;-3.98;-3.98	3.19	3.19	0.36642	Ferric reductase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.98626	0.9540	H	0.96861	3.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99177	1.0866	10	0.87932	D	0	-13.9302	12.9058	0.58152	0.0:0.0:1.0:0.0	.	557;592;564	Q96PH1-6;Q96PH1;Q96PH1-3	.;NOX5_HUMAN;.	S	557;574;592;564	ENSP00000416828:G557S;ENSP00000373518:G592S;ENSP00000432440:G564S	ENSP00000373518:G592S	G	+	1	0	NOX5	67126888	1.000000	0.71417	0.812000	0.32479	0.379000	0.30106	5.039000	0.64185	1.349000	0.45751	0.205000	0.17691	GGC		0.602	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505		11	41	0	0	0	0.013537	0	11	41				
TBC1D21	161514	broad.mit.edu	37	15	74178467	74178467	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:74178467C>A	ENST00000300504.2	+	7	711	c.628C>A	c.(628-630)Ctc>Atc	p.L210I	TBC1D21_ENST00000562056.1_Missense_Mutation_p.L173I|TBC1D21_ENST00000535547.2_Missense_Mutation_p.L174I	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	210	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						CCTAGACATGCTCAGCACCCT	0.592																																							uc002avz.2		NA																	0				ovary(2)	2						c.(628-630)CTC>ATC		TBC1 domain family, member 21							222.0	149.0	174.0					15																	74178467		2198	4297	6495	SO:0001583	missense	161514					intracellular	Rab GTPase activator activity	g.chr15:74178467C>A	BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.628C>A	15.37:g.74178467C>A	ENSP00000300504:p.Leu210Ile		Somatic				TBC1D21_uc010ulc.1_Missense_Mutation_p.L174I	p.L210I	NM_153356	NP_699187	WXS	Illumina HiSeq	Unspecified	Q8IYX1	TBC21_HUMAN			7	711	+			210			Rab-GAP TBC.		B9A6M2	Missense_Mutation	SNP	ENST00000300504.2	37	c.628C>A	CCDS10252.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433998	0.43224	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.34275	1.37;1.37	4.85	4.85	0.62838	Rab-GAP/TBC domain (5);	0.000000	0.46442	D	0.000293	T	0.50735	0.1633	L	0.43923	1.385	0.35843	D	0.826202	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.982	T	0.59311	-0.7478	10	0.51188	T	0.08	.	13.7941	0.63160	0.0:1.0:0.0:0.0	.	174;210	B9A6M2;Q8IYX1	.;TBC21_HUMAN	I	210;174	ENSP00000300504:L210I;ENSP00000439325:L174I	ENSP00000300504:L210I	L	+	1	0	TBC1D21	71965520	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	3.948000	0.56660	2.406000	0.81754	0.585000	0.79938	CTC		0.592	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1	NM_153356		26	36	1	0	9.39395e-14	0.00632	1.19458e-13	26	36				
CHRNA3	1136	broad.mit.edu	37	15	78909405	78909405	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:78909405G>A	ENST00000326828.5	-	4	722	c.338C>T	c.(337-339)gCa>gTa	p.A113V	CHRNA3_ENST00000348639.3_Missense_Mutation_p.A113V|CHRNA3_ENST00000559941.1_5'Flank	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	113					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	GATCTTCTGTGCAGGGACACG	0.562																																							uc002bec.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(337-339)GCA>GTA		cholinergic receptor, nicotinic, alpha 3							99.0	82.0	87.0					15																	78909405		2196	4293	6489	SO:0001583	missense	1136				activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr15:78909405G>A		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.338C>T	15.37:g.78909405G>A	ENSP00000315602:p.Ala113Val		Somatic				CHRNA3_uc002bea.2_RNA|CHRNA3_uc002beb.2_Missense_Mutation_p.A113V	p.A113V	NM_000743	NP_000734	WXS	Illumina HiSeq	Unspecified	P32297	ACHA3_HUMAN			4	524	-			113			Extracellular (Potential).		Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	ENST00000326828.5	37	c.338C>T	CCDS10305.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400672	0.83120	.	.	ENSG00000080644	ENST00000348639;ENST00000326828	T;T	0.79141	-1.24;-1.24	5.68	5.68	0.88126	Neurotransmitter-gated ion-channel ligand-binding (3);	0.101236	0.64402	D	0.000001	T	0.78685	0.4322	L	0.58810	1.83	0.58432	D	0.999991	B;B	0.26635	0.048;0.155	B;B	0.31245	0.126;0.119	T	0.76342	-0.2994	10	0.66056	D	0.02	.	19.374	0.94501	0.0:0.0:1.0:0.0	.	113;113	P32297;P32297-3	ACHA3_HUMAN;.	V	113	ENSP00000267951:A113V;ENSP00000315602:A113V	ENSP00000315602:A113V	A	-	2	0	CHRNA3	76696460	1.000000	0.71417	0.277000	0.24703	0.944000	0.59088	9.528000	0.98046	2.679000	0.91253	0.655000	0.94253	GCA		0.562	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3			13	11	0	0	0	0.003163	0	13	11				
FURIN	5045	broad.mit.edu	37	15	91421523	91421523	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:91421523G>T	ENST00000268171.3	+	8	1108	c.829G>T	c.(829-831)Ggg>Tgg	p.G277W		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	277	Peptidase S8.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CTTCTTCCGTGGGGTTAGCCA	0.587																																							uc002bpu.1		NA																	0				central_nervous_system(4)|lung(2)|breast(1)	7						c.(829-831)GGG>TGG		furin preproprotein							41.0	37.0	38.0					15																	91421523		2198	4298	6496	SO:0001583	missense	5045				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity	g.chr15:91421523G>T	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.829G>T	15.37:g.91421523G>T	ENSP00000268171:p.Gly277Trp		Somatic					p.G277W	NM_002569	NP_002560	WXS	Illumina HiSeq	Unspecified	P09958	FURIN_HUMAN	Lung(145;0.189)		8	1045	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		277					Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	ENST00000268171.3	37	c.829G>T	CCDS10364.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168630	0.78339	.	.	ENSG00000140564	ENST00000268171	D	0.87809	-2.3	4.76	3.85	0.44370	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.052710	0.85682	D	0.000000	D	0.95733	0.8612	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96669	0.9495	10	0.87932	D	0	-30.616	13.037	0.58877	0.0775:0.0:0.9225:0.0	.	277	P09958	FURIN_HUMAN	W	277	ENSP00000268171:G277W	ENSP00000268171:G277W	G	+	1	0	FURIN	89222527	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.141000	0.94612	1.247000	0.43917	0.555000	0.69702	GGG		0.587	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569		17	14	1	0	5.26018e-13	0.012319	6.61104e-13	17	14				
PRC1	9055	broad.mit.edu	37	15	91512795	91512795	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:91512795G>A	ENST00000361188.5	-	13	2842	c.1631C>T	c.(1630-1632)gCc>gTc	p.A544V	PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.A544V|PRC1_ENST00000442656.2_Missense_Mutation_p.A503V|PRC1_ENST00000361919.3_Missense_Mutation_p.A544V					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTCCTTGTTGGCTCCATGCCT	0.552																																							uc002bqm.2		NA																	0				ovary(1)|skin(1)	2						c.(1630-1632)GCC>GTC		protein regulator of cytokinesis 1 isoform 1							138.0	104.0	115.0					15																	91512795		2198	4298	6496	SO:0001583	missense	9055				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding	g.chr15:91512795G>A	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1631C>T	15.37:g.91512795G>A	ENSP00000354679:p.Ala544Val		Somatic				PRC1_uc002bqn.2_Missense_Mutation_p.A544V|PRC1_uc002bqo.2_Missense_Mutation_p.A544V|PRC1_uc010uqs.1_Missense_Mutation_p.A503V	p.A544V	NM_003981	NP_003972	WXS	Illumina HiSeq	Unspecified	O43663	PRC1_HUMAN			13	1788	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		544			Unstructured, Arg/Lys rich.			Missense_Mutation	SNP	ENST00000361188.5	37	c.1631C>T	CCDS45352.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882826	0.33255	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	6.06	5.07	0.68467	.	0.489546	0.21889	N	0.067618	T	0.24509	0.0594	L	0.36672	1.1	0.23816	N	0.996766	B;B;B;B	0.16166	0.005;0.016;0.007;0.009	B;B;B;B	0.18871	0.008;0.006;0.01;0.023	T	0.07139	-1.0788	10	0.26408	T	0.33	.	12.4667	0.55762	0.0:0.1185:0.7465:0.135	.	503;544;514;544	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	V	544;544;544;147;503	ENSP00000377793:A544V;ENSP00000354618:A544V;ENSP00000354679:A544V;ENSP00000409549:A503V	ENSP00000354679:A544V	A	-	2	0	PRC1	89313799	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.208000	0.51114	2.879000	0.98667	0.650000	0.86243	GCC		0.552	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981		28	83	0	0	0	0.008361	0	28	83				
SLCO3A1	28232	broad.mit.edu	37	15	92647611	92647611	+	Missense_Mutation	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:92647611T>G	ENST00000318445.6	+	4	1062	c.848T>G	c.(847-849)tTt>tGt	p.F283C	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.F283C|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	283					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CTCTTGATGTTTGGGTTTCCA	0.597																																							uc002bqx.2		NA																	0				skin(1)	1						c.(847-849)TTT>TGT		solute carrier organic anion transporter family,							176.0	149.0	158.0					15																	92647611		2198	4298	6496	SO:0001583	missense	28232				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity	g.chr15:92647611T>G	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.848T>G	15.37:g.92647611T>G	ENSP00000320634:p.Phe283Cys		Somatic				SLCO3A1_uc002bqy.2_Missense_Mutation_p.F283C|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.F225C	p.F283C	NM_013272	NP_037404	WXS	Illumina HiSeq	Unspecified	Q9UIG8	SO3A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0841)		4	1049	+	Lung NSC(78;0.0158)|all_lung(78;0.0255)		283			Helical; Name=6; (Potential).		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	c.848T>G	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.509230	0.64522	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649;ENST00000555549	D;D	0.82619	-1.63;-1.63	5.12	5.12	0.69794	Major facilitator superfamily domain, general substrate transporter (1);	0.162902	0.56097	D	0.000035	D	0.90570	0.7044	M	0.78223	2.4	0.80722	D	1	B;D;D	0.76494	0.11;0.997;0.999	B;P;D	0.76575	0.052;0.847;0.988	D	0.91307	0.5071	10	0.54805	T	0.06	.	14.9139	0.70778	0.0:0.0:0.0:1.0	.	225;283;283	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	C	283;283;76;2	ENSP00000320634:F283C;ENSP00000387846:F283C	ENSP00000320634:F283C	F	+	2	0	SLCO3A1	90448615	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.396000	0.79891	1.906000	0.55180	0.533000	0.62120	TTT		0.597	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272		36	102	0	0	0	0.003271	0	36	102				
MCTP2	55784	broad.mit.edu	37	15	94841680	94841680	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:94841680C>T	ENST00000357742.4	+	1	186	c.186C>T	c.(184-186)gcC>gcT	p.A62A	MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000543482.1_Silent_p.A62A|MCTP2_ENST00000451018.3_Silent_p.A62A	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	62					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AGGCCTTGGCCCCAGAGGGCC	0.607																																							uc002btj.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(184-186)GCC>GCT		multiple C2 domains, transmembrane 2 isoform 1							53.0	58.0	56.0					15																	94841680		2197	4298	6495	SO:0001819	synonymous_variant	55784				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding	g.chr15:94841680C>T	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.186C>T	15.37:g.94841680C>T			Somatic				MCTP2_uc010urg.1_Silent_p.A62A|MCTP2_uc002bti.2_Silent_p.A62A|MCTP2_uc010boj.2_5'UTR|MCTP2_uc010bok.2_Silent_p.A62A|MCTP2_uc002btg.3_Silent_p.A62A|MCTP2_uc002bth.3_Silent_p.A62A	p.A62A	NM_018349	NP_060819	WXS	Illumina HiSeq	Unspecified	Q6DN12	MCTP2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)		1	251	+	Lung NSC(78;0.0821)|all_lung(78;0.148)		62					A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	ENST00000357742.4	37	c.186C>T	CCDS32338.1																																																																																				0.607	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349		22	49	0	0	0	0.012319	0	22	49				
OR4F15	390649	broad.mit.edu	37	15	102358657	102358657	+	Missense_Mutation	SNP	A	A	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:102358657A>C	ENST00000332238.4	+	1	292	c.268A>C	c.(268-270)Aag>Cag	p.K90Q		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CAAGAAGCACAAGGCCATCTC	0.453																																							uc010uts.1		NA																	0					0						c.(268-270)AAG>CAG		olfactory receptor, family 4, subfamily F,							161.0	144.0	150.0					15																	102358657		2203	4300	6503	SO:0001583	missense	390649				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102358657A>C	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.268A>C	15.37:g.102358657A>C	ENSP00000333184:p.Lys90Gln		Somatic					p.K90Q	NM_001001674	NP_001001674	WXS	Illumina HiSeq	Unspecified	Q8NGB8	O4F15_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	268	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		90			Extracellular (Potential).		B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	c.268A>C	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	20.3	3.958707	0.74016	.	.	ENSG00000182854	ENST00000332238	T	0.38240	1.15	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.53465	0.1798	M	0.64080	1.96	0.27706	N	0.945624	D	0.60575	0.988	P	0.62382	0.901	T	0.51631	-0.8681	9	.	.	.	.	13.7375	0.62827	1.0:0.0:0.0:0.0	.	90	Q8NGB8	O4F15_HUMAN	Q	90	ENSP00000333184:K90Q	.	K	+	1	0	OR4F15	100176180	0.015000	0.18098	0.497000	0.27552	0.968000	0.65278	2.194000	0.42668	2.340000	0.79590	0.528000	0.53228	AAG		0.453	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674		75	89	0	0	0	0.01441	0	75	89				
KREMEN2	79412	broad.mit.edu	37	16	3014592	3014592	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:3014592C>A	ENST00000303746.5	+	1	648	c.71C>A	c.(70-72)tCg>tAg	p.S24*	KREMEN2_ENST00000575885.1_Nonsense_Mutation_p.S24*|KREMEN2_ENST00000319500.6_Nonsense_Mutation_p.S24*|KREMEN2_ENST00000572045.1_Nonsense_Mutation_p.S24*|KREMEN2_ENST00000571007.1_Nonsense_Mutation_p.S24*|KREMEN2_ENST00000575769.1_Nonsense_Mutation_p.S24*			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	24					Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						CGTGGGGCCTCGGCTGGGAGC	0.687																																							uc002csg.2		NA																	0				central_nervous_system(2)	2						c.(70-72)TCG>TAG		kringle-containing transmembrane protein 2							43.0	46.0	45.0					16																	3014592		2197	4300	6497	SO:0001587	stop_gained	79412				Wnt receptor signaling pathway	integral to membrane		g.chr16:3014592C>A	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.71C>A	16.37:g.3014592C>A	ENSP00000304422:p.Ser24*		Somatic				KREMEN2_uc010bsw.1_Nonsense_Mutation_p.S24*|KREMEN2_uc002csh.2_Nonsense_Mutation_p.S24*|KREMEN2_uc010uwl.1_Nonsense_Mutation_p.S24*|KREMEN2_uc010bsx.2_Nonsense_Mutation_p.S24*|KREMEN2_uc002csi.2_Nonsense_Mutation_p.S24*	p.S24*	NM_172229	NP_757384	WXS	Illumina HiSeq	Unspecified	Q8NCW0	KREM2_HUMAN			1	376	+			24					B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Nonsense_Mutation	SNP	ENST00000303746.5	37	c.71C>A	CCDS10483.1	.	.	.	.	.	.	.	.	.	.	C	38	6.832448	0.97873	.	.	ENSG00000131650	ENST00000303746;ENST00000319500	.	.	.	4.16	-0.563	0.11778	.	0.799381	0.10090	N	0.717271	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.9563	0.03377	0.3603:0.3583:0.176:0.1054	.	.	.	.	X	24	.	ENSP00000304422:S24X	S	+	2	0	KREMEN2	2954593	0.330000	0.24705	0.080000	0.20451	0.812000	0.45895	0.269000	0.18589	0.130000	0.18549	0.561000	0.74099	TCG		0.687	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250964.2	NM_145347		9	34	1	0	0.00621372	0.006214	0.00643279	9	34				
GTF3C1	2975	broad.mit.edu	37	16	27518169	27518169	+	Splice_Site	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:27518169C>A	ENST00000356183.4	-	9	1566	c.1551G>T	c.(1549-1551)aaG>aaT	p.K517N	GTF3C1_ENST00000561623.1_Splice_Site_p.K517N	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	517					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTCCCTACCCTTGGTTGGGG	0.622																																							uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(1549-1551)AAG>AAT		general transcription factor IIIC, polypeptide							67.0	55.0	60.0					16																	27518169		2197	4300	6497	SO:0001630	splice_region_variant	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27518169C>A	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1552+1G>T	16.37:g.27518169C>A			Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.K517N	p.K517N	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			9	1591	-			517					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.1551G>T	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783611	0.49891	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26067	1.76	4.92	2.97	0.34412	.	0.181949	0.46758	D	0.000279	T	0.33760	0.0874	M	0.64997	1.995	0.38342	D	0.944102	D;D	0.57571	0.98;0.976	P;P	0.55455	0.697;0.776	T	0.18116	-1.0347	10	0.32370	T	0.25	.	5.9604	0.19297	0.0:0.7146:0.0:0.2854	.	517;517	Q12789;Q12789-3	TF3C1_HUMAN;.	N	517;515	ENSP00000348510:K517N	ENSP00000348510:K517N	K	-	3	2	GTF3C1	27425670	1.000000	0.71417	0.997000	0.53966	0.580000	0.36256	1.525000	0.35953	1.080000	0.41073	-0.142000	0.14014	AAG		0.622	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	Missense_Mutation	4	3	1	0	8.12818e-05	0.001984	8.75135e-05	4	3				
MVP	9961	broad.mit.edu	37	16	29848101	29848101	+	Missense_Mutation	SNP	G	G	T	rs561716536	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:29848101G>T	ENST00000357402.5	+	7	869	c.731G>T	c.(730-732)cGc>cTc	p.R244L	MVP_ENST00000452209.2_Silent_p.P58P|MVP_ENST00000395353.1_Missense_Mutation_p.R244L	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	244					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GTGTCCCGCCGCACTGGGGAG	0.637																																							uc002dui.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(730-732)CGC>CTC		major vault protein							43.0	44.0	44.0					16																	29848101		2196	4300	6496	SO:0001583	missense	9961				mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding	g.chr16:29848101G>T	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.731G>T	16.37:g.29848101G>T	ENSP00000349977:p.Arg244Leu		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc010bzh.1_RNA|MVP_uc010vdz.1_RNA|MVP_uc002duj.2_Missense_Mutation_p.R244L|MVP_uc010vea.1_5'UTR	p.R244L	NM_005115	NP_005106	WXS	Illumina HiSeq	Unspecified	Q14764	MVP_HUMAN			7	815	+			244			MVP 5.		Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	c.731G>T	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186596	0.78789	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.32272	1.46;1.46	5.47	3.42	0.39159	.	0.047912	0.85682	D	0.000000	T	0.47600	0.1454	M	0.68317	2.08	0.80722	D	1	D	0.69078	0.997	D	0.66602	0.945	T	0.42015	-0.9476	10	0.40728	T	0.16	-15.1392	10.4047	0.44249	0.173:0.0:0.827:0.0	.	244	Q14764	MVP_HUMAN	L	244	ENSP00000349977:R244L;ENSP00000378760:R244L	ENSP00000349977:R244L	R	+	2	0	MVP	29755602	0.997000	0.39634	0.990000	0.47175	0.864000	0.49448	3.082000	0.50128	1.369000	0.46134	0.462000	0.41574	CGC		0.637	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115		21	29	1	0	1.22574e-08	0.014323	1.41398e-08	21	29				
SALL1	6299	broad.mit.edu	37	16	51173592	51173592	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:51173592G>A	ENST00000251020.4	-	2	2574	c.2541C>T	c.(2539-2541)tcC>tcT	p.S847S	SALL1_ENST00000440970.1_Silent_p.S750S|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	847					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGCTGTCTTGGGAGGCGTCTG	0.488																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(2539-2541)TCC>TCT		sal-like 1 isoform a							118.0	118.0	118.0					16																	51173592		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51173592G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2541C>T	16.37:g.51173592G>A			Somatic				SALL1_uc010vgr.1_Silent_p.S750S|SALL1_uc010cbv.2_Intron	p.S847S	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	2572	-		all_cancers(37;0.0322)	847					Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.2541C>T	CCDS10747.1																																																																																				0.488	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		66	64	0	0	0	0.01441	0	66	64				
RBL2	5934	broad.mit.edu	37	16	53515618	53515618	+	Silent	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:53515618A>T	ENST00000262133.6	+	21	3257	c.3120A>T	c.(3118-3120)gtA>gtT	p.V1040V	RBL2_ENST00000544545.1_Intron|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	1040					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ATCCATTTGTAAGAACAGGCT	0.333																																							uc002ehi.3		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						c.(3118-3120)GTA>GTT		retinoblastoma-like 2 (p130)							69.0	61.0	63.0					16																	53515618		2198	4300	6498	SO:0001819	synonymous_variant	5934				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr16:53515618A>T	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.3120A>T	16.37:g.53515618A>T			Somatic				RBL2_uc002ehj.2_Silent_p.V750V|RBL2_uc010vgw.1_Intron	p.V1040V	NM_005611	NP_005602	WXS	Illumina HiSeq	Unspecified	Q08999	RBL2_HUMAN			21	3238	+			1040					B7Z913|Q15073|Q16084|Q8NE70|Q92812	Silent	SNP	ENST00000262133.6	37	c.3120A>T	CCDS10748.1																																																																																				0.333	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611		12	21	0	0	0	0.013537	0	12	21				
LINC00922	283867	broad.mit.edu	37	16	65345315	65345315	+	lincRNA	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr16:65345315A>T	ENST00000569736.1	-	0	819				RP11-256I9.3_ENST00000562656.1_lincRNA	NR_027755.1				long intergenic non-protein coding RNA 922																		GGAGGTACTCACCTTCGTGAG	0.403																																							uc010cdo.1		NA																	0					0						c.e5+1		Homo sapiens cDNA clone IMAGE:5276218.							123.0	114.0	117.0					16																	65345315		1926	4143	6069			283867							g.chr16:65345315A>T	BC037902, BC104446		16q21	2013-05-24			ENSG00000261742	ENSG00000261742		"""Long non-coding RNAs"""	27545	non-coding RNA	RNA, long non-coding							Standard	NR_027755		Approved				OTTHUMG00000172812		16.37:g.65345315A>T			Somatic				LOC283867_uc010cdp.1_Intron|LOC283867_uc002eol.1_Splice_Site				WXS	Illumina HiSeq	Unspecified				OV - Ovarian serous cystadenocarcinoma(108;0.17)	5		-									Splice_Site	SNP	ENST00000569736.1	37	c.479_splice																																																																																					0.403	LINC00922-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000420601.2	NR_027755		30	73	0	0	0	0.012213	0	30	73				
DNAH9	1770	broad.mit.edu	37	17	11865532	11865532	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:11865532A>G	ENST00000262442.4	+	68	13260	c.13192A>G	c.(13192-13194)Atc>Gtc	p.I4398V	DNAH9_ENST00000608377.1_Missense_Mutation_p.I710V|DNAH9_ENST00000396001.2_3'UTR|RP11-1096G20.5_ENST00000580270.1_RNA|DNAH9_ENST00000454412.2_Missense_Mutation_p.I4322V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4398					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGGGGCCTACATCCATGGCCT	0.517																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(13192-13194)ATC>GTC		dynein, axonemal, heavy chain 9 isoform 2							68.0	70.0	69.0					17																	11865532		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11865532A>G	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.13192A>G	17.37:g.11865532A>G	ENSP00000262442:p.Ile4398Val		Somatic				DNAH9_uc010coo.2_Missense_Mutation_p.I3616V|DNAH9_uc002gnf.2_Missense_Mutation_p.I710V	p.I4398V	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	68	13260	+		Breast(5;0.0122)|all_epithelial(5;0.131)	4398					A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.13192A>G	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	2.606	-0.291786	0.05568	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.05649	3.41;3.41;3.41	5.04	-7.49	0.01355	Dynein heavy chain (1);	0.398989	0.26780	N	0.022521	T	0.02455	0.0075	N	0.10809	0.05	0.22342	N	0.999186	B	0.02656	0.0	B	0.15870	0.014	T	0.38090	-0.9677	10	0.02654	T	1	.	16.4246	0.83810	0.6745:0.0:0.3255:0.0	.	4398	Q9NYC9	DYH9_HUMAN	V	4398;4322;2904;710	ENSP00000262442:I4398V;ENSP00000414874:I4322V;ENSP00000379323:I710V	ENSP00000262442:I4398V	I	+	1	0	DNAH9	11806257	0.003000	0.15002	0.045000	0.18777	0.919000	0.55068	-0.029000	0.12329	-1.101000	0.03027	-0.177000	0.13119	ATC		0.517	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		33	29	0	0	0	0.013726	0	33	29				
TVP23C	201158	broad.mit.edu	37	17	15406338	15406338	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:15406338G>A	ENST00000225576.3	-	6	766	c.671C>T	c.(670-672)cCa>cTa	p.P224L	TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	224						integral component of membrane (GO:0016021)											ACGAAGAGGTGGAGAACTAAG	0.587																																							uc002goq.2		NA																	0					0						c.(670-672)CCA>CTA		hypothetical protein LOC201158 isoform 1							41.0	43.0	43.0					17																	15406338		2203	4300	6503	SO:0001583	missense	201158					integral to membrane		g.chr17:15406338G>A	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.671C>T	17.37:g.15406338G>A	ENSP00000225576:p.Pro224Leu		Somatic				CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	p.P224L	NM_145301	NP_660344	WXS	Illumina HiSeq	Unspecified	Q96ET8	F18B2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)	6	854	-			224					Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	c.671C>T	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810526	0.50421	.	.	ENSG00000175106	ENST00000225576	T	0.35236	1.32	3.65	0.376	0.16193	.	0.502161	0.22068	N	0.065075	T	0.22975	0.0555	L	0.39566	1.225	0.09310	N	0.999997	B	0.12630	0.006	B	0.08055	0.003	T	0.17899	-1.0354	10	0.72032	D	0.01	-5.8003	2.7701	0.05332	0.2601:0.0:0.52:0.2199	.	224	Q96ET8	F18B2_HUMAN	L	224	ENSP00000225576:P224L	ENSP00000225576:P224L	P	-	2	0	FAM18B2	15347063	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.019000	0.13444	0.127000	0.18452	0.460000	0.39030	CCA		0.587	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301		16	49	0	0	0	0.003163	0	16	49				
UBBP4	23666	broad.mit.edu	37	17	21731316	21731316	+	Silent	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:21731316A>T	ENST00000584755.1	+	2	1015	c.618A>T	c.(616-618)gtA>gtT	p.V206V	UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000578713.1_Intron					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						AGATGGCGGTACTCTTTCTGA	0.517																																							uc002gyy.3		NA																	0					NA						c.(616-618)GTA>GTT		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001819	synonymous_variant	0							g.chr17:21731316A>T	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.618A>T	17.37:g.21731316A>T			Somatic					p.V206V			WXS	Illumina HiSeq	Unspecified					2	743	+									Silent	SNP	ENST00000584755.1	37	c.618A>T																																																																																					0.517	UBBP4-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000444585.1			49	52	0	0	0	0.01441	0	49	52				
ADAM11	4185	broad.mit.edu	37	17	42853010	42853010	+	Missense_Mutation	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:42853010T>G	ENST00000200557.6	+	17	1620	c.1451T>G	c.(1450-1452)aTg>aGg	p.M484R	ADAM11_ENST00000535346.1_Missense_Mutation_p.M284R	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	484	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CACGACGCCATGTGCAGCGAC	0.667																																							uc002ihh.2		NA																	0				pancreas(1)	1						c.(1450-1452)ATG>AGG		ADAM metallopeptidase domain 11 preproprotein							10.0	9.0	9.0					17																	42853010		2185	4261	6446	SO:0001583	missense	4185				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr17:42853010T>G	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1451T>G	17.37:g.42853010T>G	ENSP00000200557:p.Met484Arg		Somatic				ADAM11_uc010wjd.1_Missense_Mutation_p.M284R|ADAM11_uc002ihi.2_5'Flank	p.M484R	NM_002390	NP_002381	WXS	Illumina HiSeq	Unspecified	O75078	ADA11_HUMAN			17	1451	+		Prostate(33;0.0959)	484			Extracellular (Potential).|Disintegrin.		Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	c.1451T>G	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.044710	0.55110	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.10477	2.87;2.87	4.42	4.42	0.53409	Blood coagulation inhibitor, Disintegrin (4);	0.000000	0.85682	D	0.000000	T	0.17746	0.0426	L	0.38953	1.18	0.80722	D	1	B;P	0.47253	0.322;0.892	B;P	0.55222	0.326;0.771	T	0.01036	-1.1473	10	0.46703	T	0.11	.	12.7856	0.57502	0.0:0.0:0.0:1.0	.	284;484	B4DKD2;O75078	.;ADA11_HUMAN	R	484;284;384	ENSP00000200557:M484R;ENSP00000443773:M284R	ENSP00000200557:M484R	M	+	2	0	ADAM11	40208536	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.052000	0.41316	1.838000	0.53458	0.448000	0.29417	ATG		0.667	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390		4	3	0	0	0	0.000602	0	4	3				
HOXB6	3216	broad.mit.edu	37	17	46675197	46675197	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:46675197A>G	ENST00000484302.2	-	2	938	c.316T>C	c.(316-318)Tcg>Ccg	p.S106P	HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000225648.3_Missense_Mutation_p.S106P|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000460041.1_RNA			P17509	HXB6_HUMAN	homeobox B6	106					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						GCGCAGTCCGACTTCCGCGGC	0.667																																							uc002ins.1		NA																	0					0						c.(316-318)TCG>CCG		homeobox B6							22.0	17.0	19.0					17																	46675197		2201	4298	6499	SO:0001583	missense	3216				anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46675197A>G		CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.316T>C	17.37:g.46675197A>G	ENSP00000420009:p.Ser106Pro		Somatic				HOXB6_uc010dbh.1_Missense_Mutation_p.S106P|HOXB6_uc002int.1_Missense_Mutation_p.S106P	p.S106P	NM_018952	NP_061825	WXS	Illumina HiSeq	Unspecified	P17509	HXB6_HUMAN			3	641	-			106					A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	Missense_Mutation	SNP	ENST00000484302.2	37	c.316T>C	CCDS11531.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.616158	0.46631	.	.	ENSG00000108511	ENST00000484302;ENST00000225648	D;D	0.90844	-2.74;-2.74	5.39	4.32	0.51571	.	0.853251	0.10171	N	0.707114	D	0.83372	0.5240	L	0.33137	0.985	0.34507	D	0.706696	B;B	0.09022	0.0;0.002	B;B	0.08055	0.0;0.003	T	0.76881	-0.2795	10	0.21540	T	0.41	.	5.3373	0.15965	0.6942:0.1511:0.1547:0.0	.	106;106	P17509-2;P17509	.;HXB6_HUMAN	P	106	ENSP00000420009:S106P;ENSP00000225648:S106P	ENSP00000225648:S106P	S	-	1	0	HOXB6	44030196	0.880000	0.30214	1.000000	0.80357	0.998000	0.95712	0.100000	0.15231	1.075000	0.40932	0.533000	0.62120	TCG		0.667	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358146.2			2	7	0	0	0	0.004672	0	2	7				
AKAP1	8165	broad.mit.edu	37	17	55195744	55195744	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:55195744G>A	ENST00000337714.3	+	9	2736	c.2503G>A	c.(2503-2505)Gat>Aat	p.D835N	AKAP1_ENST00000571629.1_Missense_Mutation_p.D835N|AKAP1_ENST00000572557.1_Missense_Mutation_p.D835N|AKAP1_ENST00000539273.1_Missense_Mutation_p.D835N	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	835					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TCCTGAAGACGATGACCAGTT	0.532																																							uc002iux.2		NA																	0				ovary(1)	1						c.(2503-2505)GAT>AAT		A-kinase anchor protein 1 precursor							112.0	97.0	102.0					17																	55195744		2203	4300	6503	SO:0001583	missense	8165				blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding	g.chr17:55195744G>A	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.2503G>A	17.37:g.55195744G>A	ENSP00000337736:p.Asp835Asn		Somatic				AKAP1_uc010wnl.1_Missense_Mutation_p.D835N|AKAP1_uc010dcm.2_Missense_Mutation_p.D835N	p.D835N	NM_003488	NP_003479	WXS	Illumina HiSeq	Unspecified	Q92667	AKAP1_HUMAN			9	2734	+	Breast(9;5.46e-08)		835					A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	c.2503G>A	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782703	0.70222	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	T;T	0.15372	2.43;2.43	5.08	5.08	0.68730	.	0.098627	0.64402	D	0.000002	T	0.24812	0.0602	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	P	0.55923	0.787	T	0.00995	-1.1487	10	0.51188	T	0.08	.	17.6397	0.88132	0.0:0.0:1.0:0.0	.	835	Q92667	AKAP1_HUMAN	N	835;877;835	ENSP00000337736:D835N;ENSP00000443139:D835N	ENSP00000337736:D835N	D	+	1	0	AKAP1	52550743	1.000000	0.71417	0.999000	0.59377	0.410000	0.31052	7.846000	0.86887	2.643000	0.89663	0.650000	0.86243	GAT		0.532	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1			37	39	0	0	0	0.00874	0	37	39				
DDX42	11325	broad.mit.edu	37	17	61895427	61895427	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:61895427G>A	ENST00000578681.1	+	19	3087	c.2486G>A	c.(2485-2487)aGc>aAc	p.S829N	DDX42_ENST00000583590.1_Missense_Mutation_p.S829N|DDX42_ENST00000389924.2_Missense_Mutation_p.S829N|DDX42_ENST00000359353.5_Missense_Mutation_p.S710N|DDX42_ENST00000457800.2_Missense_Mutation_p.S829N|DDX42_ENST00000582985.1_Intron	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	829	Gly-rich.|His-rich.|Necessary for interaction with TP53BP2.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.S829I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AATCGGCATAGCGATAGTCCA	0.587																																							uc002jbu.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(2)|skin(2)|large_intestine(1)	5						c.(2485-2487)AGC>AAC		DEAD box polypeptide 42 protein							59.0	55.0	56.0					17																	61895427		2203	4300	6503	SO:0001583	missense	11325				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr17:61895427G>A	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2486G>A	17.37:g.61895427G>A	ENSP00000464050:p.Ser829Asn		Somatic				DDX42_uc002jbv.2_Missense_Mutation_p.S829N|DDX42_uc002jbx.2_Missense_Mutation_p.S565N|DDX42_uc002jby.2_Missense_Mutation_p.S375N|DDX42_uc010wps.1_Missense_Mutation_p.S197N	p.S829N	NM_007372	NP_031398	WXS	Illumina HiSeq	Unspecified	Q86XP3	DDX42_HUMAN			19	2743	+			829			Gly-rich.|His-rich.|Necessary for interaction with TP53BP2.		A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	c.2486G>A	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706908	0.30232	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.19250	2.16;2.16	4.82	4.82	0.62117	.	1.221790	0.05395	N	0.539725	T	0.12646	0.0307	N	0.03608	-0.345	0.24470	N	0.994394	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07558	-1.0766	10	0.32370	T	0.25	-9.7906	12.5583	0.56267	0.083:0.0:0.917:0.0	.	375;829	B3KV84;Q86XP3	.;DDX42_HUMAN	N	829;829;546	ENSP00000374574:S829N;ENSP00000390121:S829N	ENSP00000352308:S546N	S	+	2	0	DDX42	59249159	0.997000	0.39634	0.934000	0.37439	0.556000	0.35491	3.126000	0.50477	2.494000	0.84150	0.563000	0.77884	AGC		0.587	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		20	52	0	0	0	0.010504	0	20	52				
KCNJ2	3759	broad.mit.edu	37	17	68171198	68171198	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:68171198C>A	ENST00000243457.3	+	2	401	c.18C>A	c.(16-18)acC>acA	p.T6T	KCNJ2_ENST00000535240.1_Silent_p.T6T	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	6					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					GTGTGCGAACCAACCGCTACA	0.493																																							uc010dfg.2		NA																	0					0						c.(16-18)ACC>ACA		potassium inwardly-rectifying channel J2							57.0	54.0	55.0					17																	68171198		2203	4300	6503	SO:0001819	synonymous_variant	3759				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding	g.chr17:68171198C>A	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.18C>A	17.37:g.68171198C>A			Somatic				KCNJ2_uc002jir.2_Silent_p.T6T	p.T6T	NM_000891	NP_000882	WXS	Illumina HiSeq	Unspecified	P63252	IRK2_HUMAN			2	419	+	Breast(10;1.64e-08)		6			Cytoplasmic (By similarity).		O15110|P48049	Silent	SNP	ENST00000243457.3	37	c.18C>A	CCDS11688.1																																																																																				0.493	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891		15	27	1	0	2.35188e-11	0.006122	2.88843e-11	15	27				
SRSF2	6427	broad.mit.edu	37	17	74732914	74732914	+	Missense_Mutation	SNP	T	T	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr17:74732914T>C	ENST00000392485.2	-	1	501	c.329A>G	c.(328-330)tAc>tGc	p.Y110C	MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000586622.1_5'UTR|MFSD11_ENST00000590514.1_5'Flank|MFSD11_ENST00000336509.4_5'Flank|SRSF2_ENST00000359995.5_Missense_Mutation_p.Y110C|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000593181.1_5'Flank|MFSD11_ENST00000588460.1_5'UTR|SRSF2_ENST00000508921.3_Intron|MFSD11_ENST00000355954.3_5'Flank|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000591864.1_5'Flank	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	110					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						ACCGCCCCCGTACCTGCGGGG	0.786			Mis		"""MDS, CLL"""																																		uc002jsv.2		NA		Dom	yes		17	17q25	6427		serine/arginine-rich splicing factor 2			L					0					0						c.(328-330)TAC>TGC		splicing factor, arginine/serine-rich 2							7.0	9.0	8.0					17																	74732914		1655	3541	5196	SO:0001583	missense	6427				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity	g.chr17:74732914T>C	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.329A>G	17.37:g.74732914T>C	ENSP00000376276:p.Tyr110Cys		Somatic				SFRS2_uc002jsw.1_5'Flank|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Missense_Mutation_p.Y110C|SFRS2_uc010wtg.1_Intron|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MIR636_hsa-mir-636|MI0003651_5'Flank|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	p.Y110C	NM_003016	NP_003007	WXS	Illumina HiSeq	Unspecified	Q01130	SRSF2_HUMAN			1	499	-			110					B3KWD5|B4DN89|H0YG49	Missense_Mutation	SNP	ENST00000392485.2	37	c.329A>G	CCDS11749.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.290483	0.23478	.	.	ENSG00000161547	ENST00000392485;ENST00000508921;ENST00000358156	T	0.74526	-0.85	4.43	4.43	0.53597	.	0.000000	0.64402	D	0.000001	T	0.69324	0.3098	M	0.83483	2.645	0.80722	D	1	P	0.47762	0.9	B	0.28385	0.089	T	0.74526	-0.3636	10	0.39692	T	0.17	.	13.3469	0.60578	0.0:0.0:0.0:1.0	.	110	Q01130	SRSF2_HUMAN	C	110;137;98	ENSP00000376276:Y110C	ENSP00000350877:Y98C	Y	-	2	0	SRSF2	72244509	1.000000	0.71417	0.130000	0.21974	0.021000	0.10359	3.647000	0.54403	1.632000	0.50472	0.455000	0.32223	TAC		0.786	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	NM_003016		9	22	0	0	0	0.006214	0	9	22				
CETN1	1068	broad.mit.edu	37	18	580499	580499	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:580499C>A	ENST00000327228.3	+	1	133	c.91C>A	c.(91-93)Caa>Aaa	p.Q31K		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	31	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						GGATCAGAAGCAAGAAGTTCG	0.597																																							uc002kko.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(91-93)CAA>AAA		centrin 1							58.0	44.0	49.0					18																	580499		2203	4300	6503	SO:0001583	missense	1068				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding	g.chr18:580499C>A	U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.91C>A	18.37:g.580499C>A	ENSP00000319052:p.Gln31Lys		Somatic					p.Q31K	NM_004066	NP_004057	WXS	Illumina HiSeq	Unspecified	Q12798	CETN1_HUMAN			1	133	+			31			EF-hand 1.		B2R536	Missense_Mutation	SNP	ENST00000327228.3	37	c.91C>A	CCDS11820.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996901	0.35226	.	.	ENSG00000177143	ENST00000327228	T	0.35789	1.29	5.2	4.33	0.51752	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.23054	0.0557	N	0.16233	0.39	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.04165	-1.0972	10	0.39692	T	0.17	.	11.7501	0.51843	0.0:0.9146:0.0:0.0854	.	31	Q12798	CETN1_HUMAN	K	31	ENSP00000319052:Q31K	ENSP00000319052:Q31K	Q	+	1	0	CETN1	570499	1.000000	0.71417	0.993000	0.49108	0.099000	0.18886	3.891000	0.56227	1.565000	0.49641	0.655000	0.94253	CAA		0.597	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066		16	12	1	0	1.3612e-06	0.003163	1.50571e-06	16	12				
LAMA3	3909	broad.mit.edu	37	18	21461922	21461922	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:21461922G>T	ENST00000313654.9	+	40	5376	c.5135G>T	c.(5134-5136)gGa>gTa	p.G1712V	LAMA3_ENST00000269217.6_Missense_Mutation_p.G103V|LAMA3_ENST00000587184.1_Missense_Mutation_p.G103V|LAMA3_ENST00000399516.3_Missense_Mutation_p.G1712V	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1712	Domain III A.|Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AACACCGCGGGAGAGCACTGT	0.547																																							uc002kuq.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(5134-5136)GGA>GTA		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						88.0	66.0	73.0					18																	21461922		2203	4299	6502	SO:0001583	missense	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21461922G>T	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5135G>T	18.37:g.21461922G>T	ENSP00000324532:p.Gly1712Val		Somatic				LAMA3_uc002kur.2_Missense_Mutation_p.G1712V|LAMA3_uc002kus.3_Missense_Mutation_p.G103V|LAMA3_uc002kut.3_Missense_Mutation_p.G103V	p.G1712V	NM_198129	NP_937762	WXS	Illumina HiSeq	Unspecified	Q16787	LAMA3_HUMAN			40	5221	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		1712			Domain III A.|Laminin EGF-like 13.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	c.5135G>T	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490457	0.64074	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	D;D;D	0.91945	-2.68;-2.68;-2.94	5.61	5.61	0.85477	EGF-like, laminin (4);Growth factor, receptor (1);	.	.	.	.	D	0.98115	0.9378	H	0.99090	4.425	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99486	1.0949	9	0.87932	D	0	.	19.2248	0.93814	0.0:0.0:1.0:0.0	.	103;103;1712;1712	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	V	1712;1712;103	ENSP00000324532:G1712V;ENSP00000382432:G1712V;ENSP00000269217:G103V	ENSP00000269217:G103V	G	+	2	0	LAMA3	19715920	1.000000	0.71417	0.175000	0.22980	0.165000	0.22458	8.593000	0.90832	2.660000	0.90430	0.655000	0.94253	GGA		0.547	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		10	20	1	0	1.08611e-07	0.010729	1.23092e-07	10	20				
SLC39A6	25800	broad.mit.edu	37	18	33704551	33704551	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:33704551C>A	ENST00000590986.1	-	3	1191	c.902G>T	c.(901-903)aGa>aTa	p.R301I	SLC39A6_ENST00000269187.5_Missense_Mutation_p.R301I|SLC39A6_ENST00000440549.2_Missense_Mutation_p.R26I			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	301					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						CAGACAAGATCTAGCATCAAT	0.383																																							uc010dmy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(901-903)AGA>ATA		solute carrier family 39 (zinc transporter),							139.0	127.0	131.0					18																	33704551		1899	4132	6031	SO:0001583	missense	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33704551C>A	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.902G>T	18.37:g.33704551C>A	ENSP00000465915:p.Arg301Ile		Somatic				SLC39A6_uc002kzj.2_Missense_Mutation_p.R26I	p.R301I	NM_012319	NP_036451	WXS	Illumina HiSeq	Unspecified	Q13433	S39A6_HUMAN			3	1192	-			301			Extracellular (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	ENST00000590986.1	37	c.902G>T	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113413	0.77210	.	.	ENSG00000141424	ENST00000269187;ENST00000543723;ENST00000440549	T;T	0.74632	-0.16;-0.86	5.31	4.42	0.53409	.	0.351880	0.36740	N	0.002425	T	0.78027	0.4219	L	0.60455	1.87	0.42064	D	0.991172	P;B	0.52577	0.954;0.32	P;B	0.53861	0.736;0.093	T	0.78132	-0.2323	10	0.45353	T	0.12	-15.9113	12.5262	0.56087	0.0:0.9132:0.0:0.0868	.	301;26	Q13433;Q13433-2	S39A6_HUMAN;.	I	301;26;26	ENSP00000269187:R301I;ENSP00000401139:R26I	ENSP00000269187:R301I	R	-	2	0	SLC39A6	31958549	0.911000	0.30947	1.000000	0.80357	0.974000	0.67602	2.309000	0.43699	2.642000	0.89623	0.462000	0.41574	AGA		0.383	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			19	58	1	0	1.56452e-12	0.007413	1.95112e-12	19	58				
FHOD3	80206	broad.mit.edu	37	18	34320650	34320650	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:34320650A>T	ENST00000359247.4	+	17	3032	c.3032A>T	c.(3031-3033)gAg>gTg	p.E1011V	FHOD3_ENST00000257209.4_Missense_Mutation_p.E1028V|FHOD3_ENST00000445677.1_Missense_Mutation_p.E990V|FHOD3_ENST00000590592.1_Missense_Mutation_p.E1203V|FHOD3_ENST00000592128.1_Missense_Mutation_p.E7V|FHOD3_ENST00000591635.1_Missense_Mutation_p.E224V	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1011	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACCGATGAGGAGAAGCAGAAA	0.488																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(3031-3033)GAG>GTG		formin homology 2 domain containing 3							67.0	61.0	63.0					18																	34320650		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34320650A>T	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3032A>T	18.37:g.34320650A>T	ENSP00000352186:p.Glu1011Val		Somatic				FHOD3_uc002kzs.1_Missense_Mutation_p.E1028V|FHOD3_uc010dmz.1_Missense_Mutation_p.E743V|FHOD3_uc010dnb.1_Missense_Mutation_p.E7V	p.E1011V	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			17	3129	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	1011			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.3032A>T		.	.	.	.	.	.	.	.	.	.	A	24.6	4.545422	0.86022	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.73681	-0.77;-0.77;-0.77	6.04	6.04	0.98038	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	D	0.89033	0.6600	M	0.90977	3.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.999;1.0	D	0.91247	0.5026	10	0.87932	D	0	.	15.4235	0.75031	1.0:0.0:0.0:0.0	.	232;990;1011;1028	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	V	1028;1011;990	ENSP00000257209:E1028V;ENSP00000352186:E1011V;ENSP00000411430:E990V	ENSP00000257209:E1028V	E	+	2	0	FHOD3	32574648	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	9.339000	0.96797	2.317000	0.78254	0.460000	0.39030	GAG		0.488	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		17	27	0	0	0	0.004007	0	17	27				
SOCS6	9306	broad.mit.edu	37	18	67992908	67992908	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:67992908A>T	ENST00000397942.3	+	2	1320	c.1004A>T	c.(1003-1005)cAc>cTc	p.H335L	SOCS6_ENST00000582322.1_Missense_Mutation_p.H335L	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	335					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ACAGAAGCCCACGTGGCTGAA	0.488																																					Melanoma(84;1024 1361 24382 36583 42651)	Melanoma(84;1024 1361 24382 36583 42651)	uc002lkr.1		NA																	0				large_intestine(1)|lung(1)	2						c.(1003-1005)CAC>CTC		suppressor of cytokine signaling 6							68.0	64.0	66.0					18																	67992908		2203	4300	6503	SO:0001583	missense	9306				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm		g.chr18:67992908A>T	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1004A>T	18.37:g.67992908A>T	ENSP00000381034:p.His335Leu		Somatic				SOCS6_uc010dqq.2_Missense_Mutation_p.H335L	p.H335L	NM_004232	NP_004223	WXS	Illumina HiSeq	Unspecified	O14544	SOCS6_HUMAN			2	1320	+		Esophageal squamous(42;0.129)|Colorectal(73;0.152)	335					Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	37	c.1004A>T	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	A	13.55	2.271200	0.40194	.	.	ENSG00000170677	ENST00000397942	T	0.23950	1.88	5.08	5.08	0.68730	.	0.648300	0.15336	N	0.267775	T	0.20780	0.0500	L	0.27053	0.805	0.52099	D	0.999948	P	0.35433	0.501	B	0.33042	0.157	T	0.05716	-1.0868	10	0.56958	D	0.05	-15.818	14.8756	0.70491	1.0:0.0:0.0:0.0	.	335	O14544	SOCS6_HUMAN	L	335	ENSP00000381034:H335L	ENSP00000381034:H335L	H	+	2	0	SOCS6	66143888	1.000000	0.71417	0.359000	0.25824	0.894000	0.52154	4.071000	0.57556	1.908000	0.55244	0.459000	0.35465	CAC		0.488	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2			13	42	0	0	0	0.001855	0	13	42				
FBXO15	201456	broad.mit.edu	37	18	71793305	71793305	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:71793305T>A	ENST00000419743.2	-	6	896	c.817A>T	c.(817-819)Aat>Tat	p.N273Y	FBXO15_ENST00000269500.5_Missense_Mutation_p.N197Y	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	273						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TGACTCAGATTGTACTTTGCA	0.463																																							uc002lle.2		NA																	0				ovary(2)|pancreas(1)	3						c.(589-591)AAT>TAT		F-box protein 15 isoform 1							128.0	115.0	120.0					18																	71793305		2203	4300	6503	SO:0001583	missense	201456							g.chr18:71793305T>A	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.817A>T	18.37:g.71793305T>A	ENSP00000393154:p.Asn273Tyr		Somatic				FBXO15_uc002llf.2_Missense_Mutation_p.N273Y	p.N197Y	NM_152676	NP_689889	WXS	Illumina HiSeq	Unspecified	Q8NCQ5	FBX15_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.143)	6	925	-		Esophageal squamous(42;0.103)|Prostate(75;0.173)	197					B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	c.589A>T	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	T	2.240	-0.374059	0.05034	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.44482	0.93;0.92	5.3	-4.74	0.03249	.	1.155070	0.06085	N	0.662554	T	0.22936	0.0554	N	0.22421	0.69	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.09377	0.004;0.001	T	0.22487	-1.0215	10	0.45353	T	0.12	-12.4901	2.6456	0.04983	0.1127:0.4:0.2289:0.2584	.	273;197	B3KST3;Q8NCQ5	.;FBX15_HUMAN	Y	197;273	ENSP00000269500:N197Y;ENSP00000393154:N273Y	ENSP00000269500:N197Y	N	-	1	0	FBXO15	69944285	0.000000	0.05858	0.002000	0.10522	0.063000	0.16089	-1.276000	0.02815	-0.552000	0.06167	-1.199000	0.01669	AAT		0.463	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676		27	93	0	0	0	0.008361	0	27	93				
STK11	6794	broad.mit.edu	37	19	1221261	1221261	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:1221261A>T	ENST00000326873.7	+	6	1957	c.784A>T	c.(784-786)Aag>Tag	p.K262*		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CAACATCTACAAGTTGTTTGA	0.582		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(2)|p.Y246fs*3(1)	cervix(14)|lung(5)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(784-786)AAG>TAG		serine/threonine protein kinase 11							59.0	63.0	62.0					19																	1221261		1991	4132	6123	SO:0001587	stop_gained	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221261A>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.784A>T	19.37:g.1221261A>T	ENSP00000324856:p.Lys262*	TSP Lung(3;<1E-08)	Somatic					p.K262*	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1899	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	262			Protein kinase.		B2RBX7|E7EW76	Nonsense_Mutation	SNP	ENST00000326873.7	37	c.784A>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	48	14.289125	0.99788	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	4.22	4.22	0.49857	.	0.090803	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.58	12.6335	0.56671	1.0:0.0:0.0:0.0	.	.	.	.	X	262	.	ENSP00000324856:K262X	K	+	1	0	STK11	1172261	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	8.984000	0.93482	1.770000	0.52166	0.459000	0.35465	AAG		0.582	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		12	4	0	0	0	0.001855	0	12	4				
MUC16	94025	broad.mit.edu	37	19	8999521	8999521	+	Missense_Mutation	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:8999521T>G	ENST00000397910.4	-	56	40857	c.40654A>C	c.(40654-40656)Acc>Ccc	p.T13552P	MUC16_ENST00000380951.5_Missense_Mutation_p.T193P	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13554	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGCGGTAGGTGCAGATGGCA	0.592																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(40654-40656)ACC>CCC		mucin 16							104.0	90.0	94.0					19																	8999521		1941	4144	6085	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:8999521T>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40654A>C	19.37:g.8999521T>G	ENSP00000381008:p.Thr13552Pro		Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.T369P|MUC16_uc010xki.1_RNA	p.T13552P	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			56	40858	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.40654A>C	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	13.34	2.207229	0.39003	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.71817	-0.6;-0.6	3.48	1.21	0.21127	SEA (2);	.	.	.	.	T	0.62829	0.2460	N	0.08118	0	.	.	.	D;D	0.76494	0.999;0.99	D;D	0.76071	0.95;0.987	T	0.62120	-0.6921	8	0.66056	D	0.02	-7.3668	2.649	0.04993	0.2271:0.131:0.0:0.6419	.	21197;13552	Q8WXI7;B5ME49	MUC16_HUMAN;.	P	13552;193	ENSP00000381008:T13552P;ENSP00000370338:T193P	ENSP00000370338:T193P	T	-	1	0	MUC16	8860521	0.816000	0.29132	0.094000	0.20943	0.065000	0.16274	1.454000	0.35178	0.070000	0.16634	0.454000	0.30748	ACC		0.592	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		62	32	0	0	0	0.01441	0	62	32				
KEAP1	9817	broad.mit.edu	37	19	10602746	10602746	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:10602746G>A	ENST00000171111.5	-	3	1379	c.832C>T	c.(832-834)Ccg>Tcg	p.P278S	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR|KEAP1_ENST00000393623.2_Missense_Mutation_p.P278S	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	278	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AGGAAGTTCGGCGTCAACGAG	0.612																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(832-834)CCG>TCG		kelch-like ECH-associated protein 1							61.0	60.0	61.0					19																	10602746		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602746G>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.832C>T	19.37:g.10602746G>A	ENSP00000171111:p.Pro278Ser		Somatic				KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.P278S	p.P278S	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	988	-			278			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.832C>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048627	0.93740	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.70164	-0.46;-0.46	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.78477	0.4289	L	0.52905	1.665	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.79838	-0.1634	10	0.87932	D	0	.	17.1459	0.86766	0.0:0.0:1.0:0.0	.	278	Q14145	KEAP1_HUMAN	S	278	ENSP00000171111:P278S;ENSP00000377245:P278S	ENSP00000171111:P278S	P	-	1	0	KEAP1	10463746	1.000000	0.71417	0.962000	0.40283	0.990000	0.78478	5.314000	0.65804	2.656000	0.90262	0.561000	0.74099	CCG		0.612	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		35	20	0	0	0	0.003755	0	35	20				
AKAP8	10270	broad.mit.edu	37	19	15484083	15484083	+	Missense_Mutation	SNP	C	C	A	rs199551594		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:15484083C>A	ENST00000269701.2	-	5	500	c.440G>T	c.(439-441)cGc>cTc	p.R147L		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	147					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R147H(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GTAGCTGGGGCGGTAGGGGTT	0.642																																					GBM(190;1671 2163 3274 27186 30476)	GBM(190;1671 2163 3274 27186 30476)	uc002nav.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(1)|breast(1)	2						c.(439-441)CGC>CTC		A-kinase anchor protein 8							26.0	31.0	29.0					19																	15484083		2203	4300	6503	SO:0001583	missense	10270				signal transduction	nuclear matrix		g.chr19:15484083C>A	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.440G>T	19.37:g.15484083C>A	ENSP00000269701:p.Arg147Leu		Somatic				AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_5'UTR	p.R147L	NM_005858	NP_005849	WXS	Illumina HiSeq	Unspecified	O43823	AKAP8_HUMAN			5	501	-			147						Missense_Mutation	SNP	ENST00000269701.2	37	c.440G>T	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	c	17.33	3.363137	0.61513	.	.	ENSG00000105127	ENST00000269701	T	0.60920	0.15	4.82	2.61	0.31194	.	0.000000	0.49305	D	0.000143	T	0.65903	0.2736	M	0.72894	2.215	0.80722	D	1	D	0.64830	0.994	P	0.57911	0.829	T	0.67760	-0.5587	10	0.87932	D	0	-20.4218	7.6915	0.28571	0.0:0.7886:0.0:0.2114	.	147	O43823	AKAP8_HUMAN	L	147	ENSP00000269701:R147L	ENSP00000269701:R147L	R	-	2	0	AKAP8	15345083	0.983000	0.35010	0.997000	0.53966	0.539000	0.34962	2.285000	0.43487	1.100000	0.41517	0.651000	0.88453	CGC		0.642	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858		29	20	1	0	1.88708e-17	0.008361	2.57185e-17	29	20				
NDUFA13	51079	broad.mit.edu	37	19	19626988	19626988	+	5'UTR	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:19626988A>G	ENST00000507754.4	+	0	425				NDUFA13_ENST00000252576.5_Missense_Mutation_p.I64V|TSSK6_ENST00000360913.3_5'Flank|TSSK6_ENST00000585580.3_5'Flank|NDUFA13_ENST00000428459.2_5'Flank|NDUFA13_ENST00000503283.1_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|NDUFA13_ENST00000512771.3_5'Flank|YJEFN3_ENST00000608404.1_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						CGCCACACTCATCATGGCGGT	0.632																																							uc010xqy.1		NA																	0					0						c.(190-192)ATC>GTC		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						44.0	44.0	44.0					19																	19626988		2203	4300	6503	SO:0001623	5_prime_UTR_variant	51079				apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding	g.chr19:19626988A>G	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.-60A>G	19.37:g.19626988A>G			Somatic				TSSK6_uc002nmq.2_5'Flank|TSSK6_uc002nmr.2_5'Flank|NDUFA13_uc002nms.2_Missense_Mutation_p.I64V|NDUFA13_uc010xqx.1_Missense_Mutation_p.I64V	p.I64V	NM_015965	NP_057049	WXS	Illumina HiSeq	Unspecified	Q9P0J0	NDUAD_HUMAN			1	449	+			Error:Variant_position_missing_in_Q9P0J0_after_alignment					B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	ENST00000507754.4	37	c.190A>G	CCDS12404.2	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187374	0.57909	.	.	ENSG00000186010	ENST00000252576	T	0.79554	-1.28	5.3	-7.48	0.01360	.	.	.	.	.	T	0.60077	0.2241	.	.	.	0.19775	N	0.999953	.	.	.	.	.	.	T	0.51764	-0.8664	6	0.28530	T	0.3	.	0.9583	0.01390	0.1707:0.3195:0.2356:0.2741	.	.	.	.	V	64	ENSP00000252576:I64V	ENSP00000252576:I64V	I	+	1	0	NDUFA13	19487988	0.001000	0.12720	0.005000	0.12908	0.532000	0.34746	0.005000	0.13129	-0.997000	0.03450	-1.175000	0.01729	ATC		0.632	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965		4	43	0	0	0	0.009096	0	4	43				
ZNF536	9745	broad.mit.edu	37	19	31040381	31040381	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:31040381C>T	ENST00000355537.3	+	4	4002	c.3855C>T	c.(3853-3855)agC>agT	p.S1285S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1285					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TTGCAAGTAGCACAGCAAATT	0.493																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3853-3855)AGC>AGT		zinc finger protein 536							51.0	50.0	50.0					19																	31040381		2182	4236	6418	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040381C>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3855C>T	19.37:g.31040381C>T			Somatic				ZNF536_uc010edd.1_Silent_p.S1285S	p.S1285S	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3993	+	Esophageal squamous(110;0.0834)		1285					A2RU18	Silent	SNP	ENST00000355537.3	37	c.3855C>T	CCDS32984.1																																																																																				0.493	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		41	59	0	0	0	0.00874	0	41	59				
ZNF607	84775	broad.mit.edu	37	19	38189117	38189117	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:38189117G>T	ENST00000355202.4	-	5	2510	c.1915C>A	c.(1915-1917)Cat>Aat	p.H639N	CTD-2528L19.4_ENST00000586606.2_Intron|ZNF607_ENST00000395835.3_Missense_Mutation_p.H638N	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	639					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CCATCAGCATGAACGCTTTCA	0.378																																							uc002ohc.1		NA																	0					0						c.(1915-1917)CAT>AAT		zinc finger protein 607							103.0	96.0	98.0					19																	38189117		2203	4300	6503	SO:0001583	missense	84775				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38189117G>T	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1915C>A	19.37:g.38189117G>T	ENSP00000347338:p.His639Asn		Somatic				ZNF607_uc002ohb.1_Missense_Mutation_p.H638N	p.H639N	NM_032689	NP_116078	WXS	Illumina HiSeq	Unspecified	Q96SK3	ZN607_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)		5	2511	-			639			C2H2-type 18.		F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	37	c.1915C>A	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.641717	0.29157	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.28895	1.59;1.59	1.76	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61800	0.2376	H	0.95745	3.715	0.25392	N	0.988519	D;D	0.89917	0.995;1.0	D;D	0.91635	0.946;0.999	T	0.49485	-0.8935	9	0.72032	D	0.01	.	6.0734	0.19901	0.1778:0.0:0.8222:0.0	.	639;638	Q96SK3;F5H141	ZN607_HUMAN;.	N	639;638	ENSP00000347338:H639N;ENSP00000438015:H638N	ENSP00000347338:H639N	H	-	1	0	ZNF607	42880957	1.000000	0.71417	0.052000	0.19188	0.040000	0.13550	5.690000	0.68241	0.955000	0.37878	0.462000	0.41574	CAT		0.378	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689		61	67	1	0	1.45723e-30	0.01441	2.1298e-30	61	67				
CLPTM1	1209	broad.mit.edu	37	19	45488522	45488522	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:45488522G>T	ENST00000337392.5	+	6	783	c.633G>T	c.(631-633)ctG>ctT	p.L211L	CLPTM1_ENST00000541297.2_Silent_p.L197L|CLPTM1_ENST00000546079.1_Silent_p.L109L|CLPTM1_ENST00000589158.1_3'UTR	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	211					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		CCAAGAACCTGCTGACAGGAG	0.542																																							uc002pai.2		NA																	0				ovary(1)	1						c.(631-633)CTG>CTT		cleft lip and palate associated transmembrane							103.0	96.0	99.0					19																	45488522		2203	4300	6503	SO:0001819	synonymous_variant	1209				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane		g.chr19:45488522G>T	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.633G>T	19.37:g.45488522G>T			Somatic				CLPTM1_uc010ejv.1_Silent_p.L109L|CLPTM1_uc010xxf.1_Silent_p.L109L|CLPTM1_uc010xxg.1_Silent_p.L197L	p.L211L	NM_001294	NP_001285	WXS	Illumina HiSeq	Unspecified	O96005	CLPT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)	6	648	+		all_neural(266;0.224)|Ovarian(192;0.231)	211			Extracellular (Potential).		B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	ENST00000337392.5	37	c.633G>T	CCDS12651.1																																																																																				0.542	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294		9	10	1	0	3.86212e-05	0.008291	4.20022e-05	9	10				
PLA2G4C	8605	broad.mit.edu	37	19	48602932	48602932	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:48602932C>A	ENST00000599921.1	-	5	800	c.443G>T	c.(442-444)aGa>aTa	p.R148I	PLA2G4C_ENST00000354276.3_Missense_Mutation_p.R148I|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.R148I|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.R158I			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	148	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.		R -> G (in dbSNP:rs2307282). {ECO:0000269|Ref.3}.		arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		ACTTACTTCTCTGGTTTGCTT	0.522																																							uc002phx.2		NA																	0				ovary(1)|skin(1)	2						c.(442-444)AGA>ATA		phospholipase A2, group IVC isoform 1 precursor							101.0	97.0	99.0					19																	48602932		2203	4300	6503	SO:0001583	missense	8605				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding	g.chr19:48602932C>A	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.443G>T	19.37:g.48602932C>A	ENSP00000469473:p.Arg148Ile		Somatic				PLA2G4C_uc002phw.2_Missense_Mutation_p.R83I|PLA2G4C_uc010elr.2_Missense_Mutation_p.R148I|PLA2G4C_uc010xzd.1_Missense_Mutation_p.R158I|PLA2G4C_uc002phy.3_Missense_Mutation_p.R148I	p.R148I	NM_003706	NP_003697	WXS	Illumina HiSeq	Unspecified	Q9UP65	PA24C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)	5	841	-		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)	148			PLA2c.		B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	c.443G>T	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613085	0.66672	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.04454	3.62;3.62	3.17	2.07	0.26955	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.158082	0.39985	U	0.001218	T	0.11707	0.0285	L	0.51422	1.61	0.21915	N	0.999476	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.982;0.982	T	0.02736	-1.1117	10	0.45353	T	0.12	-15.3518	6.8501	0.24010	0.0:0.8458:0.0:0.1542	.	158;148;148	B4DI40;Q8WWC5;Q9UP65	.;.;PA24C_HUMAN	I	148	ENSP00000346228:R148I;ENSP00000400036:R148I	ENSP00000346228:R148I	R	-	2	0	PLA2G4C	53294744	0.942000	0.31987	0.479000	0.27329	0.657000	0.38888	0.901000	0.28445	1.477000	0.48234	0.411000	0.27672	AGA		0.522	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			48	18	1	0	5.2432e-18	0.01441	7.23741e-18	48	18				
RASIP1	54922	broad.mit.edu	37	19	49224080	49224080	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:49224080C>T	ENST00000222145.4	-	12	3071	c.2867G>A	c.(2866-2868)gGg>gAg	p.G956E	MAMSTR_ENST00000419611.1_5'Flank|MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000318083.6_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	956					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CACGGGAGGCCCATGGCGATA	0.612																																							uc002pki.2		NA																	0				pancreas(1)	1						c.(2866-2868)GGG>GAG		Ras-interacting protein 1							95.0	99.0	98.0					19																	49224080		2203	4300	6503	SO:0001583	missense	54922				signal transduction	Golgi stack|perinuclear region of cytoplasm		g.chr19:49224080C>T	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2867G>A	19.37:g.49224080C>T	ENSP00000222145:p.Gly956Glu		Somatic				MAMSTR_uc002pkg.2_5'Flank|RASIP1_uc002pkh.2_Missense_Mutation_p.G217E	p.G956E	NM_017805	NP_060275	WXS	Illumina HiSeq	Unspecified	Q5U651	RAIN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)	12	3064	-		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	956					Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	c.2867G>A	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304343	0.81136	.	.	ENSG00000105538	ENST00000222145	T	0.23754	1.89	5.5	4.41	0.53225	.	0.260995	0.30667	N	0.009134	T	0.31451	0.0797	N	0.22421	0.69	0.41158	D	0.986078	D	0.63880	0.993	P	0.59643	0.861	T	0.05338	-1.0891	10	0.87932	D	0	-7.4539	12.9531	0.58411	0.0:0.8368:0.1632:0.0	.	956	Q5U651	RAIN_HUMAN	E	956	ENSP00000222145:G956E	ENSP00000222145:G956E	G	-	2	0	RASIP1	53915892	1.000000	0.71417	0.999000	0.59377	0.750000	0.42670	3.078000	0.50096	2.771000	0.95319	0.655000	0.94253	GGG		0.612	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805		95	44	0	0	0	0.01441	0	95	44				
ZNF835	90485	broad.mit.edu	37	19	57176448	57176448	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:57176448A>T	ENST00000537055.2	-	2	350	c.119T>A	c.(118-120)gTg>gAg	p.V40E		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	40					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CTTGCAGGCCACGGCCTCTGG	0.597																																							uc010ygo.1		NA																	0		p.V62V(1)		pancreas(3)|skin(1)	4						c.(184-186)GTG>GAG		zinc finger protein 835							77.0	83.0	81.0					19																	57176448		2010	4172	6182	SO:0001583	missense	90485							g.chr19:57176448A>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.119T>A	19.37:g.57176448A>T	ENSP00000444747:p.Val40Glu		Somatic				ZNF835_uc010ygn.1_Missense_Mutation_p.V40E	p.V62E	NM_001005850	NP_001005850	WXS	Illumina HiSeq	Unspecified					2	185	-								B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	c.185T>A	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	8.478	0.859207	0.17178	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.07444	3.19	2.16	-4.32	0.03688	.	.	.	.	.	T	0.04182	0.0116	N	0.19112	0.55	0.09310	N	1	B	0.28128	0.201	B	0.20767	0.031	T	0.34625	-0.9821	9	0.56958	D	0.05	.	3.9673	0.09437	0.5695:0.0:0.2521:0.1784	.	62	Q9Y2P0	ZN835_HUMAN	E	62;40	ENSP00000444747:V40E	ENSP00000341756:V62E	V	-	2	0	ZNF835	61868260	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.181000	0.03085	-1.387000	0.02095	-0.441000	0.05720	GTG		0.597	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		22	14	0	0	0	0.014323	0	22	14				
SULT1C3	442038	broad.mit.edu	37	2	108881780	108881780	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:108881780C>A	ENST00000329106.2	+	7	888	c.888C>A	c.(886-888)agC>agA	p.S296R		NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	296					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						TGGCAGGAAGCACCCTAACCT	0.463																																							uc010ywo.1		NA																	0				skin(1)	1						c.(886-888)AGC>AGA		sulfotransferase family, cytosolic, 1C, member							109.0	102.0	105.0					2																	108881780		2203	4300	6503	SO:0001583	missense	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108881780C>A	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.888C>A	2.37:g.108881780C>A	ENSP00000333310:p.Ser296Arg		Somatic					p.S296R	NM_001008743	NP_001008743	WXS	Illumina HiSeq	Unspecified	Q6IMI6	ST1C3_HUMAN			7	888	+			296					Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	37	c.888C>A	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.803051	0.50315	.	.	ENSG00000196228	ENST00000329106	T	0.01902	4.57	5.11	1.31	0.21738	Sulfotransferase domain (1);	0.369863	0.25909	N	0.027518	T	0.07188	0.0182	M	0.82517	2.595	0.09310	N	0.999999	D	0.56521	0.976	P	0.55785	0.784	T	0.14504	-1.0470	10	0.72032	D	0.01	.	4.6222	0.12461	0.1416:0.5584:0.0:0.3	.	296	Q6IMI6	ST1C3_HUMAN	R	296	ENSP00000333310:S296R	ENSP00000333310:S296R	S	+	3	2	SULT1C3	108248212	0.000000	0.05858	0.003000	0.11579	0.829000	0.46940	0.025000	0.13577	0.054000	0.16065	-0.150000	0.13652	AGC		0.463	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		18	43	1	0	9.16793e-09	0.00499	1.06138e-08	18	43				
PSD4	23550	broad.mit.edu	37	2	113955142	113955142	+	Splice_Site	SNP	G	G	A	rs368488108		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:113955142G>A	ENST00000245796.6	+	13	2583	c.2388G>A	c.(2386-2388)acG>acA	p.T796T	PSD4_ENST00000441564.3_Splice_Site_p.T768T	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	796	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGGAACAGCGCCATGGGGCA	0.547																																							uc002tjc.2		NA																	0				ovary(2)	2						c.(2386-2388)ACG>ACA		pleckstrin and Sec7 domain containing 4							92.0	76.0	82.0					2																	113955142		2203	4300	6503	SO:0001630	splice_region_variant	23550				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity	g.chr2:113955142G>A	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2387-1G>A	2.37:g.113955142G>A			Somatic				PSD4_uc002tjd.2_Silent_p.T417T|PSD4_uc002tje.2_Silent_p.T767T|PSD4_uc002tjf.2_Silent_p.T417T|PSD4_uc002tjg.2_5'UTR|PSD4_uc010yxs.1_Silent_p.A27A|PSD4_uc002tjh.2_5'Flank	p.T796T	NM_012455	NP_036587	WXS	Illumina HiSeq	Unspecified	Q8NDX1	PSD4_HUMAN			13	2571	+			796			PH.		A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	ENST00000245796.6	37	c.2388G>A	CCDS33276.1																																																																																				0.547	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	Silent	20	28	0	0	0	0.014323	0	20	28				
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	RNA	SNP	C	C	G	rs17857355	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:114355998C>G	ENST00000538033.2	+	0	2178							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCAAGGTGGGCACTTGATGTC	0.612																																							uc002tkh.2		NA																	0					0						c.(616-618)CAC>GAC		WAS protein family homolog 1																																						375260							g.chr2:114355998C>G			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355998C>G			Somatic				WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	p.H206D	NM_182905	NP_878908	WXS	Illumina HiSeq	Unspecified					5	674	+									Missense_Mutation	SNP	ENST00000538033.2	37	c.616C>G																																																																																					0.612	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1	NM_198943		5	10	0	0	0	0.000602	0	5	10				
GPR148	344561	broad.mit.edu	37	2	131486911	131486911	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:131486911A>T	ENST00000309926.4	+	1	269	c.187A>T	c.(187-189)Aca>Tca	p.T63S		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					GGCTGCAGCCACACTGGCTGT	0.632																																							uc002trv.1		NA																	0				skin(1)	1						c.(187-189)ACA>TCA		G protein-coupled receptor 148							58.0	55.0	56.0					2																	131486911		2203	4300	6503	SO:0001583	missense	344561					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr2:131486911A>T	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.187A>T	2.37:g.131486911A>T	ENSP00000308908:p.Thr63Ser		Somatic					p.T63S	NM_207364	NP_997247	WXS	Illumina HiSeq	Unspecified	Q8TDV2	GP148_HUMAN			1	189	+	Colorectal(110;0.1)		63			Helical; Name=1; (Potential).		Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	37	c.187A>T	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	5.159	0.214942	0.09810	.	.	ENSG00000173302	ENST00000309926	T	0.37058	1.22	2.97	1.77	0.24775	.	0.097576	0.38837	U	0.001545	T	0.14787	0.0357	N	0.08118	0	0.19775	N	0.99996	P	0.43750	0.816	B	0.36719	0.231	T	0.11567	-1.0582	10	0.42905	T	0.14	-3.098	6.6385	0.22897	0.8704:0.0:0.1296:0.0	.	63	Q8TDV2	GP148_HUMAN	S	63	ENSP00000308908:T63S	ENSP00000308908:T63S	T	+	1	0	GPR148	131203381	0.780000	0.28664	0.006000	0.13384	0.388000	0.30384	2.676000	0.46883	0.328000	0.23435	0.379000	0.24179	ACA		0.632	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092		32	36	0	0	0	0.012213	0	32	36				
NCKAP5	344148	broad.mit.edu	37	2	133636466	133636466	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:133636466C>G	ENST00000409261.1	-	9	976	c.603G>C	c.(601-603)ttG>ttC	p.L201F	NCKAP5_ENST00000409213.1_Missense_Mutation_p.L201F|NCKAP5_ENST00000317721.6_Missense_Mutation_p.L201F|NCKAP5_ENST00000405974.3_Missense_Mutation_p.L201F	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	201										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTTCATTCTCCAAAGCCAACG	0.403																																							uc002ttp.2		NA																	0					0						c.(601-603)TTG>TTC		Nck-associated protein 5 isoform 1							172.0	161.0	165.0					2																	133636466		1977	4148	6125	SO:0001583	missense	344148						protein binding	g.chr2:133636466C>G	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.603G>C	2.37:g.133636466C>G	ENSP00000387128:p.Leu201Phe		Somatic				NCKAP5_uc002ttq.2_Missense_Mutation_p.L201F	p.L201F	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			9	977	-			201			Potential.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.603G>C	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077839	0.55753	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.51574	2.68;0.7;2.68;0.7	5.53	4.66	0.58398	.	0.000000	0.25208	U	0.032328	T	0.58409	0.2120	L	0.40543	1.245	0.29252	N	0.871893	D;P	0.76494	0.999;0.547	D;B	0.72075	0.976;0.347	T	0.57429	-0.7813	10	0.56958	D	0.05	.	12.9079	0.58162	0.0:0.9247:0.0:0.0753	.	201;201	O14513-2;O14513	.;NCKP5_HUMAN	F	201	ENSP00000387128:L201F;ENSP00000386952:L201F;ENSP00000380603:L201F;ENSP00000385692:L201F	ENSP00000380603:L201F	L	-	3	2	NCKAP5	133352936	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	2.900000	0.48687	1.364000	0.46038	-0.254000	0.11334	TTG		0.403	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		18	51	0	0	0	0.006122	0	18	51				
LCT	3938	broad.mit.edu	37	2	136562352	136562352	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:136562352G>A	ENST00000264162.2	-	10	4459	c.4449C>T	c.(4447-4449)gcC>gcT	p.A1483A		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1483	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCTGGATGCTGGCGGCCAGCA	0.562																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(4447-4449)GCC>GCT		lactase-phlorizin hydrolase preproprotein							52.0	56.0	54.0					2																	136562352		2203	4300	6503	SO:0001819	synonymous_variant	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136562352G>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4449C>T	2.37:g.136562352G>A			Somatic					p.A1483A	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	10	4460	-			1483			Extracellular (Potential).|4.|4 X approximate repeats.		Q4ZG58	Silent	SNP	ENST00000264162.2	37	c.4449C>T	CCDS2178.1																																																																																				0.562	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		14	51	0	0	0	0.004007	0	14	51				
LRP1B	53353	broad.mit.edu	37	2	141294160	141294160	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:141294160C>A	ENST00000389484.3	-	46	8603	c.7632G>T	c.(7630-7632)ctG>ctT	p.L2544L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2544	LDL-receptor class A 11. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAGTAGAGCAGTTTTTCAT	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(7630-7632)CTG>CTT		low density lipoprotein-related protein 1B							155.0	155.0	155.0					2																	141294160		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141294160C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7632G>T	2.37:g.141294160C>A		TSP Lung(27;0.18)	Somatic					p.L2544L	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	46	8604	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2544			Extracellular (Potential).|LDL-receptor class A 11.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.7632G>T	CCDS2182.1																																																																																				0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		51	65	1	0	4.86159e-25	0.01441	6.9176e-25	51	65				
DLX2	1746	broad.mit.edu	37	2	172965613	172965613	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:172965613C>G	ENST00000234198.4	-	3	1006	c.645G>C	c.(643-645)gaG>gaC	p.E215D	AC104801.1_ENST00000448117.1_lincRNA|DLX2_ENST00000466293.2_3'UTR	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	215					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCGAGGGGATCTCACCACTTT	0.577																																					GBM(188;775 2993 11256 23072)	GBM(188;775 2993 11256 23072)	uc002uhn.2		NA																	0				ovary(1)	1						c.(643-645)GAG>GAC		distal-less homeobox 2							34.0	34.0	34.0					2																	172965613		2171	4210	6381	SO:0001583	missense	1746					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:172965613C>G	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.645G>C	2.37:g.172965613C>G	ENSP00000234198:p.Glu215Asp		Somatic					p.E215D	NM_004405	NP_004396	WXS	Illumina HiSeq	Unspecified	Q07687	DLX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		3	857	-			215					B4DMK4|B7ZA14	Missense_Mutation	SNP	ENST00000234198.4	37	c.645G>C	CCDS2248.1	.	.	.	.	.	.	.	.	.	.	c	25.5	4.642501	0.87859	.	.	ENSG00000115844	ENST00000234198	D	0.90844	-2.74	4.8	4.8	0.61643	Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.95159	0.8280	10	0.54805	T	0.06	-23.0204	17.4517	0.87594	0.0:1.0:0.0:0.0	.	215	Q07687	DLX2_HUMAN	D	215	ENSP00000234198:E215D	ENSP00000234198:E215D	E	-	3	2	DLX2	172673859	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	2.998000	0.49465	2.196000	0.70406	0.457000	0.33378	GAG		0.577	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255368.3			8	39	0	0	0	0.00308	0	8	39				
WIPF1	7456	broad.mit.edu	37	2	175437061	175437061	+	Silent	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:175437061T>G	ENST00000392547.2	-	5	571	c.472A>C	c.(472-474)Aga>Cga	p.R158R	AC010894.5_ENST00000454203.1_RNA|WIPF1_ENST00000359761.3_Silent_p.R158R|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000409891.1_Silent_p.R158R|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000392546.2_Silent_p.R158R|WIPF1_ENST00000272746.5_Silent_p.R158R|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409415.3_Silent_p.R158R	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	158					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGACCACTTCTGTGGCCTGGA	0.602																																							uc002uiy.2		NA																	0				ovary(1)|skin(1)	2						c.(472-474)AGA>CGA		WAS/WASL interacting protein family, member 1							45.0	52.0	49.0					2																	175437061		2203	4300	6503	SO:0001819	synonymous_variant	7456				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding	g.chr2:175437061T>G	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.472A>C	2.37:g.175437061T>G			Somatic				uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Silent_p.R158R|WIPF1_uc010fqt.1_Silent_p.R158R|WIPF1_uc002ujc.1_Silent_p.R158R|WIPF1_uc002uiz.2_Silent_p.R158R|WIPF1_uc002ujb.1_Silent_p.R158R|WIPF1_uc010zep.1_Silent_p.R158R	p.R158R	NM_003387	NP_003378	WXS	Illumina HiSeq	Unspecified	O43516	WIPF1_HUMAN			6	804	-			158					B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Silent	SNP	ENST00000392547.2	37	c.472A>C	CCDS2260.1																																																																																				0.602	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387		18	64	0	0	0	0.006122	0	18	64				
TTN	7273	broad.mit.edu	37	2	179396045	179396045	+	Silent	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:179396045A>T	ENST00000591111.1	-	308	100598	c.100374T>A	c.(100372-100374)tcT>tcA	p.S33458S	TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.S26159S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Silent_p.S35099S|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.S26034S|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Silent_p.S32531S|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000342175.6_Silent_p.S26226S|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000450692.2_RNA			Q8WZ42	TITIN_HUMAN	titin	33458					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCAGATGCAGAGTGTTCAT	0.408																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(97591-97593)TCT>TCA		titin isoform N2-A							112.0	115.0	114.0					2																	179396045		1890	4115	6005	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179396045A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100374T>A	2.37:g.179396045A>T			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.S26226S|TTN_uc010zfi.1_Silent_p.S26159S|TTN_uc010zfj.1_Silent_p.S26034S|TTN_uc002umq.2_5'Flank	p.S32531S	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	97817	-			33458					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.97593T>A																																																																																					0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		61	70	0	0	0	0.01441	0	61	70				
TTN	7273	broad.mit.edu	37	2	179584097	179584097	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:179584097C>A	ENST00000591111.1	-	81	23293	c.23069G>T	c.(23068-23070)cGa>cTa	p.R7690L	TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.R8007L|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.R6763L|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13234	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCAGAGACTCGGCACTCCAA	0.517																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(20287-20289)CGA>CTA		titin isoform N2-A							93.0	96.0	95.0					2																	179584097		1905	4120	6025	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179584097C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23069G>T	2.37:g.179584097C>A	ENSP00000465570:p.Arg7690Leu		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R3424L	p.R6763L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		80	20512	-			7690					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.20288G>T		.	.	.	.	.	.	.	.	.	.	C	7.615	0.675571	0.14841	.	.	ENSG00000155657	ENST00000342992	T	0.68025	-0.3	6.08	3.24	0.37175	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50922	0.1644	L	0.35593	1.075	0.80722	D	1	P	0.37038	0.579	B	0.35550	0.205	T	0.51624	-0.8682	9	0.87932	D	0	.	6.0707	0.19887	0.0:0.5178:0.0:0.4822	.	7690	Q8WZ42	TITIN_HUMAN	L	6763	ENSP00000343764:R6763L	ENSP00000343764:R6763L	R	-	2	0	TTN	179292342	1.000000	0.71417	0.948000	0.38648	0.220000	0.24768	3.988000	0.56951	0.848000	0.35191	-0.136000	0.14681	CGA		0.517	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		31	95	1	0	1.08312e-15	0.009535	1.44565e-15	31	95				
ZNF804A	91752	broad.mit.edu	37	2	185801006	185801006	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:185801006G>T	ENST00000302277.6	+	4	1477	c.883G>T	c.(883-885)Gag>Tag	p.E295*		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	295							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TCAAACTCAAGAGATAAAAGA	0.348																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(883-885)GAG>TAG		zinc finger protein 804A							41.0	39.0	40.0					2																	185801006		2202	4297	6499	SO:0001587	stop_gained	91752					intracellular	zinc ion binding	g.chr2:185801006G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.883G>T	2.37:g.185801006G>T	ENSP00000303252:p.Glu295*		Somatic					p.E295*	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1477	+			295					A7E253|Q6ZN26	Nonsense_Mutation	SNP	ENST00000302277.6	37	c.883G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	41	8.676548	0.98910	.	.	ENSG00000170396	ENST00000302277	.	.	.	5.57	5.57	0.84162	.	0.499688	0.18169	N	0.149513	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-17.9014	18.5367	0.91013	0.0:0.0:1.0:0.0	.	.	.	.	X	295	.	ENSP00000303252:E295X	E	+	1	0	ZNF804A	185509251	1.000000	0.71417	0.942000	0.38095	0.900000	0.52787	6.475000	0.73582	2.609000	0.88269	0.591000	0.81541	GAG		0.348	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		38	34	1	0	1.36161e-19	0.004289	1.9039e-19	38	34				
FAM171B	165215	broad.mit.edu	37	2	187627263	187627263	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:187627263C>T	ENST00000304698.5	+	8	2397	c.2194C>T	c.(2194-2196)Cag>Tag	p.Q732*		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	732						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AAGCATGCATCAGCCCAAGAT	0.483																																							uc002ups.2		NA																	0				ovary(6)|breast(3)|central_nervous_system(1)	10						c.(2194-2196)CAG>TAG		KIAA1946							85.0	90.0	88.0					2																	187627263		2203	4300	6503	SO:0001587	stop_gained	165215					integral to membrane	DNA binding	g.chr2:187627263C>T	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2194C>T	2.37:g.187627263C>T	ENSP00000304108:p.Gln732*		Somatic				FAM171B_uc002upr.1_Nonsense_Mutation_p.Q699*|FAM171B_uc002upt.2_Nonsense_Mutation_p.Q201*	p.Q732*	NM_177454	NP_803237	WXS	Illumina HiSeq	Unspecified	Q6P995	F171B_HUMAN			8	2306	+			732			Cytoplasmic (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Nonsense_Mutation	SNP	ENST00000304698.5	37	c.2194C>T	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	C	38	7.229336	0.98150	.	.	ENSG00000144369	ENST00000304698	.	.	.	6.02	6.02	0.97574	.	0.275032	0.37483	N	0.002061	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-7.4829	20.547	0.99278	0.0:1.0:0.0:0.0	.	.	.	.	X	732	.	ENSP00000304108:Q732X	Q	+	1	0	FAM171B	187335508	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	3.760000	0.55235	2.850000	0.98022	0.650000	0.86243	CAG		0.483	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		5	85	0	0	0	0.000602	0	5	85				
MARS2	92935	broad.mit.edu	37	2	198570930	198570930	+	Silent	SNP	G	G	T	rs144114997		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:198570930G>T	ENST00000282276.6	+	1	844	c.801G>T	c.(799-801)ccG>ccT	p.P267P	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	267					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GGGGCATTCCGGTGCCCGGGG	0.547																																							uc002uuq.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(799-801)CCG>CCT		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						65.0	65.0	65.0					2																	198570930		2203	4300	6503	SO:0001819	synonymous_variant	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198570930G>T	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.801G>T	2.37:g.198570930G>T			Somatic				uc002uup.2_Intron	p.P267P	NM_138395	NP_612404	WXS	Illumina HiSeq	Unspecified	Q96GW9	SYMM_HUMAN			1	844	+			267					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	ENST00000282276.6	37	c.801G>T	CCDS33358.1																																																																																				0.547	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		31	52	1	0	2.61193e-14	0.009535	3.37462e-14	31	52				
SGOL2	151246	broad.mit.edu	37	2	201436615	201436615	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:201436615G>C	ENST00000357799.4	+	7	1644	c.1546G>C	c.(1546-1548)Gag>Cag	p.E516Q		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	516					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						ATTTCACCAGGAGAGTAAATT	0.313																																							uc002uvw.2		NA																	0				ovary(2)|skin(2)	4						c.(1546-1548)GAG>CAG		shugoshin-like 2 isoform 1							82.0	83.0	83.0					2																	201436615		1796	4061	5857	SO:0001583	missense	151246				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding	g.chr2:201436615G>C	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1546G>C	2.37:g.201436615G>C	ENSP00000350447:p.Glu516Gln		Somatic				SGOL2_uc010zhd.1_Missense_Mutation_p.E516Q|SGOL2_uc010zhe.1_Missense_Mutation_p.E516Q	p.E516Q	NM_152524	NP_689737	WXS	Illumina HiSeq	Unspecified	Q562F6	SGOL2_HUMAN			7	1659	+			516					Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	c.1546G>C	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638450	0.47153	.	.	ENSG00000163535	ENST00000357799	T	0.46451	0.87	5.25	3.45	0.39498	.	0.501323	0.18794	N	0.130975	T	0.44705	0.1306	L	0.44542	1.39	0.58432	D	0.999998	D;D;D	0.56746	0.977;0.977;0.977	P;P;P	0.53593	0.73;0.73;0.73	T	0.35500	-0.9786	10	0.62326	D	0.03	-2.6187	8.3665	0.32389	0.2608:0.0:0.7392:0.0	.	516;516;516	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	Q	516	ENSP00000350447:E516Q	ENSP00000350447:E516Q	E	+	1	0	SGOL2	201144860	0.046000	0.20272	0.238000	0.24106	0.864000	0.49448	0.996000	0.29719	0.903000	0.36546	0.585000	0.79938	GAG		0.313	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524		48	51	0	0	0	0.01441	0	48	51				
RQCD1	9125	broad.mit.edu	37	2	219452361	219452361	+	Silent	SNP	A	A	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:219452361A>C	ENST00000273064.6	+	5	858	c.483A>C	c.(481-483)acA>acC	p.T161T	RQCD1_ENST00000295701.5_Silent_p.T161T|RQCD1_ENST00000509807.2_Silent_p.T193T|RQCD1_ENST00000542068.1_Silent_p.T161T|RNU6-136P_ENST00000384663.1_RNA	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	161					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATTAACAACAGAAATTATCC	0.303																																							uc010zkh.1		NA																	0				ovary(1)|skin(1)	2						c.(481-483)ACA>ACC		RCD1 required for cell differentiation1 homolog							97.0	100.0	99.0					2																	219452361		2202	4299	6501	SO:0001819	synonymous_variant	9125				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	g.chr2:219452361A>C	D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.483A>C	2.37:g.219452361A>C			Somatic				RQCD1_uc002vih.1_Silent_p.T161T|RQCD1_uc010zki.1_Silent_p.T193T	p.T161T	NM_005444	NP_005435	WXS	Illumina HiSeq	Unspecified	Q92600	RCD1_HUMAN		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	5	483	+		Renal(207;0.0915)	161					B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Silent	SNP	ENST00000273064.6	37	c.483A>C	CCDS33379.1																																																																																				0.303	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336920.1	NM_005444		9	17	0	0	0	0.006214	0	9	17				
OBSL1	23363	broad.mit.edu	37	2	220432677	220432677	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:220432677G>A	ENST00000404537.1	-	3	1353	c.1297C>T	c.(1297-1299)Cgc>Tgc	p.R433C	OBSL1_ENST00000373873.4_Missense_Mutation_p.R433C|OBSL1_ENST00000603926.1_Missense_Mutation_p.R433C|OBSL1_ENST00000373876.1_Missense_Mutation_p.R433C|OBSL1_ENST00000265318.4_Missense_Mutation_p.R433C|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000289656.3_Missense_Mutation_p.R20C	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	433					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CGGGGCAGGCGCTTCAGGATG	0.637																																							uc010fwk.2		NA																	0					0						c.(1297-1299)CGC>TGC		obscurin-like 1							28.0	33.0	31.0					2																	220432677		2076	4196	6272	SO:0001583	missense	23363				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity	g.chr2:220432677G>A	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1297C>T	2.37:g.220432677G>A	ENSP00000385636:p.Arg433Cys		Somatic				OBSL1_uc010fwl.1_5'Flank|OBSL1_uc002vmi.2_Missense_Mutation_p.R433C|OBSL1_uc002vmj.2_Missense_Mutation_p.R20C	p.R433C	NM_015311	NP_056126	WXS	Illumina HiSeq	Unspecified	O75147	OBSL1_HUMAN		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)	3	1354	-		Renal(207;0.0376)	433					A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	c.1297C>T	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519046	0.44866	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	4.46	2.36	0.29203	Immunoglobulin-like fold (1);	.	.	.	.	D	0.84647	0.5518	L	0.46157	1.445	0.46749	D	0.999185	D;D;D	0.89917	0.997;1.0;0.999	P;D;P	0.66979	0.667;0.948;0.891	D	0.84108	0.0399	9	0.62326	D	0.03	.	13.6314	0.62198	0.0:0.0:0.5078:0.4922	.	433;20;433	O75147;A8MSZ8;O75147-2	OBSL1_HUMAN;.;.	C	433;433;433;433;20	ENSP00000265318:R433C;ENSP00000385636:R433C;ENSP00000362983:R433C;ENSP00000362980:R433C;ENSP00000289656:R20C	ENSP00000265318:R433C	R	-	1	0	OBSL1	220140921	1.000000	0.71417	0.998000	0.56505	0.501000	0.33797	1.199000	0.32235	0.315000	0.23110	0.555000	0.69702	CGC		0.637	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1			10	35	0	0	0	0.006214	0	10	35				
PAX3	5077	broad.mit.edu	37	2	223160317	223160317	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:223160317G>T	ENST00000350526.4	-	3	517	c.381C>A	c.(379-381)ggC>ggA	p.G127G	PAX3_ENST00000392069.2_Silent_p.G127G|CCDC140_ENST00000295226.1_5'Flank|PAX3_ENST00000409828.3_Silent_p.G127G|PAX3_ENST00000392070.2_Silent_p.G127G|PAX3_ENST00000336840.6_Silent_p.G127G|PAX3_ENST00000409551.3_Silent_p.G126G|PAX3_ENST00000258387.5_Silent_p.G127G|PAX3_ENST00000344493.4_Silent_p.G127G	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	127	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCTGAACATGCCCGGGTTCT	0.542			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																																uc010fwo.2		NA		Dom	yes		2	2q35	5077	T	paired box gene 3	yes	Waardenburg syndrome; craniofacial-deafness-hand syndrome	M	FOXO1A|NCOA1		alveolar rhabdomyosarcoma	PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	0				soft_tissue(761)|ovary(4)|skin(1)	766						c.(379-381)GGC>GGA		paired box 3 isoform PAX3							141.0	131.0	134.0					2																	223160317		2203	4300	6503	SO:0001819	synonymous_variant	5077				apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:223160317G>T		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.381C>A	2.37:g.223160317G>T			Somatic				PAX3_uc002vmt.1_Silent_p.G127G|PAX3_uc002vmy.1_Silent_p.G126G|PAX3_uc002vmv.1_Silent_p.G127G|PAX3_uc002vmw.1_Silent_p.G127G|PAX3_uc002vmx.1_Silent_p.G127G|PAX3_uc002vmz.1_Silent_p.G127G|PAX3_uc002vna.1_Silent_p.G127G|CCDC140_uc002vnb.1_5'Flank	p.G127G	NM_181457	NP_852122	WXS	Illumina HiSeq	Unspecified	P23760	PAX3_HUMAN		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	3	747	-		Renal(207;0.0183)	127			Paired.		G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	37	c.381C>A	CCDS42826.1																																																																																				0.542	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			17	58	1	0	3.32936e-07	0.006122	3.73397e-07	17	58				
CPXM1	56265	broad.mit.edu	37	20	2774857	2774857	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:2774857C>A	ENST00000380605.2	-	14	2248	c.2184G>T	c.(2182-2184)cgG>cgT	p.R728R		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	728					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GTCCCCTTAGCCGCTCCAGGC	0.612																																							uc002wgu.2		NA																	0				ovary(2)|skin(2)	4						c.(2182-2184)CGG>CGT		carboxypeptidase X, member 1 precursor							37.0	42.0	40.0					20																	2774857		2201	4297	6498	SO:0001819	synonymous_variant	56265				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding	g.chr20:2774857C>A	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.2184G>T	20.37:g.2774857C>A			Somatic				CPXM1_uc010gas.2_Silent_p.R654R	p.R728R	NM_019609	NP_062555	WXS	Illumina HiSeq	Unspecified	Q96SM3	CPXM1_HUMAN			14	2248	-			728					Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	ENST00000380605.2	37	c.2184G>T	CCDS13033.1																																																																																				0.612	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		29	69	1	0	2.08457e-15	0.010818	2.74823e-15	29	69				
SPTLC3	55304	broad.mit.edu	37	20	13055137	13055137	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:13055137A>T	ENST00000399002.2	+	4	873	c.599A>T	c.(598-600)cAt>cTt	p.H200L	SPTLC3_ENST00000378194.4_Missense_Mutation_p.H200L	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	200					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						AGCACCAGGCATGAAATGGGT	0.423																																							uc002wod.1		NA																	0					0						c.(598-600)CAT>CTT		serine palmitoyltransferase, long chain base	Pyridoxal Phosphate(DB00114)						166.0	164.0	165.0					20																	13055137		1982	4165	6147	SO:0001583	missense	55304				sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups	g.chr20:13055137A>T	AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.599A>T	20.37:g.13055137A>T	ENSP00000381968:p.His200Leu		Somatic					p.H200L	NM_018327	NP_060797	WXS	Illumina HiSeq	Unspecified	Q9NUV7	SPTC3_HUMAN			4	888	+			200					A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Missense_Mutation	SNP	ENST00000399002.2	37	c.599A>T	CCDS13115.2	.	.	.	.	.	.	.	.	.	.	A	0.178	-1.065115	0.01934	.	.	ENSG00000172296	ENST00000399002;ENST00000378194;ENST00000450297	D;D;D	0.93953	-2.66;-2.66;-3.32	6.17	-0.179	0.13299	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.659026	0.17170	N	0.184314	T	0.77343	0.4116	N	0.01751	-0.74	0.23138	N	0.998237	B	0.02656	0.0	B	0.09377	0.004	T	0.66909	-0.5804	10	0.21540	T	0.41	3.6413	5.8966	0.18943	0.639:0.0:0.2528:0.1082	.	200	Q9NUV7	SPTC3_HUMAN	L	200;200;173	ENSP00000381968:H200L;ENSP00000367436:H200L;ENSP00000409125:H173L	ENSP00000367436:H200L	H	+	2	0	SPTLC3	13003137	0.995000	0.38212	0.001000	0.08648	0.048000	0.14542	4.550000	0.60733	-0.304000	0.08843	-1.127000	0.01993	CAT		0.423	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254544.1	NM_018327		73	109	0	0	0	0.01441	0	73	109				
BPI	671	broad.mit.edu	37	20	36935979	36935979	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:36935979G>A	ENST00000262865.4	+	2	242	c.153G>A	c.(151-153)caG>caA	p.Q51Q	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	51					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				CCAGCCAGCAGGGGACGGCCG	0.592																																							uc002xib.2		NA																	0				ovary(4)	4						c.(151-153)CAG>CAA		bactericidal/permeability-increasing protein							75.0	76.0	76.0					20																	36935979		2203	4300	6503	SO:0001819	synonymous_variant	671				defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding	g.chr20:36935979G>A	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.153G>A	20.37:g.36935979G>A			Somatic					p.Q51Q	NM_001725	NP_001716	WXS	Illumina HiSeq	Unspecified	P17213	BPI_HUMAN			2	215	+		Myeloproliferative disorder(115;0.00878)	51					B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	37	c.153G>A	CCDS13303.1																																																																																				0.592	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725		36	82	0	0	0	0.004878	0	36	82				
PLCG1	5335	broad.mit.edu	37	20	39801184	39801184	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:39801184G>A	ENST00000373271.1	+	26	3434	c.3029G>A	c.(3028-3030)cGc>cAc	p.R1010H	PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000244007.3_Missense_Mutation_p.R1010H|PLCG1_ENST00000373272.2_Missense_Mutation_p.R1010H	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1010	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.R1010L(2)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CAGCTCTCCCGCATCTACCCC	0.542																																							uc002xjp.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|breast(3)|skin(2)	8						c.(3028-3030)CGC>CAC		phospholipase C, gamma 1 isoform b							65.0	60.0	62.0					20																	39801184		2203	4300	6503	SO:0001583	missense	5335				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity	g.chr20:39801184G>A	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3029G>A	20.37:g.39801184G>A	ENSP00000362368:p.Arg1010His		Somatic				PLCG1_uc002xjo.1_Missense_Mutation_p.R1010H|PLCG1_uc010zwe.1_Missense_Mutation_p.R636H	p.R1010H	NM_182811	NP_877963	WXS	Illumina HiSeq	Unspecified	P19174	PLCG1_HUMAN			26	3150	+		Myeloproliferative disorder(115;0.00878)	1010			PI-PLC Y-box.		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	c.3029G>A	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	G	36	5.648503	0.96714	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	D;D;D	0.83250	-1.7;-1.7;-1.7	5.82	5.82	0.92795	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.122950	0.64402	D	0.000012	D	0.94751	0.8306	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95808	0.8839	10	0.87932	D	0	.	20.1054	0.97890	0.0:0.0:1.0:0.0	.	1010;1010;1010	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	H	1010	ENSP00000244007:R1010H;ENSP00000362368:R1010H;ENSP00000362369:R1010H	ENSP00000244007:R1010H	R	+	2	0	PLCG1	39234598	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.757000	0.94681	0.655000	0.94253	CGC		0.542	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811		3	39	0	0	0	0.004672	0	3	39				
SLC12A5	57468	broad.mit.edu	37	20	44682333	44682333	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:44682333C>A	ENST00000454036.2	+	20	2782	c.2733C>A	c.(2731-2733)gtC>gtA	p.V911V	SLC12A5_ENST00000243964.3_Silent_p.V888V	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	911					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CTGCGGAGGTCGAGGTGGTGG	0.542																																							uc010zxl.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(2731-2733)GTC>GTA		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						196.0	168.0	178.0					20																	44682333		2203	4300	6503	SO:0001819	synonymous_variant	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44682333C>A	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2733C>A	20.37:g.44682333C>A			Somatic				SLC12A5_uc002xrb.2_Silent_p.V888V	p.V911V	NM_001134771	NP_001128243	WXS	Illumina HiSeq	Unspecified	Q9H2X9	S12A5_HUMAN			20	2809	+		Myeloproliferative disorder(115;0.0122)	911			Cytoplasmic (Potential).		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	c.2733C>A	CCDS46610.1																																																																																				0.542	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			51	100	1	0	1.0442e-30	0.01441	1.54007e-30	51	100				
TFAP2C	7022	broad.mit.edu	37	20	55206867	55206867	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr20:55206867G>T	ENST00000201031.2	+	3	784	c.541G>T	c.(541-543)Gac>Tac	p.D181Y	TFAP2C_ENST00000544508.1_Missense_Mutation_p.D12Y	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	181					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			CCAGAATGTCGACGACCAGCA	0.557																																							uc002xya.2		NA																	0				central_nervous_system(1)	1						c.(541-543)GAC>TAC		transcription factor AP-2 gamma							113.0	98.0	103.0					20																	55206867		2203	4300	6503	SO:0001583	missense	7022				cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr20:55206867G>T		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.541G>T	20.37:g.55206867G>T	ENSP00000201031:p.Asp181Tyr		Somatic				TFAP2C_uc010zzi.1_Missense_Mutation_p.D12Y	p.D181Y	NM_003222	NP_003213	WXS	Illumina HiSeq	Unspecified	Q92754	AP2C_HUMAN	Colorectal(105;0.229)		3	784	+			181					B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	ENST00000201031.2	37	c.541G>T	CCDS13454.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080899	0.94050	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	T;D	0.97529	-1.11;-4.42	5.69	5.69	0.88448	.	0.292448	0.42821	D	0.000644	D	0.97645	0.9228	L	0.54323	1.7	0.58432	D	0.999994	D	0.67145	0.996	P	0.59703	0.862	D	0.98223	1.0479	10	0.87932	D	0	-20.4992	19.8052	0.96529	0.0:0.0:1.0:0.0	.	181	Q92754	AP2C_HUMAN	Y	181;12	ENSP00000201031:D181Y;ENSP00000442274:D12Y	ENSP00000201031:D181Y	D	+	1	0	TFAP2C	54640274	1.000000	0.71417	0.428000	0.26697	0.824000	0.46624	7.535000	0.82014	2.688000	0.91661	0.561000	0.74099	GAC		0.557	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	NM_003222		27	47	1	0	4.59853e-10	0.005443	5.46075e-10	27	47				
TPTE	7179	broad.mit.edu	37	21	10942750	10942750	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr21:10942750T>A	ENST00000361285.4	-	13	1020	c.691A>T	c.(691-693)Aca>Tca	p.T231S	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.T213S|TPTE_ENST00000342420.5_Missense_Mutation_p.T193S	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	231	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCATCCCTTGTGTATCGCCTT	0.313																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(691-693)ACA>TCA		transmembrane phosphatase with tensin homology							477.0	418.0	438.0					21																	10942750		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10942750T>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.691A>T	21.37:g.10942750T>A	ENSP00000355208:p.Thr231Ser		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.T213S|TPTE_uc002yir.1_Missense_Mutation_p.T193S|TPTE_uc010gkv.1_Missense_Mutation_p.T93S	p.T231S	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	13	1059	-			231			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.691A>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	9.106	1.005442	0.19199	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.30981	1.51;1.51;1.51	2.73	-0.452	0.12205	Phosphatase tensin type (1);	0.501056	0.21329	U	0.076329	T	0.20129	0.0484	L	0.34521	1.04	0.18873	N	0.999985	B;B;B	0.32101	0.095;0.356;0.077	B;B;B	0.34536	0.037;0.185;0.143	T	0.15896	-1.0421	10	0.37606	T	0.19	-0.0321	8.047	0.30555	0.0:0.0:0.6239:0.3761	.	193;213;231	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	S	213;231;193	ENSP00000298232:T213S;ENSP00000355208:T231S;ENSP00000344441:T193S	ENSP00000298232:T213S	T	-	1	0	TPTE	9964621	0.283000	0.24277	0.419000	0.26584	0.598000	0.36846	0.553000	0.23391	0.206000	0.20587	0.163000	0.16589	ACA		0.313	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			76	437	0	0	0	0.01441	0	76	437				
KRTAP6-1	337966	broad.mit.edu	37	21	31986046	31986046	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr21:31986046C>T	ENST00000329122.2	-	1	203	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	60						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						CATCCATAGCCATAGCCACAG	0.562																																							uc002yop.2		NA																	0					0						c.(178-180)GGC>AGC		keratin associated protein 6-1							99.0	105.0	103.0					21																	31986046		2203	4300	6503	SO:0001583	missense	337966					cytosol|intermediate filament		g.chr21:31986046C>T	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.178G>A	21.37:g.31986046C>T	ENSP00000332690:p.Gly60Ser		Somatic				KRTAP20-1_uc011ade.1_5'Flank	p.G60S	NM_181602	NP_853633	WXS	Illumina HiSeq	Unspecified	Q3LI64	KRA61_HUMAN			1	178	-			60						Missense_Mutation	SNP	ENST00000329122.2	37	c.178G>A	CCDS13602.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302412	0.40694	.	.	ENSG00000184724	ENST00000329122	T	0.32753	1.44	4.61	4.61	0.57282	.	0.000000	0.31685	U	0.007239	T	0.54711	0.1875	.	.	.	0.30050	N	0.811825	D	0.89917	1.0	D	0.87578	0.998	T	0.56715	-0.7933	9	0.87932	D	0	.	15.3411	0.74296	0.0:1.0:0.0:0.0	.	60	Q3LI64	KRA61_HUMAN	S	60	ENSP00000332690:G60S	ENSP00000332690:G60S	G	-	1	0	KRTAP6-1	30907917	0.997000	0.39634	1.000000	0.80357	0.668000	0.39293	1.632000	0.37102	2.582000	0.87167	0.643000	0.83706	GGC		0.562	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	NM_181602		36	128	0	0	0	0.003755	0	36	128				
SLC5A3	6526	broad.mit.edu	37	21	35469090	35469090	+	Silent	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr21:35469090T>A	ENST00000381151.3	+	2	2105	c.1593T>A	c.(1591-1593)ctT>ctA	p.L531L	SLC5A3_ENST00000608209.1_Silent_p.L531L|AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	531					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						TTGTGAGCCTTCTCACACCAC	0.468																																							uc002yto.2		NA																	0				ovary(2)	2						c.(1591-1593)CTT>CTA		solute carrier family 5 (inositol transporters),							79.0	68.0	72.0					21																	35469090		2203	4300	6503	SO:0001819	synonymous_variant	6526					integral to plasma membrane	myo-inositol:sodium symporter activity	g.chr21:35469090T>A		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1593T>A	21.37:g.35469090T>A			Somatic				MRPS6_uc002ytp.2_Intron	p.L531L	NM_006933	NP_008864	WXS	Illumina HiSeq	Unspecified	P53794	SC5A3_HUMAN			2	2105	+			531			Helical; (Potential).		O43489	Silent	SNP	ENST00000381151.3	37	c.1593T>A	CCDS33549.1																																																																																				0.468	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1			26	32	0	0	0	0.005443	0	26	32				
DIP2A	23181	broad.mit.edu	37	21	47970476	47970476	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr21:47970476G>T	ENST00000417564.2	+	23	2679	c.2658G>T	c.(2656-2658)caG>caT	p.Q886H	DIP2A_ENST00000400274.1_Missense_Mutation_p.Q882H|DIP2A_ENST00000427143.2_Missense_Mutation_p.Q822H|DIP2A_ENST00000318711.7_Missense_Mutation_p.Q887H			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	886					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.Q886H(1)|p.Q822H(1)|p.Q887H(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCATCCACCAGGTGGGCGTGT	0.582																																							uc002zjo.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(2656-2658)CAG>CAT		disco-interacting protein 2A isoform a							61.0	63.0	62.0					21																	47970476		1995	4162	6157	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47970476G>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2658G>T	21.37:g.47970476G>T	ENSP00000392066:p.Gln886His		Somatic				DIP2A_uc011afy.1_Missense_Mutation_p.Q822H|DIP2A_uc011afz.1_Missense_Mutation_p.Q882H	p.Q886H	NM_015151	NP_055966	WXS	Illumina HiSeq	Unspecified	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	23	2841	+	Breast(49;0.0933)		886					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.2658G>T	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684753	0.68157	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000417564	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.26	4.37	0.52481	.	0.070865	0.64402	D	0.000017	T	0.23649	0.0572	M	0.70595	2.14	0.80722	D	1	D;D;D	0.63880	0.993;0.988;0.988	D;P;P	0.63033	0.91;0.873;0.896	T	0.01165	-1.1431	10	0.18710	T	0.47	-22.3229	9.273	0.37684	0.1517:0.0:0.8483:0.0	.	887;822;886	E9PER1;E7EMA5;Q14689	.;.;DIP2A_HUMAN	H	882;822;887;886	ENSP00000383133:Q882H;ENSP00000400528:Q822H;ENSP00000323633:Q887H;ENSP00000392066:Q886H	ENSP00000323633:Q887H	Q	+	3	2	DIP2A	46794904	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.993000	0.49425	2.639000	0.89480	0.655000	0.94253	CAG		0.582	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		15	14	1	0	1.37285e-15	0.004007	1.82482e-15	15	14				
SNRPD3	6634	broad.mit.edu	37	22	24964111	24964112	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:24964111_24964112GG>CT	ENST00000215829.3	+	3	873_874	c.286_287GG>CT	c.(286-288)GGc>CTc	p.G96L	SNRPD3_ENST00000402849.1_Missense_Mutation_p.G96L	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	96	Arg/Lys-rich (basic).				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)	p.G96C(1)|p.G96S(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						CTCAGGGGCTGGCCGAGGAAAA	0.455																																							uc003aam.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(1)	1						c.(286-288)GGC>CTC		small nuclear ribonucleoprotein polypeptide D3																																				SO:0001583	missense	6634				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding	g.chr22:24964111_24964112GG>CT	U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	Exception_encountered	22.37:g.24964111_24964112delinsCT	ENSP00000215829:p.Gly96Leu		Somatic				SNRPD3_uc011aju.1_Missense_Mutation_p.G96L	p.G96L	NM_004175	NP_004166	WXS	Illumina HiSeq	Unspecified	P62318	SMD3_HUMAN			3	726_727	+			96			Arg/Lys-rich (basic).		B4DJP7|B5BU13|P43331	Missense_Mutation	DNP	ENST00000215829.3	37	c.286_287GG>CT	CCDS13828.1																																																																																				0.455	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319813.1	NM_004175		26	38	0	0	0	0.004672	0	26	38				
SEZ6L	23544	broad.mit.edu	37	22	26747058	26747058	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:26747058C>A	ENST00000248933.6	+	12	2543	c.2448C>A	c.(2446-2448)acC>acA	p.T816T	SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000411842.2_Silent_p.T13T|SEZ6L_ENST00000402979.1_Silent_p.T589T|SEZ6L_ENST00000529632.2_Silent_p.T816T|SEZ6L_ENST00000403121.1_Silent_p.T589T|SEZ6L_ENST00000343706.4_Silent_p.T816T|SEZ6L_ENST00000404234.3_Silent_p.T816T			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	816	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ATCACTCGACCCGCTTAATTT	0.542																																							uc003acb.2		NA																	0				ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(2446-2448)ACC>ACA		seizure related 6 homolog (mouse)-like							115.0	100.0	105.0					22																	26747058		2203	4300	6503	SO:0001819	synonymous_variant	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26747058C>A	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2448C>A	22.37:g.26747058C>A			Somatic				SEZ6L_uc003acc.2_Silent_p.T816T|SEZ6L_uc011akc.1_Silent_p.T816T|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Silent_p.T816T|SEZ6L_uc003ace.2_Silent_p.T816T|SEZ6L_uc003acf.1_Silent_p.T589T|SEZ6L_uc010gvc.1_Silent_p.T589T|SEZ6L_uc011ake.1_RNA	p.T816T	NM_021115	NP_066938	WXS	Illumina HiSeq	Unspecified	Q9BYH1	SE6L1_HUMAN			12	2604	+			816			Sushi 4.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	c.2448C>A	CCDS13833.1																																																																																				0.542	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			28	48	1	0	7.26314e-15	0.007291	9.42167e-15	28	48				
INPP5J	27124	broad.mit.edu	37	22	31523954	31523954	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:31523954G>T	ENST00000331075.5	+	7	1854	c.1805G>T	c.(1804-1806)gGg>gTg	p.G602V	INPP5J_ENST00000412277.2_Missense_Mutation_p.G535V|INPP5J_ENST00000401755.1_5'UTR|INPP5J_ENST00000400294.2_Missense_Mutation_p.G235V|INPP5J_ENST00000402238.1_5'UTR|INPP5J_ENST00000405300.1_Missense_Mutation_p.G235V|INPP5J_ENST00000404453.1_5'UTR|INPP5J_ENST00000404390.3_Missense_Mutation_p.G234V	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	602	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						TTCTGGTTCGGGGACCTGAAC	0.587																																							uc003aju.3		NA																	0				skin(1)	1						c.(1804-1806)GGG>GTG		phosphatidylinositol (4,5) bisphosphate							52.0	51.0	51.0					22																	31523954		1946	4131	6077	SO:0001583	missense	27124					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding	g.chr22:31523954G>T	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1805G>T	22.37:g.31523954G>T	ENSP00000333262:p.Gly602Val		Somatic				INPP5J_uc003ajv.3_Missense_Mutation_p.G235V|INPP5J_uc003ajs.3_Missense_Mutation_p.G235V|INPP5J_uc011alk.1_Missense_Mutation_p.G535V|INPP5J_uc010gwg.2_Missense_Mutation_p.G167V|INPP5J_uc003ajw.2_Missense_Mutation_p.G38V|INPP5J_uc003ajt.3_Missense_Mutation_p.G234V|INPP5J_uc003ajx.2_5'UTR|INPP5J_uc003ajy.2_5'UTR|INPP5J_uc003ajz.2_5'UTR	p.G602V	NM_001002837	NP_001002837	WXS	Illumina HiSeq	Unspecified	Q15735	PI5PA_HUMAN			7	1897	+			602			Catalytic (Potential).		B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	ENST00000331075.5	37	c.1805G>T		.	.	.	.	.	.	.	.	.	.	G	20.6	4.013816	0.75161	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000400294;ENST00000405300;ENST00000404390	D;D;D;D;D	0.99701	-6.45;-6.45;-6.45;-6.45;-6.45	4.83	3.81	0.43845	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.057024	0.64402	D	0.000002	D	0.99843	0.9928	H	0.98818	4.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	12.9998	0.58667	0.0784:0.0:0.9216:0.0	.	535;602;234	B4DF95;Q15735;Q15735-3	.;PI5PA_HUMAN;.	V	602;535;235;235;234	ENSP00000333262:G602V;ENSP00000392924:G535V;ENSP00000383150:G235V;ENSP00000384596:G235V;ENSP00000384534:G234V	ENSP00000333262:G602V	G	+	2	0	INPP5J	29853954	1.000000	0.71417	0.997000	0.53966	0.909000	0.53808	9.375000	0.97178	1.142000	0.42291	0.655000	0.94253	GGG		0.587	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000321784.1	NM_001002837		12	28	1	0	4.3838e-07	0.001855	4.88265e-07	12	28				
APOBEC3G	60489	broad.mit.edu	37	22	39479766	39479766	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:39479766C>A	ENST00000407997.3	+	5	969	c.612C>A	c.(610-612)ttC>ttA	p.F204L	APOBEC3G_ENST00000452957.2_Missense_Mutation_p.F204L|APOBEC3G_ENST00000461827.1_3'UTR	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	204					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					CATTCACTTTCAACTTTAACA	0.547																																							uc003awx.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(610-612)TTC>TTA		apolipoprotein B mRNA editing enzyme, catalytic							127.0	108.0	114.0					22																	39479766		2203	4300	6503	SO:0001583	missense	60489				base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding	g.chr22:39479766C>A	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.612C>A	22.37:g.39479766C>A	ENSP00000385057:p.Phe204Leu		Somatic				APOBEC3G_uc003awy.2_Missense_Mutation_p.F137L	p.F204L	NM_021822	NP_068594	WXS	Illumina HiSeq	Unspecified	Q9HC16	ABC3G_HUMAN			5	954	+	Melanoma(58;0.04)		204					B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	ENST00000407997.3	37	c.612C>A	CCDS13984.1	.	.	.	.	.	.	.	.	.	.	.	3.269	-0.149479	0.06585	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.70164	-0.46;-0.46	1.7	-3.4	0.04853	APOBEC-like, N-terminal (1);	.	.	.	.	T	0.49115	0.1538	L	0.46947	1.48	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32481	-0.9905	9	0.14252	T	0.57	.	4.5023	0.11870	0.0:0.243:0.2409:0.5161	.	204	Q9HC16	ABC3G_HUMAN	L	204	ENSP00000413376:F204L;ENSP00000385057:F204L	ENSP00000385057:F204L	F	+	3	2	APOBEC3G	37809712	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.818000	0.01717	-1.487000	0.01849	0.591000	0.81541	TTC		0.547	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822		31	41	1	0	4.31634e-10	0.012213	5.16362e-10	31	41				
KIAA1644	85352	broad.mit.edu	37	22	44681338	44681338	+	Missense_Mutation	SNP	G	G	T	rs375503885		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:44681338G>T	ENST00000381176.4	-	4	701	c.569C>A	c.(568-570)cCg>cAg	p.P190Q		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	190						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				GGTCATCAGCGGTGGGCTGTG	0.617																																							uc003bet.2		NA																	0				ovary(1)	1						c.(568-570)CCG>CAG		hypothetical protein LOC85352 precursor							68.0	71.0	70.0					22																	44681338		2111	4234	6345	SO:0001583	missense	85352					integral to membrane		g.chr22:44681338G>T	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.569C>A	22.37:g.44681338G>T	ENSP00000370568:p.Pro190Gln		Somatic					p.P190Q	NM_001099294	NP_001092764	WXS	Illumina HiSeq	Unspecified	Q3SXP7	K1644_HUMAN			4	702	-		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)	190			Cytoplasmic (Potential).		A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	ENST00000381176.4	37	c.569C>A	CCDS43025.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139092	0.77775	.	.	ENSG00000138944	ENST00000381176	.	.	.	5.06	5.06	0.68205	.	0.062204	0.64402	D	0.000004	T	0.54549	0.1865	N	0.14661	0.345	0.30119	N	0.805836	D	0.61080	0.989	P	0.62740	0.906	T	0.66984	-0.5785	8	0.72032	D	0.01	-25.2826	15.5806	0.76432	0.0:0.0:1.0:0.0	.	190	Q3SXP7	K1644_HUMAN	Q	190	.	ENSP00000370568:P190Q	P	-	2	0	KIAA1644	43012671	1.000000	0.71417	0.981000	0.43875	0.559000	0.35586	6.985000	0.76193	2.345000	0.79718	0.561000	0.74099	CCG		0.617	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294		24	70	1	0	3.73988e-18	0.00632	5.18447e-18	24	70				
GTSE1	51512	broad.mit.edu	37	22	46712020	46712020	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr22:46712020G>T	ENST00000454366.1	+	7	1355	c.1143G>T	c.(1141-1143)ctG>ctT	p.L381L		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	362					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CCGCCATGCTGCGGCCAGCTC	0.592																																					GBM(153;542 1915 12487 29016 50495)	GBM(153;542 1915 12487 29016 50495)	uc011aqy.1		NA																	0				ovary(1)	1						c.(1141-1143)CTG>CTT		G-2 and S-phase expressed 1							36.0	42.0	40.0					22																	46712020		2198	4291	6489	SO:0001819	synonymous_variant	51512				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule		g.chr22:46712020G>T	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1143G>T	22.37:g.46712020G>T			Somatic				GTSE1_uc011aqz.1_Silent_p.L228L|GTSE1_uc003bhl.1_Silent_p.L6L|GTSE1_uc003bhm.1_Silent_p.L6L	p.L381L	NM_016426	NP_057510	WXS	Illumina HiSeq	Unspecified	Q9NYZ3	GTSE1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)	7	1355	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	362					B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	37	c.1143G>T	CCDS14074.2																																																																																				0.592	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426		26	37	1	0	5.71845e-15	0.005524	7.47797e-15	26	37				
MTMR14	64419	broad.mit.edu	37	3	9730437	9730437	+	Splice_Site	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:9730437G>A	ENST00000296003.4	+	15	1415	c.1293G>A	c.(1291-1293)ctG>ctA	p.L431L	MTMR14_ENST00000353332.5_Splice_Site_p.L431L|MTMR14_ENST00000420925.1_Splice_Site_p.L185L|MTMR14_ENST00000351233.5_Splice_Site_p.L431L	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	431					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					TCTGCATGCTGAGTGAGTCCT	0.498																																							uc003brz.2		NA																	0				skin(1)	1						c.(1291-1293)CTG>CTA		jumpy isoform 2							57.0	59.0	58.0					3																	9730437		1986	4156	6142	SO:0001630	splice_region_variant	64419					perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chr3:9730437G>A	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1294+1G>A	3.37:g.9730437G>A			Somatic				MTMR14_uc003bsa.2_Silent_p.L431L|MTMR14_uc003bsb.2_Silent_p.L431L|MTMR14_uc011ath.1_RNA|MTMR14_uc010hcl.2_Silent_p.L185L|MTMR14_uc003bsc.2_RNA	p.L431L	NM_001077525	NP_001070993	WXS	Illumina HiSeq	Unspecified	Q8NCE2	MTMRE_HUMAN			15	1417	+	Medulloblastoma(99;0.227)		431					Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Silent	SNP	ENST00000296003.4	37	c.1293G>A	CCDS43043.1																																																																																				0.498	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	Silent	5	68	0	0	0	0.000602	0	5	68				
WNT7A	7476	broad.mit.edu	37	3	13860915	13860915	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:13860915C>T	ENST00000285018.4	-	4	880	c.576G>A	c.(574-576)ctG>ctA	p.L192L		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	192					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TGTTCTCCTCCAGGATCTGCA	0.657																																							uc003bye.1		NA																	0				ovary(2)|breast(1)	3						c.(574-576)CTG>CTA		wingless-type MMTV integration site family,							87.0	84.0	85.0					3																	13860915		2203	4300	6503	SO:0001819	synonymous_variant	7476				activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity	g.chr3:13860915C>T	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.576G>A	3.37:g.13860915C>T			Somatic					p.L192L	NM_004625	NP_004616	WXS	Illumina HiSeq	Unspecified	O00755	WNT7A_HUMAN			4	881	-			192					Q96H90|Q9Y560	Silent	SNP	ENST00000285018.4	37	c.576G>A	CCDS2616.1																																																																																				0.657	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625		19	56	0	0	0	0.008871	0	19	56				
GALNT15	117248	broad.mit.edu	37	3	16237266	16237266	+	Splice_Site	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:16237266G>A	ENST00000339732.5	+	2	1042		c.e2-1		GALNT15_ENST00000437509.1_Splice_Site	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CTTCCCTGCAGGTGTCTGCAG	0.597																																							uc003car.3		NA																	0				breast(1)	1						c.e2-1		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							73.0	61.0	65.0					3																	16237266		2203	4300	6503	SO:0001630	splice_region_variant	117248					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr3:16237266G>A	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.540-1G>A	3.37:g.16237266G>A			Somatic				GALNTL2_uc003caq.3_Splice_Site	p.L180_splice	NM_054110	NP_473451	WXS	Illumina HiSeq	Unspecified	Q8N3T1	GLTL2_HUMAN			2	1015	+								A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Splice_Site	SNP	ENST00000339732.5	37	c.540_splice	CCDS33711.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378326	0.82682	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0575	0.89367	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNTL2	16212270	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.037000	0.76531	2.256000	0.74724	0.555000	0.69702	.		0.597	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	Intron	10	33	0	0	0	0.008291	0	10	33				
DCLK3	85443	broad.mit.edu	37	3	36779060	36779060	+	Missense_Mutation	SNP	T	T	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:36779060T>C	ENST00000416516.2	-	2	1581	c.1091A>G	c.(1090-1092)gAt>gGt	p.D364G		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	364	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AAAGTTCCCATCCCCAATGAC	0.577																																							uc003cgi.2		NA																	0				lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						c.(1090-1092)GAT>GGT		doublecortin-like kinase 3							87.0	85.0	85.0					3																	36779060		2109	4243	6352	SO:0001583	missense	85443					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr3:36779060T>C	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1091A>G	3.37:g.36779060T>C	ENSP00000394484:p.Asp364Gly		Somatic					p.D364G	NM_033403	NP_208382	WXS	Illumina HiSeq	Unspecified	Q9C098	DCLK3_HUMAN			2	1582	-			364			Protein kinase.|ATP (By similarity).			Missense_Mutation	SNP	ENST00000416516.2	37	c.1091A>G	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392543	0.62066	.	.	ENSG00000163673	ENST00000416516	T	0.65549	-0.16	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.34223	N	0.004152	T	0.67306	0.2879	N	0.16833	0.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73078	-0.4096	10	0.87932	D	0	.	16.176	0.81851	0.0:0.0:0.0:1.0	.	364	Q9C098	DCLK3_HUMAN	G	364	ENSP00000394484:D364G	ENSP00000394484:D364G	D	-	2	0	DCLK3	36754064	1.000000	0.71417	0.989000	0.46669	0.180000	0.23129	7.990000	0.88215	2.288000	0.76882	0.533000	0.62120	GAT		0.577	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355		19	56	0	0	0	0.010504	0	19	56				
PTPRG	5793	broad.mit.edu	37	3	62063885	62063885	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:62063885G>A	ENST00000474889.1	+	5	945	c.568G>A	c.(568-570)Gca>Aca	p.A190T	PTPRG_ENST00000295874.10_Missense_Mutation_p.A190T	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	190	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CTTTCAAACCGCAATTTCTGA	0.294																																							uc003dlb.2		NA																	0				ovary(5)|lung(2)	7						c.(568-570)GCA>ACA		protein tyrosine phosphatase, receptor type, G							59.0	60.0	60.0					3																	62063885		2203	4299	6502	SO:0001583	missense	5793				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr3:62063885G>A	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.568G>A	3.37:g.62063885G>A	ENSP00000418112:p.Ala190Thr		Somatic				PTPRG_uc003dlc.2_Missense_Mutation_p.A190T	p.A190T	NM_002841	NP_002832	WXS	Illumina HiSeq	Unspecified	P23470	PTPRG_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)	5	1287	+			190			Extracellular (Potential).|Alpha-carbonic anhydrase.		B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	c.568G>A	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523971	0.85600	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.78481	-1.18;-1.18	6.07	6.07	0.98685	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.92103	0.7497	M	0.94142	3.5	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.916	D	0.92699	0.6173	10	0.59425	D	0.04	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	190;190	P23470-2;P23470	.;PTPRG_HUMAN	T	190	ENSP00000418112:A190T;ENSP00000295874:A190T	ENSP00000295874:A190T	A	+	1	0	PTPRG	62038925	1.000000	0.71417	0.941000	0.38009	0.997000	0.91878	7.988000	0.88194	2.885000	0.99019	0.655000	0.94253	GCA		0.294	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841		17	37	0	0	0	0.007413	0	17	37				
OR5AC2	81050	broad.mit.edu	37	3	97806880	97806880	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:97806880C>G	ENST00000358642.2	+	1	864	c.864C>G	c.(862-864)aaC>aaG	p.N288K		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	288					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						CCCTGCTAAACCCATTTATTT	0.358																																							uc011bgs.1		NA																	0				skin(1)	1						c.(862-864)AAC>AAG		olfactory receptor, family 5, subfamily AC,							80.0	79.0	79.0					3																	97806880		2203	4300	6503	SO:0001583	missense	81050				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97806880C>G	AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.864C>G	3.37:g.97806880C>G	ENSP00000351466:p.Asn288Lys		Somatic					p.N288K	NM_054106	NP_473447	WXS	Illumina HiSeq	Unspecified	Q9NZP5	O5AC2_HUMAN			1	864	+			288			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000358642.2	37	c.864C>G	CCDS33796.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528075	0.27299	.	.	ENSG00000196578	ENST00000358642	T	0.59364	0.27	4.4	-5.15	0.02866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39475	U	0.001353	T	0.79885	0.4523	H	0.96748	3.875	0.23221	N	0.998096	D	0.89917	1.0	D	0.91635	0.999	T	0.75277	-0.3374	10	0.87932	D	0	-32.1518	13.5467	0.61709	0.0:0.2513:0.0:0.7487	.	288	Q9NZP5	O5AC2_HUMAN	K	288	ENSP00000351466:N288K	ENSP00000351466:N288K	N	+	3	2	OR5AC2	99289570	0.000000	0.05858	0.010000	0.14722	0.127000	0.20565	-2.514000	0.00956	-1.572000	0.01661	-0.225000	0.12378	AAC		0.358	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359116.1			13	35	0	0	0	0.001855	0	13	35				
BOC	91653	broad.mit.edu	37	3	112993230	112993230	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:112993230C>A	ENST00000495514.1	+	9	1947	c.1243C>A	c.(1243-1245)Cca>Aca	p.P415T	BOC_ENST00000355385.3_Missense_Mutation_p.P415T|BOC_ENST00000273395.4_Missense_Mutation_p.P415T			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	415					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AGGCATAACCCCAAGGCTATG	0.552																																							uc003dzx.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(1243-1245)CCA>ACA		brother of CDO precursor							68.0	60.0	62.0					3																	112993230		2202	4298	6500	SO:0001583	missense	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112993230C>A	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1243C>A	3.37:g.112993230C>A	ENSP00000418663:p.Pro415Thr		Somatic				BOC_uc003dzy.2_Missense_Mutation_p.P415T|BOC_uc003dzz.2_Missense_Mutation_p.P415T|BOC_uc003eab.2_Missense_Mutation_p.P116T	p.P415T	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		9	1864	+			415			Extracellular (Potential).		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	c.1243C>A	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	1.524	-0.546132	0.04024	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.61627	0.09;0.1;0.09	5.62	1.89	0.25635	.	0.474462	0.21372	N	0.075613	T	0.34890	0.0913	N	0.22421	0.69	0.09310	N	1	B;B	0.18461	0.028;0.008	B;B	0.22386	0.039;0.017	T	0.18871	-1.0323	10	0.10377	T	0.69	.	5.6326	0.17518	0.1166:0.6447:0.1126:0.1261	.	415;415	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	T	415	ENSP00000418663:P415T;ENSP00000273395:P415T;ENSP00000347546:P415T	ENSP00000273395:P415T	P	+	1	0	BOC	114475920	0.193000	0.23313	0.250000	0.24296	0.001000	0.01503	0.549000	0.23329	0.296000	0.22592	-2.176000	0.00320	CCA		0.552	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		22	62	1	0	5.35356e-11	0.00278	6.50075e-11	22	62				
IQCB1	9657	broad.mit.edu	37	3	121547406	121547406	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:121547406G>A	ENST00000310864.6	-	4	388	c.174C>T	c.(172-174)ctC>ctT	p.L58L	IQCB1_ENST00000349820.6_Silent_p.L58L	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	58					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		AATATTGAATGAGATCATAAC	0.328																																							uc010hre.1		NA																	0					0						c.(172-174)CTC>CTT		IQ motif containing B1 isoform a							80.0	75.0	77.0					3																	121547406		2203	4300	6503	SO:0001819	synonymous_variant	9657				cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding	g.chr3:121547406G>A	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.174C>T	3.37:g.121547406G>A			Somatic				IQCB1_uc003eek.2_Silent_p.L58L|IQCB1_uc010hrf.1_RNA	p.L58L	NM_001023570	NP_001018864	WXS	Illumina HiSeq	Unspecified	Q15051	IQCB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0983)	4	389	-			58					Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Silent	SNP	ENST00000310864.6	37	c.174C>T	CCDS33837.1																																																																																				0.328	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642		22	39	0	0	0	0.012319	0	22	39				
COL6A6	131873	broad.mit.edu	37	3	130284398	130284398	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:130284398C>A	ENST00000358511.6	+	3	1253	c.1222C>A	c.(1222-1224)Cgg>Agg	p.R408R	COL6A6_ENST00000453409.2_Silent_p.R408R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	408	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R408W(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GAAGAAGCTGCGGAACCAAAT	0.463																																							uc010htl.2		NA																	1	Substitution - Missense(1)	p.R408W(1)	central_nervous_system(1)	ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(1222-1224)CGG>AGG		collagen type VI alpha 6 precursor							47.0	52.0	50.0					3																	130284398		1950	4148	6098	SO:0001819	synonymous_variant	131873				axon guidance|cell adhesion	collagen		g.chr3:130284398C>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1222C>A	3.37:g.130284398C>A			Somatic					p.R408R	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			3	1253	+			408			Nonhelical region.|VWFA 2.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	37	c.1222C>A	CCDS46911.1																																																																																				0.463	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		8	13	1	0	5.18039e-06	0.00308	5.71081e-06	8	13				
ATR	545	broad.mit.edu	37	3	142272808	142272808	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:142272808T>A	ENST00000350721.4	-	11	2512	c.2391A>T	c.(2389-2391)gaA>gaT	p.E797D	ATR_ENST00000383101.3_Missense_Mutation_p.E733D	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	797					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTGTTTCATCTTCTCTAAAAT	0.308								Other conserved DNA damage response genes																															uc003eux.3		NA																	0				lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						c.(2389-2391)GAA>GAT	Other_conserved_DNA_damage_response_genes	ataxia telangiectasia and Rad3 related protein							50.0	54.0	52.0					3																	142272808		2200	4296	6496	SO:0001583	missense	545				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity	g.chr3:142272808T>A	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2391A>T	3.37:g.142272808T>A	ENSP00000343741:p.Glu797Asp		Somatic					p.E797D	NM_001184	NP_001175	WXS	Illumina HiSeq	Unspecified	Q13535	ATR_HUMAN			11	2513	-			797					Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	c.2391A>T	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872489	0.33069	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.63744	-0.06;-0.06	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.385128	0.31450	N	0.007622	T	0.43656	0.1257	N	0.19112	0.55	0.25738	N	0.985191	B	0.23806	0.091	B	0.19148	0.024	T	0.22521	-1.0214	10	0.14656	T	0.56	-14.9132	11.5737	0.50850	0.1413:0.0:0.0:0.8587	.	797	Q13535	ATR_HUMAN	D	797;733	ENSP00000343741:E797D;ENSP00000372581:E733D	ENSP00000343741:E797D	E	-	3	2	ATR	143755498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.068000	0.41471	2.137000	0.66172	0.477000	0.44152	GAA		0.308	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184		9	27	0	0	0	0.004482	0	9	27				
ZIC4	84107	broad.mit.edu	37	3	147108741	147108741	+	Silent	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:147108741C>G	ENST00000383075.3	-	4	1493	c.981G>C	c.(979-981)gcG>gcC	p.A327A	ZIC4_ENST00000491672.1_Silent_p.A121A|ZIC4_ENST00000473123.1_Silent_p.A327A|ZIC4_ENST00000484399.1_Silent_p.A327A|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000525172.2_Silent_p.A377A|ZIC4_ENST00000425731.3_Silent_p.A365A	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	327						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CGGCGGTACGCGCCGCCACCG	0.701																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(979-981)GCG>GCC		zinc finger protein of the cerebellum 4							12.0	16.0	15.0					3																	147108741		1998	4119	6117	SO:0001819	synonymous_variant	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108741C>G	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.981G>C	3.37:g.147108741C>G			Somatic				ZIC4_uc003ewc.1_Silent_p.A257A|ZIC4_uc011bno.1_Silent_p.A377A	p.A327A	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			4	1254	-			327					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Silent	SNP	ENST00000383075.3	37	c.981G>C	CCDS43160.1																																																																																				0.701	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			10	14	0	0	0	0.010729	0	10	14				
GOLIM4	27333	broad.mit.edu	37	3	167813020	167813020	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:167813020C>A	ENST00000470487.1	-	1	743	c.54G>T	c.(52-54)ctG>ctT	p.L18L	GOLIM4_ENST00000309027.4_Silent_p.L18L	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	18					transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGGTCAGCAGCAGCAGCGTCT	0.647																																							uc003ffe.2		NA																	0				breast(4)|skin(1)	5						c.(52-54)CTG>CTT		golgi integral membrane protein 4							54.0	43.0	47.0					3																	167813020		2203	4300	6503	SO:0001819	synonymous_variant	27333				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus		g.chr3:167813020C>A	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.54G>T	3.37:g.167813020C>A			Somatic				GOLIM4_uc011bpe.1_Silent_p.L18L|GOLIM4_uc011bpf.1_Silent_p.L18L|GOLIM4_uc011bpg.1_Silent_p.L18L	p.L18L	NM_014498	NP_055313	WXS	Illumina HiSeq	Unspecified	O00461	GOLI4_HUMAN			1	398	-			18			Helical; Signal-anchor for type II membrane protein; (Potential).			Silent	SNP	ENST00000470487.1	37	c.54G>T	CCDS3204.1																																																																																				0.647	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2			11	19	1	0	2.27111e-07	0.013537	2.56493e-07	11	19				
CCDC39	339829	broad.mit.edu	37	3	180372601	180372601	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:180372601A>T	ENST00000442201.2	-	7	998	c.879T>A	c.(877-879)tgT>tgA	p.C293*	CCDC39_ENST00000273654.4_Nonsense_Mutation_p.C377*	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	293					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ATGCCGTTCTACATTTTAAAA	0.358																																							uc010hxe.2		NA																	0				ovary(4)	4						c.(877-879)TGT>TGA		coiled-coil domain containing 39							147.0	125.0	132.0					3																	180372601		1821	4088	5909	SO:0001587	stop_gained	339829				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton		g.chr3:180372601A>T	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.879T>A	3.37:g.180372601A>T	ENSP00000405708:p.Cys293*		Somatic				CCDC39_uc003fkn.2_RNA	p.C293*	NM_181426	NP_852091	WXS	Illumina HiSeq	Unspecified	Q9UFE4	CCD39_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		7	994	-	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		293					B4E2H1	Nonsense_Mutation	SNP	ENST00000442201.2	37	c.879T>A	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	43	9.858377	0.99281	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.5	-1.52	0.08637	.	0.192197	0.46145	D	0.000320	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-2.1965	7.5928	0.28031	0.3002:0.2703:0.4295:0.0	.	.	.	.	X	377;293	.	ENSP00000273654:C377X	C	-	3	2	CCDC39	181855295	0.999000	0.42202	0.009000	0.14445	0.004000	0.04260	0.864000	0.27926	-0.096000	0.12329	-0.400000	0.06385	TGT		0.358	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		13	20	0	0	0	0.00245	0	13	20				
GABRA2	2555	broad.mit.edu	37	4	46252494	46252494	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:46252494G>A	ENST00000510861.1	-	10	1360	c.1187C>T	c.(1186-1188)cCc>cTc	p.P396L	GABRA2_ENST00000381620.4_Missense_Mutation_p.P396L|GABRA2_ENST00000356504.1_Missense_Mutation_p.P396L|GABRA2_ENST00000514090.1_Missense_Mutation_p.P396L|GABRA2_ENST00000540012.1_Missense_Mutation_p.P401L|GABRA2_ENST00000507069.1_Missense_Mutation_p.P456L			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	396					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTTCTTGTTGGGTTCTGGCGT	0.428																																							uc003gxc.3		NA																	0				ovary(2)|skin(2)	4						c.(1186-1188)CCC>CTC		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						196.0	198.0	197.0					4																	46252494		2203	4299	6502	SO:0001583	missense	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46252494G>A		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1187C>T	4.37:g.46252494G>A	ENSP00000421828:p.Pro396Leu		Somatic				GABRA2_uc010igc.2_Missense_Mutation_p.P396L|GABRA2_uc011bzc.1_Missense_Mutation_p.P401L	p.P396L	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			9	1860	-			396			Cytoplasmic (Probable).		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	c.1187C>T	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005008	0.54254	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;T	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-0.48	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.348267	0.36703	N	0.002446	T	0.79816	0.4511	L	0.39898	1.24	0.80722	D	1	P;B	0.41345	0.746;0.019	B;B	0.37833	0.259;0.022	T	0.76468	-0.2948	10	0.11485	T	0.65	.	19.3998	0.94623	0.0:0.0:1.0:0.0	.	401;396	B7Z1H8;P47869	.;GBRA2_HUMAN	L	396;396;396;396;401;456	ENSP00000421828:P396L;ENSP00000421300:P396L;ENSP00000371033:P396L;ENSP00000348897:P396L;ENSP00000444409:P401L;ENSP00000427603:P456L	ENSP00000348897:P396L	P	-	2	0	GABRA2	45947251	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.354000	0.73036	2.827000	0.97445	0.655000	0.94253	CCC		0.428	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			62	178	0	0	0	0.01441	0	62	178				
SCFD2	152579	broad.mit.edu	37	4	54231754	54231754	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:54231754G>C	ENST00000401642.3	-	1	488	c.355C>G	c.(355-357)Cca>Gca	p.P119A	SCFD2_ENST00000388940.4_Missense_Mutation_p.P119A	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	119					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GCCGCCGCTGGGACATGATTA	0.597																																							uc003gzu.2		NA																	0				ovary(2)|pancreas(1)	3						c.(355-357)CCA>GCA		sec1 family domain containing 2							49.0	44.0	46.0					4																	54231754		2203	4300	6503	SO:0001583	missense	152579				protein transport|vesicle docking involved in exocytosis			g.chr4:54231754G>C	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.355C>G	4.37:g.54231754G>C	ENSP00000384182:p.Pro119Ala		Somatic				SCFD2_uc010igm.2_Missense_Mutation_p.P119A	p.P119A	NM_152540	NP_689753	WXS	Illumina HiSeq	Unspecified	Q8WU76	SCFD2_HUMAN	GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)		1	489	-			119					Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	c.355C>G	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	G	9.713	1.157590	0.21454	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.43688	0.94;0.94	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000002	T	0.42720	0.1215	L	0.44542	1.39	0.30982	N	0.722428	P;P	0.51147	0.942;0.905	P;B	0.50659	0.647;0.444	T	0.26608	-1.0098	10	0.11182	T	0.66	.	14.4504	0.67382	0.0:0.0:1.0:0.0	.	119;119	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	A	119	ENSP00000384182:P119A;ENSP00000373592:P119A	ENSP00000373592:P119A	P	-	1	0	SCFD2	53926511	0.366000	0.25014	0.324000	0.25361	0.160000	0.22226	1.139000	0.31504	2.873000	0.98535	0.561000	0.74099	CCA		0.597	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		21	26	0	0	0	0.012319	0	21	26				
IL2	3558	broad.mit.edu	37	4	123377319	123377319	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:123377319T>A	ENST00000226730.4	-	2	471	c.187A>T	c.(187-189)Aag>Tag	p.K63*		NM_000586.3	NP_000577.2	P60568	IL2_HUMAN	interleukin 2	63					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|immune response (GO:0006955)|natural killer cell activation (GO:0030101)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of heart contraction (GO:0045822)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of T cell homeostatic proliferation (GO:0046013)|T cell differentiation (GO:0030217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|cytokine activity (GO:0005125)|glycosphingolipid binding (GO:0043208)|growth factor activity (GO:0008083)|interleukin-2 receptor binding (GO:0005134)|kinase activator activity (GO:0019209)			endometrium(2)|large_intestine(4)|lung(6)|skin(1)	13				LUSC - Lung squamous cell carcinoma(721;0.185)	Pseudoephedrine(DB00852)	ATGTAAAACTTAAATGTGAGC	0.284			T	TNFRSF17	intestinal T-cell lymphoma																																		uc003ier.2		NA		Dom	yes		4	4q26-q27	3558	T	interleukin 2			L	TNFRSF17		intestinal T-cell lymphoma		0				skin(1)	1						c.(187-189)AAG>TAG		interleukin 2 precursor							97.0	100.0	99.0					4																	123377319		2203	4297	6500	SO:0001587	stop_gained	3558				anti-apoptosis|cell adhesion|cell-cell signaling|immune response|natural killer cell activation|negative regulation of B cell apoptosis|positive regulation of activated T cell proliferation|positive regulation of B cell proliferation|positive regulation of cell growth|positive regulation of interleukin-17 production|positive regulation of tyrosine phosphorylation of Stat5 protein|T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-2 receptor binding|kinase activator activity	g.chr4:123377319T>A	U25676	CCDS3726.1	4q26-q27	2011-07-14			ENSG00000109471	ENSG00000109471		"""Interleukins and interleukin receptors"""	6001	protein-coding gene	gene with protein product	"""T cell growth factor"""	147680				3260003	Standard	NM_000586		Approved	IL-2, TCGF	uc003ier.3	P60568	OTTHUMG00000133075	ENST00000226730.4:c.187A>T	4.37:g.123377319T>A	ENSP00000226730:p.Lys63*		Somatic					p.K63*	NM_000586	NP_000577	WXS	Illumina HiSeq	Unspecified	P60568	IL2_HUMAN		LUSC - Lung squamous cell carcinoma(721;0.185)	2	242	-			63					P01585	Nonsense_Mutation	SNP	ENST00000226730.4	37	c.187A>T	CCDS3726.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117930	0.77323	.	.	ENSG00000109471	ENST00000226730	.	.	.	5.81	0.323	0.15893	.	0.528750	0.17665	N	0.166166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9443	4.1193	0.10098	0.0:0.194:0.3603:0.4457	.	.	.	.	X	63	.	ENSP00000226730:K63X	K	-	1	0	IL2	123596769	0.012000	0.17670	0.005000	0.12908	0.315000	0.28087	0.240000	0.18042	0.439000	0.26476	0.482000	0.46254	AAG		0.284	IL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256715.2			15	41	0	0	0	0.003163	0	15	41				
PCDH18	54510	broad.mit.edu	37	4	138442835	138442835	+	Missense_Mutation	SNP	G	G	T	rs139751813		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:138442835G>T	ENST00000344876.4	-	4	3142	c.2756C>A	c.(2755-2757)aCg>aAg	p.T919K	PCDH18_ENST00000511115.1_Missense_Mutation_p.T99K|PCDH18_ENST00000510305.1_Missense_Mutation_p.T130K|PCDH18_ENST00000507846.1_Missense_Mutation_p.T698K|PCDH18_ENST00000412923.2_Missense_Mutation_p.T918K	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	919	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GCACTCCTCCGTGCAGAGTCT	0.433																																							uc003ihe.3		NA																	0				pancreas(3)|skin(2)	5						c.(2755-2757)ACG>AAG		protocadherin 18 precursor							91.0	94.0	93.0					4																	138442835		2203	4299	6502	SO:0001583	missense	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138442835G>T	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2756C>A	4.37:g.138442835G>T	ENSP00000355082:p.Thr919Lys		Somatic				PCDH18_uc003ihf.3_Missense_Mutation_p.T911K|PCDH18_uc011cgz.1_Missense_Mutation_p.T130K|PCDH18_uc003ihg.3_Missense_Mutation_p.T698K|PCDH18_uc011cha.1_Missense_Mutation_p.T99K	p.T919K	NM_019035	NP_061908	WXS	Illumina HiSeq	Unspecified	Q9HCL0	PCD18_HUMAN			4	3143	-	all_hematologic(180;0.24)		919			Interaction with DAB1 (By similarity).|Cytoplasmic (Potential).		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	c.2756C>A	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481056	0.63849	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.61040	0.23;0.23;0.14;1.12;1.12	5.55	5.55	0.83447	.	0.000000	0.44483	D	0.000441	T	0.78155	0.4239	M	0.80422	2.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.91635	0.993;0.999;0.966;0.997	T	0.76503	-0.2935	10	0.36615	T	0.2	.	19.5144	0.95157	0.0:0.0:1.0:0.0	.	99;698;918;919	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	K	919;918;698;130;99	ENSP00000355082:T919K;ENSP00000390688:T918K;ENSP00000425903:T698K;ENSP00000424269:T130K;ENSP00000425647:T99K	ENSP00000355082:T919K	T	-	2	0	PCDH18	138662285	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	9.211000	0.95120	2.618000	0.88619	0.655000	0.94253	ACG		0.433	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		67	71	1	0	3.00472e-47	0.01441	4.62155e-47	67	71				
RBM46	166863	broad.mit.edu	37	4	155720682	155720682	+	Silent	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:155720682G>A	ENST00000281722.3	+	4	1603	c.1368G>A	c.(1366-1368)aaG>aaA	p.K456K	RBM46_ENST00000510397.1_Silent_p.K456K|RBM46_ENST00000514866.1_Silent_p.K456K	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	456							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AAGATGCAAAGGAACTGGCAG	0.323																																							uc003ioo.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1366-1368)AAG>AAA		RNA binding motif protein 46							26.0	26.0	26.0					4																	155720682		2039	4221	6260	SO:0001819	synonymous_variant	166863						nucleotide binding|RNA binding	g.chr4:155720682G>A	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.1368G>A	4.37:g.155720682G>A			Somatic				RBM46_uc011cim.1_Silent_p.K456K|RBM46_uc003iop.1_Silent_p.K456K	p.K456K	NM_144979	NP_659416	WXS	Illumina HiSeq	Unspecified	Q8TBY0	RBM46_HUMAN			4	1541	+	all_hematologic(180;0.24)	Renal(120;0.0854)	456					B3KWU8|B4DZ27	Silent	SNP	ENST00000281722.3	37	c.1368G>A	CCDS3790.1																																																																																				0.323	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979		3	18	0	0	0	0.009096	0	3	18				
NAF1	92345	broad.mit.edu	37	4	164087830	164087830	+	Missense_Mutation	SNP	T	T	A	rs113104155		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:164087830T>A	ENST00000274054.2	-	1	243	c.50A>T	c.(49-51)aAt>aTt	p.N17I	NAF1_ENST00000422287.2_Missense_Mutation_p.N17I	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	17					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GTCGGTGCCATTGAATTTCAG	0.657																																							uc003iqj.2		NA																	0				ovary(2)	2						c.(49-51)AAT>ATT		nuclear assembly factor 1 homolog isoform a							20.0	26.0	24.0					4																	164087830		2119	4254	6373	SO:0001583	missense	92345				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding	g.chr4:164087830T>A		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.50A>T	4.37:g.164087830T>A	ENSP00000274054:p.Asn17Ile		Somatic				NAF1_uc010iqw.1_Missense_Mutation_p.N17I|NAF1_uc003iqk.2_RNA	p.N17I	NM_138386	NP_612395	WXS	Illumina HiSeq	Unspecified	Q96HR8	NAF1_HUMAN			1	244	-	all_hematologic(180;0.166)	Prostate(90;0.109)	17					D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	c.50A>T	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.373424	0.42105	.	.	ENSG00000145414	ENST00000422287;ENST00000274054	T;T	0.32988	1.43;1.48	3.24	-3.54	0.04653	.	1.469440	0.04247	N	0.338016	T	0.16727	0.0402	N	0.14661	0.345	0.09310	N	1	P;P	0.39964	0.697;0.697	B;B	0.32289	0.143;0.076	T	0.27739	-1.0065	10	0.45353	T	0.12	0.7453	11.2036	0.48756	0.0:0.8054:0.0:0.1946	.	17;17	E9PAZ2;Q96HR8	.;NAF1_HUMAN	I	17	ENSP00000408963:N17I;ENSP00000274054:N17I	ENSP00000274054:N17I	N	-	2	0	NAF1	164307280	0.000000	0.05858	0.000000	0.03702	0.419000	0.31324	-0.739000	0.04866	-0.922000	0.03789	0.254000	0.18369	AAT		0.657	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386		17	19	0	0	0	0.00499	0	17	19				
NPY1R	4886	broad.mit.edu	37	4	164247218	164247218	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:164247218C>A	ENST00000296533.2	-	2	1020	c.489G>T	c.(487-489)tgG>tgT	p.W163C	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	163					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CAGCAAGGACCCAAATCACAG	0.438																																							uc003iqm.1		NA																	0				lung(1)|pancreas(1)	2						c.(487-489)TGG>TGT		neuropeptide Y receptor Y1							133.0	122.0	125.0					4																	164247218		2203	4300	6503	SO:0001583	missense	4886				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding	g.chr4:164247218C>A		CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.489G>T	4.37:g.164247218C>A	ENSP00000354652:p.Trp163Cys		Somatic				NPY1R_uc011cjj.1_Intron	p.W163C	NM_000909	NP_000900	WXS	Illumina HiSeq	Unspecified	P25929	NPY1R_HUMAN			2	755	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	163			Helical; Name=4; (Potential).		B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	c.489G>T	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989401	0.74589	.	.	ENSG00000164128	ENST00000296533	D	0.88818	-2.43	5.84	5.84	0.93424	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96137	0.8741	H	0.96748	3.875	0.80722	D	1	D	0.54207	0.965	P	0.57620	0.824	D	0.96667	0.9493	10	0.62326	D	0.03	.	20.1512	0.98086	0.0:1.0:0.0:0.0	.	163	P25929	NPY1R_HUMAN	C	163	ENSP00000354652:W163C	ENSP00000354652:W163C	W	-	3	0	NPY1R	164466668	1.000000	0.71417	0.974000	0.42286	0.969000	0.65631	7.772000	0.85439	2.771000	0.95319	0.655000	0.94253	TGG		0.438	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1			57	44	1	0	1.59911e-31	0.01441	2.39126e-31	57	44				
CASP3	836	broad.mit.edu	37	4	185553059	185553059	+	Missense_Mutation	SNP	C	C	A	rs371766825		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:185553059C>A	ENST00000308394.4	-	6	605	c.343G>T	c.(343-345)Gtt>Ttt	p.V115F	CASP3_ENST00000393588.4_Missense_Mutation_p.V115F|CASP3_ENST00000393585.2_Missense_Mutation_p.V115F|CASP3_ENST00000523916.1_Missense_Mutation_p.V115F|CASP3_ENST00000517513.1_Missense_Mutation_p.V115F	NM_004346.3	NP_004337.2	P42574	CASP3_HUMAN	caspase 3, apoptosis-related cysteine peptidase	115					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell homeostasis (GO:0001782)|cell fate commitment (GO:0045165)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte differentiation (GO:0030218)|execution phase of apoptosis (GO:0097194)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|heart development (GO:0007507)|hippo signaling (GO:0035329)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|keratinocyte differentiation (GO:0030216)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|proteolysis (GO:0006508)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|release of cytochrome c from mitochondria (GO:0001836)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:0097200)|peptidase activity (GO:0008233)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	Minocycline(DB01017)	AGCACACAAACAAAACTGCTC	0.338																																							uc003iwh.2		NA																	0				kidney(1)	1						c.(343-345)GTT>TTT		caspase 3 preproprotein	Melatonin(DB01065)|Minocycline(DB01017)|Simvastatin(DB00641)						102.0	107.0	105.0					4																	185553059		2203	4300	6503	SO:0001583	missense	836				activation of caspase activity by cytochrome c|DNA fragmentation involved in apoptotic nuclear change|negative regulation of apoptosis|nerve growth factor receptor signaling pathway|nuclear fragmentation involved in apoptotic nuclear change|proteolysis|response to tumor necrosis factor	cytosol|mitochondrion|nucleoplasm|plasma membrane	cysteine-type endopeptidase activity|protein binding	g.chr4:185553059C>A	BC016926	CCDS3836.1	4q34	2008-02-05	2005-08-17		ENSG00000164305	ENSG00000164305		"""Caspases"""	1504	protein-coding gene	gene with protein product		600636	"""caspase 3, apoptosis-related cysteine protease"""			8780721	Standard	NM_004346		Approved	CPP32, CPP32B, Yama, apopain	uc003iwi.3	P42574	OTTHUMG00000133681	ENST00000308394.4:c.343G>T	4.37:g.185553059C>A	ENSP00000311032:p.Val115Phe		Somatic				CASP3_uc003iwg.2_Missense_Mutation_p.V115F|CASP3_uc003iwi.2_Missense_Mutation_p.V115F	p.V115F	NM_004346	NP_004337	WXS	Illumina HiSeq	Unspecified	P42574	CASP3_HUMAN		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	6	606	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)	115					A8K5M2|D3DP53|Q96AN1|Q96KP2	Missense_Mutation	SNP	ENST00000308394.4	37	c.343G>T	CCDS3836.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308435	0.60305	.	.	ENSG00000164305	ENST00000308394;ENST00000393585;ENST00000523916;ENST00000438467;ENST00000517513;ENST00000393588;ENST00000447121	T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;1.9	5.89	-7.16	0.01516	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.531074	0.20597	N	0.089228	T	0.65801	0.2726	M	0.74389	2.26	0.58432	D	0.999995	D;D	0.76494	0.992;0.999	D;D	0.69824	0.954;0.966	T	0.73585	-0.3936	10	0.72032	D	0.01	.	23.7544	0.99985	0.0:0.8857:0.0:0.1143	.	115;115	P42574;A8MVM1	CASP3_HUMAN;.	F	115;115;115;124;115;115;115	ENSP00000311032:V115F;ENSP00000377210:V115F;ENSP00000428929:V115F;ENSP00000428372:V115F;ENSP00000377213:V115F;ENSP00000407142:V115F	ENSP00000311032:V115F	V	-	1	0	CASP3	185790053	0.979000	0.34478	0.065000	0.19835	0.476000	0.33039	0.729000	0.26028	-1.478000	0.01869	-0.291000	0.09656	GTT		0.338	CASP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257885.2	NM_004346		38	73	1	0	6.48837e-15	0.010771	8.45057e-15	38	73				
SLC12A7	10723	broad.mit.edu	37	5	1064054	1064054	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:1064054C>A	ENST00000264930.5	-	20	2687	c.2644G>T	c.(2644-2646)Gcc>Tcc	p.A882S	MIR4635_ENST00000583759.1_RNA	NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	882					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCCACCTGGGCCACGGTGAAG	0.627																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(2644-2646)GCC>TCC		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						128.0	100.0	110.0					5																	1064054		2202	4300	6502	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1064054C>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2644G>T	5.37:g.1064054C>A	ENSP00000264930:p.Ala882Ser		Somatic					p.A882S	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		20	2710	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		882			Cytoplasmic (Potential).		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.2644G>T	CCDS34129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.47|17.47	3.398005|3.398005	0.62177|0.62177	.|.	.|.	ENSG00000113504|ENSG00000113504	ENST00000264930|ENST00000513223	D|.	0.90197|.	-2.63|.	4.25|4.25	4.25|4.25	0.50352|0.50352	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78978|0.78978	0.4369|0.4369	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D|.	0.57899|.	0.981|.	P|.	0.46585|.	0.521|.	T|T	0.82827|0.82827	-0.0265|-0.0265	10|5	0.51188|.	T|.	0.08|.	.|.	15.1764|15.1764	0.72916|0.72916	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	882|.	Q9Y666|.	S12A7_HUMAN|.	S|V	882|239	ENSP00000264930:A882S|.	ENSP00000264930:A882S|.	A|G	-|-	1|2	0|0	SLC12A7|SLC12A7	1117054|1117054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.223000|0.223000	0.24884|0.24884	6.870000|6.870000	0.75526|0.75526	1.921000|1.921000	0.55644|0.55644	0.305000|0.305000	0.20034|0.20034	GCC|GGC		0.627	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		23	40	1	0	4.16121e-05	0.00278	4.51031e-05	23	40				
PRDM9	56979	broad.mit.edu	37	5	23527869	23527869	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:23527869G>T	ENST00000296682.3	+	11	2854	c.2672G>T	c.(2671-2673)aGg>aTg	p.R891M		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	891					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						TACGTCTGCAGGGAGGATGAG	0.522										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2671-2673)AGG>ATG		PR domain containing 9							52.0	60.0	58.0					5																	23527869		2160	4287	6447	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527869G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2672G>T	5.37:g.23527869G>T	ENSP00000296682:p.Arg891Met	HNSCC(3;0.000094)	Somatic					p.R891M	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	2854	+			891					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.2672G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	3.982	-0.006142	0.07773	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.15487	2.42	1.96	-2.88	0.05682	.	.	.	.	.	T	0.17365	0.0417	L	0.28014	0.82	0.09310	N	1	D	0.64830	0.994	P	0.62014	0.897	T	0.10847	-1.0612	9	0.59425	D	0.04	-0.0688	0.6349	0.00801	0.4149:0.1781:0.2278:0.1793	.	891	Q9NQV7	PRDM9_HUMAN	M	891;405	ENSP00000296682:R891M	ENSP00000253473:R405M	R	+	2	0	PRDM9	23563626	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.598000	0.05706	-0.888000	0.03956	-0.465000	0.05216	AGG		0.522	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		17	47	1	0	7.05477e-17	0.00499	9.45514e-17	17	47				
IL7R	3575	broad.mit.edu	37	5	35876359	35876359	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:35876359C>A	ENST00000303115.3	+	8	1280	c.1151C>A	c.(1150-1152)tCt>tAt	p.S384Y	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	384				S -> P (in Ref. 7; AAH67537). {ECO:0000305}.	B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.S384F(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ATTCTCTCCTCTTCCAGGTCC	0.542			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					1	Substitution - Missense(1)		skin(1)	ovary(3)|breast(1)|skin(1)	5						c.(1150-1152)TCT>TAT		interleukin 7 receptor precursor							95.0	86.0	89.0					5																	35876359		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876359C>A	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1151C>A	5.37:g.35876359C>A	ENSP00000306157:p.Ser384Tyr		Somatic				IL7R_uc011cop.1_RNA	p.S384Y	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1240	+	all_lung(31;0.00015)		384	S -> P (in Ref. 7; AAH67537).		Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1151C>A	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	C	9.677	1.148200	0.21288	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.41758	1.21;0.99	5.6	1.59	0.23543	.	1.417080	0.03902	N	0.280486	T	0.49321	0.1550	M	0.64997	1.995	0.09310	N	0.999999	D	0.56521	0.976	P	0.47744	0.556	T	0.38993	-0.9635	10	0.56958	D	0.05	-15.3293	8.6826	0.34218	0.0:0.4754:0.4424:0.0822	.	384	P16871	IL7RA_HUMAN	Y	384;150	ENSP00000306157:S384Y;ENSP00000420923:S150Y	ENSP00000306157:S384Y	S	+	2	0	IL7R	35912116	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	0.607000	0.24209	0.300000	0.22699	-0.165000	0.13383	TCT		0.542	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			31	38	1	0	1.56442e-22	0.012213	2.20658e-22	31	38				
LMBRD2	92255	broad.mit.edu	37	5	36122394	36122394	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:36122394T>A	ENST00000296603.4	-	9	1570	c.1108A>T	c.(1108-1110)Aat>Tat	p.N370Y		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	370						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AATGTAGGATTATAAAAATAT	0.294																																							uc003jkb.1		NA																	0					0						c.(1108-1110)AAT>TAT		LMBR1 domain containing 2							56.0	63.0	60.0					5																	36122394		2203	4299	6502	SO:0001583	missense	92255					integral to membrane		g.chr5:36122394T>A		CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.1108A>T	5.37:g.36122394T>A	ENSP00000296603:p.Asn370Tyr		Somatic					p.N370Y	NM_001007527	NP_001007528	WXS	Illumina HiSeq	Unspecified	Q68DH5	LMBD2_HUMAN	Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		9	1523	-	all_lung(31;0.000146)		370			Cytoplasmic (Potential).		B3KRB6|Q9NTC7	Missense_Mutation	SNP	ENST00000296603.4	37	c.1108A>T	CCDS34145.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.080987	0.55753	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	T	0.32988	1.43	5.69	4.46	0.54185	LMBR1-like membrane protein (1);	0.293288	0.35040	N	0.003481	T	0.21761	0.0524	N	0.14661	0.345	0.36783	D	0.884454	B	0.27971	0.196	B	0.34452	0.183	T	0.26430	-1.0103	10	0.66056	D	0.02	-12.7047	11.7141	0.51641	0.1322:0.0:0.0:0.8678	.	370	Q68DH5	LMBD2_HUMAN	Y	370;264	ENSP00000296603:N370Y	ENSP00000296603:N370Y	N	-	1	0	LMBRD2	36158151	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.890000	0.69774	2.147000	0.66899	0.528000	0.53228	AAT		0.294	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367552.1	NM_001007527		17	27	0	0	0	0.007413	0	17	27				
PAIP1	10605	broad.mit.edu	37	5	43537010	43537010	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:43537010T>A	ENST00000306846.3	-	6	1115	c.883A>T	c.(883-885)Att>Ttt	p.I295F	PAIP1_ENST00000338972.4_Missense_Mutation_p.I183F|PAIP1_ENST00000514514.1_Missense_Mutation_p.I216F|PAIP1_ENST00000436644.2_Missense_Mutation_p.I216F	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	295	MIF4G.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)			endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					ACCTGAAGAATATCTGCTCTT	0.338																																							uc003job.2		NA																	0				ovary(1)	1						c.(883-885)ATT>TTT		poly(A) binding protein interacting protein 1							73.0	70.0	71.0					5																	43537010		2203	4300	6503	SO:0001583	missense	10605				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity	g.chr5:43537010T>A	AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.883A>T	5.37:g.43537010T>A	ENSP00000302768:p.Ile295Phe		Somatic				PAIP1_uc003joa.2_Missense_Mutation_p.I216F|PAIP1_uc010ivp.2_Missense_Mutation_p.I216F|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.I183F	p.I295F	NM_006451	NP_006442	WXS	Illumina HiSeq	Unspecified	Q9H074	PAIP1_HUMAN			6	1130	-	Lung NSC(6;2.07e-05)		295			MIF4G.		A6NKV8|O60455|Q96B61|Q9BS63	Missense_Mutation	SNP	ENST00000306846.3	37	c.883A>T	CCDS3947.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.551807	0.86127	.	.	ENSG00000172239	ENST00000306846;ENST00000436644;ENST00000338972;ENST00000514514;ENST00000511321	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	5.61	3.29	0.37713	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.155671	0.56097	D	0.000025	T	0.42562	0.1208	M	0.80616	2.505	0.58432	D	0.999996	D;D;P	0.61697	0.99;0.988;0.938	P;P;P	0.55112	0.622;0.769;0.453	T	0.47341	-0.9125	10	0.66056	D	0.02	-9.634	10.3852	0.44136	0.0:0.1196:0.0:0.8804	.	216;295;216	D6REB4;Q9H074;Q9H074-2	.;PAIP1_HUMAN;.	F	295;216;183;216;183	ENSP00000302768:I295F;ENSP00000387729:I216F;ENSP00000339622:I183F;ENSP00000425084:I216F;ENSP00000425675:I183F	ENSP00000302768:I295F	I	-	1	0	PAIP1	43572767	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.118000	0.50414	2.140000	0.66376	0.528000	0.53228	ATT		0.338	PAIP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214024.1	NM_006451		6	65	0	0	0	0.001984	0	6	65				
ANKRD55	79722	broad.mit.edu	37	5	55472081	55472081	+	Silent	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:55472081A>G	ENST00000341048.4	-	4	361	c.210T>C	c.(208-210)tcT>tcC	p.S70S	ANKRD55_ENST00000504958.2_Silent_p.S70S|ANKRD55_ENST00000513241.2_Silent_p.S41S	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	70										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CTTGACGTCCAGAAACCGCAT	0.493																																							uc003jqu.2		NA																	0				skin(1)	1						c.(208-210)TCT>TCC		ankyrin repeat domain 55 isoform 1							166.0	142.0	150.0					5																	55472081		2203	4300	6503	SO:0001819	synonymous_variant	79722							g.chr5:55472081A>G	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.210T>C	5.37:g.55472081A>G			Somatic					p.S70S	NM_024669	NP_078945	WXS	Illumina HiSeq	Unspecified	Q3KP44	ANR55_HUMAN			4	362	-		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)	69			ANK 2.		B3KVT8|Q3KP45|Q9HAD3	Silent	SNP	ENST00000341048.4	37	c.210T>C	CCDS34161.1																																																																																				0.493	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		42	108	0	0	0	0.010771	0	42	108				
PIK3R1	5295	broad.mit.edu	37	5	67575530	67575530	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:67575530C>T	ENST00000521381.1	+	5	1219	c.603C>T	c.(601-603)gcC>gcT	p.A201A	PIK3R1_ENST00000396611.1_Silent_p.A201A|PIK3R1_ENST00000274335.5_Silent_p.A201A|PIK3R1_ENST00000521657.1_Silent_p.A201A	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	201	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TTCCAGCAGCCGTTTACAGTG	0.433			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																													uc003jva.2		NA		Rec	yes		5	5q13.1	5295	Mis|F|O	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""			"""E, O"""			gliobastoma|ovarian|colorectal		2	Whole gene deletion(1)|Unknown(1)	p.?(1)	large_intestine(1)|lung(1)	endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101						c.(601-603)GCC>GCT		phosphoinositide-3-kinase, regulatory subunit 1	Isoproterenol(DB01064)						159.0	147.0	151.0					5																	67575530		2203	4300	6503	SO:0001819	synonymous_variant	5295				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	g.chr5:67575530C>T	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.603C>T	5.37:g.67575530C>T		TCGA GBM(4;<1E-08)	Somatic				PIK3R1_uc003jvb.2_Silent_p.A201A	p.A201A	NM_181523	NP_852664	WXS	Illumina HiSeq	Unspecified	P27986	P85A_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	5	1163	+		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)	201			Rho-GAP.		B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	37	c.603C>T	CCDS3993.1																																																																																				0.433	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504		43	58	0	0	0	0.01441	0	43	58				
TSLP	85480	broad.mit.edu	37	5	110407631	110407631	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:110407631A>T	ENST00000344895.3	+	1	242	c.43A>T	c.(43-45)Agg>Tgg	p.R15W	TSLP_ENST00000420978.2_Missense_Mutation_p.R15W|TSLP_ENST00000379706.4_5'Flank	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	15						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGTTTCTTTCAGGAAAATCTT	0.408																																							uc003kpb.2		NA																	0					0						c.(43-45)AGG>TGG		thymic stromal lymphopoietin isoform 1							217.0	198.0	205.0					5																	110407631		2202	4300	6502	SO:0001583	missense	85480					extracellular space	cytokine activity	g.chr5:110407631A>T	BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.43A>T	5.37:g.110407631A>T	ENSP00000339804:p.Arg15Trp		Somatic				TSLP_uc003kpa.2_RNA|TSLP_uc010jbt.1_5'Flank	p.R15W	NM_033035	NP_149024	WXS	Illumina HiSeq	Unspecified	Q969D9	TSLP_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)	1	242	+		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)	15					Q8IW99	Missense_Mutation	SNP	ENST00000344895.3	37	c.43A>T	CCDS4101.1	.	.	.	.	.	.	.	.	.	.	A	18.87	3.714482	0.68730	.	.	ENSG00000145777	ENST00000420978;ENST00000344895	.	.	.	5.81	5.81	0.92471	.	0.227078	0.31697	N	0.007216	T	0.65133	0.2662	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68640	-0.5355	9	0.87932	D	0	-4.4833	12.5512	0.56227	1.0:0.0:0.0:0.0	.	15	Q969D9	TSLP_HUMAN	W	15	.	ENSP00000339804:R15W	R	+	1	2	TSLP	110435530	1.000000	0.71417	0.996000	0.52242	0.246000	0.25737	2.744000	0.47450	2.217000	0.71921	0.533000	0.62120	AGG		0.408	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250717.1	NM_033035		51	67	0	0	0	0.01441	0	51	67				
FBN2	2201	broad.mit.edu	37	5	127782228	127782228	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:127782228C>G	ENST00000508053.1	-	13	1872	c.898G>C	c.(898-900)Gaa>Caa	p.E300Q	FBN2_ENST00000262464.4_Missense_Mutation_p.E300Q|FBN2_ENST00000508989.1_Missense_Mutation_p.E267Q			P35556	FBN2_HUMAN	fibrillin 2	300	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CATCTGCATTCAAAAGAGCCC	0.428																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(898-900)GAA>CAA		fibrillin 2 precursor							147.0	132.0	137.0					5																	127782228		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127782228C>G	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.898G>C	5.37:g.127782228C>G	ENSP00000424571:p.Glu300Gln		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.E267Q|FBN2_uc003kuw.3_Missense_Mutation_p.E300Q|FBN2_uc003kux.1_Missense_Mutation_p.E300Q	p.E300Q	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	7	1337	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	300			EGF-like 4; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.898G>C	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797359	0.70567	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	4.81	4.81	0.61882	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.382213	0.24256	N	0.040130	T	0.80116	0.4564	N	0.01235	-0.94	0.44652	D	0.997634	P;B;B;B	0.35745	0.518;0.118;0.186;0.074	B;B;B;B	0.36464	0.225;0.088;0.212;0.093	T	0.81138	-0.1069	10	0.24483	T	0.36	.	17.5047	0.87741	0.0:1.0:0.0:0.0	.	267;300;267;300	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	Q	300;300;267;300	ENSP00000262464:E300Q;ENSP00000424571:E300Q;ENSP00000425596:E267Q;ENSP00000424753:E300Q	ENSP00000262464:E300Q	E	-	1	0	FBN2	127810127	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.638000	0.61353	2.613000	0.88420	0.650000	0.86243	GAA		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		38	67	0	0	0	0.005524	0	38	67				
FNIP1	96459	broad.mit.edu	37	5	131080266	131080266	+	Missense_Mutation	SNP	T	T	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:131080266T>C	ENST00000510461.1	-	2	305	c.210A>G	c.(208-210)atA>atG	p.I70M	CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.I70M|FNIP1_ENST00000307968.7_Missense_Mutation_p.I70M|FNIP1_ENST00000307954.8_Missense_Mutation_p.I70M|FNIP1_ENST00000511848.1_Missense_Mutation_p.I70M	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	70					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CCGATACTGATATGTCCTCAT	0.368																																						Melanoma(168;435 1955 13113 13877 23213)	uc003kvp.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(208-210)ATA>ATG		PDZ domain-containing guanine nucleotide							154.0	141.0	145.0					5																	131080266		2203	4300	6503	SO:0001583	missense	51735				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding	g.chr5:131080266T>C	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.210A>G	5.37:g.131080266T>C	ENSP00000421985:p.Ile70Met		Somatic				FNIP1_uc003kvs.1_Missense_Mutation_p.I70M|FNIP1_uc003kvt.1_Missense_Mutation_p.I70M|FNIP1_uc010jdm.1_Missense_Mutation_p.I70M|FNIP1_uc003kvu.2_Missense_Mutation_p.I70M	p.I70M	NM_016340	NP_057424	WXS	Illumina HiSeq	Unspecified	Q8TEU7	RPGF6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)	2	352	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	c.210A>G	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	T	12.11	1.839673	0.32513	.	.	ENSG00000217128	ENST00000514667;ENST00000307968;ENST00000307954;ENST00000510461;ENST00000511848	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.88	3.53	0.40419	.	.	.	.	.	T	0.20700	0.0498	N	0.14661	0.345	0.22581	N	0.998964	B;B;B;B;B	0.29805	0.002;0.001;0.001;0.0;0.257	B;B;B;B;B	0.21360	0.002;0.002;0.002;0.006;0.034	T	0.11372	-1.0590	9	0.28530	T	0.3	-4.2153	4.3094	0.10964	0.1479:0.2189:0.0:0.6331	.	70;70;70;70;70	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40;E9PCH4	.;.;.;FNIP1_HUMAN;.	M	70	ENSP00000426948:I70M;ENSP00000309266:I70M;ENSP00000310453:I70M;ENSP00000421985:I70M;ENSP00000425619:I70M	ENSP00000310453:I70M	I	-	3	3	FNIP1	131108165	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.971000	0.29396	1.042000	0.40150	0.533000	0.62120	ATA		0.368	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		38	51	0	0	0	0.011902	0	38	51				
DCANP1	140947	broad.mit.edu	37	5	134782574	134782574	+	Silent	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:134782574G>T	ENST00000503143.2	-	1	464	c.225C>A	c.(223-225)acC>acA	p.T75T	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN		75			T -> P (in dbSNP:rs1031844).			nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGCTGGCAAGGTTTTGTTCC	0.602																																							uc003lav.2		NA																	0					0						c.(223-225)ACC>ACA		dendritic cell nuclear protein 1							29.0	32.0	31.0					5																	134782574		2203	4300	6503	SO:0001819	synonymous_variant	140947					nucleus		g.chr5:134782574G>T																												ENST00000503143.2:c.225C>A	5.37:g.134782574G>T			Somatic					p.T75T	NM_130848	NP_570900	WXS	Illumina HiSeq	Unspecified	Q8TF63	DCNP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		1	465	-			75						Silent	SNP	ENST00000503143.2	37	c.225C>A	CCDS4186.1																																																																																				0.602	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372531.1			13	43	1	0	1.05317e-09	0.00245	1.23251e-09	13	43				
PCDHA7	56141	broad.mit.edu	37	5	140215502	140215502	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140215502G>T	ENST00000525929.1	+	1	1534	c.1534G>T	c.(1534-1536)Gcg>Tcg	p.A512S	PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A512S|PCDHA5_ENST00000529619.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCAGTGCACGCGGAGAGCGG	0.701																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(1534-1536)GCG>TCG		protocadherin alpha 7 isoform 1 precursor							68.0	73.0	71.0					5																	140215502		2203	4296	6499	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215502G>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1534G>T	5.37:g.140215502G>T	ENSP00000436426:p.Ala512Ser		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A512S	p.A512S	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1534	+			512			Cadherin 5.|Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.1534G>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	1.582	-0.531281	0.04112	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.51325	0.71;0.71	4.01	1.99	0.26369	Cadherin (4);Cadherin-like (1);	0.305910	0.16548	U	0.209624	T	0.25195	0.0612	N	0.00864	-1.135	0.22142	N	0.999335	B;B	0.33940	0.433;0.407	B;P	0.50136	0.309;0.632	T	0.46638	-0.9177	10	0.06365	T	0.9	.	9.3167	0.37939	0.0:0.1097:0.5252:0.365	.	512;512	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	S	512	ENSP00000436426:A512S;ENSP00000367365:A512S	ENSP00000367365:A512S	A	+	1	0	PCDHA7	140195686	0.000000	0.05858	1.000000	0.80357	0.538000	0.34931	-0.347000	0.07750	0.781000	0.33589	0.306000	0.20318	GCG		0.701	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		76	96	1	0	3.83088e-25	0.01441	5.4751e-25	76	96				
PCDHB3	56132	broad.mit.edu	37	5	140480970	140480970	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140480970T>A	ENST00000231130.2	+	1	737	c.737T>A	c.(736-738)cTc>cAc	p.L246H	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	246					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACAGCCGCTCTATGAGGTT	0.493																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(736-738)CTC>CAC		protocadherin beta 3 precursor							62.0	68.0	66.0					5																	140480970		2202	4300	6502	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140480970T>A	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.737T>A	5.37:g.140480970T>A	ENSP00000231130:p.Leu246His		Somatic				uc003lin.2_Intron	p.L246H	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	737	+			246			Extracellular (Potential).		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.737T>A	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	T	8.832	0.940203	0.18281	.	.	ENSG00000113205	ENST00000231130	T	0.61980	0.06	4.93	3.69	0.42338	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.61148	0.2324	L	0.28608	0.87	0.18873	N	0.999982	D	0.64830	0.994	P	0.60345	0.873	T	0.47471	-0.9115	9	0.27082	T	0.32	.	7.9912	0.30242	0.1321:0.0:0.1366:0.7312	.	246	Q9Y5E6	PCDB3_HUMAN	H	246	ENSP00000231130:L246H	ENSP00000231130:L246H	L	+	2	0	PCDHB3	140461154	0.000000	0.05858	0.980000	0.43619	0.048000	0.14542	0.013000	0.13310	1.975000	0.57531	0.533000	0.62120	CTC		0.493	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		53	65	0	0	0	0.01441	0	53	65				
PCDHB3	56132	broad.mit.edu	37	5	140481614	140481614	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140481614C>T	ENST00000231130.2	+	1	1381	c.1381C>T	c.(1381-1383)Cgc>Tgc	p.R461C	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	461	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGTTCGTCCGCGAGAACAA	0.602																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1381-1383)CGC>TGC		protocadherin beta 3 precursor							86.0	84.0	85.0					5																	140481614		2203	4296	6499	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140481614C>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1381C>T	5.37:g.140481614C>T	ENSP00000231130:p.Arg461Cys		Somatic				uc003lin.2_Intron	p.R461C	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1381	+			461			Extracellular (Potential).|Cadherin 5.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.1381C>T	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639790	0.47153	.	.	ENSG00000113205	ENST00000231130	T	0.01767	4.65	4.26	3.37	0.38596	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.10423	0.0255	M	0.86178	2.8	0.09310	N	1	D	0.89917	1.0	D	0.67725	0.953	T	0.03673	-1.1014	9	0.59425	D	0.04	.	11.947	0.52934	0.4505:0.5495:0.0:0.0	.	461	Q9Y5E6	PCDB3_HUMAN	C	461	ENSP00000231130:R461C	ENSP00000231130:R461C	R	+	1	0	PCDHB3	140461798	0.000000	0.05858	0.952000	0.39060	0.974000	0.67602	-0.003000	0.12901	0.893000	0.36288	0.563000	0.77884	CGC		0.602	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		113	111	0	0	0	0.01441	0	113	111				
PCDHB11	56125	broad.mit.edu	37	5	140580431	140580431	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140580431G>C	ENST00000354757.3	+	1	1084	c.1084G>C	c.(1084-1086)Gag>Cag	p.E362Q	PCDHB11_ENST00000536699.1_5'UTR	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	362	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATACGCCAGAGACCGTGGT	0.408																																							uc003liy.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1084-1086)GAG>CAG		protocadherin beta 11 precursor							111.0	110.0	110.0					5																	140580431		2203	4300	6503	SO:0001583	missense	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140580431G>C	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1084G>C	5.37:g.140580431G>C	ENSP00000346802:p.Glu362Gln		Somatic				PCDHB11_uc011daj.1_5'UTR	p.E362Q	NM_018931	NP_061754	WXS	Illumina HiSeq	Unspecified	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1084	+			362			Extracellular (Potential).|Cadherin 4.		B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	c.1084G>C	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375735	0.61735	.	.	ENSG00000197479	ENST00000354757;ENST00000536825	T	0.72615	-0.67	2.52	2.52	0.30459	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.83755	0.5323	M	0.90082	3.085	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.83848	0.0261	9	0.51188	T	0.08	.	8.4432	0.32826	0.1257:0.0:0.8743:0.0	.	362	Q9Y5F2	PCDBB_HUMAN	Q	362;52	ENSP00000346802:E362Q	ENSP00000346802:E362Q	E	+	1	0	PCDHB11	140560615	0.920000	0.31207	0.012000	0.15200	0.378000	0.30076	4.568000	0.60857	1.417000	0.47077	0.306000	0.20318	GAG		0.408	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		38	79	0	0	0	0.004878	0	38	79				
PCDHGA2	56113	broad.mit.edu	37	5	140720243	140720243	+	Missense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140720243A>T	ENST00000394576.2	+	1	1705	c.1705A>T	c.(1705-1707)Aca>Tca	p.T569S	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	569					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTTCCCCACAGACGGTTC	0.637																																							uc003ljk.1		NA																	0				skin(2)|ovary(1)	3						c.(1705-1707)ACA>TCA		protocadherin gamma subfamily A, 2 isoform 1							129.0	132.0	131.0					5																	140720243		2203	4300	6503	SO:0001583	missense	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140720243A>T	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1705A>T	5.37:g.140720243A>T	ENSP00000378077:p.Thr569Ser		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.T569S	p.T569S	NM_018915	NP_061738	WXS	Illumina HiSeq	Unspecified	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1890	+			569			Extracellular (Potential).		Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	c.1705A>T	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	6.670	0.492106	0.12702	.	.	ENSG00000081853	ENST00000394576	T	0.49139	0.79	4.88	3.7	0.42460	Cadherin-like (1);	0.000000	0.42548	U	0.000694	T	0.32704	0.0838	N	0.25201	0.72	0.23030	N	0.998407	B;B	0.32604	0.182;0.377	B;B	0.31614	0.086;0.133	T	0.15983	-1.0418	10	0.42905	T	0.14	.	11.7701	0.51953	0.8524:0.1476:0.0:0.0	.	569;569	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	S	569	ENSP00000378077:T569S	ENSP00000378077:T569S	T	+	1	0	PCDHGA2	140700427	0.000000	0.05858	0.268000	0.24571	0.047000	0.14425	0.442000	0.21628	0.808000	0.34231	0.397000	0.26171	ACA		0.637	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		100	153	0	0	0	0.01441	0	100	153				
PCDHGB3	56102	broad.mit.edu	37	5	140778645	140778645	+	Intron	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140778645G>T	ENST00000576222.1	+	1	2546				PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTAGAAGGGAGGGATGGTG	0.383																																							uc003lkf.1		NA																	0					0						c.(949-951)GGG>GGT		protocadherin gamma subfamily B, 5 isoform 1							106.0	107.0	107.0					5																	140778645		1871	4113	5984	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140778645G>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26269G>T	5.37:g.140778645G>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Silent_p.G317G	p.G317G	NM_018925	NP_061748	WXS	Illumina HiSeq	Unspecified	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	951	+			317			Extracellular (Potential).|Cadherin 3.		A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	37	c.951G>T	CCDS58980.1																																																																																				0.383	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		69	98	1	0	2.69673e-31	0.01441	4.01403e-31	69	98				
PCDHGC5	56097	broad.mit.edu	37	5	140870351	140870351	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:140870351G>T	ENST00000252087.1	+	1	1544	c.1544G>T	c.(1543-1545)cGg>cTg	p.R515L	PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	515	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGATGGACGGATCTTTGCC	0.547																																							uc003lla.1		NA																	0				ovary(3)	3						c.(1543-1545)CGG>CTG		protocadherin gamma subfamily C, 5 isoform 1							94.0	97.0	96.0					5																	140870351		2203	4300	6503	SO:0001583	missense	56097				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140870351G>T	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1544G>T	5.37:g.140870351G>T	ENSP00000252087:p.Arg515Leu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.R515L	p.R515L	NM_018929	NP_061752	WXS	Illumina HiSeq	Unspecified	Q9Y5F6	PCDGM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1544	+			515			Extracellular (Potential).|Cadherin 5.		Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	c.1544G>T	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560694	0.27827	.	.	ENSG00000240764	ENST00000252087	T	0.51325	0.71	5.56	5.56	0.83823	Cadherin (5);Cadherin-like (1);	0.000000	0.51477	D	0.000083	T	0.26882	0.0658	N	0.10645	0.015	0.09310	N	1	P;P	0.50369	0.934;0.54	B;P	0.44359	0.433;0.447	T	0.13548	-1.0505	10	0.33141	T	0.24	.	5.9733	0.19365	0.151:0.1649:0.684:0.0	.	515;515	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	L	515	ENSP00000252087:R515L	ENSP00000252087:R515L	R	+	2	0	PCDHGC5	140850535	0.050000	0.20438	0.993000	0.49108	0.902000	0.53008	2.901000	0.48695	2.890000	0.99128	0.655000	0.94253	CGG		0.547	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		36	99	1	0	5.71845e-15	0.005524	7.47797e-15	36	99				
KCTD16	57528	broad.mit.edu	37	5	143587020	143587020	+	Missense_Mutation	SNP	T	T	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:143587020T>G	ENST00000507359.3	+	2	1834	c.743T>G	c.(742-744)gTg>gGg	p.V248G	KCTD16_ENST00000512467.1_Missense_Mutation_p.V248G	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	248					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TTCCACATGGTGGCCTGTAAC	0.428																																							uc003lnm.1		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(742-744)GTG>GGG		potassium channel tetramerisation domain							95.0	93.0	93.0					5																	143587020		2203	4300	6503	SO:0001583	missense	57528					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr5:143587020T>G	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.743T>G	5.37:g.143587020T>G	ENSP00000426548:p.Val248Gly		Somatic				KCTD16_uc003lnn.1_Missense_Mutation_p.V248G	p.V248G	NM_020768	NP_065819	WXS	Illumina HiSeq	Unspecified	Q68DU8	KCD16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		3	1372	+		all_hematologic(541;0.118)	248					Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	c.743T>G	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111990	0.56398	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.61510	0.1;0.1	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.64768	0.2628	M	0.83774	2.66	0.80722	D	1	P	0.48407	0.91	B	0.42462	0.388	T	0.73307	-0.4024	10	0.87932	D	0	.	15.955	0.79880	0.0:0.0:0.0:1.0	.	248	Q68DU8	KCD16_HUMAN	G	248	ENSP00000424151:V248G;ENSP00000426548:V248G	ENSP00000426548:V248G	V	+	2	0	KCTD16	143567213	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.991000	0.88244	2.181000	0.69327	0.459000	0.35465	GTG		0.428	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368		71	77	0	0	0	0.01441	0	71	77				
SLIT3	6586	broad.mit.edu	37	5	168671714	168671714	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:168671714C>A	ENST00000519560.1	-	3	755	c.336G>T	c.(334-336)gaG>gaT	p.E112D	SLIT3_ENST00000332966.8_Missense_Mutation_p.E112D|SLIT3_ENST00000404867.3_Missense_Mutation_p.E112D|SLIT3_ENST00000521130.1_5'UTR	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	112					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTACAGTCGCTCTAGCTGCT	0.413																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	0				ovary(3)|skin(1)	4						c.(334-336)GAG>GAT		slit homolog 3 precursor							94.0	80.0	85.0					5																	168671714		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168671714C>A	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.336G>T	5.37:g.168671714C>A	ENSP00000430333:p.Glu112Asp		Somatic				SLIT3_uc010jjg.2_Missense_Mutation_p.E112D|SLIT3_uc010jji.2_Missense_Mutation_p.E112D	p.E112D	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		3	756	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	112			LRR 3.		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.336G>T	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.844537	0.51164	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.58940	0.3;0.3;0.3	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000007	T	0.70055	0.3180	L	0.53780	1.695	0.40694	D	0.982429	D;P	0.56035	0.974;0.584	D;B	0.67725	0.953;0.346	T	0.72434	-0.4295	10	0.59425	D	0.04	.	14.2625	0.66094	0.0:1.0:0.0:0.0	.	112;112	O75094-2;O75094	.;SLIT3_HUMAN	D	112	ENSP00000430333:E112D;ENSP00000332164:E112D;ENSP00000384890:E112D	ENSP00000332164:E112D	E	-	3	2	SLIT3	168604292	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	0.919000	0.28692	2.522000	0.85027	0.655000	0.94253	GAG		0.413	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		21	28	1	0	0.00152264	0.010504	0.001602	21	28				
SLC34A1	6569	broad.mit.edu	37	5	176824901	176824901	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:176824901C>T	ENST00000324417.5	+	13	1625	c.1534C>T	c.(1534-1536)Cgc>Tgc	p.R512C	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	512					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCAAGTACCGCTGGTTTGC	0.607																																							uc003mgk.3		NA																	0				ovary(1)	1						c.(1534-1536)CGC>TGC		solute carrier family 34 (sodium phosphate),							141.0	115.0	124.0					5																	176824901		2203	4300	6503	SO:0001583	missense	6569				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr5:176824901C>T	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1534C>T	5.37:g.176824901C>T	ENSP00000321424:p.Arg512Cys		Somatic					p.R512C	NM_003052	NP_003043	WXS	Illumina HiSeq	Unspecified	Q06495	NPT2A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		13	1635	+	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	512			Cytoplasmic (Potential).		B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	c.1534C>T	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278248	0.59758	.	.	ENSG00000131183	ENST00000324417	T	0.38401	1.14	5.22	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.63450	0.2512	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70230	-0.4929	10	0.87932	D	0	-25.3129	13.7309	0.62787	0.0:0.9256:0.0:0.0744	.	512	Q06495	NPT2A_HUMAN	C	512	ENSP00000321424:R512C	ENSP00000321424:R512C	R	+	1	0	SLC34A1	176757507	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	3.855000	0.55957	1.195000	0.43115	0.305000	0.20034	CGC		0.607	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		62	62	0	0	0	0.01441	0	62	62				
FAM153A	285596	broad.mit.edu	37	5	177158588	177158588	+	Missense_Mutation	SNP	G	G	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:177158588G>A	ENST00000440605.3	-	15	896	c.613C>T	c.(613-615)Cca>Tca	p.P205S	FAM153A_ENST00000513554.1_Missense_Mutation_p.P73S|FAM153A_ENST00000393518.3_Intron|FAM153A_ENST00000510276.1_Missense_Mutation_p.P205S	NM_173663.3	NP_775934.3	Q9UHL3	F153A_HUMAN	family with sequence similarity 153, member A	205										kidney(6)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	11	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCGTGGCTGGGTCCACCTGC	0.463																																							uc010jkp.1		NA																	0				skin(1)	1						c.(613-615)CCA>TCA		hypothetical protein LOC285596							63.0	58.0	60.0					5																	177158588		2060	4019	6079	SO:0001583	missense	285596							g.chr5:177158588G>A	AB018295	CCDS34305.1	5q35.3	2010-05-12			ENSG00000170074	ENSG00000170074			29940	protein-coding gene	gene with protein product	"""NY REN 7 antigen"""					10508479, 9872452	Standard	NM_173663		Approved	NY-REN-7	uc003mic.3	Q9UHL3	OTTHUMG00000163394	ENST00000440605.3:c.613C>T	5.37:g.177158588G>A	ENSP00000411506:p.Pro205Ser		Somatic				FAM153A_uc011dgd.1_Intron|FAM153A_uc003mib.1_RNA|FAM153A_uc003mic.2_Missense_Mutation_p.P205S	p.P205S	NM_173663	NP_775934	WXS	Illumina HiSeq	Unspecified	Q9UHL3	F153A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		17	1034	-	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	205					A8K0F3|O94852	Missense_Mutation	SNP	ENST00000440605.3	37	c.613C>T	CCDS34305.1	.	.	.	.	.	.	.	.	.	.	.	0.212	-1.035587	0.02029	.	.	ENSG00000170074	ENST00000440977;ENST00000510276;ENST00000440605;ENST00000513554;ENST00000505531	.	.	.	1.16	-2.32	0.06745	.	.	.	.	.	T	0.13286	0.0322	N	0.14661	0.345	0.09310	N	1	P	0.35481	0.504	B	0.32583	0.148	T	0.09773	-1.0659	8	0.87932	D	0	.	0.6176	0.00772	0.2907:0.2147:0.32:0.1745	.	205	Q9UHL3	F153A_HUMAN	S	282;205;205;73;73	.	ENSP00000353887:P205S	P	-	1	0	FAM153A	177091194	0.021000	0.18746	0.000000	0.03702	0.004000	0.04260	-1.793000	0.01755	-3.292000	0.00194	-1.606000	0.00808	CCA		0.463	FAM153A-022	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417242.1	NM_173663		31	17	0	0	0	0.004289	0	31	17				
MSH5	4439	broad.mit.edu	37	6	31727709	31727709	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:31727709C>A	ENST00000375755.3	+	18	1928	c.1642C>A	c.(1642-1644)Cgt>Agt	p.R548S	MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.R565S|MSH5_ENST00000395853.1_Missense_Mutation_p.R222S|MSH5_ENST00000431848.2_Missense_Mutation_p.R247S|MSH5_ENST00000375750.3_Missense_Mutation_p.R548S|MSH5_ENST00000375742.3_Missense_Mutation_p.R565S|MSH5_ENST00000375740.3_Missense_Mutation_p.R565S|RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000534153.4_Missense_Mutation_p.R565S|MSH5_ENST00000375703.3_Missense_Mutation_p.R548S	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	548					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						CTCAAGGCCGCGTTACTCCCC	0.572								Direct reversal of damage;Mismatch excision repair (MMR)																															uc003nwv.1		NA																	0				ovary(2)|breast(1)	3						c.(1642-1644)CGT>AGT	Direct_reversal_of_damage|MMR	mutS homolog 5 isoform c							49.0	49.0	49.0					6																	31727709		2203	4300	6503	SO:0001583	missense	4439				chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr6:31727709C>A	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1642C>A	6.37:g.31727709C>A	ENSP00000364908:p.Arg548Ser		Somatic				MSH5_uc003nwt.1_Missense_Mutation_p.R565S|MSH5_uc003nwu.1_Missense_Mutation_p.R548S|MSH5_uc003nww.1_Missense_Mutation_p.R548S|MSH5_uc003nwx.1_Missense_Mutation_p.R565S|MSH5_uc011dof.1_Missense_Mutation_p.R247S|MSH5_uc003nwy.1_Missense_Mutation_p.R222S|MSH5_uc003nwz.3_RNA	p.R548S	NM_172166	NP_751898	WXS	Illumina HiSeq	Unspecified	O43196	MSH5_HUMAN			18	1721	+			548					B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	c.1642C>A	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544154	0.27563	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000383401;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000431848;ENST00000395853	D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.97	3.27	0.37495	DNA mismatch repair protein MutS, core (1);DNA mismatch repair protein MutS, C-terminal (1);	0.558696	0.20074	N	0.099815	T	0.55593	0.1930	N	0.25992	0.78	0.29564	N	0.850394	B;B;B;B;B	0.31256	0.316;0.076;0.027;0.002;0.123	B;B;B;B;B	0.31946	0.138;0.052;0.055;0.017;0.052	T	0.37407	-0.9707	9	0.09338	T	0.73	-0.3519	9.4268	0.38586	0.0:0.7701:0.0:0.2299	.	233;565;548;548;565	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	S	548;565;80;548;565;548;565;247;222	ENSP00000364908:R548S;ENSP00000364894:R565S;ENSP00000364903:R548S;ENSP00000431693:R565S;ENSP00000364855:R548S;ENSP00000364892:R565S;ENSP00000416784:R247S;ENSP00000379194:R222S	ENSP00000364855:R548S	R	+	1	0	MSH5	31835688	0.002000	0.14202	0.250000	0.24296	0.519000	0.34347	0.686000	0.25392	0.438000	0.26450	0.591000	0.81541	CGT		0.572	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4			34	59	1	0	4.31634e-10	0.012213	5.16362e-10	34	59				
C6orf222	389384	broad.mit.edu	37	6	36298043	36298043	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:36298043G>C	ENST00000437635.2	-	2	602	c.425C>G	c.(424-426)cCa>cGa	p.P142R		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	142										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						CCTGAGGGCTGGCTCCCCTGC	0.627																																							uc003oly.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(424-426)CCA>CGA		hypothetical protein LOC389384							78.0	67.0	71.0					6																	36298043		2203	4300	6503	SO:0001583	missense	389384							g.chr6:36298043G>C		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.425C>G	6.37:g.36298043G>C	ENSP00000418983:p.Pro142Arg		Somatic					p.P142R	NM_001010903	NP_001010903	WXS	Illumina HiSeq	Unspecified	P0C671	CF222_HUMAN			2	603	-			142					B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	c.425C>G	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944787	0.34283	.	.	ENSG00000189325	ENST00000437635	T	0.55760	0.5	4.27	0.188	0.15114	.	0.546000	0.15474	N	0.260464	T	0.36880	0.0983	L	0.50333	1.59	0.09310	N	1	D	0.57571	0.98	P	0.57152	0.814	T	0.17107	-1.0380	10	0.62326	D	0.03	-30.6244	3.3417	0.07120	0.2027:0.0:0.4425:0.3547	.	142	P0C671	CF222_HUMAN	R	142	ENSP00000418983:P142R	ENSP00000418983:P142R	P	-	2	0	C6orf222	36406021	0.148000	0.22702	0.000000	0.03702	0.671000	0.39405	0.388000	0.20735	-0.087000	0.12528	0.289000	0.19496	CCA		0.627	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903		40	62	0	0	0	0.006999	0	40	62				
PIM1	5292	broad.mit.edu	37	6	37140918	37140918	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:37140918C>T	ENST00000373509.5	+	5	1127	c.754C>T	c.(754-756)Cag>Tag	p.Q252*	PIM1_ENST00000468243.1_3'UTR	NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	343	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CATCAGGGGCCAGGTTTTCTT	0.527			T	BCL6	NHL																																		uc003onk.2		NA		Dom	yes		6	6p21.2	5292	T	pim-1 oncogene			L	BCL6		NHL		0				large_intestine(1)|central_nervous_system(1)	2						c.(754-756)CAG>TAG		non-specific serine/threonine protein kinase	Adenosine monophosphate(DB00131)						104.0	101.0	102.0					6																	37140918		2203	4300	6503	SO:0001587	stop_gained	5292				cell cycle|cell proliferation|multicellular organismal development|negative regulation of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|protein autophosphorylation	cytoplasm|nucleus|plasma membrane	ATP binding|manganese ion binding|protein binding|protein binding|protein serine/threonine kinase activity|transcription factor binding	g.chr6:37140918C>T		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.754C>T	6.37:g.37140918C>T	ENSP00000362608:p.Gln252*		Somatic				PIM1_uc011dtw.1_Silent_p.A120A	p.Q252*	NM_002648	NP_002639	WXS	Illumina HiSeq	Unspecified	P11309	PIM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(102;0.241)		5	1184	+			343			Protein kinase.		Q38RT9|Q5T7H7|Q96RG3	Nonsense_Mutation	SNP	ENST00000373509.5	37	c.754C>T	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	42	9.348304	0.99145	.	.	ENSG00000137193	ENST00000373509	.	.	.	5.35	5.35	0.76521	.	0.211962	0.41712	D	0.000827	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	18.1853	0.89791	0.0:1.0:0.0:0.0	.	.	.	.	X	252	.	ENSP00000362608:Q252X	Q	+	1	0	PIM1	37248896	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	4.676000	0.61627	2.660000	0.90430	0.591000	0.81541	CAG		0.527	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1			4	88	0	0	0	0.000602	0	4	88				
PTCHD4	442213	broad.mit.edu	37	6	47846599	47846599	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:47846599C>G	ENST00000339488.4	-	3	2014	c.1981G>C	c.(1981-1983)Gtt>Ctt	p.V661L		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	661						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GCAATCAGAACAGGCACTGTG	0.483																																							uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(1930-1932)GTT>CTT		hypothetical protein LOC442213							126.0	118.0	121.0					6																	47846599		2203	4300	6503	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846599C>G		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1981G>C	6.37:g.47846599C>G	ENSP00000341914:p.Val661Leu		Somatic				C6orf138_uc011dwn.1_Missense_Mutation_p.V408L	p.V644L	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			3	2015	-			661			Helical; (Potential).		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.1930G>C	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	C	1.330	-0.597027	0.03771	.	.	ENSG00000244694	ENST00000339488	D	0.84516	-1.86	5.91	5.91	0.95273	.	0.058815	0.64402	D	0.000002	T	0.60830	0.2299	N	0.13043	0.29	0.80722	D	1	B	0.13145	0.007	B	0.17098	0.017	T	0.64364	-0.6425	10	0.02654	T	1	.	20.3052	0.98627	0.0:1.0:0.0:0.0	.	661	Q6ZW05	CF138_HUMAN	L	661	ENSP00000341914:V661L	ENSP00000341914:V661L	V	-	1	0	C6orf138	47954558	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.426000	0.59882	2.814000	0.96858	0.650000	0.86243	GTT		0.483	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		45	79	0	0	0	0.011902	0	45	79				
TFAP2D	83741	broad.mit.edu	37	6	50683151	50683151	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:50683151C>T	ENST00000008391.3	+	2	590	c.362C>T	c.(361-363)gCg>gTg	p.A121V		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					AATGCGCGGGCGCTCAAGTCG	0.607																																							uc003paf.2		NA																	0				ovary(6)|breast(1)	7						c.(361-363)GCG>GTG		transcription factor AP-2 beta-like 1							78.0	77.0	77.0					6																	50683151		2203	4300	6503	SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50683151C>T	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.362C>T	6.37:g.50683151C>T	ENSP00000008391:p.Ala121Val		Somatic				TFAP2D_uc011dwt.1_RNA	p.A121V	NM_172238	NP_758438	WXS	Illumina HiSeq	Unspecified	Q7Z6R9	AP2D_HUMAN			2	874	+	Lung NSC(77;0.0334)		121						Missense_Mutation	SNP	ENST00000008391.3	37	c.362C>T	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360522	0.82353	.	.	ENSG00000008197	ENST00000008391	D	0.97209	-4.29	5.21	5.21	0.72293	.	0.444606	0.24354	N	0.039245	D	0.94192	0.8136	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.65874	0.939	D	0.92459	0.5976	10	0.12430	T	0.62	-15.8753	19.1268	0.93388	0.0:1.0:0.0:0.0	.	121	Q7Z6R9	AP2D_HUMAN	V	121	ENSP00000008391:A121V	ENSP00000008391:A121V	A	+	2	0	TFAP2D	50791110	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.604000	0.82830	2.590000	0.87494	0.655000	0.94253	GCG		0.607	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		59	86	0	0	0	0.01441	0	59	86				
HTR1E	3354	broad.mit.edu	37	6	87725995	87725995	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:87725995G>T	ENST00000305344.5	+	2	1646	c.943G>T	c.(943-945)Ggt>Tgt	p.G315C		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	315					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GTTGATTGTGGGTCTGAGCAT	0.498																																							uc003pli.2		NA																	0				ovary(2)|skin(1)	3						c.(943-945)GGT>TGT		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						164.0	168.0	167.0					6																	87725995		2203	4300	6503	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87725995G>T		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.943G>T	6.37:g.87725995G>T	ENSP00000307766:p.Gly315Cys		Somatic					p.G315C	NM_000865	NP_000856	WXS	Illumina HiSeq	Unspecified	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1646	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	315			Extracellular (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.943G>T	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954099	0.34471	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.37235	1.21;1.21	4.51	4.51	0.55191	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000009	T	0.49440	0.1557	M	0.62723	1.935	0.36236	D	0.852936	D	0.89917	1.0	D	0.74674	0.984	T	0.57283	-0.7838	10	0.66056	D	0.02	.	17.1988	0.86901	0.0:0.0:1.0:0.0	.	315	P28566	5HT1E_HUMAN	C	315	ENSP00000307766:G315C;ENSP00000358597:G315C	ENSP00000307766:G315C	G	+	1	0	HTR1E	87782714	1.000000	0.71417	0.992000	0.48379	0.591000	0.36615	5.827000	0.69300	2.062000	0.61559	0.407000	0.27541	GGT		0.498	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		71	55	1	0	7.46257e-40	0.01441	1.13699e-39	71	55				
SYNE1	23345	broad.mit.edu	37	6	152473247	152473247	+	Silent	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr6:152473247C>G	ENST00000367255.5	-	134	24760	c.24159G>C	c.(24157-24159)ctG>ctC	p.L8053L	SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000265368.4_Silent_p.L8053L|SYNE1_ENST00000423061.1_Silent_p.L7982L|SYNE1_ENST00000341594.5_Silent_p.L7665L|SYNE1_ENST00000354674.4_Silent_p.L208L|SYNE1_ENST00000539504.1_Silent_p.L208L|SYNE1_ENST00000448038.1_Silent_p.L7982L|SYNE1_ENST00000356820.4_Silent_p.L2577L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8053					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGCTGCGTCAGGCACTCGT	0.542										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(24157-24159)CTG>CTC		spectrin repeat containing, nuclear envelope 1							90.0	77.0	81.0					6																	152473247		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152473247C>G	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24159G>C	6.37:g.152473247C>G		HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Silent_p.L2577L|SYNE1_uc003qos.3_Silent_p.L2577L|SYNE1_uc003qot.3_Silent_p.L7982L|SYNE1_uc003qou.3_Silent_p.L8053L|SYNE1_uc003qop.3_Silent_p.L215L|SYNE1_uc011eez.1_Silent_p.L255L|SYNE1_uc003qoq.3_Silent_p.L255L|SYNE1_uc003qor.3_Silent_p.L953L	p.L8053L	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	134	24761	-		Ovarian(120;0.0955)	8053			Spectrin 29.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.24159G>C	CCDS5236.2																																																																																				0.542	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		24	43	0	0	0	0.004656	0	24	43				
SDK1	221935	broad.mit.edu	37	7	3991439	3991439	+	Missense_Mutation	SNP	G	G	A	rs138596298	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:3991439G>A	ENST00000404826.2	+	7	1176	c.1037G>A	c.(1036-1038)cGc>cAc	p.R346H	SDK1_ENST00000389531.3_Missense_Mutation_p.R346H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	346	Ig-like C2-type 3.			R -> H (in Ref. 1; AAP75619 and 2; BAB71066). {ECO:0000305}.	cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTTGGAAGACGCCTCACCATC	0.617																																							uc003smx.2		NA																	0				large_intestine(3)|ovary(2)|skin(1)	6						c.(1036-1038)CGC>CAC		sidekick 1 precursor		G	HIS/ARG	0,4406		0,0,2203	83.0	72.0	76.0		1037	1.2	0.1	7	dbSNP_134	76	12,8588	9.1+/-34.3	0,12,4288	yes	missense	SDK1	NM_152744.3	29	0,12,6491	AA,AG,GG		0.1395,0.0,0.0923	benign	346/2214	3991439	12,12994	2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:3991439G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1037G>A	7.37:g.3991439G>A	ENSP00000385899:p.Arg346His		Somatic					p.R346H	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	7	1176	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	346	R -> H (in Ref. 1; AAP75619 and 2; BAB71066).		Ig-like C2-type 3.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.1037G>A	CCDS34590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.28|14.28	2.488189|2.488189	0.44249|0.44249	0.0|0.0	0.001395|0.001395	ENSG00000146555|ENSG00000146555	ENST00000426596|ENST00000404826;ENST00000389531	.|T;T	.|0.03035	.|4.07;4.07	4.87|4.87	1.24|1.24	0.21308|0.21308	.|Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.166261	.|0.36167	.|N	.|0.002742	T|T	0.06508|0.06508	0.0167|0.0167	M|M	0.81802|0.81802	2.56|2.56	0.42281|0.42281	D|D	0.992094|0.992094	.|B	.|0.27932	.|0.194	.|B	.|0.25506	.|0.061	T|T	0.12091|0.12091	-1.0561|-1.0561	5|10	.|0.51188	.|T	.|0.08	.|.	9.8019|9.8019	0.40770|0.40770	0.2055:0.0:0.7945:0.0|0.2055:0.0:0.7945:0.0	.|.	.|346	.|Q7Z5N4	.|SDK1_HUMAN	T|H	65|346	.|ENSP00000385899:R346H;ENSP00000374182:R346H	.|ENSP00000374182:R346H	A|R	+|+	1|2	0|0	SDK1|SDK1	3957965|3957965	0.012000|0.012000	0.17670|0.17670	0.135000|0.135000	0.22099|0.22099	0.786000|0.786000	0.44442|0.44442	1.060000|1.060000	0.30530|0.30530	0.009000|0.009000	0.14813|0.14813	0.655000|0.655000	0.94253|0.94253	GCC|CGC		0.617	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		9	81	0	0	0	0.004482	0	9	81				
PMS2	5395	broad.mit.edu	37	7	6029588	6029588	+	Splice_Site	SNP	T	T	C	rs587779347		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:6029588T>C	ENST00000265849.7	-	10	1094		c.e10-2		PMS2_ENST00000382321.4_Intron|PMS2_ENST00000406569.3_Splice_Site|PMS2_ENST00000441476.2_Splice_Site|PMS2_ENST00000469652.1_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)						ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CAACGCATTCTAAGGCAAAAA	0.313			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003spl.2		NA	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	Mis|N|F	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)			E		colorectal|endometrial|ovarian|medulloblastoma|glioma			0				lung(1)|central_nervous_system(1)	2						c.e10-1	Direct_reversal_of_damage|MMR	PMS2 postmeiotic segregation increased 2 isoform							57.0	54.0	55.0					7																	6029588		2201	4300	6501	SO:0001630	splice_region_variant	5395	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding	g.chr7:6029588T>C		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.989-2A>G	7.37:g.6029588T>C			Somatic				PMS2_uc003spj.2_Splice_Site_p.E224_splice|PMS2_uc003spk.2_Splice_Site_p.E195_splice|PMS2_uc011jwl.1_Splice_Site_p.E195_splice|PMS2_uc010ktg.2_Splice_Site_p.E19_splice|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Splice_Site_p.E330_splice	p.E330_splice	NM_000535	NP_000526	WXS	Illumina HiSeq	Unspecified	P54278	PMS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)	10	1076	-		Ovarian(82;0.0694)						B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Splice_Site	SNP	ENST00000265849.7	37	c.989_splice	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	N	18.04	3.533862	0.64972	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9006	0.79373	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PMS2	5996114	1.000000	0.71417	0.999000	0.59377	0.723000	0.41478	7.410000	0.80065	2.158000	0.67659	0.477000	0.44152	.		0.313	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	Intron	18	17	0	0	0	0.00499	0	18	17				
BMPER	168667	broad.mit.edu	37	7	34085917	34085918	+	Splice_Site	DNP	GG	GG	TT			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:34085917_34085918GG>TT	ENST00000297161.2	+	8	950_951	c.576_577GG>TT	c.(574-579)acGGga>acTTga	p.G193*	BMPER_ENST00000426693.1_Splice_Site_p.G193*|BMPER_ENST00000494786.1_3'UTR	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	193	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TCTTTTCTTAGGGAGGCAGGAC	0.436																																							uc011kap.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.e7-1		BMP-binding endothelial regulator precursor																																				SO:0001630	splice_region_variant	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34085917_34085918GG>TT		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	Exception_encountered	7.37:g.34085917_34085918delinsTT			Somatic					p.G193_splice	NM_133468	NP_597725	WXS	Illumina HiSeq	Unspecified	Q8N8U9	BMPER_HUMAN			7	691	+								A8K1P8|Q8TF36	Splice_Site	DNP	ENST00000297161.2	37	c.577_splice	CCDS5442.1																																																																																				0.436	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	Nonsense_Mutation	28	112	0	0	0	0.004672	0	28	112				
UPP1	7378	broad.mit.edu	37	7	48141551	48141551	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:48141551A>G	ENST00000331803.4	+	6	916	c.293A>G	c.(292-294)tAt>tGt	p.Y98C	UPP1_ENST00000341253.4_Missense_Mutation_p.Y98C|UPP1_ENST00000395564.4_Missense_Mutation_p.Y98C|UPP1_ENST00000482015.1_Intron|UPP1_ENST00000429491.2_Intron			Q16831	UPP1_HUMAN	uridine phosphorylase 1	98					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	TATGCCATGTATAAAGTAGGA	0.562																																							uc003toj.2		NA																	0					0						c.(292-294)TAT>TGT		uridine phosphorylase 1							220.0	165.0	184.0					7																	48141551		2203	4300	6503	SO:0001583	missense	7378				nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity	g.chr7:48141551A>G	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.293A>G	7.37:g.48141551A>G	ENSP00000330032:p.Tyr98Cys		Somatic				UPP1_uc003tok.2_Missense_Mutation_p.Y98C|UPP1_uc003tol.2_Missense_Mutation_p.Y98C|UPP1_uc011kcg.1_Missense_Mutation_p.Y98C|UPP1_uc011kch.1_Intron|UPP1_uc003ton.2_Intron|UPP1_uc003too.2_Intron	p.Y98C	NM_181597	NP_853628	WXS	Illumina HiSeq	Unspecified	Q16831	UPP1_HUMAN			6	822	+			98					D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	c.293A>G	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.127785	0.77549	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43	5.77	4.62	0.57501	Nucleoside phosphorylase domain (1);	0.057359	0.64402	D	0.000001	D	0.94301	0.8169	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.94016	0.7288	10	0.87932	D	0	-17.4367	9.8612	0.41116	0.8002:0.0:0.0:0.1998	.	98;98	B4DND0;Q16831	.;UPP1_HUMAN	C	98	ENSP00000405209:Y98C;ENSP00000330032:Y98C;ENSP00000342878:Y98C;ENSP00000378931:Y98C;ENSP00000390118:Y98C	ENSP00000330032:Y98C	Y	+	2	0	UPP1	48108076	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	7.057000	0.76669	1.000000	0.39049	0.533000	0.62120	TAT		0.562	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364		39	44	0	0	0	0.010771	0	39	44				
ABCA13	154664	broad.mit.edu	37	7	48626780	48626780	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:48626780C>G	ENST00000435803.1	+	57	14560	c.14536C>G	c.(14536-14538)Ctc>Gtc	p.L4846V	ABCA13_ENST00000544596.1_Missense_Mutation_p.L576V	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4846	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCGCTTACACCTCGAAGCCCA	0.572																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(14536-14538)CTC>GTC		ATP binding cassette, sub-family A (ABC1),							45.0	51.0	49.0					7																	48626780		2062	4206	6268	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48626780C>G	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14536C>G	7.37:g.48626780C>G	ENSP00000411096:p.Leu4846Val		Somatic				ABCA13_uc010kys.1_Missense_Mutation_p.L1921V|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.L576V	p.L4846V	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			57	14561	+			4846			ABC transporter 2.		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.14536C>G	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723971	0.48728	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.52754	0.65;0.65;0.65	5.71	2.95	0.34219	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.43110	D	0.000615	T	0.68961	0.3058	M	0.86420	2.815	0.39518	D	0.968462	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	T	0.71133	-0.4681	10	0.72032	D	0.01	.	9.4674	0.38822	0.0:0.7672:0.0:0.2328	.	576;2548;4846	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	V	4846;619;576	ENSP00000411096:L4846V;ENSP00000391042:L619V;ENSP00000442634:L576V	ENSP00000391042:L619V	L	+	1	0	ABCA13	48597326	1.000000	0.71417	0.581000	0.28614	0.380000	0.30137	2.770000	0.47662	0.350000	0.24002	-0.142000	0.14014	CTC		0.572	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		12	11	0	0	0	0.010729	0	12	11				
ELN	2006	broad.mit.edu	37	7	73467602	73467602	+	Silent	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:73467602T>A	ENST00000252034.7	+	18	1458	c.1059T>A	c.(1057-1059)gtT>gtA	p.V353V	ELN_ENST00000357036.5_Silent_p.V358V|ELN_ENST00000380584.4_Silent_p.V339V|ELN_ENST00000320492.7_Silent_p.V317V|ELN_ENST00000429192.1_Silent_p.V358V|ELN_ENST00000380576.5_Silent_p.V353V|ELN_ENST00000358929.4_Silent_p.V353V|ELN_ENST00000458204.1_Silent_p.V343V|ELN_ENST00000320399.6_Silent_p.V353V|ELN_ENST00000380553.4_Silent_p.V236V|ELN_ENST00000380575.4_Silent_p.V343V|ELN_ENST00000466878.1_3'UTR|ELN_ENST00000380562.4_Silent_p.V353V|ELN_ENST00000414324.1_Silent_p.V348V|ELN_ENST00000445912.1_Silent_p.V353V	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	353	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGATTCCAGTTGTCCCAGGTG	0.587			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																uc003tzw.2		NA		Dom	yes		7	7q11.23	2006	T	elastin	yes	Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome	L	PAX5		B-ALL		0				ovary(3)|pancreas(2)	5						c.(1057-1059)GTT>GTA		elastin isoform a precursor	Rofecoxib(DB00533)						97.0	86.0	90.0					7																	73467602		2203	4300	6503	SO:0001819	synonymous_variant	2006				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	g.chr7:73467602T>A		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1059T>A	7.37:g.73467602T>A			Somatic				RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_RNA|ELN_uc011kfe.1_Silent_p.V322V|ELN_uc003tzn.2_Silent_p.V353V|ELN_uc003tzz.2_Silent_p.V317V|ELN_uc003tzo.2_Silent_p.V339V|ELN_uc003tzp.2_Silent_p.V309V|ELN_uc003tzq.2_Silent_p.V236V|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Silent_p.V353V|ELN_uc003tzt.2_Silent_p.V358V|ELN_uc003tzu.2_Silent_p.V358V|ELN_uc003tzv.2_Silent_p.V343V|ELN_uc003tzx.2_Silent_p.V343V|ELN_uc011kff.1_Silent_p.V353V|ELN_uc003tzy.2_Silent_p.V348V	p.V353V	NM_000501	NP_001075224	WXS	Illumina HiSeq	Unspecified	P15502	ELN_HUMAN			18	1150	+		Lung NSC(55;0.159)	353			Ala-rich.		B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	37	c.1059T>A	CCDS5562.2																																																																																				0.587	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		43	24	0	0	0	0.00874	0	43	24				
CALCR	799	broad.mit.edu	37	7	93063564	93063564	+	Splice_Site	SNP	C	C	A	rs551183900	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:93063564C>A	ENST00000394441.1	-	12	1507		c.e12+1		CALCR_ENST00000421592.1_Splice_Site|CALCR_ENST00000426151.1_Splice_Site|CALCR_ENST00000359558.2_Splice_Site|CALCR_ENST00000360249.4_Splice_Site	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TGCATGCTTACCTCATTGTTG	0.358																																							uc003umv.1		NA																	0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.e14+1		calcitonin receptor isoform 2 precursor	Salmon Calcitonin(DB00017)						116.0	121.0	120.0					7																	93063564		2203	4300	6503	SO:0001630	splice_region_variant	799				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	g.chr7:93063564C>A	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1191+1G>T	7.37:g.93063564C>A			Somatic				CALCR_uc011kia.1_Splice_Site_p.E211_splice|CALCR_uc003ums.1_Splice_Site|CALCR_uc003umt.1_Splice_Site|CALCR_uc003umu.1_Splice_Site_p.E397_splice|CALCR_uc003umw.2_Splice_Site_p.E397_splice	p.E431_splice	NM_001742	NP_001733	WXS	Illumina HiSeq	Unspecified	P30988	CALCR_HUMAN	STAD - Stomach adenocarcinoma(171;0.000244)		14	1554	-	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)							A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Splice_Site	SNP	ENST00000394441.1	37	c.1293_splice	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160411	0.38119	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	.	.	.	3.89	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0221	0.53350	0.1735:0.8265:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CALCR	92901500	1.000000	0.71417	0.766000	0.31476	0.429000	0.31625	7.199000	0.77831	1.205000	0.43262	0.555000	0.69702	.		0.358	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	Intron	26	45	1	0	6.38683e-12	0.008361	7.93441e-12	26	45				
MET	4233	broad.mit.edu	37	7	116397705	116397705	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:116397705C>G	ENST00000318493.6	+	8	2166	c.1979C>G	c.(1978-1980)aCa>aGa	p.T660R	MET_ENST00000397752.3_Missense_Mutation_p.T660R|MET_ENST00000436117.2_Missense_Mutation_p.T660R			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CCTGTAATAACAAGTATTTCG	0.333			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		0				upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(1978-1980)ACA>AGA		met proto-oncogene isoform b precursor							70.0	67.0	68.0					7																	116397705		1818	4079	5897	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116397705C>G	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1979C>G	7.37:g.116397705C>G	ENSP00000317272:p.Thr660Arg		Somatic				MET_uc010lkh.2_Missense_Mutation_p.T660R|MET_uc011kne.1_Missense_Mutation_p.T632R|MET_uc011knf.1_Missense_Mutation_p.T660R|MET_uc011kng.1_Missense_Mutation_p.T660R|MET_uc011knh.1_Missense_Mutation_p.T660R|MET_uc011kni.1_Missense_Mutation_p.T660R|MET_uc011knj.1_Missense_Mutation_p.T230R	p.T660R	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		8	2166	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	660			Extracellular (Potential).|IPT/TIG 2.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.1979C>G	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	9.045	0.990681	0.18966	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.78126	-1.15;-1.15;-1.15	5.3	5.3	0.74995	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.222231	0.45867	D	0.000327	D	0.83653	0.5301	M	0.78049	2.395	0.80722	D	1	B;B;P;B;B;B;P	0.41673	0.255;0.006;0.759;0.004;0.011;0.016;0.461	B;B;P;B;B;B;B	0.48815	0.169;0.005;0.591;0.012;0.056;0.02;0.269	D	0.85544	0.1217	10	0.66056	D	0.02	.	15.6575	0.77155	0.0:0.8626:0.1374:0.0	.	660;660;660;660;632;660;660	B5A929;E7EQ94;B5A930;B5A934;B5A936;P08581-2;P08581	.;.;.;.;.;.;MET_HUMAN	R	660	ENSP00000380860:T660R;ENSP00000317272:T660R;ENSP00000410980:T660R	ENSP00000317272:T660R	T	+	2	0	MET	116184941	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	1.995000	0.40767	2.640000	0.89533	0.585000	0.79938	ACA		0.333	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			25	42	0	0	0	0.003954	0	25	42				
PRSS1	5644	broad.mit.edu	37	7	142458515	142458515	+	Silent	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:142458515C>T	ENST00000311737.7	+	2	156	c.150C>T	c.(148-150)ggC>ggT	p.G50G	PRSS1_ENST00000486171.1_Silent_p.G50G	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	50	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCTGTGGTGGCTCCCTCATCA	0.562																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(148-150)GGC>GGT		protease, serine, 1 preproprotein							102.0	102.0	102.0					7																	142458515		2203	4300	6503	SO:0001819	synonymous_variant	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142458515C>T	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.150C>T	7.37:g.142458515C>T			Somatic				uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Missense_Mutation_p.L26F|PRSS1_uc003wam.2_5'Flank	p.G50G	NM_002769	NP_002760	WXS	Illumina HiSeq	Unspecified	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		2	167	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	50			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	c.150C>T	CCDS5872.1																																																																																				0.562	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			7	146	0	0	0	0.001984	0	7	146				
TRPV5	56302	broad.mit.edu	37	7	142626165	142626165	+	Missense_Mutation	SNP	G	G	C			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:142626165G>C	ENST00000265310.1	-	5	886	c.538C>G	c.(538-540)Cgg>Ggg	p.R180G	TRPV5_ENST00000442623.1_Missense_Mutation_p.R180G	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	180					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ATGAGCAGCCGCACGATCTCC	0.612																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(538-540)CGG>GGG		transient receptor potential cation channel,							89.0	72.0	78.0					7																	142626165		2203	4300	6503	SO:0001583	missense	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142626165G>C	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.538C>G	7.37:g.142626165G>C	ENSP00000265310:p.Arg180Gly		Somatic				TRPV5_uc003wbz.2_Missense_Mutation_p.R180G	p.R180G	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			5	802	-	Melanoma(164;0.059)		180			ANK 4.|Cytoplasmic (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	c.538C>G	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.683178	0.29872	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	T;T;T	0.66280	-0.2;-0.2;-0.2	4.3	-3.75	0.04372	Ankyrin repeat-containing domain (4);	0.514133	0.21247	N	0.077719	T	0.47746	0.1462	L	0.43923	1.385	0.09310	N	1	B;B	0.23990	0.095;0.011	B;B	0.24269	0.052;0.016	T	0.36407	-0.9749	10	0.56958	D	0.05	-28.1495	10.0218	0.42048	0.0721:0.0:0.3733:0.5546	.	180;180	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	G	180;174;180	ENSP00000265310:R180G;ENSP00000406361:R174G;ENSP00000406572:R180G	ENSP00000265310:R180G	R	-	1	2	TRPV5	142336287	0.057000	0.20700	0.074000	0.20217	0.899000	0.52679	0.051000	0.14141	-0.925000	0.03775	0.462000	0.41574	CGG		0.612	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		17	14	0	0	0	0.007413	0	17	14				
TAS2R60	338398	broad.mit.edu	37	7	143140732	143140732	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:143140732G>T	ENST00000332690.1	+	1	187	c.187G>T	c.(187-189)Ggg>Tgg	p.G63W	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	63					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					GGTTAGCCTAGGGGCCTCTCG	0.498																																							uc011ktg.1		NA																	0				skin(6)	6						c.(187-189)GGG>TGG		taste receptor, type 2, member 60							201.0	187.0	192.0					7																	143140732		2203	4300	6503	SO:0001583	missense	338398				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143140732G>T	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.187G>T	7.37:g.143140732G>T	ENSP00000327724:p.Gly63Trp		Somatic				uc003wda.2_Intron	p.G63W	NM_177437	NP_803186	WXS	Illumina HiSeq	Unspecified	P59551	T2R60_HUMAN			1	187	+	Melanoma(164;0.172)		63			Extracellular (Potential).		A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	ENST00000332690.1	37	c.187G>T	CCDS5885.1	.	.	.	.	.	.	.	.	.	.	G	9.537	1.112448	0.20795	.	.	ENSG00000185899	ENST00000332690	T	0.37584	1.19	5.27	0.915	0.19366	.	0.792987	0.10715	U	0.642435	T	0.52613	0.1745	M	0.62088	1.915	0.09310	N	1	D	0.71674	0.998	D	0.74674	0.984	T	0.37267	-0.9713	10	0.87932	D	0	.	8.1918	0.31372	0.383:0.0:0.617:0.0	.	63	P59551	T2R60_HUMAN	W	63	ENSP00000327724:G63W	ENSP00000327724:G63W	G	+	1	0	TAS2R60	142850854	0.119000	0.22226	0.000000	0.03702	0.000000	0.00434	-0.002000	0.12924	0.243000	0.21327	-0.777000	0.03380	GGG		0.498	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1			63	61	1	0	1.53122e-18	0.01441	2.13183e-18	63	61				
GIMAP8	155038	broad.mit.edu	37	7	150174248	150174248	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:150174248G>T	ENST00000307271.3	+	5	1952	c.1378G>T	c.(1378-1380)Ggg>Tgg	p.G460W		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	460	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.G460W(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CTCTATCCTGGGGAGCCTCGT	0.592																																							uc003whj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(1378-1380)GGG>TGG		GTPase, IMAP family member 8							72.0	74.0	73.0					7																	150174248		2203	4300	6503	SO:0001583	missense	155038					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding	g.chr7:150174248G>T	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1378G>T	7.37:g.150174248G>T	ENSP00000305107:p.Gly460Trp		Somatic					p.G460W	NM_175571	NP_783161	WXS	Illumina HiSeq	Unspecified	Q8ND71	GIMA8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)	5	1708	+			460						Missense_Mutation	SNP	ENST00000307271.3	37	c.1378G>T	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950210	0.34377	.	.	ENSG00000171115	ENST00000307271	T	0.10288	2.89	4.44	2.63	0.31362	AIG1 (1);	0.146684	0.31721	N	0.007166	T	0.38268	0.1034	H	0.94886	3.595	0.36277	D	0.855522	D	0.89917	1.0	D	0.97110	1.0	T	0.47711	-0.9096	10	0.87932	D	0	.	6.5653	0.22509	0.2188:0.0:0.7812:0.0	.	460	Q8ND71	GIMA8_HUMAN	W	460	ENSP00000305107:G460W	ENSP00000305107:G460W	G	+	1	0	GIMAP8	149805181	0.978000	0.34361	0.071000	0.20095	0.030000	0.12068	1.950000	0.40323	0.517000	0.28361	-0.140000	0.14226	GGG		0.592	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		20	48	1	0	6.44725e-10	0.014323	7.62807e-10	20	48				
ARHGEF10	9639	broad.mit.edu	37	8	1844550	1844550	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:1844550A>G	ENST00000398564.1	+	14	1567	c.1567A>G	c.(1567-1569)Agc>Ggc	p.S523G	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.S523G|ARHGEF10_ENST00000398560.1_Missense_Mutation_p.S484G|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.S523G|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.S498G|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.S460G			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	523	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GAACAATTTCAGCACAGCCGT	0.403																																							uc003wpr.2		NA																	0				large_intestine(1)	1						c.(1492-1494)AGC>GGC		Rho guanine nucleotide exchange factor 10							137.0	132.0	134.0					8																	1844550		2203	4300	6503	SO:0001583	missense	9639				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity	g.chr8:1844550A>G	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1567A>G	8.37:g.1844550A>G	ENSP00000381571:p.Ser523Gly		Somatic				ARHGEF10_uc003wpq.1_Missense_Mutation_p.S523G|ARHGEF10_uc003wps.2_Missense_Mutation_p.S460G|ARHGEF10_uc003wpt.2_Missense_Mutation_p.S374G|ARHGEF10_uc003wpv.2_Missense_Mutation_p.S231G|ARHGEF10_uc010lre.2_Missense_Mutation_p.S178G	p.S498G	NM_014629	NP_055444	WXS	Illumina HiSeq	Unspecified	O15013	ARHGA_HUMAN		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)	14	1670	+		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)	523			DH.		O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37	c.1492A>G		.	.	.	.	.	.	.	.	.	.	A	13.46	2.245135	0.39697	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	4.83	3.68	0.42216	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.56702	0.2003	L	0.53780	1.695	0.53005	D	0.999966	B;B;B;B	0.26258	0.145;0.002;0.068;0.018	B;B;B;B	0.28784	0.094;0.049;0.036;0.044	T	0.56025	-0.8047	10	0.72032	D	0.01	-28.8544	10.2211	0.43198	0.9205:0.0:0.0795:0.0	.	523;484;460;498	O15013;E9PB39;O15013-7;O15013-5	ARHGA_HUMAN;.;.;.	G	498;460;523;484;523;523;171	ENSP00000340297:S498G;ENSP00000427909:S460G;ENSP00000431012:S523G;ENSP00000381568:S484G;ENSP00000381571:S523G;ENSP00000262112:S523G;ENSP00000427768:S171G	ENSP00000262112:S523G	S	+	1	0	ARHGEF10	1831957	1.000000	0.71417	0.699000	0.30290	0.562000	0.35680	5.577000	0.67444	0.690000	0.31570	0.460000	0.39030	AGC		0.403	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding				41	57	0	0	0	0.006999	0	41	57				
CSMD1	64478	broad.mit.edu	37	8	3263580	3263580	+	Silent	SNP	C	C	A	rs577019255		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:3263580C>A	ENST00000520002.1	-	16	2793	c.2238G>T	c.(2236-2238)gtG>gtT	p.V746V	CSMD1_ENST00000602557.1_Silent_p.V746V|CSMD1_ENST00000602723.1_Silent_p.V746V|CSMD1_ENST00000537824.1_Silent_p.V745V|CSMD1_ENST00000542608.1_Silent_p.V745V|CSMD1_ENST00000539096.1_Silent_p.V745V|CSMD1_ENST00000400186.3_Silent_p.V746V			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	746	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGCTCCAGACCACGTTCCCGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		15363	0.0		0.001	False		,,,				2504	0.0						uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(2236-2238)GTG>GTT		CUB and Sushi multiple domains 1 precursor							58.0	60.0	59.0					8																	3263580		1992	4177	6169	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:3263580C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2238G>T	8.37:g.3263580C>A			Somatic				CSMD1_uc011kwj.1_Silent_p.V138V	p.V746V	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	15	2628	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	746			Sushi 4.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.2238G>T		.	.	.	.	.	.	.	.	.	.	C	10.21	1.288224	0.23478	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.36	-4.64	0.03349	.	.	.	.	.	T	0.47210	0.1433	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46871	-0.9160	4	.	.	.	.	5.7492	0.18138	0.419:0.4121:0.0925:0.0764	.	.	.	.	C	226	.	.	G	-	1	0	CSMD1	3250987	0.004000	0.15560	0.911000	0.35937	0.875000	0.50365	-1.128000	0.03247	-0.530000	0.06349	0.591000	0.81541	GGT		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		13	28	1	0	6.53275e-17	0.00245	8.792e-17	13	28				
RP1L1	94137	broad.mit.edu	37	8	10467346	10467346	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:10467346G>T	ENST00000382483.3	-	4	4485	c.4262C>A	c.(4261-4263)tCc>tAc	p.S1421Y		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1501	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ATCTTCCTGGGAGCCTTTCCC	0.607																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4261-4263)TCC>TAC		retinitis pigmentosa 1-like 1							256.0	281.0	273.0					8																	10467346		2006	4169	6175	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10467346G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4262C>A	8.37:g.10467346G>T	ENSP00000371923:p.Ser1421Tyr		Somatic					p.S1421Y	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	4491	-			1421					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.4262C>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	g	9.898	1.206020	0.22205	.	.	ENSG00000183638	ENST00000382483	T	0.05447	3.44	3.73	1.87	0.25490	.	3.726600	0.01310	U	0.010587	T	0.10208	0.0250	N	0.19112	0.55	0.09310	N	1	D	0.61697	0.99	P	0.53593	0.73	T	0.27365	-1.0076	10	0.72032	D	0.01	0.1899	7.1578	0.25647	0.0958:0.3287:0.5754:0.0	.	1421	A6NKC6	.	Y	1421	ENSP00000371923:S1421Y	ENSP00000371923:S1421Y	S	-	2	0	RP1L1	10504756	0.038000	0.19896	0.000000	0.03702	0.004000	0.04260	2.395000	0.44459	0.524000	0.28502	0.486000	0.48141	TCC		0.607	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			166	362	1	0	1.13191e-60	0.01441	1.75773e-60	166	362				
KCNU1	157855	broad.mit.edu	37	8	36698451	36698451	+	Splice_Site	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:36698451C>A	ENST00000399881.3	+	16	1670	c.1633C>A	c.(1633-1635)Ctc>Atc	p.L545I		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	545	Segment S8.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CCTTCCCAGGCTCTGCTTTCT	0.463																																							uc010lvw.2		NA																	0				ovary(1)	1						c.(1633-1635)CTC>ATC		potassium channel, subfamily U, member 1							141.0	131.0	134.0					8																	36698451		2009	4183	6192	SO:0001630	splice_region_variant	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36698451C>A	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1632-1C>A	8.37:g.36698451C>A			Somatic				KCNU1_uc003xjw.2_RNA	p.L545I	NM_001031836	NP_001027006	WXS	Illumina HiSeq	Unspecified	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	16	1720	+			545			Segment S8.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.1633C>A	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.411999	0.25465	.	.	ENSG00000215262	ENST00000399881	T	0.45668	0.89	5.06	0.776	0.18532	Potassium channel, calcium-activated, BK, alpha subunit (2);	0.000000	0.31113	U	0.008232	T	0.37945	0.1022	L	0.54323	1.7	0.80722	D	1	B	0.16802	0.019	B	0.33042	0.157	T	0.13072	-1.0523	10	0.40728	T	0.16	-3.3559	7.8075	0.29211	0.618:0.3001:0.0:0.0819	.	545	A8MYU2	KCNU1_HUMAN	I	545	ENSP00000382770:L545I	ENSP00000382770:L545I	L	+	1	0	KCNU1	36817609	1.000000	0.71417	0.996000	0.52242	0.451000	0.32288	0.583000	0.23849	-0.085000	0.12573	-0.175000	0.13238	CTC		0.463	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	Missense_Mutation	10	27	1	0	1.33987e-11	0.008291	1.65182e-11	10	27				
RNF5P1	286140	broad.mit.edu	37	8	38458368	38458368	+	IGR	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:38458368C>T								RP11-675F6.4 (41830 upstream) : RP11-495O10.1 (99775 downstream)																							AGTGGAAGCCCCCGGTATCAC	0.567																																							uc003xly.2		NA																	0					0						c.(349-351)GGG>GGA		SubName: Full=Putative uncharacterized protein RNF5;																																				SO:0001628	intergenic_variant	286140							g.chr8:38458368C>T																													8.37:g.38458368C>T			Somatic					p.G117G	NR_003129		WXS	Illumina HiSeq	Unspecified					1	408	-									Silent	SNP		37	c.351G>A																																																																																				0	0.567									52	75	0	0	0	0.01441	0	52	75				
ADAM2	2515	broad.mit.edu	37	8	39624758	39624758	+	Missense_Mutation	SNP	T	T	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:39624758T>A	ENST00000265708.4	-	13	1328	c.1225A>T	c.(1225-1227)Att>Ttt	p.I409F	ADAM2_ENST00000347580.4_Missense_Mutation_p.I390F|ADAM2_ENST00000521880.1_Missense_Mutation_p.I409F|ADAM2_ENST00000379853.2_Missense_Mutation_p.I283F	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	409	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GTTTCTCCAATAAGGGCACAA	0.378																																							uc003xnj.2		NA																	0				ovary(1)|lung(1)	2						c.(1225-1227)ATT>TTT		ADAM metallopeptidase domain 2 proprotein							149.0	141.0	144.0					8																	39624758		2203	4300	6503	SO:0001583	missense	2515				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:39624758T>A	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1225A>T	8.37:g.39624758T>A	ENSP00000265708:p.Ile409Phe		Somatic				ADAM2_uc003xnk.2_Missense_Mutation_p.I390F|ADAM2_uc011lck.1_Missense_Mutation_p.I409F|ADAM2_uc003xnl.2_Missense_Mutation_p.I283F	p.I409F	NM_001464	NP_001455	WXS	Illumina HiSeq	Unspecified	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)	13	1300	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	409			Extracellular (Potential).|Disintegrin.		P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	c.1225A>T	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	T	1.113	-0.657668	0.03454	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.02216	5.03;4.39;5.27;5.21	4.82	-9.64	0.00541	Blood coagulation inhibitor, Disintegrin (4);	.	.	.	.	T	0.01287	0.0042	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.14805	0.001;0.011;0.0;0.001	B;B;B;B	0.19148	0.015;0.024;0.001;0.001	T	0.39941	-0.9589	8	.	.	.	.	2.7945	0.05397	0.1335:0.2879:0.3149:0.2637	.	409;283;390;409	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	F	390;283;409;409	ENSP00000343854:I390F;ENSP00000369182:I283F;ENSP00000265708:I409F;ENSP00000429352:I409F	.	I	-	1	0	ADAM2	39743915	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.958000	0.00088	-5.741000	0.00010	-3.979000	0.00014	ATT		0.378	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		65	100	0	0	0	0.01441	0	65	100				
MCM4	4173	broad.mit.edu	37	8	48883348	48883348	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:48883348G>T	ENST00000262105.2	+	11	1921	c.1712G>T	c.(1711-1713)tGc>tTc	p.C571F	MCM4_ENST00000523944.1_Missense_Mutation_p.C571F	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	571	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				AACGGCATCTGCTGTATCGAT	0.498																																							uc003xqk.1		NA																	0				ovary(2)|skin(2)	4						c.(1711-1713)TGC>TTC		minichromosome maintenance complex component 4							96.0	78.0	84.0					8																	48883348		2203	4300	6503	SO:0001583	missense	4173				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr8:48883348G>T		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1712G>T	8.37:g.48883348G>T	ENSP00000262105:p.Cys571Phe		Somatic				MCM4_uc003xql.1_Missense_Mutation_p.C571F|MCM4_uc011ldi.1_Missense_Mutation_p.C558F	p.C571F	NM_182746	NP_877423	WXS	Illumina HiSeq	Unspecified	P33991	MCM4_HUMAN			12	1807	+		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)	571			MCM.		Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	37	c.1712G>T	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.850312	0.91277	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229	T;T	0.10668	2.85;2.85	6.03	6.03	0.97812	Mini-chromosome maintenance, conserved site (1);ATPase, AAA+ type, core (1);	0.079601	0.85682	D	0.000000	T	0.53690	0.1812	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.70626	-0.4820	10	0.87932	D	0	-31.2626	20.5568	0.99304	0.0:0.0:1.0:0.0	.	571;571	B3KMX0;P33991	.;MCM4_HUMAN	F	571;571;558;531	ENSP00000430194:C571F;ENSP00000262105:C571F	ENSP00000262105:C571F	C	+	2	0	MCM4	49045901	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.845000	0.99498	2.861000	0.98227	0.655000	0.94253	TGC		0.498	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914		18	34	1	0	1.67942e-08	0.006122	1.93043e-08	18	34				
CHD7	55636	broad.mit.edu	37	8	61774827	61774827	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:61774827A>T	ENST00000423902.2	+	36	8382	c.7903A>T	c.(7903-7905)Aaa>Taa	p.K2635*	CHD7_ENST00000524602.1_Nonsense_Mutation_p.K586*	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2635					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAACCCTAATAAATTGGATAT	0.368																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(7903-7905)AAA>TAA		chromodomain helicase DNA binding protein 7							50.0	47.0	48.0					8																	61774827		1845	4093	5938	SO:0001587	stop_gained	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61774827A>T	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7903A>T	8.37:g.61774827A>T	ENSP00000392028:p.Lys2635*		Somatic					p.K2635*	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		36	8380	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	2635					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Nonsense_Mutation	SNP	ENST00000423902.2	37	c.7903A>T	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	A	52	19.709157	0.99922	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.9975	15.7733	0.78190	1.0:0.0:0.0:0.0	.	.	.	.	X	2635;2635;586	.	ENSP00000307304:K2635X	K	+	1	0	CHD7	61937381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.336000	0.96533	2.126000	0.65437	0.529000	0.55759	AAA		0.368	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		11	14	0	0	0	0.010729	0	11	14				
ZFHX4	79776	broad.mit.edu	37	8	77761847	77761847	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:77761847C>T	ENST00000521891.2	+	8	4193	c.3745C>T	c.(3745-3747)Cct>Tct	p.P1249S	ZFHX4_ENST00000518282.1_Missense_Mutation_p.P1223S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P1204S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P1204S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATCTGCTGTCCTCTCTGTCA	0.488										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3610-3612)CCT>TCT		zinc finger homeodomain 4							122.0	116.0	118.0					8																	77761847		2059	4216	6275	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77761847C>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3745C>T	8.37:g.77761847C>T	ENSP00000430497:p.Pro1249Ser	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.P1249S|ZFHX4_uc003yaw.1_Missense_Mutation_p.P1204S	p.P1204S	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		8	3997	+			1204			C2H2-type 9.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.3610C>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244915	0.79912	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.57595	0.39;0.49;0.46;0.43	4.58	4.58	0.56647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.41938	U	0.000791	T	0.76033	0.3931	M	0.84585	2.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.998	T	0.80797	-0.1222	10	0.72032	D	0.01	.	17.9143	0.88944	0.0:1.0:0.0:0.0	.	1204;1204;1249	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	1249;1249;1204;1204;1223	ENSP00000430497:P1249S;ENSP00000399605:P1204S;ENSP00000050961:P1204S;ENSP00000430848:P1223S	ENSP00000050961:P1204S	P	+	1	0	ZFHX4	77924402	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.524000	0.85096	0.555000	0.69702	CCT		0.488	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		10	66	0	0	0	0.006214	0	10	66				
ZFHX4	79776	broad.mit.edu	37	8	77766851	77766851	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:77766851C>A	ENST00000521891.2	+	10	8142	c.7694C>A	c.(7693-7695)tCc>tAc	p.S2565Y	ZFHX4_ENST00000518282.1_Missense_Mutation_p.S2539Y|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S2520Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S2520Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGGCCAGTTCCTCCCACACC	0.498										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(7558-7560)TCC>TAC		zinc finger homeodomain 4							67.0	67.0	67.0					8																	77766851		1940	4113	6053	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766851C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7694C>A	8.37:g.77766851C>A	ENSP00000430497:p.Ser2565Tyr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.S2565Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.S2520Y	p.S2520Y	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7946	+			2520					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.7559C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	5.015	0.188373	0.09547	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52526	0.66;0.71;0.68;0.67	5.38	5.38	0.77491	.	0.176197	0.27327	U	0.019872	T	0.45458	0.1343	L	0.50333	1.59	0.45747	D	0.99864	B;B;P	0.35982	0.049;0.082;0.531	B;B;B	0.38264	0.089;0.183;0.269	T	0.48364	-0.9042	10	0.72032	D	0.01	.	12.6162	0.56578	0.0:0.9249:0.0:0.0751	.	2520;2520;2565	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	2565;2549;2520;2520;2539	ENSP00000430497:S2565Y;ENSP00000399605:S2520Y;ENSP00000050961:S2520Y;ENSP00000430848:S2539Y	ENSP00000050961:S2520Y	S	+	2	0	ZFHX4	77929406	1.000000	0.71417	0.529000	0.27951	0.008000	0.06430	5.923000	0.70045	2.791000	0.96007	0.650000	0.86243	TCC		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		32	52	1	0	5.60225e-13	0.009535	7.01367e-13	32	52				
ZFHX4	79776	broad.mit.edu	37	8	77767876	77767876	+	Missense_Mutation	SNP	C	C	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:77767876C>G	ENST00000521891.2	+	10	9167	c.8719C>G	c.(8719-8721)Ccg>Gcg	p.P2907A	ZFHX4_ENST00000518282.1_Missense_Mutation_p.P2881A|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P2862A|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P2862A	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2862					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATAGCGGACCCGAGCTCCCC	0.502										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(8584-8586)CCG>GCG		zinc finger homeodomain 4							62.0	61.0	62.0					8																	77767876		1936	4133	6069	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77767876C>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8719C>G	8.37:g.77767876C>G	ENSP00000430497:p.Pro2907Ala	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.P2907A|ZFHX4_uc003yaw.1_Missense_Mutation_p.P2862A	p.P2862A	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	8971	+			2862					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.8584C>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.15	2.746766	0.49257	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.54866	0.55;0.6;0.58;0.56	5.05	5.05	0.67936	.	0.000000	0.44285	U	0.000476	T	0.63663	0.2530	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.85130	0.993;0.997;0.997	T	0.66480	-0.5913	10	0.62326	D	0.03	.	18.5922	0.91217	0.0:1.0:0.0:0.0	.	2862;2862;2907	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	A	2907;2891;2862;2862;2881	ENSP00000430497:P2907A;ENSP00000399605:P2862A;ENSP00000050961:P2862A;ENSP00000430848:P2881A	ENSP00000050961:P2862A	P	+	1	0	ZFHX4	77930431	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	7.651000	0.83577	2.628000	0.89032	0.561000	0.74099	CCG		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		21	28	0	0	0	0.012319	0	21	28				
TONSL	4796	broad.mit.edu	37	8	145661513	145661513	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:145661513C>T	ENST00000409379.3	-	17	2332	c.2303G>A	c.(2302-2304)cGg>cAg	p.R768Q	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	768					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GGCTGCCACCCGTTGTGCTGT	0.711																																							uc011llg.1		NA																	0					0						c.(2302-2304)CGG>CAG		NF-kappa-B inhibitor-like protein 2							7.0	9.0	8.0					8																	145661513		2153	4228	6381	SO:0001583	missense	4796				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity	g.chr8:145661513C>T		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2303G>A	8.37:g.145661513C>T	ENSP00000386239:p.Arg768Gln		Somatic				uc011llh.1_Intron	p.R768Q	NM_013432	NP_038460	WXS	Illumina HiSeq	Unspecified	Q96HA7	TONSL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)		17	2318	-	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		768					B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	c.2303G>A	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	C	0.911	-0.719090	0.03182	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.41758	0.99	3.53	-2.48	0.06423	.	0.503767	0.18637	N	0.135415	T	0.08582	0.0213	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.32798	-0.9893	10	0.02654	T	1	-7.8116	2.2901	0.04136	0.3904:0.2479:0.0:0.3617	.	768	Q96HA7	TONSL_HUMAN	Q	768;767	ENSP00000386239:R768Q	ENSP00000386239:R768Q	R	-	2	0	TONSL	145632321	0.000000	0.05858	0.012000	0.15200	0.015000	0.08874	-1.521000	0.02239	0.020000	0.15106	-0.518000	0.04402	CGG		0.711	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432		4	9	0	0	0	0.001168	0	4	9				
ZNF16	7564	broad.mit.edu	37	8	146156251	146156251	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:146156251C>T	ENST00000276816.4	-	4	2108	c.1922G>A	c.(1921-1923)cGt>cAt	p.R641H	ZNF16_ENST00000394909.2_Missense_Mutation_p.R641H	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	641					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GAGGACCGAACGCTGACTGAA	0.537																																							uc003zet.2		NA																	0				ovary(5)	5						c.(1921-1923)CGT>CAT		zinc finger protein 16							130.0	125.0	126.0					8																	146156251		2203	4300	6503	SO:0001583	missense	7564				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:146156251C>T	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1922G>A	8.37:g.146156251C>T	ENSP00000276816:p.Arg641His		Somatic				ZNF16_uc003zeu.2_Missense_Mutation_p.R641H	p.R641H	NM_001029976	NP_001025147	WXS	Illumina HiSeq	Unspecified	P17020	ZNF16_HUMAN	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)	4	2109	-	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	641			C2H2-type 16.		B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	c.1922G>A	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713456	0.30413	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.61040	0.14;0.14	4.0	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.52517	0.1739	N	0.20807	0.61	0.09310	N	1	D	0.89917	1.0	P	0.60012	0.867	T	0.37174	-0.9717	9	0.34782	T	0.22	.	4.9053	0.13795	0.2128:0.6785:0.0:0.1087	.	641	P17020	ZNF16_HUMAN	H	641	ENSP00000276816:R641H;ENSP00000378369:R641H	ENSP00000276816:R641H	R	-	2	0	ZNF16	146127055	0.000000	0.05858	0.980000	0.43619	0.501000	0.33797	-0.260000	0.08708	2.058000	0.61347	0.462000	0.41574	CGT		0.537	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958		49	69	0	0	0	0.01441	0	49	69				
PTPRD	5789	broad.mit.edu	37	9	8340442	8340442	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:8340442C>A	ENST00000381196.4	-	39	5697	c.5154G>T	c.(5152-5154)caG>caT	p.Q1718H	PTPRD_ENST00000360074.4_Missense_Mutation_p.Q1705H|PTPRD_ENST00000537002.1_Missense_Mutation_p.Q1308H|PTPRD_ENST00000540109.1_Missense_Mutation_p.Q1718H|PTPRD_ENST00000397606.3_Missense_Mutation_p.Q1311H|PTPRD_ENST00000358503.5_Missense_Mutation_p.Q1696H|PTPRD_ENST00000355233.5_Missense_Mutation_p.Q1312H|PTPRD_ENST00000486161.1_Missense_Mutation_p.Q1311H|PTPRD_ENST00000397611.3_Missense_Mutation_p.Q1308H|PTPRD_ENST00000397617.3_Missense_Mutation_p.Q1311H|PTPRD_ENST00000356435.5_Missense_Mutation_p.Q1718H	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1718	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAAGGGCCCCTGGGTAGCGA	0.458										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(5152-5154)CAG>CAT		protein tyrosine phosphatase, receptor type, D							108.0	97.0	101.0					9																	8340442		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8340442C>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.5154G>T	9.37:g.8340442C>A	ENSP00000370593:p.Gln1718His	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Missense_Mutation_p.Q1312H|PTPRD_uc003zkq.2_Missense_Mutation_p.Q1311H|PTPRD_uc003zkr.2_Missense_Mutation_p.Q1302H|PTPRD_uc003zks.2_Missense_Mutation_p.Q1311H|PTPRD_uc003zkl.2_Missense_Mutation_p.Q1709H|PTPRD_uc003zkm.2_Missense_Mutation_p.Q1705H|PTPRD_uc003zkn.2_Missense_Mutation_p.Q1307H|PTPRD_uc003zko.2_Missense_Mutation_p.Q1308H	p.Q1718H	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	41	5865	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1718			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.5154G>T	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318182	0.60524	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	D;D;D;D;D;D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	5.98	4.14	0.48551	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.059739	0.64402	D	0.000001	D	0.97420	0.9156	H	0.99863	4.86	0.54753	D	0.999983	D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.999;1.0;0.998;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.993;0.993;0.993;0.993;0.997;0.988;0.998;0.969;0.997	D	0.97021	0.9743	9	.	.	.	.	10.1594	0.42842	0.0:0.7956:0.0:0.2044	.	1311;1302;1311;1312;1308;1308;1705;1718;1718	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	H	1718;1718;1705;1696;1312;1311;1308;1308;1189;1718;1311;1311	ENSP00000370593:Q1718H;ENSP00000348812:Q1718H;ENSP00000353187:Q1705H;ENSP00000351293:Q1696H;ENSP00000347373:Q1312H;ENSP00000380741:Q1311H;ENSP00000380735:Q1308H;ENSP00000440515:Q1308H;ENSP00000438164:Q1718H;ENSP00000417093:Q1311H;ENSP00000380731:Q1311H	.	Q	-	3	2	PTPRD	8330442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.678000	0.46900	1.538000	0.49270	0.591000	0.81541	CAG		0.458	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			25	22	1	0	0.00047179	0.00333	0.000504596	25	22				
PTPRD	5789	broad.mit.edu	37	9	8484231	8484231	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:8484231C>A	ENST00000381196.4	-	27	3844	c.3301G>T	c.(3301-3303)Gca>Tca	p.A1101S	PTPRD_ENST00000360074.4_Missense_Mutation_p.A1088S|PTPRD_ENST00000537002.1_Missense_Mutation_p.A687S|PTPRD_ENST00000540109.1_Missense_Mutation_p.A1101S|PTPRD_ENST00000397606.3_Missense_Mutation_p.A680S|PTPRD_ENST00000358503.5_Missense_Mutation_p.A1079S|PTPRD_ENST00000355233.5_Missense_Mutation_p.A690S|PTPRD_ENST00000471274.1_5'Flank|PTPRD_ENST00000486161.1_Missense_Mutation_p.A690S|PTPRD_ENST00000397611.3_Missense_Mutation_p.A687S|PTPRD_ENST00000397617.3_Missense_Mutation_p.A680S|PTPRD_ENST00000356435.5_Missense_Mutation_p.A1101S	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1101	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCAGTCTTTGCCGTGACCCTG	0.473										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(3301-3303)GCA>TCA		protein tyrosine phosphatase, receptor type, D							157.0	129.0	138.0					9																	8484231		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8484231C>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3301G>T	9.37:g.8484231C>A	ENSP00000370593:p.Ala1101Ser	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Missense_Mutation_p.A690S|PTPRD_uc003zkq.2_Missense_Mutation_p.A690S|PTPRD_uc003zkr.2_Missense_Mutation_p.A685S|PTPRD_uc003zks.2_Missense_Mutation_p.A680S|PTPRD_uc003zkl.2_Missense_Mutation_p.A1092S|PTPRD_uc003zkm.2_Missense_Mutation_p.A1088S|PTPRD_uc003zkn.2_Missense_Mutation_p.A690S|PTPRD_uc003zko.2_Missense_Mutation_p.A687S	p.A1101S	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	29	4012	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1101			Fibronectin type-III 8.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.3301G>T	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913442	0.33815	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51	6.06	6.06	0.98353	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.156022	0.56097	D	0.000022	T	0.58623	0.2135	L	0.52573	1.65	0.47037	D	0.99929	B;B;B;B;B;B;B;B;B	0.31274	0.128;0.091;0.0;0.146;0.176;0.317;0.254;0.091;0.165	B;B;B;B;B;B;B;B;B	0.42030	0.065;0.024;0.0;0.024;0.373;0.164;0.287;0.103;0.15	T	0.49399	-0.8944	9	.	.	.	.	20.2312	0.98350	0.0:1.0:0.0:0.0	.	680;685;690;690;687;687;1088;1101;1101	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	S	1101;1101;1088;1079;690;680;687;687;1101;690;680	ENSP00000370593:A1101S;ENSP00000348812:A1101S;ENSP00000353187:A1088S;ENSP00000351293:A1079S;ENSP00000347373:A690S;ENSP00000380741:A680S;ENSP00000380735:A687S;ENSP00000440515:A687S;ENSP00000438164:A1101S;ENSP00000417093:A690S;ENSP00000380731:A680S	.	A	-	1	0	PTPRD	8474231	1.000000	0.71417	0.515000	0.27774	0.136000	0.21042	4.597000	0.61062	2.882000	0.98803	0.655000	0.94253	GCA		0.473	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			43	38	1	0	6.5261e-18	0.00874	8.96992e-18	43	38				
PRKACG	5568	broad.mit.edu	37	9	71628335	71628335	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:71628335A>G	ENST00000377276.2	-	1	704	c.674T>C	c.(673-675)cTa>cCa	p.L225P		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GAGCACCCCTAGGGCCCACCA	0.612																																					Esophageal Squamous(110;2236 2623 32146)	Esophageal Squamous(110;2236 2623 32146)	uc004agy.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(673-675)CTA>CCA		protein kinase, cAMP-dependent, catalytic,							66.0	64.0	65.0					9																	71628335		2203	4300	6503	SO:0001583	missense	5568				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity	g.chr9:71628335A>G	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.674T>C	9.37:g.71628335A>G	ENSP00000366488:p.Leu225Pro		Somatic					p.L225P	NM_002732	NP_002723	WXS	Illumina HiSeq	Unspecified	P22612	KAPCG_HUMAN			1	705	-			225			Protein kinase.		O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	ENST00000377276.2	37	c.674T>C	CCDS6625.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479836	0.44044	.	.	ENSG00000165059	ENST00000377276	T	0.11930	2.73	1.16	1.16	0.20824	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.25881	U	0.027688	T	0.46541	0.1398	H	0.98155	4.16	0.52501	D	0.999956	D	0.89917	1.0	D	0.85130	0.997	T	0.48625	-0.9019	10	0.87932	D	0	.	6.0938	0.20008	1.0:0.0:0.0:0.0	.	225	P22612	KAPCG_HUMAN	P	225	ENSP00000366488:L225P	ENSP00000366488:L225P	L	-	2	0	PRKACG	70818155	0.018000	0.18449	0.004000	0.12327	0.004000	0.04260	2.762000	0.47597	0.470000	0.27294	0.460000	0.39030	CTA		0.612	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1			25	23	0	0	0	0.00333	0	25	23				
TRPM3	80036	broad.mit.edu	37	9	73151003	73151003	+	Missense_Mutation	SNP	G	G	A	rs41287375	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:73151003G>A	ENST00000377110.3	-	25	5233	c.4990C>T	c.(4990-4992)Cgg>Tgg	p.R1664W	TRPM3_ENST00000408909.2_Missense_Mutation_p.R1523W|TRPM3_ENST00000396292.4_Missense_Mutation_p.R1536W|TRPM3_ENST00000358082.3_Missense_Mutation_p.R1526W|TRPM3_ENST00000357533.2_Missense_Mutation_p.R1668W|TRPM3_ENST00000423814.3_Missense_Mutation_p.R1691W|TRPM3_ENST00000360823.2_Missense_Mutation_p.R1526W|TRPM3_ENST00000396280.5_Missense_Mutation_p.R1513W|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000377105.1_Missense_Mutation_p.R1523W|TRPM3_ENST00000396285.1_Missense_Mutation_p.R1523W|TRPM3_ENST00000377106.1_Missense_Mutation_p.R1536W			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1689					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCTGTGTTCCGCTGCCTGTCG	0.577													G|||	2	0.000399361	0.0	0.0	5008	,	,		18066	0.001		0.001	False		,,,				2504	0.0						uc004aid.2		NA																	0				ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(4990-4992)CGG>TGG		transient receptor potential cation channel,		G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	215.0	202.0	206.0		4990,4531,4567,4501,4537,4606,4576	3.8	1.0	9	dbSNP_127	206	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense,missense,missense,missense	TRPM3	NM_001007471.2,NM_020952.4,NM_024971.5,NM_206944.3,NM_206945.3,NM_206946.3,NM_206947.3	101,101,101,101,101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1664/1708,1511/1555,1523/1567,1501/1545,1513/1557,1536/1580,1526/1570	73151003	1,13005	2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73151003G>A	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4990C>T	9.37:g.73151003G>A	ENSP00000366314:p.Arg1664Trp		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.R1506W|TRPM3_uc004ahv.2_Missense_Mutation_p.R1466W|TRPM3_uc004ahw.2_Missense_Mutation_p.R1536W|TRPM3_uc004ahx.2_Missense_Mutation_p.R1523W|TRPM3_uc004ahy.2_Missense_Mutation_p.R1526W|TRPM3_uc004ahz.2_Missense_Mutation_p.R1513W|TRPM3_uc004aia.2_Missense_Mutation_p.R1511W|TRPM3_uc004aib.2_Missense_Mutation_p.R1501W|TRPM3_uc004aic.2_Intron	p.R1664W	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			25	5234	-			1689			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	37	c.4990C>T	CCDS43835.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	1|1	0.0013192612137203166|0.0013192612137203166	G|G	17.73|17.73	3.462125|3.462125	0.63513|0.63513	0.0|0.0	1.16E-4|1.16E-4	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T	.|0.60040	.|0.33;0.24;0.24;0.22;0.32;0.22;0.25;0.24;0.24;0.32	5.77|5.77	3.85|3.85	0.44370|0.44370	.|.	.|0.063715	.|0.64402	.|D	.|0.000007	T|T	0.60534|0.60534	0.2276|0.2276	L|L	0.27053|0.27053	0.805|0.805	0.46678|0.46678	D|D	0.999154|0.999154	.|D;D;D;D;D;D;D	.|0.76494	.|0.999;0.996;0.997;0.999;0.999;0.999;0.999	.|P;P;P;P;P;P;P	.|0.59288	.|0.855;0.648;0.649;0.63;0.725;0.796;0.63	T|T	0.64377|0.64377	-0.6422|-0.6422	5|10	.|0.72032	.|D	.|0.01	-18.0411|-18.0411	15.123|15.123	0.72460|0.72460	0.0:0.0:0.7735:0.2265|0.0:0.0:0.7735:0.2265	rs41287375|rs41287375	.|1664;1654;1668;1526;1523;1636;1523	.|Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.	V|W	1512|1664;1536;1526;1523;1668;1523;1523;1536;1526;1691	.|ENSP00000366314:R1664W;ENSP00000366310:R1536W;ENSP00000354066:R1526W;ENSP00000366309:R1523W;ENSP00000350140:R1668W;ENSP00000386127:R1523W;ENSP00000379581:R1523W;ENSP00000379587:R1536W;ENSP00000350791:R1526W;ENSP00000389542:R1691W	.|ENSP00000350140:R1668W	A|R	-|-	2|1	0|2	TRPM3|TRPM3	72340823|72340823	0.983000|0.983000	0.35010|0.35010	0.962000|0.962000	0.40283|0.40283	0.966000|0.966000	0.64601|0.64601	1.539000|1.539000	0.36104|0.36104	0.705000|0.705000	0.31890|0.31890	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.577	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945		129	74	0	0	0	0.01441	0	129	74				
TRPM6	140803	broad.mit.edu	37	9	77436629	77436629	+	Silent	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:77436629C>A	ENST00000360774.1	-	8	1203	c.966G>T	c.(964-966)gcG>gcT	p.A322A	TRPM6_ENST00000376871.3_Silent_p.A322A|TRPM6_ENST00000451710.3_Silent_p.A322A|TRPM6_ENST00000449912.2_Silent_p.A317A|TRPM6_ENST00000376872.3_Silent_p.A322A|TRPM6_ENST00000361255.3_Silent_p.A317A|TRPM6_ENST00000376864.4_Silent_p.A322A|TRPM6_ENST00000483186.1_5'UTR	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	322					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GGAGGTCAGCCGCCCTACCTG	0.542																																							uc004ajl.1		NA																	0				lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(964-966)GCG>GCT		transient receptor potential cation channel,							128.0	100.0	109.0					9																	77436629		2203	4300	6503	SO:0001819	synonymous_variant	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77436629C>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.966G>T	9.37:g.77436629C>A			Somatic				TRPM6_uc004ajk.1_Silent_p.A317A|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Silent_p.A322A|TRPM6_uc010mpd.1_Silent_p.A322A|TRPM6_uc010mpe.1_Intron	p.A322A	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			8	1204	-			322			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	c.966G>T	CCDS6647.1																																																																																				0.542	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		32	22	1	0	2.80507e-11	0.012213	3.43196e-11	32	22				
GADD45G	10912	broad.mit.edu	37	9	92220638	92220638	+	Missense_Mutation	SNP	A	A	G			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:92220638A>G	ENST00000252506.6	+	3	321	c.212A>G	c.(211-213)gAc>gGc	p.D71G	GADD45G_ENST00000375769.1_Missense_Mutation_p.D53G|GADD45G_ENST00000494726.1_Intron	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	71	Homodimerization.				activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						GACGAGGGCGACATCGCGCTG	0.627																																					Colon(131;320 2336 18973 23919)	Colon(131;320 2336 18973 23919)	uc004aqq.2		NA																	0					0						c.(211-213)GAC>GGC		growth arrest and DNA-damage-inducible, gamma							75.0	59.0	65.0					9																	92220638		2203	4300	6503	SO:0001583	missense	10912				activation of MAPKKK activity|apoptosis|cell differentiation|DNA repair|multicellular organismal development		protein binding	g.chr9:92220638A>G	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.212A>G	9.37:g.92220638A>G	ENSP00000252506:p.Asp71Gly		Somatic				GADD45G_uc004aqr.2_Missense_Mutation_p.D53G	p.D71G	NM_006705	NP_006696	WXS	Illumina HiSeq	Unspecified	O95257	GA45G_HUMAN			3	322	+			71					Q5VZ87|Q9C076	Missense_Mutation	SNP	ENST00000252506.6	37	c.212A>G	CCDS6686.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703442	0.88924	.	.	ENSG00000130222	ENST00000252506;ENST00000375769	T;T	0.58358	0.34;0.34	4.23	4.23	0.50019	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77763	-0.2466	10	0.87932	D	0	-17.8676	12.6094	0.56542	1.0:0.0:0.0:0.0	.	71	O95257	GA45G_HUMAN	G	71;53	ENSP00000252506:D71G;ENSP00000364924:D53G	ENSP00000252506:D71G	D	+	2	0	GADD45G	91410458	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.475000	0.90417	1.906000	0.55180	0.459000	0.35465	GAC		0.627	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705		18	21	0	0	0	0.008871	0	18	21				
CAMSAP1	157922	broad.mit.edu	37	9	138713787	138713787	+	Missense_Mutation	SNP	C	C	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr9:138713787C>T	ENST00000389532.4	-	11	2784	c.2720G>A	c.(2719-2721)cGc>cAc	p.R907H	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.R629H|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.R918H	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	907	Sufficient for interaction with calmodulin.				cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GAGCTTCAGGCGCTGCCTTGC	0.617																																							uc004cgr.3		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2719-2721)CGC>CAC		calmodulin regulated spectrin-associated protein							63.0	71.0	69.0					9																	138713787		2203	4300	6503	SO:0001583	missense	157922					cytoplasm|microtubule		g.chr9:138713787C>T	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.2720G>A	9.37:g.138713787C>T	ENSP00000374183:p.Arg907His		Somatic				CAMSAP1_uc004cgq.3_Missense_Mutation_p.R797H|CAMSAP1_uc010nbg.2_Missense_Mutation_p.R629H	p.R907H	NM_015447	NP_056262	WXS	Illumina HiSeq	Unspecified	Q5T5Y3	CAMP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)	11	2720	-			907					A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	c.2720G>A	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692625	0.88735	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.71341	-0.56;-0.56;-0.56	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.86727	0.6002	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88956	0.3390	10	0.87932	D	0	-3.1478	18.9181	0.92515	0.0:1.0:0.0:0.0	.	907;918	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	H	907;629;918	ENSP00000374183:R907H;ENSP00000312463:R629H;ENSP00000386420:R918H	ENSP00000312463:R629H	R	-	2	0	CAMSAP1	137853608	1.000000	0.71417	0.974000	0.42286	0.528000	0.34623	7.664000	0.83830	2.554000	0.86153	0.655000	0.94253	CGC		0.617	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857		60	97	0	0	0	0.01441	0	60	97				
FAM46D	169966	broad.mit.edu	37	X	79699185	79699185	+	Missense_Mutation	SNP	C	C	T	rs199636557		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chrX:79699185C>T	ENST00000308293.5	+	3	1386	c.1147C>T	c.(1147-1149)Cgt>Tgt	p.R383C	FAM46D_ENST00000538312.1_Missense_Mutation_p.R383C	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	383										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						ACTGCACTTTCGTGGATCAAA	0.403																																							uc004edl.1		NA																	0				lung(2)	2						c.(1147-1149)CGT>TGT		hypothetical protein LOC169966							36.0	35.0	35.0					X																	79699185		2202	4296	6498	SO:0001583	missense	169966							g.chrX:79699185C>T	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1147C>T	X.37:g.79699185C>T	ENSP00000308575:p.Arg383Cys		Somatic				FAM46D_uc004edm.1_Missense_Mutation_p.R383C	p.R383C	NM_152630	NP_689843	WXS	Illumina HiSeq	Unspecified	Q8NEK8	FA46D_HUMAN			5	1481	+			383					B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	c.1147C>T	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	C	2.797	-0.250095	0.05867	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.23754	1.89;1.89	5.21	-0.265	0.12946	.	0.320352	0.30101	N	0.010404	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B	0.23854	0.092	B	0.09377	0.004	T	0.18085	-1.0348	10	0.59425	D	0.04	-0.028	8.3431	0.32256	0.5145:0.4109:0.0:0.0746	.	383	Q8NEK8	FA46D_HUMAN	C	383	ENSP00000443410:R383C;ENSP00000308575:R383C	ENSP00000308575:R383C	R	+	1	0	FAM46D	79585841	0.105000	0.21958	0.000000	0.03702	0.001000	0.01503	1.156000	0.31712	-0.201000	0.10284	-0.198000	0.12761	CGT		0.403	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630		15	6	0	0	0	0.007413	0	15	6				
GPR112	139378	broad.mit.edu	37	X	135431752	135431752	+	Missense_Mutation	SNP	G	G	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chrX:135431752G>T	ENST00000394143.1	+	6	6178	c.5887G>T	c.(5887-5889)Gct>Tct	p.A1963S	GPR112_ENST00000370652.1_Missense_Mutation_p.A1963S|GPR112_ENST00000287534.4_Missense_Mutation_p.A1900S|GPR112_ENST00000394141.1_Missense_Mutation_p.A1758S|GPR112_ENST00000412101.1_Missense_Mutation_p.A1758S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1963					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ATCTTTAAGAGCTATCACTTC	0.418																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(5887-5889)GCT>TCT		G-protein coupled receptor 112							105.0	99.0	101.0					X																	135431752		2203	4299	6502	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135431752G>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5887G>T	X.37:g.135431752G>T	ENSP00000377699:p.Ala1963Ser		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.A1758S|GPR112_uc010nsc.1_Missense_Mutation_p.A1730S	p.A1963S	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	6178	+	Acute lymphoblastic leukemia(192;0.000127)		1963			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.5887G>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.395053	0.00198	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.32023	1.51;1.51;1.47;1.6;1.47	4.21	-2.02	0.07388	.	.	.	.	.	T	0.11153	0.0272	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.17038	0.02;0.007;0.01	B;B;B	0.13407	0.007;0.009;0.004	T	0.21861	-1.0233	9	0.40728	T	0.16	.	3.7082	0.08408	0.3425:0.0:0.3011:0.3564	.	1900;1758;1963	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	1963;1963;1758;1900;1758	ENSP00000377699:A1963S;ENSP00000359686:A1963S;ENSP00000416526:A1758S;ENSP00000287534:A1900S;ENSP00000377697:A1758S	ENSP00000287534:A1900S	A	+	1	0	GPR112	135259418	0.000000	0.05858	0.013000	0.15412	0.078000	0.17371	-0.491000	0.06474	-0.497000	0.06641	0.530000	0.56133	GCT		0.418	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			33	15	1	0	2.08457e-15	0.010818	2.74823e-15	33	15				
SLITRK2	84631	broad.mit.edu	37	X	144904874	144904874	+	Missense_Mutation	SNP	C	C	A			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chrX:144904874C>A	ENST00000370490.1	+	1	5186	c.931C>A	c.(931-933)Cca>Aca	p.P311T	SLITRK2_ENST00000447897.2_Missense_Mutation_p.P311T|SLITRK2_ENST00000434188.2_Missense_Mutation_p.P311T|SLITRK2_ENST00000428560.2_Missense_Mutation_p.P311T|SLITRK2_ENST00000413937.2_Missense_Mutation_p.P311T			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	311					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P311A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAAATCGTCCAACTCCTCG	0.552																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(931-933)CCA>ACA		SLIT and NTRK-like family, member 2 precursor							69.0	62.0	64.0					X																	144904874		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904874C>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.931C>A	X.37:g.144904874C>A	ENSP00000359521:p.Pro311Thr		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.P311T|SLITRK2_uc010nso.2_Missense_Mutation_p.P311T|SLITRK2_uc011mwq.1_Missense_Mutation_p.P311T|SLITRK2_uc011mwr.1_Missense_Mutation_p.P311T|SLITRK2_uc011mws.1_Missense_Mutation_p.P311T|SLITRK2_uc004fcg.2_Missense_Mutation_p.P311T|SLITRK2_uc011mwt.1_Missense_Mutation_p.P311T	p.P311T	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1921	+	Acute lymphoblastic leukemia(192;6.56e-05)		311			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.931C>A	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660617	0.67586	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.56103	0.56;0.48;0.48;0.48;0.48;0.48	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	M	0.63843	1.955	0.80722	D	1	P	0.51057	0.941	P	0.48227	0.571	T	0.52859	-0.8519	10	0.11794	T	0.64	-5.3148	15.945	0.79787	0.0:1.0:0.0:0.0	.	311	Q9H156	SLIK2_HUMAN	T	311	ENSP00000334374:P311T;ENSP00000411681:P311T;ENSP00000359521:P311T;ENSP00000397015:P311T;ENSP00000407347:P311T;ENSP00000412010:P311T	ENSP00000334374:P311T	P	+	1	0	SLITRK2	144712566	1.000000	0.71417	0.987000	0.45799	0.996000	0.88848	7.487000	0.81328	2.365000	0.80145	0.600000	0.82982	CCA		0.552	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		35	16	1	0	1.414e-09	0.003755	1.64882e-09	35	16				
C1QA	712	broad.mit.edu	37	1	22965531	22965531	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:22965531delC	ENST00000374642.3	+	3	573	c.369delC	c.(367-369)aacfs	p.N123fs	C1QA_ENST00000402322.1_Frame_Shift_Del_p.N123fs	NM_015991.2	NP_057075.1	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	123	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell-cell signaling (GO:0007267)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|liver(1)|lung(3)|skin(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TTCGGCGGAACCCCCCAATGG	0.622																																							uc001bfy.2		NA																	0					0						c.(367-369)AACfs		complement component 1, q subcomponent, A chain	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						31.0	34.0	33.0					1																	22965531		2203	4300	6503	SO:0001589	frameshift_variant	712				cell-cell signaling|complement activation, classical pathway|innate immune response	collagen|complement component C1 complex		g.chr1:22965531delC	AF135157	CCDS226.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173372	ENSG00000173372		"""Complement system"""	1241	protein-coding gene	gene with protein product		120550	"""complement component 1, q subcomponent, alpha polypeptide"""			1537612	Standard	NM_015991		Approved		uc001bfy.3	P02745	OTTHUMG00000002893	ENST00000374642.3:c.369delC	1.37:g.22965531delC	ENSP00000363773:p.Asn123fs		Somatic				C1QA_uc001bfz.2_Frame_Shift_Del_p.N123fs	p.N123fs	NM_015991	NP_057075	WXS	Illumina HiSeq	Unspecified	P02745	C1QA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	3	454	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	123			C1q.		B2R4X2|Q5T963	Frame_Shift_Del	DEL	ENST00000374642.3	37	c.369delC	CCDS226.1																																																																																				0.622	C1QA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008087.2	NM_015991		14	22	NA	NA	NA	NA	NA	14	22	---	---	---	---
MROH9	80133	broad.mit.edu	37	1	170940953	170940974	+	Frame_Shift_Del	DEL	AAGATCCCTCGATTGTAAAACA	AAGATCCCTCGATTGTAAAACA	-	rs200626752|rs554437403	byFrequency	TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	AAGATCCCTCGATTGTAAAACA	AAGATCCCTCGATTGTAAAACA	-	-	AAGATCCCTCGATTGTAAAACA	AAGATCCCTCGATTGTAAAACA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr1:170940953_170940974delAAGATCCCTCGATTGTAAAACA	ENST00000367758.3	+	8	644_665	c.545_566delAAGATCCCTCGATTGTAAAACA	c.(544-567)gaagatccctcgattgtaaaacaafs	p.EDPSIVKQ182fs	MROH9_ENST00000367759.4_Frame_Shift_Del_p.EDPSIVKQ182fs	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	182								p.S185L(2)|p.P184H(2)|p.S185S(1)									TGTTCCCATGAAGATCCCTCGATTGTAAAACAAGCATCATTG	0.432																																							uc001ghg.2		NA																	5	Substitution - Missense(4)|Substitution - coding silent(1)		lung(4)|large_intestine(1)	pancreas(1)	1						c.(544-567)GAAGATCCCTCGATTGTAAAACAAfs		hypothetical protein LOC80133 isoform 2																																				SO:0001589	frameshift_variant	80133						binding	g.chr1:170940953_170940974delAAGATCCCTCGATTGTAAAACA	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.545_566delAAGATCCCTCGATTGTAAAACA	1.37:g.170940953_170940974delAAGATCCCTCGATTGTAAAACA	ENSP00000356732:p.Glu182fs		Somatic				C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Frame_Shift_Del_p.E182fs	p.E182fs	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			8	675_696	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		182_189					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Frame_Shift_Del	DEL	ENST00000367758.3	37	c.545_566delAAGATCCCTCGATTGTAAAACA	CCDS41436.1																																																																																				0.432	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		52	295	NA	NA	NA	NA	NA	52	295	---	---	---	---
SNX1	6642	broad.mit.edu	37	15	64426931	64426937	+	Frame_Shift_Del	DEL	GCGGGAG	GCGGGAG	-	rs561096025		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	GCGGGAG	GCGGGAG	-	-	GCGGGAG	GCGGGAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr15:64426931_64426937delGCGGGAG	ENST00000559844.1	+	12	1304_1310	c.1290_1296delGCGGGAG	c.(1288-1296)aagcgggagfs	p.KRE430fs	SNX1_ENST00000561026.1_Frame_Shift_Del_p.KRE365fs|SNX1_ENST00000560829.1_Frame_Shift_Del_p.KRE212fs|SNX1_ENST00000353874.4_Intron|SNX1_ENST00000261889.5_Frame_Shift_Del_p.KRE430fs			Q13596	SNX1_HUMAN	sorting nexin 1	430	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TGCAGAAGAAGCGGGAGGCCGAGGCTC	0.643																																							uc002amv.2		NA																	0					0						c.(1288-1296)AAGCGGGAGfs		sorting nexin 1 isoform a																																				SO:0001589	frameshift_variant	6642				cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity	g.chr15:64426931_64426937delGCGGGAG	BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1290_1296delGCGGGAG	15.37:g.64426931_64426937delGCGGGAG	ENSP00000453785:p.Lys430fs		Somatic				SNX1_uc010bgv.2_Frame_Shift_Del_p.K144fs|SNX1_uc010uio.1_Frame_Shift_Del_p.K430fs|SNX1_uc002amw.2_Intron|SNX1_uc002amx.2_Frame_Shift_Del_p.K365fs|SNX1_uc002amy.2_Frame_Shift_Del_p.K359fs|SNX1_uc010bgw.2_Frame_Shift_Del_p.K332fs	p.K430fs	NM_003099	NP_003090	WXS	Illumina HiSeq	Unspecified	Q13596	SNX1_HUMAN			12	1326_1332	+			430_432			BAR.		A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Frame_Shift_Del	DEL	ENST00000559844.1	37	c.1290_1296delGCGGGAG	CCDS32266.1																																																																																				0.643	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418559.1	NM_003099		16	21	NA	NA	NA	NA	NA	16	21	---	---	---	---
ASXL3	80816	broad.mit.edu	37	18	31319308	31319308	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr18:31319308delC	ENST00000269197.5	+	11	1940	c.1940delC	c.(1939-1941)acafs	p.T648fs		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	648	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TCCCTTGAGACAACATTTTGT	0.443																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1939-1941)ACAfs		additional sex combs like 3							50.0	48.0	49.0					18																	31319308		1900	4118	6018	SO:0001589	frameshift_variant	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31319308delC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1940delC	18.37:g.31319308delC	ENSP00000269197:p.Thr648fs		Somatic				ASXL3_uc002kxq.2_Frame_Shift_Del_p.T354fs	p.T647fs	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			11	1995	+			647			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Frame_Shift_Del	DEL	ENST00000269197.5	37	c.1940delC	CCDS45847.1																																																																																				0.443	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			16	25	NA	NA	NA	NA	NA	16	25	---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9082881	9082881	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:9082881delG	ENST00000397910.4	-	1	9137	c.8934delC	c.(8932-8934)cccfs	p.P2978fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2979	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCCTGAAGTGGGGACTCTGG	0.502																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(8932-8934)CCCfs		mucin 16							107.0	109.0	108.0					19																	9082881		2057	4227	6284	SO:0001589	frameshift_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9082881delG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8934delC	19.37:g.9082881delG	ENSP00000381008:p.Pro2978fs		Somatic					p.P2978fs	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	9138	-			2979			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	ENST00000397910.4	37	c.8934delC	CCDS54212.1																																																																																				0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		63	62	NA	NA	NA	NA	NA	63	62	---	---	---	---
EMP3	2014	broad.mit.edu	37	19	48833629	48833629	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr19:48833629delG	ENST00000270221.6	+	5	695	c.394delG	c.(394-396)gggfs	p.G133fs	EMP3_ENST00000597279.1_Frame_Shift_Del_p.G133fs|EMP3_ENST00000596315.1_Frame_Shift_Del_p.G64fs	NM_001425.2	NP_001416.1	P54852	EMP3_HUMAN	epithelial membrane protein 3	133					cell growth (GO:0016049)|negative regulation of cell proliferation (GO:0008285)	integral component of membrane (GO:0016021)				lung(1)	1		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GCACCCGCGAGGGGGCAGCTT	0.622																																							uc002piv.2		NA																	0					0						c.(394-396)GGGfs		epithelial membrane protein 3							74.0	74.0	74.0					19																	48833629		2203	4300	6503	SO:0001589	frameshift_variant	2014				cell growth|negative regulation of cell proliferation	integral to membrane		g.chr19:48833629delG	U52101	CCDS12715.1	19q13.3	2008-07-16				ENSG00000142227			3335	protein-coding gene	gene with protein product		602335				8996089, 10331954	Standard	NM_001425		Approved	YMP	uc002piv.2	P54852		ENST00000270221.6:c.394delG	19.37:g.48833629delG	ENSP00000270221:p.Gly133fs		Somatic					p.G132fs	NM_001425	NP_001416	WXS	Illumina HiSeq	Unspecified	P54852	EMP3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)	5	648	+		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)	132					Q6FH01	Frame_Shift_Del	DEL	ENST00000270221.6	37	c.394delG	CCDS12715.1																																																																																				0.622	EMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465613.1	NM_001425		43	34	NA	NA	NA	NA	NA	43	34	---	---	---	---
IL36G	56300	broad.mit.edu	37	2	113742558	113742558	+	Frame_Shift_Del	DEL	C	C	-	rs376883493		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:113742558delC	ENST00000259205.4	+	5	511	c.442delC	c.(442-444)cccfs	p.P148fs	IL36G_ENST00000376489.2_Frame_Shift_Del_p.P113fs	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	148					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						GAGAGACCAGCCCATCATTCT	0.488																																						Esophageal Squamous(44;715 981 6239 42838 46707)	uc002tio.1		NA																	0					0						c.(442-444)CCCfs		interleukin 1 family, member 9							92.0	82.0	85.0					2																	113742558		2203	4300	6503	SO:0001589	frameshift_variant	56300				cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity	g.chr2:113742558delC	AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.442delC	2.37:g.113742558delC	ENSP00000259205:p.Pro148fs		Somatic				IL1F9_uc010fkr.1_Frame_Shift_Del_p.P113fs	p.P148fs	NM_019618	NP_062564	WXS	Illumina HiSeq	Unspecified	Q9NZH8	IL36G_HUMAN			5	511	+			148					Q56B91|Q6UVX7|Q7RTZ9	Frame_Shift_Del	DEL	ENST00000259205.4	37	c.442delC	CCDS2108.1																																																																																				0.488	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618		29	78	NA	NA	NA	NA	NA	29	78	---	---	---	---
LOC401010	401010	broad.mit.edu	37	2	132201558	132201558	+	IGR	DEL	G	G	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr2:132201558delG								AC073869.19 (34936 upstream) : RP11-109E12.1 (17835 downstream)																							TGCTCCATACGACCACCATTC	0.607																																							uc002tst.2		NA																	0					0						c.(442-444)GTCfs		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132201558delG																													2.37:g.132201558delG			Somatic					p.V148fs	NR_002826		WXS	Illumina HiSeq	Unspecified					1	910	-									Frame_Shift_Del	DEL		37	c.444delC																																																																																				0	0.607									25	22	NA	NA	NA	NA	NA	25	22	---	---	---	---
RRP1B	23076	broad.mit.edu	37	21	45113189	45113203	+	In_Frame_Del	DEL	CAGCTCACCCCTGGT	CAGCTCACCCCTGGT	-	rs367654052		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	CAGCTCACCCCTGGT	CAGCTCACCCCTGGT	-	-	CAGCTCACCCCTGGT	CAGCTCACCCCTGGT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr21:45113189_45113203delCAGCTCACCCCTGGT	ENST00000340648.4	+	16	2319_2333	c.2202_2216delCAGCTCACCCCTGGT	c.(2200-2217)gccagctcacccctggtg>gcg	p.SSPLV735del		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	735					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)	p.V739E(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		GCTCACCTGCCAGCTCACCCCTGGTGGCCAAGAAG	0.586																																							uc002zdk.2		NA																	1	Substitution - Missense(1)		ovary(1)	skin(1)	1						c.(2200-2217)GCCAGCTCACCCCTGGTG>GCG		ribosomal RNA processing 1 homolog B																																				SO:0001651	inframe_deletion	23076				rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding	g.chr21:45113189_45113203delCAGCTCACCCCTGGT	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.2202_2216delCAGCTCACCCCTGGT	21.37:g.45113189_45113203delCAGCTCACCCCTGGT	ENSP00000339145:p.Ser735_Val739del		Somatic				RRP1B_uc002zdl.2_In_Frame_Del_p.SSPLV268del	p.SSPLV735del	NM_015056	NP_055871	WXS	Illumina HiSeq	Unspecified	Q14684	RRP1B_HUMAN		STAD - Stomach adenocarcinoma(101;0.178)	16	2316_2330	+			735_739					Q8TBZ4	In_Frame_Del	DEL	ENST00000340648.4	37	c.2202_2216delCAGCTCACCCCTGGT	CCDS33577.1																																																																																				0.586	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056		7	17	NA	NA	NA	NA	NA	7	17	---	---	---	---
ZNF148	7707	broad.mit.edu	37	3	124996612	124996612	+	Frame_Shift_Del	DEL	T	T	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr3:124996612delT	ENST00000360647.4	-	7	1110	c.625delA	c.(625-627)atafs	p.I209fs	ZNF148_ENST00000485866.1_Frame_Shift_Del_p.I209fs|ZNF148_ENST00000544464.1_Frame_Shift_Del_p.I4fs|ZNF148_ENST00000468369.1_Frame_Shift_Del_p.I17fs|SLC12A8_ENST00000423114.2_Frame_Shift_Del_p.S32fs|ZNF148_ENST00000484491.1_Frame_Shift_Del_p.I209fs|ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000492394.1_Frame_Shift_Del_p.I209fs	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	209					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						TACTTCTGTATGAAACGCATG	0.338																																							uc003ehx.3		NA																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(625-627)ATAfs		zinc finger protein 148							112.0	103.0	106.0					3																	124996612		2203	4300	6503	SO:0001589	frameshift_variant	7707				cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chr3:124996612delT	U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.625delA	3.37:g.124996612delT	ENSP00000353863:p.Ile209fs		Somatic				SLC12A8_uc003ehw.3_Frame_Shift_Del_p.S32fs|ZNF148_uc003ehz.3_Frame_Shift_Del_p.I209fs|ZNF148_uc010hsa.2_Frame_Shift_Del_p.I209fs|ZNF148_uc003eia.3_Frame_Shift_Del_p.I209fs|ZNF148_uc003ehy.2_Frame_Shift_Del_p.I4fs	p.I209fs	NM_021964	NP_068799	WXS	Illumina HiSeq	Unspecified	Q9UQR1	ZN148_HUMAN			7	1111	-			209			C2H2-type 2.		D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Frame_Shift_Del	DEL	ENST00000360647.4	37	c.625delA	CCDS3031.1																																																																																				0.338	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964		21	43	NA	NA	NA	NA	NA	21	43	---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115998015	115998016	+	Frame_Shift_Ins	INS	-	-	T			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr4:115998015_115998016insT	ENST00000264363.2	-	2	855_856	c.177_178insA	c.(175-180)ccatatfs	p.Y60fs		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	60	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		ATTGACCTATATGGTAGAATTT	0.416																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(175-180)CCATATfs		heparan sulfate N-deacetylase/N-sulfotransferase																																				SO:0001589	frameshift_variant	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115998015_115998016insT	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.178dupA	4.37:g.115998016_115998016dupT	ENSP00000264363:p.Tyr60fs		Somatic				NDST4_uc010imw.2_Intron	p.P59fs	NM_022569	NP_072091	WXS	Illumina HiSeq	Unspecified	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	2	856_857	-		Ovarian(17;0.156)	59_60			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Frame_Shift_Ins	INS	ENST00000264363.2	37	c.177_178insA	CCDS3706.1																																																																																				0.416	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		29	54	NA	NA	NA	NA	NA	29	54	---	---	---	---
NSD1	64324	broad.mit.edu	37	5	176562850	176562850	+	Frame_Shift_Del	DEL	A	A	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr5:176562850delA	ENST00000439151.2	+	2	791	c.746delA	c.(745-747)gaafs	p.E249fs	NSD1_ENST00000354179.4_Intron|NSD1_ENST00000347982.4_Intron|NSD1_ENST00000511258.1_Intron|NSD1_ENST00000361032.4_Frame_Shift_Del_p.E249fs	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	249					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GGCAGCAATGAAAAAGCAGCC	0.413			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		0				ovary(2)|kidney(1)	3						c.(745-747)GAAfs		nuclear receptor binding SET domain protein 1							77.0	76.0	76.0					5																	176562850		2203	4300	6503	SO:0001589	frameshift_variant	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176562850delA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.746delA	5.37:g.176562850delA	ENSP00000395929:p.Glu249fs	HNSCC(47;0.14)	Somatic				NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Frame_Shift_Del_p.E249fs|NSD1_uc011dfx.1_Intron|NSD1_uc003mfp.2_Frame_Shift_Del_p.E249fs|NSD1_uc003mfq.2_Frame_Shift_Del_p.E249fs	p.E249fs	NM_022455	NP_071900	WXS	Illumina HiSeq	Unspecified	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	2	884	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	249					Q96PD8|Q96RN7	Frame_Shift_Del	DEL	ENST00000439151.2	37	c.746delA	CCDS4412.1																																																																																				0.413	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		25	40	NA	NA	NA	NA	NA	25	40	---	---	---	---
FASTK	10922	broad.mit.edu	37	7	150774247	150774249	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	TGG	TGG	-	-	TGG	TGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr7:150774247_150774249delTGG	ENST00000297532.6	-	8	1443_1445	c.1366_1368delCCA	c.(1366-1368)ccadel	p.P456del	FASTK_ENST00000482571.1_In_Frame_Del_p.P429del|FASTK_ENST00000353841.2_In_Frame_Del_p.P315del|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000540185.1_3'UTR	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	456					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GGCAGGACCTTGGTGGGTATGGC	0.685																																							uc003wix.1		NA																	0				lung(2)|stomach(2)	4						c.(1366-1368)CCAdel		Fas-activated serine/threonine kinase isoform 1																																				SO:0001651	inframe_deletion	10922				apoptosis|induction of apoptosis by extracellular signals|regulation of RNA splicing		ATP binding|Fas-activated serine/threonine kinase activity|protein binding	g.chr7:150774247_150774249delTGG		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1366_1368delCCA	7.37:g.150774250_150774252delTGG	ENSP00000297532:p.Pro456del		Somatic				uc011kvf.1_5'Flank|FASTK_uc003wiw.1_In_Frame_Del_p.P217del|FASTK_uc003wiy.1_In_Frame_Del_p.P315del|FASTK_uc003wiz.1_In_Frame_Del_p.P429del|FASTK_uc003wja.1_3'UTR	p.P456del	NM_006712	NP_006703	WXS	Illumina HiSeq	Unspecified	Q14296	FASTK_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)	8	1464_1466	-			456					A8K867|F8VTW9|Q59EM8|Q8IVA0	In_Frame_Del	DEL	ENST00000297532.6	37	c.1366_1368delCCA	CCDS5918.1																																																																																				0.685	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2	NM_006712		10	64	NA	NA	NA	NA	NA	10	64	---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885101	88885101	+	Frame_Shift_Del	DEL	C	C	-	rs138379350		TCGA-44-7671-01A-11D-2063-08	TCGA-44-7671-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a9e5a202-125b-4fd6-866e-78c1cf41a9f1	a3fb8d58-8cd9-41b8-b108-b5ca14a116a6	g.chr8:88885101delC	ENST00000319675.3	-	1	1195	c.1099delG	c.(1099-1101)gccfs	p.A367fs		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	367										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GAAGAGAAGGCCACACTGGGA	0.582																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(1099-1101)GCCfs		WD repeat domain 21C							68.0	76.0	73.0					8																	88885101		2203	4300	6503	SO:0001589	frameshift_variant	138009							g.chr8:88885101delC	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1099delG	8.37:g.88885101delC	ENSP00000316496:p.Ala367fs		Somatic					p.A367fs	NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	1196	-			367						Frame_Shift_Del	DEL	ENST00000319675.3	37	c.1099delG	CCDS6245.1																																																																																				0.582	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		25	63	NA	NA	NA	NA	NA	25	63	---	---	---	---
