#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SLC2A5	6518	broad.mit.edu	37	1	9097678	9097678	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:9097678C>G	ENST00000377424.4	-	12	1652	c.1473G>C	c.(1471-1473)ctG>ctC	p.L491L	SLC2A5_ENST00000536305.1_Silent_p.L432L|SLC2A5_ENST00000535586.1_Silent_p.L376L	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	491					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)	p.L491L(1)		endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGCTCTTTCAGTTCCTCCT	0.493																																							uc001apo.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(1471-1473)CTG>CTC		solute carrier family 2 (facilitated							128.0	133.0	132.0					1																	9097678		2203	4300	6503	SO:0001819	synonymous_variant	6518				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity	g.chr1:9097678C>G	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1473G>C	1.37:g.9097678C>G			Somatic				SLC2A5_uc010nzy.1_Silent_p.L432L|SLC2A5_uc010nzz.1_Silent_p.L376L|SLC2A5_uc010oaa.1_Silent_p.L447L|SLC2A5_uc010oab.1_Silent_p.L491L	p.L491L	NM_003039	NP_003030	WXS	Illumina HiSeq	Unspecified	P22732	GTR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)	12	1765	-	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	491			Cytoplasmic (Potential).		Q14770|Q5T977|Q8IVB3	Silent	SNP	ENST00000377424.4	37	c.1473G>C	CCDS99.1																																																																																				0.493	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039		4	233	0	0	0	0.000602	0	4	233				
MTOR	2475	broad.mit.edu	37	1	11297992	11297992	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:11297992C>G	ENST00000361445.4	-	13	2192	c.2116G>C	c.(2116-2118)Gag>Cag	p.E706Q		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	706					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E706Q(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCCCGGATCTCAAACACCTGG	0.572																																							uc001asd.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						c.(2116-2118)GAG>CAG		FK506 binding protein 12-rapamycin associated							89.0	73.0	79.0					1																	11297992		2203	4300	6503	SO:0001583	missense	2475				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr1:11297992C>G	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2116G>C	1.37:g.11297992C>G	ENSP00000354558:p.Glu706Gln		Somatic					p.E706Q	NM_004958	NP_004949	WXS	Illumina HiSeq	Unspecified	P42345	MTOR_HUMAN			13	2237	-			706					Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	c.2116G>C	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811994	0.90707	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.33216	1.42	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.56153	-0.8026	10	0.40728	T	0.16	-1.6844	19.8344	0.96650	0.0:1.0:0.0:0.0	.	706	P42345	MTOR_HUMAN	Q	706	ENSP00000354558:E706Q	ENSP00000354558:E706Q	E	-	1	0	MTOR	11220579	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.456000	0.80751	2.696000	0.92011	0.561000	0.74099	GAG		0.572	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		7	80	0	0	0	0.004482	0	7	80				
CASP9	842	broad.mit.edu	37	1	15819510	15819510	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:15819510C>T	ENST00000333868.5	-	9	1273	c.1179G>A	c.(1177-1179)gtG>gtA	p.V393V	CASP9_ENST00000375890.4_Silent_p.V310V|CASP9_ENST00000546424.1_3'UTR|CASP9_ENST00000348549.5_Silent_p.V243V	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	393					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)	p.V393V(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		AAATCCCTTTCACCGAAACAG	0.458																																							uc001awn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|kidney(1)	2						c.(1177-1179)GTG>GTA		caspase 9 isoform alpha preproprotein							82.0	89.0	87.0					1																	15819510		2203	4300	6503	SO:0001819	synonymous_variant	842				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding	g.chr1:15819510C>T	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1179G>A	1.37:g.15819510C>T			Somatic				CASP9_uc001awm.1_3'UTR|CASP9_uc001awo.2_Silent_p.V243V|CASP9_uc001awp.2_Silent_p.V237V|CASP9_uc009voi.2_Silent_p.V237V|CASP9_uc010obm.1_Silent_p.V310V|CASP9_uc001awq.2_Silent_p.V310V	p.V393V	NM_001229	NP_001220	WXS	Illumina HiSeq	Unspecified	P55211	CASP9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)	9	1274	-		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	393					B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Silent	SNP	ENST00000333868.5	37	c.1179G>A	CCDS158.1	.	.	.	.	.	.	.	.	.	.	C	4.236	0.042721	0.08196	.	.	ENSG00000132906	ENST00000424908	.	.	.	5.98	1.39	0.22231	.	.	.	.	.	T	0.34424	0.0897	.	.	.	0.33793	D	0.625743	.	.	.	.	.	.	T	0.42327	-0.9458	4	.	.	.	.	1.24	0.01960	0.2058:0.3718:0.2452:0.1771	.	.	.	.	K	175	.	.	E	-	1	0	CASP9	15692097	0.542000	0.26426	0.631000	0.29282	0.538000	0.34931	0.313000	0.19415	0.813000	0.34350	0.650000	0.86243	GAA		0.458	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996		65	130	0	0	0	0.01441	0	65	130				
SEPN1	57190	broad.mit.edu	37	1	26139275	26139275	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:26139275C>T	ENST00000374315.1	+	9	1315	c.1277C>T	c.(1276-1278)tCc>tTc	p.S426F	RP1-317E23.6_ENST00000527604.1_5'Flank|SEPN1_ENST00000354177.4_Intron|SEPN1_ENST00000361547.2_Missense_Mutation_p.S460F|SEPN1_ENST00000494537.1_3'UTR	NM_206926.1	NP_996809.1	Q9NZV5	SELN_HUMAN	selenoprotein N, 1	460						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.S460F(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GATGACCAGTCCTGCTGAGGT	0.597																																							uc010oer.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1378-1380)TCC>TTC		selenoprotein N, 1 isoform 1 precursor							30.0	32.0	31.0					1																	26139275		1968	4137	6105	SO:0001583	missense	57190					endoplasmic reticulum membrane|extracellular region	protein binding	g.chr1:26139275C>T	AF166125	CCDS41282.1, CCDS41283.1	1p36.13	2014-09-17	2004-02-13		ENSG00000162430	ENSG00000162430		"""EF-hand domain containing"""	15999	protein-coding gene	gene with protein product		606210	"""rigid spine muscular dystrophy 1"""	RSMD1, MDRS1		10608886	Standard	NM_020451		Approved	selN, RSS	uc021ojl.1	Q9NZV5	OTTHUMG00000007375	ENST00000374315.1:c.1277C>T	1.37:g.26139275C>T	ENSP00000363434:p.Ser426Phe		Somatic				SEPN1_uc010oes.1_Missense_Mutation_p.S426F	p.S460F	NM_020451	NP_065184	WXS	Illumina HiSeq	Unspecified	Q9NZV5	SELN_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)	12	1434	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)	460					A6NJG8|A8MQ64|Q6PI70|Q969F6|Q9NUI6	Missense_Mutation	SNP	ENST00000374315.1	37	c.1379C>T	CCDS41283.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723280	0.68959	.	.	ENSG00000162430	ENST00000361547;ENST00000374315	D;D	0.90788	-2.67;-2.73	5.6	5.6	0.85130	.	0.549745	0.21333	N	0.076273	D	0.95079	0.8406	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	D	0.95116	0.8242	10	0.87932	D	0	-3.6862	19.6146	0.95629	0.0:1.0:0.0:0.0	.	426;460	Q9NZV5-2;Q9NZV5	.;SELN_HUMAN	F	460;426	ENSP00000355141:S460F;ENSP00000363434:S426F	ENSP00000355141:S460F	S	+	2	0	SEPN1	26011862	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.783000	0.85696	2.639000	0.89480	0.563000	0.77884	TCC		0.597	SEPN1-002	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000019315.2	NM_020451		11	20	0	0	0	0.00245	0	11	20				
TMEM39B	55116	broad.mit.edu	37	1	32568034	32568034	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:32568034C>T	ENST00000336294.5	+	9	1385	c.1239C>T	c.(1237-1239)ttC>ttT	p.F413F	TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000373634.4_Silent_p.F214F	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	413						integral component of membrane (GO:0016021)		p.F286F(1)|p.F413F(1)		endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCGGGCAGTTCTTTTTCAGCA	0.567																																							uc010ogv.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1237-1239)TTC>TTT		transmembrane protein 39B							94.0	94.0	94.0					1																	32568034		2203	4300	6503	SO:0001819	synonymous_variant	55116					integral to membrane		g.chr1:32568034C>T	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.1239C>T	1.37:g.32568034C>T			Somatic				TMEM39B_uc001bue.3_Silent_p.F414F|TMEM39B_uc001buf.3_Silent_p.F214F|TMEM39B_uc010ogw.1_Silent_p.F214F	p.F413F	NM_018056	NP_060526	WXS	Illumina HiSeq	Unspecified	Q9GZU3	TM39B_HUMAN			9	1385	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	413					B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Silent	SNP	ENST00000336294.5	37	c.1239C>T	CCDS351.2																																																																																				0.567	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056		10	108	0	0	0	0.010729	0	10	108				
TSPAN1	10103	broad.mit.edu	37	1	46649908	46649908	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:46649908G>A	ENST00000372003.1	+	4	567	c.103G>A	c.(103-105)Gat>Aat	p.D35N	TSPAN1_ENST00000498443.1_3'UTR	NM_005727.3	NP_005718.2	O60635	TSN1_HUMAN	tetraspanin 1	35					cell migration (GO:0016477)|cell proliferation (GO:0008283)|positive regulation of endocytosis (GO:0045807)|protein stabilization (GO:0050821)|thiamine transmembrane transport (GO:0071934)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.D35N(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				GGTGTCAATCGATGGGGCATC	0.567																																							uc001cpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(103-105)GAT>AAT		tetraspan 1							182.0	154.0	163.0					1																	46649908		2203	4300	6503	SO:0001583	missense	10103					integral to membrane|lysosomal membrane		g.chr1:46649908G>A	BC013404	CCDS530.1	1p33	2013-02-14			ENSG00000117472	ENSG00000117472		"""Tetraspanins"""	20657	protein-coding gene	gene with protein product		613170				9714763, 10719184	Standard	NM_005727		Approved	TSPAN-1, NET-1	uc001cpd.3	O60635	OTTHUMG00000007602	ENST00000372003.1:c.103G>A	1.37:g.46649908G>A	ENSP00000361072:p.Asp35Asn		Somatic				TSPAN1_uc009vyd.1_Missense_Mutation_p.D35N	p.D35N	NM_005727	NP_005718	WXS	Illumina HiSeq	Unspecified	O60635	TSN1_HUMAN			4	567	+	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)	35			Extracellular (Potential).		D3DQ14|O60745|Q5VST0	Missense_Mutation	SNP	ENST00000372003.1	37	c.103G>A	CCDS530.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843721	0.91197	.	.	ENSG00000117472	ENST00000372003	T	0.38722	1.12	4.87	3.96	0.45880	.	0.156902	0.53938	N	0.000044	T	0.65544	0.2701	M	0.83312	2.635	0.53688	D	0.999977	D	0.89917	1.0	D	0.85130	0.997	T	0.70132	-0.4956	10	0.56958	D	0.05	.	12.906	0.58152	0.0779:0.0:0.9221:0.0	.	35	O60635	TSN1_HUMAN	N	35	ENSP00000361072:D35N	ENSP00000361072:D35N	D	+	1	0	TSPAN1	46422495	1.000000	0.71417	0.688000	0.30117	0.989000	0.77384	7.725000	0.84808	1.273000	0.44346	0.557000	0.71058	GAT		0.567	TSPAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020135.1	NM_005727		17	159	0	0	0	0.00278	0	17	159				
NSUN4	387338	broad.mit.edu	37	1	46827467	46827467	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:46827467C>G	ENST00000474844.1	+	6	1754	c.1104C>G	c.(1102-1104)ctC>ctG	p.L368L	NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Silent_p.L319L|NSUN4_ENST00000536062.1_Silent_p.L319L	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	368					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)	p.L368L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					TACCAAACCTCATGGCCAATT	0.453																																							uc001cpr.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1102-1104)CTC>CTG		NOL1/NOP2/Sun domain family 4 protein							154.0	146.0	149.0					1																	46827467		2203	4300	6503	SO:0001819	synonymous_variant	387338						methyltransferase activity	g.chr1:46827467C>G	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.1104C>G	1.37:g.46827467C>G			Somatic				NSUN4_uc010omc.1_Silent_p.L319L|NSUN4_uc009vyf.1_Silent_p.L217L|NSUN4_uc009vyg.1_Silent_p.L319L|NSUN4_uc001cpt.1_RNA|NSUN4_uc001cps.1_RNA	p.L368L	NM_199044	NP_950245	WXS	Illumina HiSeq	Unspecified	Q96CB9	NSUN4_HUMAN			6	1213	+	Acute lymphoblastic leukemia(166;0.155)		368					A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Silent	SNP	ENST00000474844.1	37	c.1104C>G	CCDS534.1																																																																																				0.453	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044		19	80	0	0	0	0.007413	0	19	80				
LRRC42	115353	broad.mit.edu	37	1	54418039	54418039	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:54418039G>A	ENST00000371370.3	+	3	888	c.367G>A	c.(367-369)Gaa>Aaa	p.E123K	LRRC42_ENST00000319223.4_Missense_Mutation_p.E123K	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	123								p.E123K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						CTCTGCTGCTGAAGCCAGACA	0.493																																							uc001cwj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(367-369)GAA>AAA		leucine rich repeat containing 42							77.0	75.0	75.0					1																	54418039		2203	4300	6503	SO:0001583	missense	115353							g.chr1:54418039G>A	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.367G>A	1.37:g.54418039G>A	ENSP00000360421:p.Glu123Lys		Somatic				LRRC42_uc001cwl.1_Missense_Mutation_p.E123K|LRRC42_uc001cwk.1_Missense_Mutation_p.E123K|LRRC42_uc009vzm.1_Missense_Mutation_p.E123K	p.E123K	NM_052940	NP_443172	WXS	Illumina HiSeq	Unspecified	Q9Y546	LRC42_HUMAN			2	567	+			123					D3DQ46|Q8N2Q8	Missense_Mutation	SNP	ENST00000371370.3	37	c.367G>A	CCDS585.1	.	.	.	.	.	.	.	.	.	.	G	32	5.163616	0.94727	.	.	ENSG00000116212	ENST00000371370;ENST00000371368;ENST00000319223;ENST00000444987	.	.	.	5.65	5.65	0.86999	.	0.049573	0.85682	D	0.000000	T	0.67173	0.2865	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.99;0.997;0.982	P;D;P	0.66196	0.896;0.942;0.791	T	0.68618	-0.5361	9	0.66056	D	0.02	-18.6186	20.1111	0.97911	0.0:0.0:1.0:0.0	.	123;123;123	E7EP35;A6NL66;Q9Y546	.;.;LRC42_HUMAN	K	123	.	ENSP00000318185:E123K	E	+	1	0	LRRC42	54190627	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.973000	0.93428	2.838000	0.97847	0.655000	0.94253	GAA		0.493	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940		4	112	0	0	0	0.009096	0	4	112				
ANKRD34A	284615	broad.mit.edu	37	1	145473380	145473380	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:145473380C>A	ENST00000323397.4	+	4	1345	c.52C>A	c.(52-54)Cta>Ata	p.L18I	POLR3GL_ENST00000369314.1_5'Flank|POLR3GL_ENST00000369313.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	18						cytoplasm (GO:0005737)		p.L18I(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCAGGGTAAGCTACGCTTGGC	0.657																																							uc001enq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(52-54)CTA>ATA		ankyrin repeat domain 34							46.0	49.0	48.0					1																	145473380		2203	4300	6503	SO:0001583	missense	284615							g.chr1:145473380C>A	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.52C>A	1.37:g.145473380C>A	ENSP00000314103:p.Leu18Ile		Somatic				NBPF10_uc001emp.3_Intron|POLR3GL_uc001enp.1_5'Flank	p.L18I	NM_001039888	NP_001034977	WXS	Illumina HiSeq	Unspecified	Q69YU3	AN34A_HUMAN			4	1345	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		18			ANK 1.		B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	c.52C>A	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.517061	0.64634	.	.	ENSG00000181039	ENST00000323397	T	0.36157	1.27	5.12	5.12	0.69794	Ankyrin repeat-containing domain (3);	0.080948	0.51477	D	0.000089	T	0.24547	0.0595	L	0.38953	1.18	0.33929	D	0.641852	D	0.57257	0.979	P	0.50590	0.645	T	0.12477	-1.0546	10	0.59425	D	0.04	-6.8957	9.4601	0.38778	0.0:0.9064:0.0:0.0936	.	18	Q69YU3	AN34A_HUMAN	I	18	ENSP00000314103:L18I	ENSP00000314103:L18I	L	+	1	2	ANKRD34A	144184737	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.827000	0.27421	2.648000	0.89879	0.561000	0.74099	CTA		0.657	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1			37	35	1	0	1.15183e-24	0.009718	1.41872e-24	37	35				
CHD1L	9557	broad.mit.edu	37	1	146727479	146727479	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:146727479G>T	ENST00000369258.4	+	4	379	c.359G>T	c.(358-360)gGt>gTt	p.G120V	CHD1L_ENST00000431239.1_Missense_Mutation_p.G120V|CHD1L_ENST00000361293.5_Intron|CHD1L_ENST00000369259.3_Intron|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	120	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.G120V(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TTTGCTCCAGGTCTTTCCTGT	0.418																																							uc001epm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6						c.(358-360)GGT>GTT		chromodomain helicase DNA binding protein							82.0	76.0	78.0					1																	146727479		2203	4300	6503	SO:0001583	missense	9557				chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding	g.chr1:146727479G>T	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.359G>T	1.37:g.146727479G>T	ENSP00000358262:p.Gly120Val		Somatic				CHD1L_uc001epn.3_Missense_Mutation_p.G7V|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_Missense_Mutation_p.G120V|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron	p.G120V	NM_004284	NP_004275	WXS	Illumina HiSeq	Unspecified	Q86WJ1	CHD1L_HUMAN			4	422	+	all_hematologic(923;0.0487)		120			Helicase ATP-binding.		A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	c.359G>T	CCDS927.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.80|19.80	3.894723|3.894723	0.72639|0.72639	.|.	.|.	ENSG00000131778|ENSG00000131778	ENST00000431239;ENST00000369258;ENST00000436230|ENST00000254086	D;D|.	0.94687|.	-3.49;-3.49|.	5.57|5.57	4.66|4.66	0.58398|0.58398	DEAD-like helicase (2);SNF2-related (1);|.	0.318886|.	0.38381|.	N|.	0.001708|.	T|T	0.34978|0.34978	0.0916|0.0916	L|L	0.53729|0.53729	1.69|1.69	0.80722|0.80722	D|D	1|1	P;P|.	0.48407|.	0.585;0.91|.	B;P|.	0.51742|.	0.413;0.678|.	T|T	0.41645|0.41645	-0.9497|-0.9497	10|6	0.48119|0.02654	T|T	0.1|1	.|.	10.9929|10.9929	0.47559|0.47559	0.0866:0.0:0.9134:0.0|0.0866:0.0:0.9134:0.0	.|.	120;120|.	Q86WJ1-2;Q86WJ1|.	.;CHD1L_HUMAN|.	V|S	120;120;20|81	ENSP00000389031:G120V;ENSP00000358262:G120V|.	ENSP00000358262:G120V|ENSP00000254086:R81S	G|R	+|+	2|3	0|2	CHD1L|CHD1L	145194103|145194103	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.071000|5.071000	0.64382|0.64382	1.497000|1.497000	0.48584|0.48584	0.591000|0.591000	0.81541|0.81541	GGT|AGG		0.418	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284		4	60	1	0	0.000602214	0.000602	0.000683412	4	60				
CDC42SE1	56882	broad.mit.edu	37	1	151026774	151026774	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:151026774C>T	ENST00000439374.2	-	7	1073	c.189G>A	c.(187-189)atG>atA	p.M63I	CDC42SE1_ENST00000540998.1_Missense_Mutation_p.M63I|CDC42SE1_ENST00000357235.5_Missense_Mutation_p.M63I|CDC42SE1_ENST00000492796.1_5'UTR			Q9NRR8	C42S1_HUMAN	CDC42 small effector 1	63					negative regulation of catalytic activity (GO:0043086)|phagocytosis (GO:0006909)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	GTPase inhibitor activity (GO:0005095)	p.M63I(2)		large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTTGGATCTCATCTGCTCCT	0.448																																							uc001ewo.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(187-189)ATG>ATA		CDC42 small effector 1							248.0	223.0	232.0					1																	151026774		2203	4300	6503	SO:0001583	missense	56882				phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity	g.chr1:151026774C>T	AF187845	CCDS981.1	1q21.1	2008-02-05			ENSG00000197622	ENSG00000197622			17719	protein-coding gene	gene with protein product						10816584	Standard	NM_001038707		Approved	SCIP1, SPEC1	uc001ewp.3	Q9NRR8	OTTHUMG00000035158	ENST00000439374.2:c.189G>A	1.37:g.151026774C>T	ENSP00000475845:p.Met63Ile		Somatic				CDC42SE1_uc001ewp.2_Missense_Mutation_p.M63I	p.M63I	NM_001038707	NP_001033796	WXS	Illumina HiSeq	Unspecified	Q9NRR8	C42S1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		5	759	-	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		63					D3DV12|Q9HB17|Q9NQR2	Missense_Mutation	SNP	ENST00000439374.2	37	c.189G>A	CCDS981.1	.	.	.	.	.	.	.	.	.	.	C	34	5.369304	0.95900	.	.	ENSG00000197622	ENST00000357235;ENST00000540998	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	.	.	.	0.53688	D	0.999971	P	0.42039	0.769	P	0.61397	0.888	T	0.79926	-0.1597	8	0.87932	D	0	-15.5157	17.8376	0.88704	0.0:1.0:0.0:0.0	.	63	Q9NRR8	C42S1_HUMAN	I	63	.	ENSP00000349773:M63I	M	-	3	0	CDC42SE1	149293398	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.152000	0.64882	2.815000	0.96918	0.561000	0.74099	ATG		0.448	CDC42SE1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085096.2	NM_020239		12	498	0	0	0	0.013537	0	12	498				
RFX5	5993	broad.mit.edu	37	1	151316755	151316755	+	Splice_Site	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:151316755C>G	ENST00000290524.4	-	8	652		c.e8-1		RFX5_ENST00000452513.2_Splice_Site|RFX5_ENST00000478564.1_5'Flank|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000368870.2_Splice_Site|RP11-126K1.6_ENST00000455503.1_RNA|RFX5_ENST00000452671.2_Splice_Site	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTAGCAATATCTGATGCAAGT	0.498																																							uc001exv.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e8-1		regulatory factor X, 5							100.0	95.0	96.0					1																	151316755		2203	4300	6503	SO:0001630	splice_region_variant	5993					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:151316755C>G		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.474-1G>C	1.37:g.151316755C>G			Somatic				RFX5_uc001exw.1_Splice_Site_p.K158_splice|RFX5_uc009wmr.1_Splice_Site_p.K158_splice|RFX5_uc010pcx.1_Splice_Site_p.K118_splice	p.K158_splice	NM_001025603	NP_001020774	WXS	Illumina HiSeq	Unspecified	P48382	RFX5_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		8	688	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)							B7Z848|D3DV19|E9PFU4|Q5VWC3	Splice_Site	SNP	ENST00000290524.4	37	c.474_splice	CCDS994.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592635	0.28357	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000436637;ENST00000452671;ENST00000452513;ENST00000392746;ENST00000422595;ENST00000450506;ENST00000458484	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9184	0.63916	0.0:0.7532:0.2468:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RFX5	149583379	0.999000	0.42202	1.000000	0.80357	0.301000	0.27625	1.055000	0.30467	2.836000	0.97738	0.655000	0.94253	.		0.498	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	Intron	3	119	0	0	0	0.004672	0	3	119				
DENND4B	9909	broad.mit.edu	37	1	153911514	153911514	+	Silent	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:153911514G>C	ENST00000361217.4	-	13	2245	c.1827C>G	c.(1825-1827)ctC>ctG	p.L609L		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	609	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L497L(1)|p.L609L(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCGGGATTTGAGGAAGCCTG	0.547																																							uc001fdd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1825-1827)CTC>CTG		DENN/MADD domain containing 4B							61.0	66.0	64.0					1																	153911514		1978	4159	6137	SO:0001819	synonymous_variant	9909							g.chr1:153911514G>C	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.1827C>G	1.37:g.153911514G>C			Somatic					p.L609L	NM_014856	NP_055671	WXS	Illumina HiSeq	Unspecified	O75064	DEN4B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		13	2228	-	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		609			dDENN.		Q5T4K0	Silent	SNP	ENST00000361217.4	37	c.1827C>G	CCDS44228.1																																																																																				0.547	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806		3	39	0	0	0	0.004672	0	3	39				
CHRNB2	1141	broad.mit.edu	37	1	154548343	154548343	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:154548343C>G	ENST00000368476.3	+	6	1708	c.1444C>G	c.(1444-1446)Ctc>Gtc	p.L482V		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	482					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.L482V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CCTGCAGCCTCTCTTCCAGAA	0.562																																							uc001ffg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1444-1446)CTC>GTC		neuronal nicotinic acetylcholine receptor beta 2	Nicotine(DB00184)						312.0	235.0	261.0					1																	154548343		2203	4300	6503	SO:0001583	missense	1141				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr1:154548343C>G	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1444C>G	1.37:g.154548343C>G	ENSP00000357461:p.Leu482Val		Somatic					p.L482V	NM_000748	NP_000739	WXS	Illumina HiSeq	Unspecified	P17787	ACHB2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		6	1708	+	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		482					Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	c.1444C>G	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667857	0.47677	.	.	ENSG00000160716	ENST00000368476	D	0.84589	-1.87	4.89	4.89	0.63831	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.64402	D	0.000001	T	0.74191	0.3684	L	0.39514	1.22	0.50813	D	0.999896	B	0.31009	0.303	B	0.31686	0.134	T	0.74575	-0.3620	10	0.38643	T	0.18	.	17.8548	0.88759	0.0:1.0:0.0:0.0	.	482	P17787	ACHB2_HUMAN	V	482	ENSP00000357461:L482V	ENSP00000357461:L482V	L	+	1	0	CHRNB2	152814967	0.753000	0.28349	1.000000	0.80357	0.989000	0.77384	1.541000	0.36126	2.542000	0.85734	0.563000	0.77884	CTC		0.562	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748		4	204	0	0	0	0.001168	0	4	204				
ZBTB7B	51043	broad.mit.edu	37	1	154987712	154987712	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:154987712G>T	ENST00000368426.3	+	3	713	c.576G>T	c.(574-576)ccG>ccT	p.P192P	ZBTB7B_ENST00000535420.1_Silent_p.P192P|ZBTB7B_ENST00000417934.2_Silent_p.P226P|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000292176.2_Silent_p.P192P	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	192	Pro-rich.				cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P192P(1)		endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTCCGCCACCGCCACCTCGGC	0.657																																							uc001fgk.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(574-576)CCG>CCT		zinc finger and BTB domain containing 7B							33.0	36.0	35.0					1																	154987712		2200	4295	6495	SO:0001819	synonymous_variant	51043				cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr1:154987712G>T	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.576G>T	1.37:g.154987712G>T			Somatic				ZBTB7B_uc009wpa.2_Silent_p.P192P|ZBTB7B_uc001fgj.3_Silent_p.P226P|ZBTB7B_uc010peq.1_Silent_p.P226P|ZBTB7B_uc001fgl.3_Silent_p.P192P	p.P192P	NM_015872	NP_056956	WXS	Illumina HiSeq	Unspecified	O15156	ZBT7B_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		3	734	+	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		192			Pro-rich.		B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Silent	SNP	ENST00000368426.3	37	c.576G>T	CCDS1081.1																																																																																				0.657	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872		19	60	1	0	4.54149e-19	0.014323	5.50979e-19	19	60				
TTC24	164118	broad.mit.edu	37	1	156555560	156555560	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:156555560C>T	ENST00000368237.3	+	8	1512	c.1512C>T	c.(1510-1512)ccC>ccT	p.P504P	AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000368236.3_Silent_p.P504P|TTC24_ENST00000478081.1_3'UTR			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	504								p.P504P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTAGTTGCCCCACGTTTACCA	0.527																																							uc009wsc.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(670-672)CCC>CCT		tetratricopeptide repeat domain 24							126.0	126.0	126.0					1																	156555560		2119	4234	6353	SO:0001819	synonymous_variant	164118						binding	g.chr1:156555560C>T		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1512C>T	1.37:g.156555560C>T			Somatic					p.P224P	NM_001105669	NP_001099139	WXS	Illumina HiSeq	Unspecified	A2A3L6	TTC24_HUMAN			7	812	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		504					Q5T3H7	Silent	SNP	ENST00000368237.3	37	c.672C>T	CCDS53379.1	.	.	.	.	.	.	.	.	.	.	C	3.532	-0.095519	0.07010	.	.	ENSG00000187862	ENST00000340086	T	0.37915	1.17	3.63	1.71	0.24356	.	2.554800	0.02072	N	0.051645	T	0.05640	0.0148	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15694	-1.0428	7	0.13108	T	0.6	.	5.1955	0.15233	0.0:0.6724:0.21:0.1176	.	.	.	.	L	277	ENSP00000339487:P277L	ENSP00000339487:P277L	P	+	2	0	TTC24	154822184	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.143000	0.03200	0.506000	0.28125	0.462000	0.41574	CCA		0.527	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384		5	208	0	0	0	0.000602	0	5	208				
FCRL4	83417	broad.mit.edu	37	1	157557312	157557312	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:157557312G>A	ENST00000271532.1	-	5	736	c.601C>T	c.(601-603)Cag>Tag	p.Q201*	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	201	Ig-like C2-type 3.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q201*(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TCTGTAGGCTGAGAGTCTGTA	0.478																																							uc001fqw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|kidney(1)|skin(1)	4						c.(601-603)CAG>TAG		Fc receptor-like 4 precursor							114.0	118.0	117.0					1																	157557312		2203	4300	6503	SO:0001587	stop_gained	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157557312G>A	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.601C>T	1.37:g.157557312G>A	ENSP00000271532:p.Gln201*		Somatic				FCRL4_uc010phy.1_RNA	p.Q201*	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			5	737	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	201			Ig-like C2-type 3.|Extracellular (Potential).		Q96PJ3|Q96RE0	Nonsense_Mutation	SNP	ENST00000271532.1	37	c.601C>T	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946972	0.92593	.	.	ENSG00000163518	ENST00000271532	.	.	.	4.71	2.63	0.31362	.	0.185882	0.26328	N	0.025015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	10.668	0.45741	0.0:0.3781:0.6219:0.0	.	.	.	.	X	201	.	ENSP00000271532:Q201X	Q	-	1	0	FCRL4	155823936	0.190000	0.23276	0.726000	0.30738	0.541000	0.35023	0.299000	0.19138	1.273000	0.44346	0.467000	0.42956	CAG		0.478	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		8	252	0	0	0	0.00308	0	8	252				
FCRL1	115350	broad.mit.edu	37	1	157765949	157765949	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:157765949G>T	ENST00000368176.3	-	11	1297	c.1230C>A	c.(1228-1230)gaC>gaA	p.D410E	FCRL1_ENST00000491942.1_Missense_Mutation_p.D409E|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_3'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	410						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D410E(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGGAATAGATGTCTAAGGAAA	0.448																																					GBM(54;482 1003 11223 30131 35730)	GBM(54;482 1003 11223 30131 35730)	uc001frg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)	7						c.(1228-1230)GAC>GAA		Fc receptor-like 1 isoform 1 precursor							137.0	117.0	124.0					1																	157765949		2203	4300	6503	SO:0001583	missense	115350					integral to membrane|plasma membrane	receptor activity	g.chr1:157765949G>T	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1230C>A	1.37:g.157765949G>T	ENSP00000357158:p.Asp410Glu		Somatic				FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.D409E|FCRL1_uc001fri.2_3'UTR|FCRL1_uc001frj.2_RNA	p.D410E	NM_052938	NP_443170	WXS	Illumina HiSeq	Unspecified	Q96LA6	FCRL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		11	1343	-	all_hematologic(112;0.0378)		410			ITIM motif 4.|Cytoplasmic (Potential).		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	c.1230C>A	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	G	4.831	0.154504	0.09236	.	.	ENSG00000163534	ENST00000368176;ENST00000491942	T;T	0.36520	1.25;1.26	4.37	1.34	0.21922	.	1.184600	0.06115	N	0.667960	T	0.06781	0.0173	N	0.22421	0.69	0.09310	N	1	P;B	0.36535	0.557;0.421	B;B	0.35971	0.215;0.107	T	0.19614	-1.0300	10	0.10111	T	0.7	.	3.1397	0.06451	0.2264:0.0:0.5514:0.2223	.	409;410	Q96LA6-2;Q96LA6	.;FCRL1_HUMAN	E	410;409	ENSP00000357158:D410E;ENSP00000418130:D409E	ENSP00000357158:D410E	D	-	3	2	FCRL1	156032573	0.234000	0.23783	0.043000	0.18650	0.091000	0.18340	0.518000	0.22847	0.536000	0.28733	0.555000	0.69702	GAC		0.448	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938		31	76	1	0	8.88839e-20	0.010818	1.08487e-19	31	76				
OR6Y1	391112	broad.mit.edu	37	1	158517081	158517081	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:158517081G>T	ENST00000302617.3	-	1	814	c.815C>A	c.(814-816)gCc>gAc	p.A272D		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A272D(1)		NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GGAATTGTAGGCATACATGAG	0.473																																							uc010pil.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(814-816)GCC>GAC		olfactory receptor, family 6, subfamily Y,							215.0	201.0	205.0					1																	158517081		2203	4300	6503	SO:0001583	missense	391112				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158517081G>T	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.815C>A	1.37:g.158517081G>T	ENSP00000304807:p.Ala272Asp		Somatic					p.A272D	NM_001005189	NP_001005189	WXS	Illumina HiSeq	Unspecified	Q8NGX8	OR6Y1_HUMAN			1	815	-	all_hematologic(112;0.0378)		272			Extracellular (Potential).		Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	37	c.815C>A	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785374	0.70337	.	.	ENSG00000197532	ENST00000302617	T	0.00152	8.66	5.34	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41938	D	0.000800	T	0.00144	0.0004	L	0.39898	1.24	0.19775	N	0.999951	D	0.71674	0.998	D	0.66084	0.941	T	0.56661	-0.7942	10	0.87932	D	0	.	14.47	0.67509	0.0:0.0:0.8526:0.1473	.	272	Q8NGX8	OR6Y1_HUMAN	D	272	ENSP00000304807:A272D	ENSP00000304807:A272D	A	-	2	0	OR6Y1	156783705	0.080000	0.21391	0.995000	0.50966	0.997000	0.91878	2.062000	0.41413	2.763000	0.94921	0.655000	0.94253	GCC		0.473	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189		133	135	1	0	1.02165e-56	0.01441	1.28582e-56	133	135				
PPOX	5498	broad.mit.edu	37	1	161137915	161137915	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:161137915G>C	ENST00000367999.4	+	5	735	c.469G>C	c.(469-471)Gag>Cag	p.E157Q	PPOX_ENST00000535223.1_Intron|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.E157Q|PPOX_ENST00000495483.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	157					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)	p.E157Q(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCTTGGACCTGAGGTGACACT	0.572																																							uc001fyj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(469-471)GAG>CAG		protoporphyrinogen oxidase							39.0	42.0	41.0					1																	161137915		2203	4300	6503	SO:0001583	missense	5498	Porphyria_Variegata			heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity	g.chr1:161137915G>C	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.469G>C	1.37:g.161137915G>C	ENSP00000356978:p.Glu157Gln		Somatic				PPOX_uc001fyn.2_Intron|PPOX_uc001fyg.2_Missense_Mutation_p.E157Q|PPOX_uc001fyl.2_Missense_Mutation_p.E123Q|PPOX_uc001fym.2_RNA|PPOX_uc001fyk.2_5'UTR|PPOX_uc001fyh.2_5'UTR|PPOX_uc010pkg.1_Intron|PPOX_uc009wuc.1_5'UTR|PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Intron	p.E157Q	NM_001122764	NP_001116236	WXS	Illumina HiSeq	Unspecified	P50336	PPOX_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		5	759	+	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		157					D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	c.469G>C	CCDS1221.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903234	0.72754	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.93247	-3.19;-3.19	5.69	5.69	0.88448	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.91106	0.7200	M	0.62154	1.92	0.80722	D	1	P	0.40032	0.699	B	0.40864	0.342	D	0.92204	0.5770	10	0.62326	D	0.03	-14.8873	17.3153	0.87221	0.0:0.0:1.0:0.0	.	157	P50336	PPOX_HUMAN	Q	157	ENSP00000343943:E157Q;ENSP00000356978:E157Q	ENSP00000343943:E157Q	E	+	1	0	PPOX	159404539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.917000	0.75782	2.679000	0.91253	0.650000	0.86243	GAG		0.572	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		4	92	0	0	0	0.009096	0	4	92				
ATF6	22926	broad.mit.edu	37	1	161736217	161736217	+	Missense_Mutation	SNP	C	C	G	rs149825732		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:161736217C>G	ENST00000367942.3	+	1	134	c.67C>G	c.(67-69)Ctg>Gtg	p.L23V	RP11-474I16.8_ENST00000431097.2_RNA	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	23	Transcription activation.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.L23V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	CTTTCACAGGCTGGATGAAGA	0.567																																							uc001gbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(67-69)CTG>GTG		activating transcription factor 6							81.0	78.0	79.0					1																	161736217		2203	4300	6503	SO:0001583	missense	22926				positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr1:161736217C>G	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.67C>G	1.37:g.161736217C>G	ENSP00000356919:p.Leu23Val		Somatic				ATF6_uc001gbq.1_Missense_Mutation_p.L23V	p.L23V	NM_007348	NP_031374	WXS	Illumina HiSeq	Unspecified	P18850	ATF6A_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00953)		1	134	+	all_hematologic(112;0.156)		23			Cytoplasmic (Potential).|Transcription activation.		O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	c.67C>G	CCDS1235.1	.	.	.	.	.	.	.	.	.	.	C	4.132	0.022692	0.08006	.	.	ENSG00000118217	ENST00000367942	T	0.14516	2.5	4.52	3.6	0.41247	.	0.397130	0.22150	N	0.063940	T	0.02230	0.0069	N	0.08118	0	0.19775	N	0.999958	B;B	0.10296	0.001;0.003	B;B	0.09377	0.004;0.004	T	0.42531	-0.9446	9	0.24483	T	0.36	-11.1988	10.5588	0.45133	0.0:0.7872:0.2127:0.0	.	23;24	P18850;Q59H30	ATF6A_HUMAN;.	V	23	ENSP00000356919:L23V	ENSP00000356919:L23V	L	+	1	2	ATF6	160002841	0.616000	0.27035	0.058000	0.19502	0.683000	0.39861	0.595000	0.24029	1.234000	0.43709	0.561000	0.74099	CTG		0.567	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348		12	111	0	0	0	0.010729	0	12	111				
CENPL	91687	broad.mit.edu	37	1	173780416	173780416	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:173780416C>G	ENST00000345664.6	-	2	235	c.22G>C	c.(22-24)Gag>Cag	p.E8Q	CENPL_ENST00000367710.3_Missense_Mutation_p.E8Q|CENPL_ENST00000356198.2_Missense_Mutation_p.E8Q|Y_RNA_ENST00000516548.1_RNA	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	8					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E8Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						GGAGTTGACTCTGGTGCACTG	0.398																																							uc001gje.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(22-24)GAG>CAG		centromere protein L isoform 2							115.0	121.0	119.0					1																	173780416		2203	4300	6503	SO:0001583	missense	91687				mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus		g.chr1:173780416C>G	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.22G>C	1.37:g.173780416C>G	ENSP00000323543:p.Glu8Gln		Somatic				CENPL_uc009wwg.2_5'UTR|CENPL_uc001gjg.3_Missense_Mutation_p.E8Q|CENPL_uc001gjf.3_Missense_Mutation_p.E8Q	p.E8Q	NM_033319	NP_201576	WXS	Illumina HiSeq	Unspecified	Q8N0S6	CENPL_HUMAN			2	236	-			8					Q5TEL5|Q96ND4	Missense_Mutation	SNP	ENST00000345664.6	37	c.22G>C	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	C	8.073	0.770575	0.15983	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.49720	1.29;0.77;0.77	5.11	3.19	0.36642	.	0.969977	0.08502	N	0.936358	T	0.22975	0.0555	L	0.44542	1.39	0.09310	N	1	B;B	0.14012	0.009;0.0	B;B	0.12837	0.008;0.001	T	0.37478	-0.9704	10	0.44086	T	0.13	.	12.1422	0.54005	0.0:0.6685:0.3315:0.0	.	8;8	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	Q	8	ENSP00000348527:E8Q;ENSP00000323543:E8Q;ENSP00000356683:E8Q	ENSP00000323543:E8Q	E	-	1	0	CENPL	172047039	0.011000	0.17503	0.001000	0.08648	0.010000	0.07245	2.100000	0.41777	0.627000	0.30340	-0.304000	0.09214	GAG		0.398	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319		4	193	0	0	0	0.009096	0	4	193				
PRG4	10216	broad.mit.edu	37	1	186276981	186276981	+	Silent	SNP	A	A	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:186276981A>G	ENST00000445192.2	+	7	2175	c.2130A>G	c.(2128-2130)aaA>aaG	p.K710K	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.K667K|PRG4_ENST00000367483.4_Silent_p.K669K|PRG4_ENST00000367485.4_Silent_p.K617K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	710	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAAGGGACTGCTC	0.582																																							uc001gru.3		NA																	0				skin(1)	1						c.(2128-2130)AAA>AAG		proteoglycan 4 isoform A							162.0	175.0	171.0					1																	186276981		2203	4300	6503	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276981A>G	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2130A>G	1.37:g.186276981A>G			Somatic				PRG4_uc001grt.3_Silent_p.K669K|PRG4_uc009wyl.2_Silent_p.K617K|PRG4_uc009wym.2_Silent_p.K576K|PRG4_uc010poo.1_Intron	p.K710K	NM_005807	NP_005798	WXS	Illumina HiSeq	Unspecified	Q92954	PRG4_HUMAN			7	2181	+			710			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|43; approximate.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.2130A>G	CCDS1369.1																																																																																				0.582	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		5	293	0	0	0	0.001168	0	5	293				
CENPF	1063	broad.mit.edu	37	1	214802433	214802433	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:214802433G>C	ENST00000366955.3	+	8	1281	c.1113G>C	c.(1111-1113)ttG>ttC	p.L371F		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.L371F(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CGGAAGATTTGAGTTGTCAGC	0.308																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(1111-1113)TTG>TTC		centromere protein F							63.0	68.0	66.0					1																	214802433		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214802433G>C	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1113G>C	1.37:g.214802433G>C	ENSP00000355922:p.Leu371Phe		Somatic					p.L371F	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	8	1287	+			371			Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.1113G>C	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910577	0.72983	.	.	ENSG00000117724	ENST00000366955	T	0.81163	-1.46	5.61	4.7	0.59300	.	0.000000	0.29218	N	0.012794	D	0.88209	0.6375	.	.	.	0.38237	D	0.941223	D	0.89917	1.0	D	0.83275	0.996	D	0.89559	0.3805	9	0.62326	D	0.03	.	9.8211	0.40883	0.0732:0.0:0.7874:0.1395	.	371	P49454	CENPF_HUMAN	F	371	ENSP00000355922:L371F	ENSP00000355922:L371F	L	+	3	2	CENPF	212869056	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.907000	0.56348	1.376000	0.46267	0.655000	0.94253	TTG		0.308	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		3	121	0	0	0	0.004672	0	3	121				
KCNK2	3776	broad.mit.edu	37	1	215259970	215259970	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:215259970C>G	ENST00000444842.2	+	2	456	c.306C>G	c.(304-306)ttC>ttG	p.F102L	KCNK2_ENST00000391895.2_Missense_Mutation_p.F98L|KCNK2_ENST00000391894.2_Missense_Mutation_p.F87L	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	102					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.F87L(1)|p.F102L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	AGCAAACATTCATATCCCAAC	0.463																																							uc001hkq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(304-306)TTC>TTG		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						170.0	156.0	161.0					1																	215259970		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215259970C>G	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.306C>G	1.37:g.215259970C>G	ENSP00000394033:p.Phe102Leu		Somatic				KCNK2_uc001hko.2_Missense_Mutation_p.F98L|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Missense_Mutation_p.F87L	p.F102L	NM_001017425	NP_001017425	WXS	Illumina HiSeq	Unspecified	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	2	475	+			102					A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.306C>G	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035073	0.54896	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	T;T;T;T;T	0.23348	1.92;2.25;1.94;1.91;2.47	5.55	1.66	0.24008	.	0.000000	0.85682	D	0.000000	T	0.46776	0.1410	M	0.81682	2.555	0.53005	D	0.999967	D;P;P	0.59357	0.985;0.876;0.924	D;P;P	0.64321	0.924;0.562;0.908	T	0.43877	-0.9364	10	0.87932	D	0	.	10.2099	0.43134	0.0:0.6015:0.0:0.3985	.	87;102;98	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	L	98;98;46;87;102;46	ENSP00000375765:F98L;ENSP00000420569:F46L;ENSP00000375764:F87L;ENSP00000394033:F102L;ENSP00000413460:F46L	ENSP00000355915:F98L	F	+	3	2	KCNK2	213326593	0.995000	0.38212	0.957000	0.39632	0.996000	0.88848	0.839000	0.27586	0.057000	0.16193	0.557000	0.71058	TTC		0.463	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		15	262	0	0	0	0.003163	0	15	262				
USH2A	7399	broad.mit.edu	37	1	215848324	215848324	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:215848324C>A	ENST00000307340.3	-	63	13315	c.12929G>T	c.(12928-12930)aGc>aTc	p.S4310I	USH2A_ENST00000366943.2_Missense_Mutation_p.S4310I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4310	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S4310I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGATCAAAGCTAAAAGGATA	0.438										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(12928-12930)AGC>ATC		usherin isoform B							106.0	103.0	104.0					1																	215848324		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215848324C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12929G>T	1.37:g.215848324C>A	ENSP00000305941:p.Ser4310Ile	HNSCC(13;0.011)	Somatic					p.S4310I	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	63	13316	-			4310			Fibronectin type-III 28.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.12929G>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700657	0.48307	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.58358	0.34;0.34	5.24	2.97	0.34412	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.262172	0.26518	N	0.023932	T	0.57184	0.2036	M	0.72624	2.21	0.39187	D	0.962892	P	0.47841	0.901	P	0.53401	0.725	T	0.56992	-0.7887	10	0.14656	T	0.56	.	8.667	0.34127	0.0:0.7136:0.1284:0.158	.	4310	O75445	USH2A_HUMAN	I	4310	ENSP00000305941:S4310I;ENSP00000355910:S4310I	ENSP00000305941:S4310I	S	-	2	0	USH2A	213914947	1.000000	0.71417	0.755000	0.31263	0.510000	0.34073	2.329000	0.43876	1.179000	0.42884	0.563000	0.77884	AGC		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		95	86	1	0	6.1132e-60	0.01441	7.71791e-60	95	86				
USH2A	7399	broad.mit.edu	37	1	215914740	215914740	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:215914740G>C	ENST00000307340.3	-	60	12074	c.11688C>G	c.(11686-11688)atC>atG	p.I3896M	USH2A_ENST00000366943.2_Missense_Mutation_p.I3896M	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3896	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.I3896M(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTTGATGATGATTCCATTTG	0.388										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(11686-11688)ATC>ATG		usherin isoform B							152.0	155.0	154.0					1																	215914740		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215914740G>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11688C>G	1.37:g.215914740G>C	ENSP00000305941:p.Ile3896Met	HNSCC(13;0.011)	Somatic					p.I3896M	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	60	12075	-			3896			Fibronectin type-III 24.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.11688C>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292585	0.59976	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55234	0.53;0.53	5.24	4.33	0.51752	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.364750	0.18243	N	0.147186	T	0.56485	0.1988	M	0.79343	2.45	0.34467	D	0.702417	P	0.39216	0.664	B	0.42462	0.388	T	0.68834	-0.5304	10	0.45353	T	0.12	.	9.4848	0.38922	0.0737:0.0:0.7835:0.1428	.	3896	O75445	USH2A_HUMAN	M	3896	ENSP00000305941:I3896M;ENSP00000355910:I3896M	ENSP00000305941:I3896M	I	-	3	3	USH2A	213981363	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.749000	0.47492	1.445000	0.47624	0.561000	0.74099	ATC		0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		34	176	0	0	0	0.003271	0	34	176				
RAB3GAP2	25782	broad.mit.edu	37	1	220386243	220386243	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:220386243T>A	ENST00000358951.2	-	4	488	c.372A>T	c.(370-372)ttA>ttT	p.L124F		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	124					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.L124F(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CTTCGACATTTAAGGAACCAC	0.303																																							uc010puk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(370-372)TTA>TTT		rab3 GTPase-activating protein, non-catalytic							123.0	117.0	119.0					1																	220386243		2203	4300	6503	SO:0001583	missense	25782				intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity	g.chr1:220386243T>A	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.372A>T	1.37:g.220386243T>A	ENSP00000351832:p.Leu124Phe		Somatic				RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_5'UTR|RAB3GAP2_uc010pum.1_Missense_Mutation_p.L124F	p.L124F	NM_012414	NP_036546	WXS	Illumina HiSeq	Unspecified	Q9H2M9	RBGPR_HUMAN		GBM - Glioblastoma multiforme(131;0.0443)	4	536	-			124					A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	c.372A>T	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.150898	0.57151	.	.	ENSG00000118873	ENST00000358951	T	0.38077	1.16	5.41	0.484	0.16825	.	0.144593	0.47852	D	0.000216	T	0.45276	0.1334	L	0.53249	1.67	0.44728	D	0.99772	D;P	0.55800	0.973;0.889	P;P	0.58210	0.835;0.831	T	0.36089	-0.9762	10	0.66056	D	0.02	.	10.4473	0.44501	0.0:0.5188:0.0:0.4812	.	124;124	Q9H2M9-2;Q9H2M9	.;RBGPR_HUMAN	F	124	ENSP00000351832:L124F	ENSP00000351832:L124F	L	-	3	2	RAB3GAP2	218452866	1.000000	0.71417	0.041000	0.18516	0.986000	0.74619	0.609000	0.24238	-0.087000	0.12528	0.460000	0.39030	TTA		0.303	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414		45	41	0	0	0	0.01441	0	45	41				
PGBD5	79605	broad.mit.edu	37	1	230486821	230486821	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:230486821C>G	ENST00000525115.1	-	3	593	c.570G>C	c.(568-570)ctG>ctC	p.L190L	PGBD5_ENST00000391860.1_Silent_p.L144L|PGBD5_ENST00000321327.2_Silent_p.L289L			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	190						integral component of membrane (GO:0016021)		p.L289L(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CCTCATCGATCAGGGGTTCAT	0.522																																							uc010pwb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(568-570)CTG>CTC		piggyBac transposable element derived 5							89.0	74.0	79.0					1																	230486821		2203	4300	6503	SO:0001819	synonymous_variant	79605					integral to membrane		g.chr1:230486821C>G	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.570G>C	1.37:g.230486821C>G			Somatic				PGBD5_uc001htv.2_Silent_p.L289L	p.L190L	NM_024554	NP_078830	WXS	Illumina HiSeq	Unspecified	Q8N414	PGBD5_HUMAN		GBM - Glioblastoma multiforme(131;0.201)	3	570	-	Breast(184;0.0397)	Prostate(94;0.167)	190					A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37	c.570G>C																																																																																					0.522	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554		7	78	0	0	0	0.004482	0	7	78				
NID1	4811	broad.mit.edu	37	1	236144994	236144994	+	Silent	SNP	C	C	T	rs148662892		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:236144994C>T	ENST00000264187.6	-	16	3226	c.3144G>A	c.(3142-3144)gcG>gcA	p.A1048A	NID1_ENST00000366595.3_Silent_p.A915A	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1048					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.A1048A(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CGTCCAGCTTCGCCACTTCTA	0.498													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18471	0.0		0.0	False		,,,				2504	0.0						uc001hxo.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(3142-3144)GCG>GCA		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)	C		2,4404	4.2+/-10.8	0,2,2201	85.0	81.0	83.0		3144	-11.8	0.0	1	dbSNP_134	83	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous	NID1	NM_002508.2		0,14,6489	TT,TC,CC		0.1395,0.0454,0.1076		1048/1248	236144994	14,12992	2203	4300	6503	SO:0001819	synonymous_variant	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236144994C>T	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3144G>A	1.37:g.236144994C>T			Somatic				NID1_uc009xgd.2_Silent_p.A915A|NID1_uc009xgc.2_Silent_p.A129A	p.A1048A	NM_002508	NP_002499	WXS	Illumina HiSeq	Unspecified	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		16	3246	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	1048			LDL-receptor class B 2.		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	c.3144G>A	CCDS1608.1																																																																																				0.498	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		5	151	0	0	0	0.001168	0	5	151				
MTR	4548	broad.mit.edu	37	1	237049656	237049656	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:237049656A>C	ENST00000366577.5	+	27	3234	c.2840A>C	c.(2839-2841)gAa>gCa	p.E947A	MTR_ENST00000535889.1_Missense_Mutation_p.E896A	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	947	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.E947A(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TGGCTGTCTGAACCTCACCCA	0.413																																							uc001hyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2839-2841)GAA>GCA		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						94.0	89.0	91.0					1																	237049656		2203	4300	6503	SO:0001583	missense	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237049656A>C	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2840A>C	1.37:g.237049656A>C	ENSP00000355536:p.Glu947Ala		Somatic				MTR_uc010pxw.1_Missense_Mutation_p.E540A|MTR_uc010pxx.1_Missense_Mutation_p.E896A|MTR_uc010pxy.1_Missense_Mutation_p.E801A	p.E947A	NM_000254	NP_000245	WXS	Illumina HiSeq	Unspecified	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	27	3263	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	947			AdoMet activation.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	c.2840A>C	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	A	2.721	-0.266620	0.05754	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;T	0.75589	-0.95;-0.95;-0.95	5.22	4.09	0.47781	Vitamin B12-dependent methionine synthase, activation domain (2);	0.650922	0.16194	N	0.225265	T	0.61800	0.2376	L	0.34521	1.04	0.31558	N	0.657842	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.61628	-0.7024	10	0.49607	T	0.09	-24.0776	7.6369	0.28272	0.7827:0.1423:0.075:0.0	.	947;896;947	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	A	801;947;896;501	ENSP00000355536:E947A;ENSP00000441845:E896A;ENSP00000355535:E501A	ENSP00000355535:E501A	E	+	2	0	MTR	235116279	0.951000	0.32395	0.997000	0.53966	0.737000	0.42083	2.343000	0.44001	0.980000	0.38523	0.460000	0.39030	GAA		0.413	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		20	77	0	0	0	0.012319	0	20	77				
SDCCAG8	10806	broad.mit.edu	37	1	243493899	243493899	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:243493899G>C	ENST00000366541.3	+	10	1244	c.1126G>C	c.(1126-1128)Gaa>Caa	p.E376Q	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.E231Q|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E333Q	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	376	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.E376Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GGAGCGACTTGAAAAAGAACT	0.443																																							uc001hzw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1126-1128)GAA>CAA		serologically defined colon cancer antigen 8							69.0	66.0	67.0					1																	243493899		2203	4300	6503	SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243493899G>C	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1126G>C	1.37:g.243493899G>C	ENSP00000355499:p.Glu376Gln		Somatic				SDCCAG8_uc010pyk.1_Missense_Mutation_p.E231Q|SDCCAG8_uc010pyl.1_Missense_Mutation_p.E188Q|SDCCAG8_uc001hzx.2_Missense_Mutation_p.E188Q	p.E376Q	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	10	1282	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	376			Potential.|Sufficient for homodimerization (By similarity).		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	c.1126G>C	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737755	0.69304	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.78	4.86	0.63082	.	0.098785	0.64402	D	0.000002	T	0.63616	0.2526	M	0.71581	2.175	0.32196	N	0.578471	P;D	0.76494	0.835;0.999	P;D	0.66979	0.453;0.948	T	0.69439	-0.5145	10	0.26408	T	0.33	-1.24	12.9067	0.58156	0.0:0.163:0.837:0.0	.	333;376	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	Q	333;376;231;156	ENSP00000348137:E333Q;ENSP00000355499:E376Q;ENSP00000341260:E231Q;ENSP00000410200:E156Q	ENSP00000341260:E231Q	E	+	1	0	SDCCAG8	241560522	1.000000	0.71417	0.907000	0.35723	0.899000	0.52679	2.123000	0.41996	1.424000	0.47217	0.655000	0.94253	GAA		0.443	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		3	79	0	0	0	0.004672	0	3	79				
OR2M7	391196	broad.mit.edu	37	1	248487240	248487240	+	Missense_Mutation	SNP	C	C	G	rs146462189	byFrequency	TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:248487240C>G	ENST00000317965.2	-	1	659	c.631G>C	c.(631-633)Gtt>Ctt	p.V211L		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V211L(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGATTGCAACAGGGAAAACA	0.423																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(631-633)GTT>CTT		olfactory receptor, family 2, subfamily M,							321.0	303.0	309.0					1																	248487240		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487240C>G	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.631G>C	1.37:g.248487240C>G	ENSP00000324557:p.Val211Leu		Somatic					p.V211L	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	631	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		211			Helical; Name=5; (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.631G>C	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.629342	0.00813	.	.	ENSG00000177186	ENST00000317965	T	0.30182	1.54	1.55	-1.58	0.08479	GPCR, rhodopsin-like superfamily (1);	0.426089	0.14644	U	0.307027	T	0.12902	0.0313	N	0.05592	-0.015	0.09310	N	1	B	0.27316	0.175	B	0.33339	0.162	T	0.32214	-0.9915	10	0.21014	T	0.42	.	4.8631	0.13594	0.6051:0.2319:0.163:0.0	.	211	Q8NG81	OR2M7_HUMAN	L	211	ENSP00000324557:V211L	ENSP00000324557:V211L	V	-	1	0	OR2M7	246553863	0.000000	0.05858	0.078000	0.20375	0.123000	0.20343	-1.901000	0.01597	-0.032000	0.13758	0.194000	0.17425	GTT		0.423	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		274	294	0	0	0	0.01441	0	274	294				
CSGALNACT2	55454	broad.mit.edu	37	10	43678736	43678736	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:43678736G>C	ENST00000374466.3	+	8	1710	c.1375G>C	c.(1375-1377)Gat>Cat	p.D459H		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	459					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.D459H(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GGGTGGAGAAGATGTTCATCT	0.423																																							uc001jan.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1375-1377)GAT>CAT		chondroitin sulfate							143.0	141.0	142.0					10																	43678736		2203	4300	6503	SO:0001583	missense	55454				chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Golgi cisterna membrane|integral to Golgi membrane	glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding	g.chr10:43678736G>C	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1375G>C	10.37:g.43678736G>C	ENSP00000363590:p.Asp459His		Somatic					p.D459H	NM_018590	NP_061060	WXS	Illumina HiSeq	Unspecified	Q8N6G5	CGAT2_HUMAN			8	1710	+			459			Lumenal (Potential).		B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	c.1375G>C	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965183	0.92855	.	.	ENSG00000169826	ENST00000374466	T	0.74737	-0.87	5.87	5.87	0.94306	.	0.043608	0.85682	D	0.000000	D	0.89312	0.6679	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89920	0.4058	10	0.87932	D	0	-29.2772	20.5827	0.99408	0.0:0.0:1.0:0.0	.	459	Q8N6G5	CGAT2_HUMAN	H	459	ENSP00000363590:D459H	ENSP00000363590:D459H	D	+	1	0	CSGALNACT2	42998742	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.269000	0.95684	2.941000	0.99782	0.655000	0.94253	GAT		0.423	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590		7	300	0	0	0	0.00308	0	7	300				
JMJD1C	221037	broad.mit.edu	37	10	64944420	64944420	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:64944420C>G	ENST00000399262.2	-	21	7127	c.6909G>C	c.(6907-6909)ttG>ttC	p.L2303F	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000542921.1_Missense_Mutation_p.L2121F|JMJD1C_ENST00000402544.1_Missense_Mutation_p.L2066F	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2303	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.L2066F(1)|p.L2303F(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AAAATCCTGGCAAATGAGAGG	0.373																																							uc001jmn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(1)|central_nervous_system(1)	6						c.(6907-6909)TTG>TTC		jumonji domain containing 1C isoform a							97.0	95.0	96.0					10																	64944420		1833	4079	5912	SO:0001583	missense	221037				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding	g.chr10:64944420C>G	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6909G>C	10.37:g.64944420C>G	ENSP00000382204:p.Leu2303Phe		Somatic				JMJD1C_uc001jml.2_Missense_Mutation_p.L2066F|JMJD1C_uc001jmm.2_Missense_Mutation_p.L2015F|JMJD1C_uc010qiq.1_Missense_Mutation_p.L2121F|JMJD1C_uc009xpi.2_Missense_Mutation_p.L2121F|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_Missense_Mutation_p.L210F	p.L2303F	NM_032776	NP_116165	WXS	Illumina HiSeq	Unspecified	Q15652	JHD2C_HUMAN			21	7209	-	Prostate(12;0.0119)|all_hematologic(501;0.191)		2303			JmjC.		A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	c.6909G>C	CCDS41532.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.115942|4.115942	0.77323|0.77323	.|.	.|.	ENSG00000171988|ENSG00000171988	ENST00000327520|ENST00000399262;ENST00000402544;ENST00000542921	.|D;D;D	.|0.85013	.|-1.93;-1.93;-1.93	5.96|5.96	3.07|3.07	0.35406|0.35406	.|Transcription factor jumonji/aspartyl beta-hydroxylase (2);	.|0.225081	.|0.38272	.|N	.|0.001754	D|D	0.88183|0.88183	0.6368|0.6368	L|L	0.55017|0.55017	1.72|1.72	0.80722|0.80722	D|D	1|1	.|D;D;B	.|0.71674	.|0.998;0.998;0.369	.|D;D;B	.|0.65684	.|0.937;0.937;0.229	D|D	0.86414|0.86414	0.1750|0.1750	5|10	.|0.62326	.|D	.|0.03	-5.177|-5.177	9.4468|9.4468	0.38701|0.38701	0.0:0.7492:0.1192:0.1317|0.0:0.7492:0.1192:0.1317	.|.	.|2121;2303;2121	.|B7ZLC8;Q15652;A0T124	.|.;JHD2C_HUMAN;.	S|F	850|2303;2066;2121	.|ENSP00000382204:L2303F;ENSP00000384990:L2066F;ENSP00000444682:L2121F	.|ENSP00000382204:L2303F	C|L	-|-	2|3	0|2	JMJD1C|JMJD1C	64614426|64614426	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.859000|0.859000	0.49053|0.49053	2.107000|2.107000	0.41844|0.41844	0.400000|0.400000	0.25396|0.25396	-0.291000|-0.291000	0.09656|0.09656	TGC|TTG		0.373	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		4	119	0	0	0	0.009096	0	4	119				
MRPS16	51021	broad.mit.edu	37	10	75010727	75010727	+	Silent	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:75010727C>A	ENST00000372945.3	-	3	507	c.297G>T	c.(295-297)ctG>ctT	p.L99L	MRPS16_ENST00000372940.3_Intron|DNAJC9-AS1_ENST00000440197.2_RNA|TTC18_ENST00000493787.1_5'Flank|RP11-152N13.5_ENST00000457147.1_RNA|DNAJC9-AS1_ENST00000513954.1_RNA|RP11-152N13.5_ENST00000394864.2_RNA|RP11-152N13.5_ENST00000457758.1_RNA|MRPS16_ENST00000479005.1_5'UTR|DNAJC9_ENST00000372950.4_5'Flank|MRPS16_ENST00000416782.2_Intron	NM_016065.3	NP_057149.1	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16	99					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)	p.L99L(1)		large_intestine(2)|lung(2)	4	Prostate(51;0.0119)					TCATAGGATGCAGAGGGAAAA	0.428																																							uc001jts.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(295-297)CTG>CTT		mitochondrial ribosomal protein S16 precursor							114.0	107.0	109.0					10																	75010727		2203	4300	6503	SO:0001819	synonymous_variant	51021				translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome	g.chr10:75010727C>A	AB051351	CCDS7323.1	10q22.1	2012-09-13			ENSG00000182180	ENSG00000182180		"""Mitochondrial ribosomal proteins / small subunits"""	14048	protein-coding gene	gene with protein product		609204				10810093	Standard	NM_016065		Approved	CGI-132	uc001jts.1	Q9Y3D3	OTTHUMG00000018454	ENST00000372945.3:c.297G>T	10.37:g.75010727C>A			Somatic				DNAJC9_uc010qkg.1_5'Flank|MRPS16_uc010qkh.1_Intron|MRPS16_uc001jtt.1_RNA|uc001jtu.1_5'Flank	p.L99L	NM_016065	NP_057149	WXS	Illumina HiSeq	Unspecified	Q9Y3D3	RT16_HUMAN			3	508	-	Prostate(51;0.0119)		99					B4E032|Q96Q60	Silent	SNP	ENST00000372945.3	37	c.297G>T	CCDS7323.1																																																																																				0.428	MRPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048616.1			59	113	1	0	7.92265e-33	0.01441	9.87886e-33	59	113				
MRPS16	51021	broad.mit.edu	37	10	75011685	75011685	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:75011685G>C	ENST00000372945.3	-	2	320	c.110C>G	c.(109-111)gCt>gGt	p.A37G	MRPS16_ENST00000372940.3_Missense_Mutation_p.A37G|DNAJC9-AS1_ENST00000440197.2_RNA|TTC18_ENST00000493787.1_5'Flank|RP11-152N13.5_ENST00000457147.1_RNA|DNAJC9-AS1_ENST00000513954.1_RNA|RP11-152N13.5_ENST00000394864.2_RNA|RP11-152N13.5_ENST00000457758.1_RNA|MRPS16_ENST00000479005.1_5'UTR|MRPS16_ENST00000416782.2_Missense_Mutation_p.A37G	NM_016065.3	NP_057149.1	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16	37					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)	p.A37G(1)		large_intestine(2)|lung(2)	4	Prostate(51;0.0119)					CTTGTTGTGAGCAGCCACAAT	0.572																																							uc001jts.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(109-111)GCT>GGT		mitochondrial ribosomal protein S16 precursor							66.0	59.0	62.0					10																	75011685		2203	4300	6503	SO:0001583	missense	51021				translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome	g.chr10:75011685G>C	AB051351	CCDS7323.1	10q22.1	2012-09-13			ENSG00000182180	ENSG00000182180		"""Mitochondrial ribosomal proteins / small subunits"""	14048	protein-coding gene	gene with protein product		609204				10810093	Standard	NM_016065		Approved	CGI-132	uc001jts.1	Q9Y3D3	OTTHUMG00000018454	ENST00000372945.3:c.110C>G	10.37:g.75011685G>C	ENSP00000362036:p.Ala37Gly		Somatic				MRPS16_uc010qkh.1_RNA|MRPS16_uc001jtt.1_RNA|uc001jtu.1_5'Flank	p.A37G	NM_016065	NP_057149	WXS	Illumina HiSeq	Unspecified	Q9Y3D3	RT16_HUMAN			2	321	-	Prostate(51;0.0119)		37					B4E032|Q96Q60	Missense_Mutation	SNP	ENST00000372945.3	37	c.110C>G	CCDS7323.1	.	.	.	.	.	.	.	.	.	.	G	35	5.475133	0.96291	.	.	ENSG00000182180	ENST00000416782;ENST00000372945;ENST00000372940	T;T;T	0.55588	0.56;0.51;0.65	5.33	5.33	0.75918	Ribosomal protein S16 domain (2);	0.000000	0.85682	U	0.000000	T	0.77994	0.4214	H	0.94964	3.605	0.80722	D	1	D	0.58268	0.982	P	0.59643	0.861	D	0.84761	0.0762	10	0.87932	D	0	-9.6226	16.5422	0.84395	0.0:0.0:1.0:0.0	.	37	Q9Y3D3	RT16_HUMAN	G	37	ENSP00000408812:A37G;ENSP00000362036:A37G;ENSP00000362031:A37G	ENSP00000362031:A37G	A	-	2	0	MRPS16	74681691	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.957000	0.93082	2.495000	0.84180	0.655000	0.94253	GCT		0.572	MRPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048616.1			4	28	0	0	0	0.007413	0	4	28				
CYP2C8	1558	broad.mit.edu	37	10	96818250	96818250	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:96818250G>C	ENST00000371270.3	-	5	755	c.661C>G	c.(661-663)Cta>Gta	p.L221V	CYP2C8_ENST00000539050.1_Missense_Mutation_p.L135V|CYP2C8_ENST00000535898.1_Missense_Mutation_p.L119V	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	221					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)	p.L221V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	TCAATGAGTAGAGGGAAATTA	0.323																																							uc001kkb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(661-663)CTA>GTA		cytochrome P450, family 2, subfamily C,	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)						102.0	93.0	96.0					10																	96818250		2203	4300	6503	SO:0001583	missense	1558				exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding	g.chr10:96818250G>C	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.661C>G	10.37:g.96818250G>C	ENSP00000360317:p.Leu221Val		Somatic				CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Missense_Mutation_p.L151V|CYP2C8_uc010qob.1_Missense_Mutation_p.L135V|CYP2C8_uc010qoc.1_Missense_Mutation_p.L119V|CYP2C8_uc010qod.1_Missense_Mutation_p.L135V	p.L221V	NM_000770	NP_000761	WXS	Illumina HiSeq	Unspecified	P10632	CP2C8_HUMAN		all cancers(201;6.21e-05)	5	756	-		Colorectal(252;0.0397)	221					A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	37	c.661C>G	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	G	2.031	-0.422454	0.04734	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.13420	2.59;2.59;2.59	3.97	-7.94	0.01152	.	2.271390	0.02396	N	0.080172	T	0.06188	0.0160	N	0.17278	0.47	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.26849	-1.0091	10	0.22109	T	0.4	.	1.7402	0.02951	0.1987:0.1135:0.2093:0.4785	.	135;119;189;221	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	V	221;188;119;135	ENSP00000360317:L221V;ENSP00000445062:L119V;ENSP00000442343:L135V	ENSP00000360317:L221V	L	-	1	2	CYP2C8	96808240	0.000000	0.05858	0.000000	0.03702	0.450000	0.32258	-6.884000	0.00050	-2.364000	0.00607	0.305000	0.20034	CTA		0.323	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770		17	39	0	0	0	0.007413	0	17	39				
SFXN3	81855	broad.mit.edu	37	10	102799248	102799248	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:102799248C>G	ENST00000224807.5	+	12	1340	c.884C>G	c.(883-885)tCc>tGc	p.S295C	SFXN3_ENST00000393459.1_Missense_Mutation_p.S291C|SFXN3_ENST00000466982.1_3'UTR	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	295					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)	p.S295C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		TATTGCAGCTCCATACACATA	0.537																																							uc001ksp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(883-885)TCC>TGC		sideroflexin 3							192.0	178.0	182.0					10																	102799248		2203	4300	6503	SO:0001583	missense	81855				iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity	g.chr10:102799248C>G	AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.884C>G	10.37:g.102799248C>G	ENSP00000224807:p.Ser295Cys		Somatic				SFXN3_uc001ksq.2_Missense_Mutation_p.S295C|SFXN3_uc010qpx.1_Missense_Mutation_p.S299C	p.S295C	NM_030971	NP_112233	WXS	Illumina HiSeq	Unspecified	Q9BWM7	SFXN3_HUMAN		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)	12	1340	+		Colorectal(252;0.234)	295					Q8NCJ0|Q9NTP4	Missense_Mutation	SNP	ENST00000224807.5	37	c.884C>G	CCDS7508.2	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244072	0.79912	.	.	ENSG00000107819	ENST00000393459;ENST00000224807	T;T	0.34072	1.38;1.38	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	M	0.92026	3.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.987;0.987	T	0.77172	-0.2685	10	0.87932	D	0	-33.7895	17.9482	0.89045	0.0:1.0:0.0:0.0	.	299;295;295	B4DRS6;A6NCZ6;Q9BWM7	.;.;SFXN3_HUMAN	C	291;295	ENSP00000377103:S291C;ENSP00000224807:S295C	ENSP00000224807:S295C	S	+	2	0	SFXN3	102789238	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.911000	0.69939	2.483000	0.83821	0.561000	0.74099	TCC		0.537	SFXN3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_030971		9	239	0	0	0	0.010729	0	9	239				
RAB11FIP2	22841	broad.mit.edu	37	10	119798615	119798615	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:119798615C>A	ENST00000355624.3	-	3	1572	c.1133G>T	c.(1132-1134)gGg>gTg	p.G378V	RP11-354M20.3_ENST00000417968.4_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.G378V|RP11-354M20.3_ENST00000451610.2_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	378					establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.G378V(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		ATCAGATCCCCCATTGTTAAG	0.348																																							uc001ldj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1132-1134)GGG>GTG		RAB11 family interacting protein 2							180.0	196.0	191.0					10																	119798615		2203	4300	6503	SO:0001583	missense	22841				protein transport	plasma membrane|recycling endosome membrane	protein homodimerization activity	g.chr10:119798615C>A	AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.1133G>T	10.37:g.119798615C>A	ENSP00000347839:p.Gly378Val		Somatic				RAB11FIP2_uc009xyz.1_Missense_Mutation_p.G378V	p.G378V	NM_014904	NP_055719	WXS	Illumina HiSeq	Unspecified	Q7L804	RFIP2_HUMAN		all cancers(201;0.0238)	3	1573	-		Colorectal(252;0.235)	378					A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	ENST00000355624.3	37	c.1133G>T	CCDS7602.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755429	0.31046	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.69685	-0.42;-0.36	5.76	4.84	0.62591	.	0.369242	0.34932	N	0.003568	T	0.59074	0.2167	L	0.43152	1.355	0.80722	D	1	P;P	0.36577	0.558;0.498	B;B	0.36666	0.23;0.164	T	0.57447	-0.7810	10	0.30078	T	0.28	-12.6326	14.2874	0.66254	0.0:0.9258:0.0:0.0742	.	378;378	Q3I768;Q7L804	.;RFIP2_HUMAN	V	378	ENSP00000347839:G378V;ENSP00000358200:G378V	ENSP00000347839:G378V	G	-	2	0	RAB11FIP2	119788605	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.038000	0.57318	1.508000	0.48769	0.650000	0.86243	GGG		0.348	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050583.1	NM_014904		56	101	1	0	4.88482e-21	0.01441	5.99839e-21	56	101				
MKI67	4288	broad.mit.edu	37	10	129902254	129902254	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr10:129902254G>A	ENST00000368654.3	-	13	8225	c.7850C>T	c.(7849-7851)tCa>tTa	p.S2617L	MKI67_ENST00000368653.3_Missense_Mutation_p.S2257L	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2617	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.S2617L(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTCAACTGCTGAGAGCTCCTC	0.507																																							uc001lke.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(7849-7851)TCA>TTA		antigen identified by monoclonal antibody Ki-67							161.0	144.0	150.0					10																	129902254		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129902254G>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7850C>T	10.37:g.129902254G>A	ENSP00000357643:p.Ser2617Leu		Somatic				MKI67_uc001lkf.2_Missense_Mutation_p.S2257L|MKI67_uc009yav.1_Missense_Mutation_p.S2192L|MKI67_uc009yaw.1_Missense_Mutation_p.S1767L	p.S2617L	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	8045	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2617			14.|16 X 122 AA approximate repeats.		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.7850C>T	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626240	0.28978	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02472	4.28;4.28	3.2	2.26	0.28386	.	.	.	.	.	T	0.02380	0.0073	N	0.10874	0.06	0.09310	N	1	P;D;P	0.54964	0.886;0.969;0.828	B;P;P	0.49451	0.393;0.611;0.542	T	0.50659	-0.8802	9	0.25751	T	0.34	.	5.623	0.17467	0.1637:0.0:0.8363:0.0	.	2616;2257;2617	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	L	2617;2257;2616	ENSP00000357643:S2617L;ENSP00000357642:S2257L	ENSP00000357642:S2257L	S	-	2	0	MKI67	129792244	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	0.444000	0.21661	0.628000	0.30357	0.563000	0.77884	TCA		0.507	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		7	227	0	0	0	0.001984	0	7	227				
MUC5B	727897	broad.mit.edu	37	11	1275485	1275485	+	Silent	SNP	C	C	A	rs569178429		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:1275485C>A	ENST00000529681.1	+	34	15439	c.15381C>A	c.(15379-15381)gcC>gcA	p.A5127A	MUC5B_ENST00000447027.1_Silent_p.A5130A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5127	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A5127A(1)|p.A5082A(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGCCACTGCCGCTGCCGCCC	0.607																																							uc009ycr.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(16384-16386)GCC>GCA		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							33.0	46.0	42.0					11																	1275485		2155	4270	6425	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1275485C>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15381C>A	11.37:g.1275485C>A			Somatic				MUC5B_uc001ltb.2_Silent_p.A5130A	p.A5462A	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	55	16512	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.16386C>A	CCDS44515.2																																																																																				0.607	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		14	15	1	0	1.42536e-11	0.004656	1.69865e-11	14	15				
ZNF195	7748	broad.mit.edu	37	11	3380816	3380816	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:3380816G>A	ENST00000399602.4	-	6	1548	c.1422C>T	c.(1420-1422)gtC>gtT	p.V474V	ZNF195_ENST00000429541.2_Silent_p.V406V|ZNF195_ENST00000526601.1_Silent_p.V455V|ZNF195_ENST00000354599.6_Silent_p.V402V|ZNF195_ENST00000005082.9_Silent_p.V451V|ZNF195_ENST00000343338.7_Silent_p.V406V|ZNF195_ENST00000528796.1_Intron	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V402V(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		AAGTTCTGAAGACCTTCCCAC	0.443																																							uc001lxt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1420-1422)GTC>GTT		zinc finger protein 195 isoform 1							109.0	115.0	113.0					11																	3380816		2115	4254	6369	SO:0001819	synonymous_variant	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3380816G>A		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1422C>T	11.37:g.3380816G>A			Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Silent_p.V451V|ZNF195_uc001lxs.2_Silent_p.V402V|ZNF195_uc010qxr.1_Silent_p.V455V|ZNF195_uc009ydz.2_Silent_p.V429V|ZNF195_uc001lxu.2_Silent_p.V406V	p.V474V	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1600	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	474			C2H2-type 5.		A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	37	c.1422C>T	CCDS44522.1																																																																																				0.443	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			75	107	0	0	0	0.01441	0	75	107				
OR52B2	255725	broad.mit.edu	37	11	6191554	6191554	+	Start_Codon_SNP	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:6191554C>T	ENST00000530810.1	-	1	84	c.3G>A	c.(1-3)atG>atA	p.M1I	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	1						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M1I(2)		NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTGTGACTCATGATGCACT	0.418																																					NSCLC(5;186 261 1778 7098 14207)	NSCLC(5;186 261 1778 7098 14207)	uc010qzy.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1-3)ATG>ATA		olfactory receptor, family 52, subfamily B,							53.0	50.0	51.0					11																	6191554		1986	4164	6150	SO:0001582	initiator_codon_variant	255725				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6191554C>T	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.3G>A	11.37:g.6191554C>T	ENSP00000432011:p.Met1Ile		Somatic					p.M1I	NM_001004052	NP_001004052	WXS	Illumina HiSeq	Unspecified	Q96RD2	O52B2_HUMAN		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	3	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	1			Extracellular (Potential).		Q8NGM7	Missense_Mutation	SNP	ENST00000530810.1	37	c.3G>A	CCDS53598.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873586	0.72180	.	.	ENSG00000255307	ENST00000530810	T	0.01918	4.56	4.61	3.7	0.42460	.	.	.	.	.	T	0.06508	0.0167	.	.	.	0.80722	D	1	D	0.57257	0.979	P	0.53006	0.715	T	0.13629	-1.0502	8	0.87932	D	0	.	11.7336	0.51752	0.0:0.9147:0.0:0.0853	.	1	Q96RD2	O52B2_HUMAN	I	1	ENSP00000432011:M1I	ENSP00000432011:M1I	M	-	3	0	OR52B2	6148130	0.991000	0.36638	0.748000	0.31131	0.018000	0.09664	3.046000	0.49846	1.269000	0.44280	0.643000	0.83706	ATG		0.418	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052	Missense_Mutation	22	40	0	0	0	0.00278	0	22	40				
SLC6A5	9152	broad.mit.edu	37	11	20622793	20622793	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:20622793C>T	ENST00000525748.1	+	2	395	c.122C>T	c.(121-123)cCc>cTc	p.P41L		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	41					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.P41L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CAGGAGCTTCCCGCGGCTGCC	0.726																																							uc001mqd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(121-123)CCC>CTC		solute carrier family 6 (neurotransmitter	Glycine(DB00145)						4.0	5.0	5.0					11																	20622793		1850	3776	5626	SO:0001583	missense	9152				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr11:20622793C>T	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.122C>T	11.37:g.20622793C>T	ENSP00000434364:p.Pro41Leu		Somatic				SLC6A5_uc009yic.2_5'UTR	p.P41L	NM_004211	NP_004202	WXS	Illumina HiSeq	Unspecified	Q9Y345	SC6A5_HUMAN			2	395	+			41			Cytoplasmic (Potential).		O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	c.122C>T	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.906350	0.52333	.	.	ENSG00000165970	ENST00000525748	T	0.72394	-0.65	5.25	4.28	0.50868	.	1.428200	0.03785	N	0.261945	T	0.66237	0.2769	L	0.29908	0.895	0.31754	N	0.634225	B	0.24186	0.099	B	0.24155	0.051	T	0.56751	-0.7927	10	0.87932	D	0	.	14.0543	0.64756	0.0:0.8481:0.1519:0.0	.	41	Q9Y345	SC6A5_HUMAN	L	41	ENSP00000434364:P41L	ENSP00000298923:P41L	P	+	2	0	SLC6A5	20579369	0.995000	0.38212	0.536000	0.28039	0.494000	0.33585	6.263000	0.72521	2.463000	0.83235	0.462000	0.41574	CCC		0.726	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211		3	1	0	0	0	0.009096	0	3	1				
OR5AS1	219447	broad.mit.edu	37	11	55798482	55798482	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:55798482G>T	ENST00000313555.1	+	1	588	c.588G>T	c.(586-588)caG>caT	p.Q196H		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q196H(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					AGATCAACCAGCTTCTGCTCT	0.413																																							uc010riw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(1)|skin(1)	5						c.(586-588)CAG>CAT		olfactory receptor, family 5, subfamily AS,							316.0	314.0	315.0					11																	55798482		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798482G>T	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.588G>T	11.37:g.55798482G>T	ENSP00000324111:p.Gln196His		Somatic					p.Q196H	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	588	+	Esophageal squamous(21;0.00693)		196			Extracellular (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.588G>T	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263716	0.39995	.	.	ENSG00000181785	ENST00000313555	T	0.00158	8.65	5.23	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.226072	0.22057	U	0.065223	T	0.00178	0.0005	L	0.38175	1.15	0.21386	N	0.99971	P	0.42941	0.794	P	0.49140	0.601	T	0.37709	-0.9694	10	0.72032	D	0.01	.	4.2312	0.10604	0.3285:0.0:0.5077:0.1638	.	196	Q8N127	O5AS1_HUMAN	H	196	ENSP00000324111:Q196H	ENSP00000324111:Q196H	Q	+	3	2	OR5AS1	55555058	0.006000	0.16342	0.950000	0.38849	0.570000	0.35934	-0.211000	0.09332	0.597000	0.29811	0.643000	0.83706	CAG		0.413	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		165	325	1	0	4.72421e-73	0.01441	6.00182e-73	165	325				
OR8H2	390151	broad.mit.edu	37	11	55873052	55873052	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:55873052C>T	ENST00000313503.1	+	1	534	c.534C>T	c.(532-534)ttC>ttT	p.F178F		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F178F(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					ATCACTTTTTCTGTGACACTT	0.418										HNSCC(53;0.14)																													uc010riy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(532-534)TTC>TTT		olfactory receptor, family 8, subfamily H,							264.0	241.0	249.0					11																	55873052		2201	4296	6497	SO:0001819	synonymous_variant	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55873052C>T	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.534C>T	11.37:g.55873052C>T		HNSCC(53;0.14)	Somatic					p.F178F	NM_001005200	NP_001005200	WXS	Illumina HiSeq	Unspecified	Q8N162	OR8H2_HUMAN			1	534	+	Esophageal squamous(21;0.00693)		178			Extracellular (Potential).		Q6IFC1	Silent	SNP	ENST00000313503.1	37	c.534C>T	CCDS31518.1																																																																																				0.418	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		37	294	0	0	0	0.009718	0	37	294				
OR4D9	390199	broad.mit.edu	37	11	59282631	59282631	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:59282631G>A	ENST00000329328.3	+	1	246	c.246G>A	c.(244-246)ctG>ctA	p.L82L		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L82L(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						CTAAGGTCCTGATAGATCTTC	0.463																																							uc010rkv.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(244-246)CTG>CTA		olfactory receptor, family 4, subfamily D,							141.0	136.0	138.0					11																	59282631		2201	4295	6496	SO:0001819	synonymous_variant	390199				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59282631G>A	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.246G>A	11.37:g.59282631G>A			Somatic					p.L82L	NM_001004711	NP_001004711	WXS	Illumina HiSeq	Unspecified	Q8NGE8	OR4D9_HUMAN			1	246	+			82			Extracellular (Potential).		Q6IFF3	Silent	SNP	ENST00000329328.3	37	c.246G>A	CCDS31564.1																																																																																				0.463	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711		7	197	0	0	0	0.001984	0	7	197				
AHNAK	79026	broad.mit.edu	37	11	62292702	62292702	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:62292702G>C	ENST00000378024.4	-	5	9461	c.9187C>G	c.(9187-9189)Cca>Gca	p.P3063A	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3063					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P3063A(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCACATCTGGAACATCAATG	0.498																																							uc001ntl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(9187-9189)CCA>GCA		AHNAK nucleoprotein isoform 1							136.0	146.0	143.0					11																	62292702		2202	4296	6498	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62292702G>C	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.9187C>G	11.37:g.62292702G>C	ENSP00000367263:p.Pro3063Ala		Somatic				AHNAK_uc001ntk.1_Intron	p.P3063A	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	9487	-		Melanoma(852;0.155)	3063					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.9187C>G	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	g	12.19	1.862360	0.32884	.	.	ENSG00000124942	ENST00000378024	T	0.03004	4.08	4.48	4.48	0.54585	.	.	.	.	.	T	0.25005	0.0607	H	0.95079	3.62	0.42529	D	0.993034	D	0.54772	0.968	P	0.61201	0.885	T	0.41233	-0.9520	9	0.38643	T	0.18	.	16.7427	0.85464	0.0:0.0:1.0:0.0	.	3063	Q09666	AHNK_HUMAN	A	3063	ENSP00000367263:P3063A	ENSP00000367263:P3063A	P	-	1	0	AHNAK	62049278	1.000000	0.71417	0.868000	0.34077	0.257000	0.26127	5.669000	0.68081	2.021000	0.59480	0.305000	0.20034	CCA		0.498	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		6	342	0	0	0	0.001168	0	6	342				
SLC3A2	6520	broad.mit.edu	37	11	62656063	62656063	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:62656063C>T	ENST00000377890.2	+	12	1959	c.1791C>T	c.(1789-1791)ctC>ctT	p.L597L	SLC3A2_ENST00000377889.2_Silent_p.L535L|SLC3A2_ENST00000377892.1_Silent_p.L628L|SLC3A2_ENST00000338663.7_Silent_p.L496L|SLC3A2_ENST00000377891.2_Silent_p.L598L|SLC3A2_ENST00000535296.1_Silent_p.L566L|SLC3A2_ENST00000536981.1_Silent_p.L142L	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	597					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)	p.L628L(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						ACCTCCTGCTCAGCACCCAGC	0.662																																							uc001nwd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1789-1791)CTC>CTT		solute carrier family 3, member 2 isoform c							59.0	63.0	62.0					11																	62656063		2201	4298	6499	SO:0001819	synonymous_variant	6520				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding	g.chr11:62656063C>T		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.1791C>T	11.37:g.62656063C>T			Somatic				SLC3A2_uc001nwb.2_Silent_p.L628L|SLC3A2_uc001nwc.2_Silent_p.L598L|SLC3A2_uc001nwe.2_Silent_p.L566L|SLC3A2_uc001nwf.2_Silent_p.L535L|SLC3A2_uc001nwg.2_Silent_p.L496L	p.L597L	NM_002394	NP_002385	WXS	Illumina HiSeq	Unspecified	P08195	4F2_HUMAN			12	2015	+			597			Extracellular (Potential).		Q13543	Silent	SNP	ENST00000377890.2	37	c.1791C>T	CCDS8039.2																																																																																				0.662	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661		18	62	0	0	0	0.008361	0	18	62				
RPS6KA4	8986	broad.mit.edu	37	11	64128005	64128005	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:64128005G>A	ENST00000334205.4	+	4	468	c.403G>A	c.(403-405)Gag>Aag	p.E135K	RPS6KA4_ENST00000528057.1_Missense_Mutation_p.E135K|RPS6KA4_ENST00000294261.4_Missense_Mutation_p.E135K	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	135	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)	p.E135K(2)		breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						GTACTTCAAGGAGGCTGAGGT	0.612																																							uc001oae.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(1)|breast(1)	5						c.(403-405)GAG>AAG		ribosomal protein S6 kinase, 90kDa, polypeptide							73.0	55.0	61.0					11																	64128005		2200	4297	6497	SO:0001583	missense	8986				axon guidance|histone phosphorylation|interleukin-1-mediated signaling pathway|intracellular protein kinase cascade|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|magnesium ion binding|mitogen-activated protein kinase p38 binding|ribosomal protein S6 kinase activity	g.chr11:64128005G>A	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.403G>A	11.37:g.64128005G>A	ENSP00000333896:p.Glu135Lys		Somatic				RPS6KA4_uc001oad.2_Missense_Mutation_p.E135K|RPS6KA4_uc010rnl.1_Missense_Mutation_p.E72K|RPS6KA4_uc001oaf.2_Missense_Mutation_p.E135K|RPS6KA4_uc009ypp.2_Missense_Mutation_p.E135K	p.E135K	NM_003942	NP_003933	WXS	Illumina HiSeq	Unspecified	O75676	KS6A4_HUMAN			4	486	+			135			Protein kinase 1.		A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	c.403G>A	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	g	26.6	4.752804	0.89753	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261;ENST00000530504	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	3.32	3.32	0.38043	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60457	0.2270	M	0.90425	3.115	0.49798	D	0.999829	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.97;0.998;0.998;1.0	T	0.70171	-0.4945	10	0.87932	D	0	.	12.8929	0.58082	0.0:0.0:1.0:0.0	.	135;135;135;135	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	K	135;135;135;119	ENSP00000435580:E135K;ENSP00000333896:E135K;ENSP00000294261:E135K;ENSP00000432945:E119K	ENSP00000294261:E135K	E	+	1	0	RPS6KA4	63884581	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.062000	0.93920	2.165000	0.68154	0.313000	0.20887	GAG		0.612	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942		4	13	0	0	0	0.001168	0	4	13				
ACER3	55331	broad.mit.edu	37	11	76637694	76637694	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:76637694C>T	ENST00000532485.1	+	2	301	c.197C>T	c.(196-198)tCt>tTt	p.S66F	ACER3_ENST00000533873.1_Intron|ACER3_ENST00000530182.1_3'UTR|ACER3_ENST00000538157.1_Missense_Mutation_p.S24F|ACER3_ENST00000526597.1_5'UTR	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3	66					ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)	p.S66F(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						TACATTGCTTCTTATTTAGCA	0.378																																							uc009yum.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(196-198)TCT>TTT		phytoceramidase, alkaline							142.0	119.0	127.0					11																	76637694		2200	4292	6492	SO:0001583	missense	55331				ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity	g.chr11:76637694C>T	AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.197C>T	11.37:g.76637694C>T	ENSP00000434480:p.Ser66Phe		Somatic				ACER3_uc010rsg.1_Missense_Mutation_p.S24F|ACER3_uc009yul.1_RNA|ACER3_uc001oxu.2_RNA|ACER3_uc009yun.1_Missense_Mutation_p.S24F|ACER3_uc009yuo.1_5'UTR|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_5'UTR|ACER3_uc010rsj.1_5'UTR	p.S66F	NM_018367	NP_060837	WXS	Illumina HiSeq	Unspecified	Q9NUN7	ACER3_HUMAN			2	301	+			66			Helical; (Potential).		B2RC99	Missense_Mutation	SNP	ENST00000532485.1	37	c.197C>T	CCDS8247.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085756	0.76642	.	.	ENSG00000078124	ENST00000534206;ENST00000532485;ENST00000538157;ENST00000530243	T;T;T	0.44083	0.93;0.93;0.93	5.76	5.76	0.90799	.	0.411121	0.26510	N	0.023967	T	0.56761	0.2007	M	0.77820	2.39	0.80722	D	1	P	0.35107	0.484	P	0.44518	0.452	T	0.56848	-0.7911	10	0.49607	T	0.09	-2.9014	17.4534	0.87599	0.0:1.0:0.0:0.0	.	66	Q9NUN7	ACER3_HUMAN	F	24;66;24;24	ENSP00000435733:S24F;ENSP00000434480:S66F;ENSP00000440916:S24F	ENSP00000278544:S66F	S	+	2	0	ACER3	76315342	0.994000	0.37717	0.992000	0.48379	0.995000	0.86356	4.051000	0.57412	2.726000	0.93360	0.655000	0.94253	TCT		0.378	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382770.2	NM_018367		12	65	0	0	0	0.00245	0	12	65				
TMEM123	114908	broad.mit.edu	37	11	102272716	102272716	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:102272716G>C	ENST00000398136.2	-	3	799	c.379C>G	c.(379-381)Cag>Gag	p.Q127E	TMEM123_ENST00000525577.1_5'UTR|TMEM123_ENST00000532161.1_Missense_Mutation_p.Q39E|TMEM123_ENST00000361236.3_Missense_Mutation_p.Q108E	NM_052932.2	NP_443164.2	Q8N131	PORIM_HUMAN	transmembrane protein 123	127	Thr-rich.				oncosis (GO:0070267)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Q127E(1)		breast(3)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		GTTGATATCTGAGATGTGTTC	0.388																																							uc001pha.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(379-381)CAG>GAG		transmembrane protein 123 precursor							430.0	392.0	404.0					11																	102272716		1986	4170	6156	SO:0001583	missense	114908				oncosis	external side of plasma membrane|integral to membrane	receptor activity	g.chr11:102272716G>C	AL050161	CCDS41702.1	11q22.1	2014-01-02			ENSG00000152558	ENSG00000152558			30138	protein-coding gene	gene with protein product	"""pro oncosis receptor inducing membrane injury gene"""	606356				11481458, 24318988	Standard	NM_052932		Approved	PORIMIN, KCT3	uc001pha.3	Q8N131	OTTHUMG00000167326	ENST00000398136.2:c.379C>G	11.37:g.102272716G>C	ENSP00000381204:p.Gln127Glu		Somatic				TMEM123_uc009yxc.2_Missense_Mutation_p.Q108E	p.Q127E	NM_052932	NP_443164	WXS	Illumina HiSeq	Unspecified	Q8N131	PORIM_HUMAN	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)	3	800	-	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	127			Thr-rich.|Extracellular (Potential).		Q8IWS2|Q96QV2	Missense_Mutation	SNP	ENST00000398136.2	37	c.379C>G	CCDS41702.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296323	0.23650	.	.	ENSG00000152558	ENST00000361236;ENST00000398136;ENST00000532161;ENST00000528969	T;T;T;T	0.40225	1.04;1.97;1.04;1.04	5.44	3.49	0.39957	.	0.748572	0.12128	N	0.497086	T	0.35068	0.0919	L	0.38175	1.15	0.09310	N	1	P;P	0.50819	0.884;0.939	B;B	0.44278	0.256;0.445	T	0.07233	-1.0783	10	0.20519	T	0.43	-1.1383	11.0103	0.47659	0.0:0.0:0.6609:0.3391	.	108;127	Q8N131-2;Q8N131	.;PORIM_HUMAN	E	108;127;39;39	ENSP00000355285:Q108E;ENSP00000381204:Q127E;ENSP00000435331:Q39E;ENSP00000434976:Q39E	ENSP00000355285:Q108E	Q	-	1	0	TMEM123	101777926	0.011000	0.17503	0.078000	0.20375	0.067000	0.16453	1.206000	0.32321	0.711000	0.32018	0.563000	0.77884	CAG		0.388	TMEM123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394178.1	NM_052932		15	284	0	0	0	0.003163	0	15	284				
ATM	472	broad.mit.edu	37	11	108159736	108159736	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:108159736T>G	ENST00000452508.2	+	29	4331	c.4142T>G	c.(4141-4143)tTt>tGt	p.F1381C	ATM_ENST00000278616.4_Missense_Mutation_p.F1381C			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1381	Interaction with ABL1.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.F1381C(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CCACCTCATTTTCCATCGCAT	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(4141-4143)TTT>TGT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							103.0	100.0	101.0					11																	108159736		2201	4297	6498	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108159736T>G	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4142T>G	11.37:g.108159736T>G	ENSP00000388058:p.Phe1381Cys	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.F1381C|ATM_uc001pkd.3_Missense_Mutation_p.F33C|ATM_uc001pke.1_Missense_Mutation_p.F33C|ATM_uc010rvw.1_Missense_Mutation_p.F33C|ATM_uc001pkf.2_Missense_Mutation_p.F33C	p.F1381C	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	28	4527	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	1381			Interaction with ABL1.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.4142T>G	CCDS31669.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.1|24.1	4.495089|4.495089	0.85069|0.85069	.|.	.|.	ENSG00000149311|ENSG00000149311	ENST00000278616;ENST00000452508;ENST00000389511|ENST00000531525	T;T|T	0.76578|0.76060	-1.03;-1.03|-0.99	5.36|5.36	5.36|5.36	0.76844|0.76844	Armadillo-type fold (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.81744|0.81744	0.4887|0.4887	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.996|.	D|D	0.83907|0.83907	0.0293|0.0293	10|8	0.87932|0.87932	D|D	0|0	.|.	15.3554|15.3554	0.74423|0.74423	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	33;1381|.	E7EV38;Q13315|.	.;ATM_HUMAN|.	C|V	1381;1381;33|51	ENSP00000278616:F1381C;ENSP00000388058:F1381C|ENSP00000434327:F51V	ENSP00000278616:F1381C|ENSP00000434327:F51V	F|F	+|+	2|1	0|0	ATM|ATM	107664946|107664946	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.284000|7.284000	0.78650|0.78650	2.020000|2.020000	0.59435|0.59435	0.528000|0.528000	0.53228|0.53228	TTT|TTC		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		4	121	0	0	0	0.001168	0	4	121				
EXPH5	23086	broad.mit.edu	37	11	108412521	108412521	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:108412521C>G	ENST00000265843.4	-	2	248	c.138G>C	c.(136-138)aaG>aaC	p.K46N	EXPH5_ENST00000525344.1_Missense_Mutation_p.K39N|EXPH5_ENST00000428840.1_5'UTR	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	46	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.K46N(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TGATATCCCTCTTTGTCTTCT	0.303																																							uc001pkk.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(136-138)AAG>AAC		exophilin 5 isoform a							86.0	83.0	84.0					11																	108412521		2201	4298	6499	SO:0001583	missense	23086				intracellular protein transport		Rab GTPase binding	g.chr11:108412521C>G		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.138G>C	11.37:g.108412521C>G	ENSP00000265843:p.Lys46Asn		Somatic				EXPH5_uc010rwa.1_5'UTR	p.K46N	NM_015065	NP_055880	WXS	Illumina HiSeq	Unspecified	Q8NEV8	EXPH5_HUMAN		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)	2	249	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	46					Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	c.138G>C	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.189054	0.57909	.	.	ENSG00000110723	ENST00000265843;ENST00000525344	T;T	0.02737	4.18;4.18	5.93	2.06	0.26882	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);	0.000000	0.64402	D	0.000013	T	0.10680	0.0261	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00553	-1.1674	10	0.72032	D	0.01	-20.7021	8.1798	0.31305	0.0:0.6123:0.0:0.3877	.	46	Q8NEV8	EXPH5_HUMAN	N	46;39	ENSP00000265843:K46N;ENSP00000432546:K39N	ENSP00000265843:K46N	K	-	3	2	EXPH5	107917731	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	1.008000	0.29872	0.139000	0.18822	-0.194000	0.12790	AAG		0.303	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		4	136	0	0	0	0.000602	0	4	136				
VPS11	55823	broad.mit.edu	37	11	118948942	118948942	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:118948942C>T	ENST00000300793.6	+	12	1860	c.1818C>T	c.(1816-1818)ttC>ttT	p.F606F	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	607					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.F606F(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TGAAAGCCTTCCTAGAGCACA	0.552																																							uc010ryx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1819-1821)TTC>TTT		vacuolar protein sorting 11							150.0	150.0	150.0					11																	118948942		1995	4167	6162	SO:0001819	synonymous_variant	55823				protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding	g.chr11:118948942C>T	AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.1818C>T	11.37:g.118948942C>T			Somatic				VPS11_uc010ryy.1_Silent_p.F453F	p.F607F	NM_021729	NP_068375	WXS	Illumina HiSeq	Unspecified	Q9H270	VPS11_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)	12	1863	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	607					Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Silent	SNP	ENST00000300793.6	37	c.1821C>T																																																																																					0.552	VPS11-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021729		9	267	0	0	0	0.008291	0	9	267				
GRIK4	2900	broad.mit.edu	37	11	120852826	120852826	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:120852826G>C	ENST00000527524.2	+	20	2694	c.2407G>C	c.(2407-2409)Gag>Cag	p.E803Q	GRIK4_ENST00000438375.2_Missense_Mutation_p.E803Q	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	803					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E803Q(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CCTGGGAATGGAGAATATTGG	0.338																																							uc001pxn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2407-2409)GAG>CAG		glutamate receptor KA1 precursor	L-Glutamic Acid(DB00142)						248.0	254.0	252.0					11																	120852826		2203	4299	6502	SO:0001583	missense	2900				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr11:120852826G>C	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2407G>C	11.37:g.120852826G>C	ENSP00000435648:p.Glu803Gln		Somatic				GRIK4_uc009zaw.1_Missense_Mutation_p.E803Q|GRIK4_uc009zax.1_Missense_Mutation_p.E803Q	p.E803Q	NM_014619	NP_055434	WXS	Illumina HiSeq	Unspecified	Q16099	GRIK4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	20	2694	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	803			Extracellular (Potential).		A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	c.2407G>C	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777451	0.70107	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.54866	0.55;0.55	5.6	5.6	0.85130	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	N	0.21617	0.685	0.80722	D	1	D	0.63880	0.993	D	0.64687	0.928	T	0.54410	-0.8298	10	0.27082	T	0.32	.	19.2057	0.93729	0.0:0.0:1.0:0.0	.	803	Q16099	GRIK4_HUMAN	Q	803	ENSP00000435648:E803Q;ENSP00000404063:E803Q	ENSP00000404063:E803Q	E	+	1	0	GRIK4	120358036	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.621000	0.88768	0.655000	0.94253	GAG		0.338	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		6	323	0	0	0	0.001168	0	6	323				
SORL1	6653	broad.mit.edu	37	11	121420743	121420743	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:121420743C>T	ENST00000260197.7	+	15	2255	c.2126C>T	c.(2125-2127)tCa>tTa	p.S709L		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	709					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.S709L(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TCTGGAAAGTCATACTCCCCT	0.473																																							uc001pxx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15						c.(2125-2127)TCA>TTA		sortilin-related receptor containing LDLR class							148.0	139.0	142.0					11																	121420743		2203	4299	6502	SO:0001583	missense	6653				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity	g.chr11:121420743C>T	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2126C>T	11.37:g.121420743C>T	ENSP00000260197:p.Ser709Leu		Somatic					p.S709L	NM_003105	NP_003096	WXS	Illumina HiSeq	Unspecified	Q92673	SORL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)	15	2206	+		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)	709			Extracellular (Potential).		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	c.2126C>T	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135639	0.37728	.	.	ENSG00000137642	ENST00000260197	D	0.91521	-2.86	5.39	5.39	0.77823	VPS10 (1);	0.358117	0.30159	N	0.010280	T	0.72061	0.3414	N	0.00583	-1.355	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70335	-0.4900	10	0.33141	T	0.24	.	12.4943	0.55918	0.0:0.9234:0.0:0.0766	.	709	Q92673	SORL_HUMAN	L	709	ENSP00000260197:S709L	ENSP00000260197:S709L	S	+	2	0	SORL1	120925953	0.988000	0.35896	0.007000	0.13788	0.986000	0.74619	4.267000	0.58877	2.523000	0.85059	0.655000	0.94253	TCA		0.473	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		8	112	0	0	0	0.004482	0	8	112				
KCNJ5	3762	broad.mit.edu	37	11	128781480	128781480	+	Silent	SNP	C	C	T	rs201217363	byFrequency	TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr11:128781480C>T	ENST00000338350.4	+	3	664	c.312C>T	c.(310-312)ttC>ttT	p.F104F	KCNJ5_ENST00000529694.1_Silent_p.F104F|KCNJ5_ENST00000533599.1_Silent_p.F104F			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	104					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.F104F(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	GGCTGTTCTTCGGCTTCATTT	0.527													C|||	4	0.000798722	0.0	0.0029	5008	,	,		20762	0.0		0.0	False		,,,				2504	0.002				Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	uc001qet.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(310-312)TTC>TTT		potassium inwardly-rectifying channel J5	Glibenclamide(DB01016)	C		0,4402		0,0,2201	135.0	126.0	129.0		312	-7.1	0.6	11		129	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	KCNJ5	NM_000890.3		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		104/420	128781480	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	3762				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr11:128781480C>T	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.312C>T	11.37:g.128781480C>T			Somatic				KCNJ5_uc009zck.2_Silent_p.F104F|KCNJ5_uc001qew.2_Silent_p.F104F	p.F104F	NM_000890	NP_000881	WXS	Illumina HiSeq	Unspecified	P48544	IRK5_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	2	626	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	104			Helical; Name=M1; (By similarity).		B2R744|Q6DK13|Q6DK14|Q92807	Silent	SNP	ENST00000338350.4	37	c.312C>T	CCDS8479.1																																																																																				0.527	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890		12	120	0	0	0	0.001855	0	12	120				
GALNT8	26290	broad.mit.edu	37	12	4870202	4870202	+	Missense_Mutation	SNP	G	G	T	rs373419543		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:4870202G>T	ENST00000252318.2	+	7	1589	c.1252G>T	c.(1252-1254)Gcc>Tcc	p.A418S		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	418					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A418S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CAAGCCCTACGCCTTGGATCT	0.537																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1252-1254)GCC>TCC		polypeptide N-acetylgalactosaminyltransferase 8							182.0	143.0	156.0					12																	4870202		2203	4300	6503	SO:0001583	missense	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4870202G>T	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1252G>T	12.37:g.4870202G>T	ENSP00000252318:p.Ala418Ser		Somatic					p.A418S	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			7	1344	+			418			Lumenal (Potential).		B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	c.1252G>T	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	G	5.649	0.304334	0.10678	.	.	ENSG00000130035	ENST00000252318	T	0.57907	0.37	3.27	-1.38	0.09027	.	3.646770	0.01015	N	0.003890	T	0.27663	0.0680	N	0.04724	-0.175	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.09862	-1.0655	10	0.25751	T	0.34	.	1.6224	0.02716	0.1142:0.3087:0.236:0.3411	.	418	Q9NY28	GALT8_HUMAN	S	418	ENSP00000252318:A418S	ENSP00000252318:A418S	A	+	1	0	GALNT8	4740463	0.000000	0.05858	0.093000	0.20910	0.938000	0.57974	-0.736000	0.04882	0.101000	0.17610	0.456000	0.33151	GCC		0.537	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		49	65	1	0	2.9001e-28	0.01441	3.60505e-28	49	65				
TAS2R31	259290	broad.mit.edu	37	12	11183031	11183032	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:11183031_11183032TC>CA	ENST00000390675.2	-	1	974_975	c.903_904GA>TG	c.(901-906)gtGAaa>gtTGaa	p.K302E	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	302					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.K302E(1)		kidney(1)|lung(6)	7						TTCTCTCCTTTCACCCAGTACC	0.411																																							uc001qzo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(901-906)GTGAAA>GTTGAA		taste receptor, type 2, member 31																																				SO:0001583	missense	259290				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11183031_11183032TC>CA	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.903_904delinsCA	12.37:g.11183031_11183032delinsCA	ENSP00000375093:p.Lys302Glu		Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.K302E	NM_176885	NP_795366	WXS	Illumina HiSeq	Unspecified	P59538	T2R31_HUMAN			1	975_976	-			302			Cytoplasmic (Potential).		P59547|Q17R84|Q645X5	Missense_Mutation	DNP	ENST00000390675.2	37	c.903_904GA>TG	CCDS53747.1																																																																																				0.411	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885		7	225	0	0	0	0.004672	0	7	225				
GPRC5A	9052	broad.mit.edu	37	12	13065462	13065462	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:13065462G>C	ENST00000014914.5	+	4	1953	c.1063G>C	c.(1063-1065)Gag>Cag	p.E355Q	GPRC5A_ENST00000542056.1_3'UTR	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	355					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E355Q(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	AGTAAAGAAAGAGGGCAGCTA	0.527																																							uc001rba.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1063-1065)GAG>CAG		G protein-coupled receptor, family C, group 5,	Tretinoin(DB00755)						86.0	90.0	89.0					12																	13065462		2203	4300	6503	SO:0001583	missense	9052					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity	g.chr12:13065462G>C	AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.1063G>C	12.37:g.13065462G>C	ENSP00000014914:p.Glu355Gln		Somatic				uc001rbb.3_5'Flank	p.E355Q	NM_003979	NP_003970	WXS	Illumina HiSeq	Unspecified	Q8NFJ5	RAI3_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0708)	4	1713	+		Prostate(47;0.141)	355			Cytoplasmic (Potential).		B3KV45|O95357	Missense_Mutation	SNP	ENST00000014914.5	37	c.1063G>C	CCDS8657.1	.	.	.	.	.	.	.	.	.	.	G	8.240	0.806568	0.16467	.	.	ENSG00000013588	ENST00000014914	T	0.18657	2.2	4.95	3.99	0.46301	.	1.369740	0.04333	N	0.352777	T	0.13030	0.0316	N	0.14661	0.345	0.22500	N	0.99905	B	0.29432	0.244	B	0.24155	0.051	T	0.29549	-1.0008	10	0.14656	T	0.56	-21.9809	8.0096	0.30344	0.2076:0.0:0.7924:0.0	.	355	Q8NFJ5	RAI3_HUMAN	Q	355	ENSP00000014914:E355Q	ENSP00000014914:E355Q	E	+	1	0	GPRC5A	12956729	0.997000	0.39634	0.826000	0.32828	0.157000	0.22087	2.925000	0.48884	0.951000	0.37770	0.313000	0.20887	GAG		0.527	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1			4	170	0	0	0	0.000602	0	4	170				
KRT75	9119	broad.mit.edu	37	12	52826902	52826902	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:52826902C>T	ENST00000252245.5	-	2	853	c.633G>A	c.(631-633)ctG>ctA	p.L211L		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	211	Coil 1B.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.L211L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		TGATGCTTTCCAGCTGCCGTC	0.557																																							uc001saj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(631-633)CTG>CTA		keratin 75							113.0	108.0	110.0					12																	52826902		2203	4300	6503	SO:0001819	synonymous_variant	9119					keratin filament	structural molecule activity	g.chr12:52826902C>T	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.633G>A	12.37:g.52826902C>T			Somatic					p.L211L	NM_004693	NP_004684	WXS	Illumina HiSeq	Unspecified	O95678	K2C75_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.192)	2	655	-			211			Coil 1B.|Rod.		B4DQU4|Q9NSA9	Silent	SNP	ENST00000252245.5	37	c.633G>A	CCDS8827.1																																																																																				0.557	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693		5	176	0	0	0	0.000602	0	5	176				
SP1	6667	broad.mit.edu	37	12	53777321	53777321	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:53777321G>A	ENST00000327443.4	+	3	1688	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q	SP1_ENST00000426431.2_Silent_p.Q523Q	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	530	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q530Q(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		CAGGCCTCCAGACCATTAACC	0.532																																							uc001scw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(1588-1590)CAG>CAA		Sp1 transcription factor isoform a							139.0	127.0	131.0					12																	53777321		2203	4300	6503	SO:0001819	synonymous_variant	6667				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:53777321G>A	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1590G>A	12.37:g.53777321G>A			Somatic				SP1_uc010sog.1_Silent_p.Q523Q	p.Q530Q	NM_138473	NP_612482	WXS	Illumina HiSeq	Unspecified	P08047	SP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.00527)	3	1687	+			530			Transactivation domain C (highly charged).		E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	ENST00000327443.4	37	c.1590G>A	CCDS8857.1																																																																																				0.532	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1			5	177	0	0	0	0.001984	0	5	177				
PDE1B	5153	broad.mit.edu	37	12	54968907	54968907	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:54968907C>G	ENST00000243052.3	+	11	1526	c.1090C>G	c.(1090-1092)Cta>Gta	p.L364V	PDE1B_ENST00000550620.1_Missense_Mutation_p.L344V|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.L323V	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	364	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.L364V(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GGCCCTGTCTCTACTGCTCCA	0.542																																							uc001sgd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1090-1092)CTA>GTA		phosphodiesterase 1B isoform 1							131.0	118.0	122.0					12																	54968907		2203	4300	6503	SO:0001583	missense	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54968907C>G	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1090C>G	12.37:g.54968907C>G	ENSP00000243052:p.Leu364Val		Somatic				PDE1B_uc010soz.1_Missense_Mutation_p.L227V|PDE1B_uc010spa.1_Missense_Mutation_p.L323V|PDE1B_uc001sgf.2_Missense_Mutation_p.L227V|PDE1B_uc001sge.2_Missense_Mutation_p.L344V|PDE1B_uc009znq.2_Missense_Mutation_p.L160V	p.L364V	NM_000924	NP_000915	WXS	Illumina HiSeq	Unspecified	Q01064	PDE1B_HUMAN			11	1256	+			364			Catalytic (By similarity).		Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	c.1090C>G	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081283	0.76528	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	D;D;D	0.82984	-1.67;-1.67;-1.67	5.25	5.25	0.73442	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.64402	D	0.000011	D	0.87434	0.6176	L	0.55834	1.745	0.80722	D	1	P;P	0.49961	0.914;0.93	P;P	0.58266	0.747;0.836	D	0.86710	0.1935	10	0.44086	T	0.13	.	16.7112	0.85386	0.0:1.0:0.0:0.0	.	344;364	Q01064-2;Q01064	.;PDE1B_HUMAN	V	364;323;344	ENSP00000243052:L364V;ENSP00000442559:L323V;ENSP00000448519:L344V	ENSP00000243052:L364V	L	+	1	2	PDE1B	53255174	0.998000	0.40836	0.190000	0.23270	0.802000	0.45316	3.949000	0.56668	2.618000	0.88619	0.561000	0.74099	CTA		0.542	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			5	135	0	0	0	0.001168	0	5	135				
BAZ2A	11176	broad.mit.edu	37	12	57009066	57009066	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:57009066A>T	ENST00000551812.1	-	3	661	c.468T>A	c.(466-468)agT>agA	p.S156R	BAZ2A_ENST00000179765.5_Missense_Mutation_p.S154R|BAZ2A_ENST00000549884.1_Missense_Mutation_p.S154R|BAZ2A_ENST00000379441.3_Missense_Mutation_p.S156R	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	156					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.S156R(2)|p.S192R(1)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GCCCCATGGGACTCTGGGTAC	0.522																																							uc001slq.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(466-468)AGT>AGA		bromodomain adjacent to zinc finger domain, 2A							63.0	63.0	63.0					12																	57009066		1884	4109	5993	SO:0001583	missense	11176				chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding	g.chr12:57009066A>T	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.468T>A	12.37:g.57009066A>T	ENSP00000446880:p.Ser156Arg		Somatic				BAZ2A_uc001slp.1_Missense_Mutation_p.S154R|BAZ2A_uc010sqr.1_Missense_Mutation_p.S156R|BAZ2A_uc009zow.1_Missense_Mutation_p.S154R	p.S156R	NM_013449	NP_038477	WXS	Illumina HiSeq	Unspecified	Q9UIF9	BAZ2A_HUMAN			3	662	-			156					B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	c.468T>A	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.987862	0.53934	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	4.75	2.36	0.29203	.	0.110120	0.64402	D	0.000010	T	0.19127	0.0459	N	0.24115	0.695	0.31930	N	0.612369	D;D;D	0.69078	0.987;0.997;0.995	P;P;P	0.62184	0.76;0.899;0.795	T	0.15206	-1.0445	10	0.87932	D	0	.	4.2864	0.10857	0.6465:0.1714:0.1821:0.0	.	156;154;156	B7Z8F7;F8VU39;Q9UIF9	.;.;BAZ2A_HUMAN	R	156;154;156;154	ENSP00000368754:S156R;ENSP00000179765:S154R;ENSP00000446880:S156R;ENSP00000447941:S154R	ENSP00000179765:S154R	S	-	3	2	BAZ2A	55295333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.239000	0.32719	0.399000	0.25367	-0.290000	0.09829	AGT		0.522	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449		24	41	0	0	0	0.00333	0	24	41				
INHBE	83729	broad.mit.edu	37	12	57850041	57850041	+	Missense_Mutation	SNP	C	C	T	rs369380744		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:57850041C>T	ENST00000266646.2	+	2	679	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	155					growth (GO:0040007)	extracellular region (GO:0005576)		p.R155C(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						CCAAGGGTCCCGCACTCTCCT	0.602											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)	GBM(191;1808 2166 15720 36624 50371)	uc001snw.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(463-465)CGC>TGC		activin beta E precursor							175.0	166.0	169.0					12																	57850041		2203	4300	6503	SO:0001583	missense	83729				growth	extracellular region	growth factor activity|hormone activity	g.chr12:57850041C>T		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.463C>T	12.37:g.57850041C>T	ENSP00000266646:p.Arg155Cys		Somatic	OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1026		p.R155C	NM_031479	NP_113667	WXS	Illumina HiSeq	Unspecified	P58166	INHBE_HUMAN			2	687	+			155						Missense_Mutation	SNP	ENST00000266646.2	37	c.463C>T	CCDS8939.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313003	0.23908	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	D;T	0.83591	-1.74;-0.22	4.35	2.49	0.30216	Transforming growth factor-beta, N-terminal (1);	0.870841	0.10027	N	0.725225	D	0.85164	0.5634	M	0.61703	1.905	0.19945	N	0.999948	D	0.62365	0.991	P	0.54100	0.742	T	0.72666	-0.4224	10	0.72032	D	0.01	-0.303	7.5832	0.27976	0.0:0.7375:0.1679:0.0946	.	155	P58166	INHBE_HUMAN	C	100;155	ENSP00000450212:R100C;ENSP00000266646:R155C	ENSP00000266646:R155C	R	+	1	0	INHBE	56136308	0.003000	0.15002	0.011000	0.14972	0.241000	0.25554	1.831000	0.39141	0.565000	0.29255	0.655000	0.94253	CGC		0.602	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479		152	238	0	0	0	0.01441	0	152	238				
DDIT3	1649	broad.mit.edu	37	12	57910715	57910715	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:57910715C>G	ENST00000346473.3	-	4	566	c.387G>C	c.(385-387)agG>agC	p.R129S	DDIT3_ENST00000552740.1_Missense_Mutation_p.R152S|DDIT3_ENST00000547303.1_Missense_Mutation_p.R129S|MIR616_ENST00000385293.1_RNA|RN7SL312P_ENST00000582079.1_RNA|DDIT3_ENST00000551116.1_Missense_Mutation_p.R152S	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	129	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.R129S(1)|p.R129R(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GTGCCACTTTCCTTTCATTCT	0.542			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)	GBM(112;1383 1547 7626 23045 28770)	uc001soi.2		NA		Dom	yes		12	12q13.1-q13.2	1649	T	DNA-damage-inducible transcript 3			M	FUS		liposarcoma	FUS/DDIT3(623)|EWSR1/DDIT3(43)	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	soft_tissue(666)|large_intestine(1)|central_nervous_system(1)|lung(1)|skin(1)|ovary(1)	671						c.(385-387)AGG>AGC		DNA-damage-inducible transcript 3							174.0	180.0	178.0					12																	57910715		2203	4300	6503	SO:0001583	missense	1649				cell cycle arrest|cell redox homeostasis|mRNA transcription from RNA polymerase II promoter|negative regulation of determination of dorsal identity|regulation of DNA-dependent transcription in response to stress|response to DNA damage stimulus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding	g.chr12:57910715C>G	BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.387G>C	12.37:g.57910715C>G	ENSP00000340671:p.Arg129Ser		Somatic				MARS_uc001sof.1_Intron|DDIT3_uc009zps.2_Missense_Mutation_p.R152S|DDIT3_uc009zpt.2_Missense_Mutation_p.R152S	p.R129S	NM_004083	NP_004074	WXS	Illumina HiSeq	Unspecified	P35638	DDIT3_HUMAN			4	567	-			129					F8VS99	Missense_Mutation	SNP	ENST00000346473.3	37	c.387G>C	CCDS8943.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.780785	0.70222	.	.	ENSG00000175197	ENST00000547303;ENST00000551116;ENST00000346473;ENST00000552740	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.75	1.43	0.22495	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.439429	0.24933	N	0.034456	T	0.23727	0.0574	N	0.19112	0.55	0.45056	D	0.998077	P;B	0.42692	0.787;0.192	B;B	0.36666	0.23;0.133	T	0.04840	-1.0923	10	0.72032	D	0.01	-7.6818	8.7254	0.34467	0.0:0.5434:0.3064:0.1502	.	152;129	F8VS99;P35638	.;DDIT3_HUMAN	S	129;152;129;152	ENSP00000447188:R129S;ENSP00000448665:R152S;ENSP00000340671:R129S;ENSP00000447803:R152S	ENSP00000340671:R129S	R	-	3	2	DDIT3	56196982	0.896000	0.30565	0.835000	0.33067	0.944000	0.59088	0.783000	0.26802	0.445000	0.26639	0.655000	0.94253	AGG		0.542	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083		4	272	0	0	0	0.009096	0	4	272				
CCT2	10576	broad.mit.edu	37	12	69993722	69993722	+	Silent	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:69993722G>C	ENST00000299300.6	+	15	1703	c.1515G>C	c.(1513-1515)ctG>ctC	p.L505L	CCT2_ENST00000543146.2_Silent_p.L458L|CCT2_ENST00000544368.2_Intron	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	505					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.L505L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			AGGTTCTTCTGAGTGCAGCTG	0.433																																							uc001svb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1513-1515)CTG>CTC		chaperonin containing TCP1, subunit 2							84.0	79.0	81.0					12																	69993722		2203	4300	6503	SO:0001819	synonymous_variant	10576				'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding	g.chr12:69993722G>C	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.1515G>C	12.37:g.69993722G>C			Somatic				CCT2_uc009zrm.1_RNA|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Silent_p.L458L	p.L505L	NM_006431	NP_006422	WXS	Illumina HiSeq	Unspecified	P78371	TCPB_HUMAN	Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		15	1609	+	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		505					A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Silent	SNP	ENST00000299300.6	37	c.1515G>C	CCDS8991.1																																																																																				0.433	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403818.1	NM_006431		5	84	0	0	0	0.001168	0	5	84				
ACTR6	64431	broad.mit.edu	37	12	100606231	100606231	+	Silent	SNP	G	G	A	rs372894060		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:100606231G>A	ENST00000188312.2	+	8	1440	c.675G>A	c.(673-675)ttG>ttA	p.L225L	ACTR6_ENST00000546902.1_Silent_p.L143L|ACTR6_ENST00000552376.1_Silent_p.L225L|ACTR6_ENST00000551617.1_Silent_p.L143L	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	225						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.L225L(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TTTCCAGGTTGAAAGGAGAAG	0.299																																							uc001thb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(673-675)TTG>TTA		ARP6 actin-related protein 6 homolog		G		0,4406		0,0,2203	71.0	76.0	74.0		675	3.4	1.0	12		74	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ACTR6	NM_022496.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		225/397	100606231	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	64431					cytoplasm|cytoskeleton		g.chr12:100606231G>A	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.675G>A	12.37:g.100606231G>A			Somatic				ACTR6_uc001thc.1_Silent_p.L117L|ACTR6_uc001thd.1_Silent_p.L225L|ACTR6_uc009ztu.1_Silent_p.L30L|ACTR6_uc001the.1_Silent_p.L143L|ACTR6_uc001thf.1_Silent_p.L143L|uc001thg.1_Intron	p.L225L	NM_022496	NP_071941	WXS	Illumina HiSeq	Unspecified	Q9GZN1	ARP6_HUMAN			8	731	+			225					B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Silent	SNP	ENST00000188312.2	37	c.675G>A	CCDS9074.1																																																																																				0.299	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496		4	119	0	0	0	0.009096	0	4	119				
DEPDC4	120863	broad.mit.edu	37	12	100649949	100649949	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:100649949G>C	ENST00000416321.1	-	4	758	c.756C>G	c.(754-756)ttC>ttG	p.F252L	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	252					intracellular signal transduction (GO:0035556)			p.F252L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TATTGTCCAAGAATGGAAGGT	0.323																																							uc001thi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(754-756)TTC>TTG		DEP domain containing 4							132.0	121.0	125.0					12																	100649949		2203	4298	6501	SO:0001583	missense	120863				intracellular signal transduction			g.chr12:100649949G>C	AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.756C>G	12.37:g.100649949G>C	ENSP00000396234:p.Phe252Leu		Somatic				DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.F198L|DEPDC4_uc009ztv.1_Missense_Mutation_p.F252L|DEPDC4_uc001thk.1_Missense_Mutation_p.F63L|DEPDC4_uc001thl.1_RNA	p.F252L	NM_152317	NP_689530	WXS	Illumina HiSeq	Unspecified	Q8N2C3	DEPD4_HUMAN			4	759	-			252					Q496C8|Q96BW0	Missense_Mutation	SNP	ENST00000416321.1	37	c.756C>G	CCDS9075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.996|8.996	0.978795|0.978795	0.18812|0.18812	.|.	.|.	ENSG00000166153|ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642|ENST00000548313	T;T;T;T|.	0.26810|.	1.78;1.71;1.85;1.79|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.418272|.	0.24217|.	N|.	0.040472|.	T|T	0.35307|0.35307	0.0927|0.0927	L|L	0.34521|0.34521	1.04|1.04	0.21105|0.21105	N|N	0.999786|0.999786	B;B;B;B|.	0.18310|.	0.005;0.01;0.027;0.004|.	B;B;B;B|.	0.10450|.	0.002;0.005;0.003;0.003|.	T|T	0.21211|0.21211	-1.0252|-1.0252	10|5	0.05721|.	T|.	0.95|.	.|.	7.5873|7.5873	0.27999|0.27999	0.0886:0.1684:0.7431:0.0|0.0886:0.1684:0.7431:0.0	.|.	252;252;198;252|.	E9PGM3;A4FU15;Q3ZCN8;Q8N2C3|.	.;.;.;DEPD4_HUMAN|.	L|C	252;198;252;252;198;245|63	ENSP00000396234:F252L;ENSP00000448385:F252L;ENSP00000448338:F198L;ENSP00000449590:F245L|.	ENSP00000367490:F252L|.	F|S	-|-	3|2	2|0	DEPDC4|DEPDC4	99174080|99174080	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.550000|0.550000	0.35303|0.35303	1.632000|1.632000	0.37102|0.37102	2.398000|2.398000	0.81561|0.81561	0.514000|0.514000	0.50259|0.50259	TTC|TCT		0.323	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317		4	83	0	0	0	0.009096	0	4	83				
ARPC3	10094	broad.mit.edu	37	12	110874419	110874419	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr12:110874419C>G	ENST00000228825.7	-	5	468	c.322G>C	c.(322-324)Gag>Cag	p.E108Q	RP11-478C19.2_ENST00000550231.1_RNA	NM_001278556.1|NM_005719.2	NP_001265485.1|NP_005710.1	O15145	ARPC3_HUMAN	actin related protein 2/3 complex, subunit 3, 21kDa	108					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)	p.E108Q(1)		lung(1)|ovary(1)	2						AAACCAGGCTCTCCAGGAATG	0.373																																							uc001tqq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(322-324)GAG>CAG		actin related protein 2/3 complex subunit 3							160.0	148.0	152.0					12																	110874419		2203	4300	6503	SO:0001583	missense	10094				cellular component movement|regulation of actin filament polymerization	Arp2/3 protein complex|cytoplasm	actin binding|structural constituent of cytoskeleton	g.chr12:110874419C>G	AF006086	CCDS9146.1	12q24	2011-07-06	2002-08-29		ENSG00000111229	ENSG00000111229		"""Actin related protein 2/3 complex subunits"""	706	protein-coding gene	gene with protein product		604225	"""actin related protein 2/3 complex, subunit 3 (21 kD)"""			9230079, 9359840	Standard	NM_001278556		Approved	p21-Arc, ARC21	uc001tqq.3	O15145	OTTHUMG00000134333	ENST00000228825.7:c.322G>C	12.37:g.110874419C>G	ENSP00000228825:p.Glu108Gln		Somatic					p.E108Q	NM_005719	NP_005710	WXS	Illumina HiSeq	Unspecified	O15145	ARPC3_HUMAN			5	415	-			108					O00554	Missense_Mutation	SNP	ENST00000228825.7	37	c.322G>C	CCDS9146.1	.	.	.	.	.	.	.	.	.	.	C	34	5.321363	0.95682	.	.	ENSG00000111229	ENST00000228825;ENST00000392683	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77909	0.4201	M	0.64567	1.98	0.80722	D	1	D	0.69078	0.997	D	0.65987	0.94	T	0.78163	-0.2311	9	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	108	O15145	ARPC3_HUMAN	Q	108	.	ENSP00000228825:E108Q	E	-	1	0	ARPC3	109358802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.444000	0.80532	2.824000	0.97209	0.655000	0.94253	GAG		0.373	ARPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259487.2			4	253	0	0	0	0.000602	0	4	253				
SKA3	221150	broad.mit.edu	37	13	21742491	21742491	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:21742491C>G	ENST00000314759.5	-	4	503	c.379G>C	c.(379-381)Gaa>Caa	p.E127Q	SKA3_ENST00000400018.3_Missense_Mutation_p.E127Q	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	127					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)		p.E127Q(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						TGAAAATTTTCACAATTAGAC	0.393																																							uc001unt.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(379-381)GAA>CAA		SKA3							63.0	69.0	67.0					13																	21742491		2203	4300	6503	SO:0001583	missense	221150				cell division|chromosome segregation|mitosis|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytoplasm|spindle microtubule	protein binding	g.chr13:21742491C>G	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.379G>C	13.37:g.21742491C>G	ENSP00000319417:p.Glu127Gln		Somatic				SKA3_uc001unv.2_Missense_Mutation_p.E45Q|SKA3_uc001unu.2_Missense_Mutation_p.E127Q	p.E127Q	NM_145061	NP_659498	WXS	Illumina HiSeq	Unspecified	Q8IX90	SKA3_HUMAN			4	473	-			127					A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Missense_Mutation	SNP	ENST00000314759.5	37	c.379G>C	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.832064	0.32421	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	T;T	0.24723	1.84;1.84	5.88	2.19	0.27852	.	0.641937	0.16351	N	0.218227	T	0.20251	0.0487	L	0.44542	1.39	0.09310	N	1	D;D	0.53462	0.96;0.96	B;B	0.43103	0.408;0.408	T	0.09400	-1.0676	10	0.27785	T	0.31	-2.0306	7.7628	0.28961	0.0:0.5844:0.0:0.4156	.	127;127	Q8IX90-3;Q8IX90	.;SKA3_HUMAN	Q	127	ENSP00000319417:E127Q;ENSP00000382896:E127Q	ENSP00000319417:E127Q	E	-	1	0	SKA3	20640491	0.018000	0.18449	0.002000	0.10522	0.016000	0.09150	1.138000	0.31491	0.570000	0.29347	0.655000	0.94253	GAA		0.393	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061		3	115	0	0	0	0.009096	0	3	115				
CENPJ	55835	broad.mit.edu	37	13	25480067	25480067	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:25480067G>C	ENST00000381884.4	-	7	2294	c.2109C>G	c.(2107-2109)agC>agG	p.S703R	CENPJ_ENST00000545981.1_Missense_Mutation_p.S703R	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	703					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.S703R(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CAGAGTCAGTGCTACTGTCAC	0.463																																							uc001upt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2107-2109)AGC>AGG		centromere protein J							142.0	129.0	133.0					13																	25480067		2203	4300	6503	SO:0001583	missense	55835				cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding	g.chr13:25480067G>C	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2109C>G	13.37:g.25480067G>C	ENSP00000371308:p.Ser703Arg		Somatic				CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_5'Flank	p.S703R	NM_018451	NP_060921	WXS	Illumina HiSeq	Unspecified	Q9HC77	CENPJ_HUMAN		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)	7	2362	-		Lung SC(185;0.0225)|Breast(139;0.0602)	703					Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	c.2109C>G	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813763	0.32053	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.38240	1.15;1.71	5.78	3.14	0.36123	.	0.372729	0.29956	N	0.010777	T	0.44030	0.1274	M	0.75447	2.3	0.22745	N	0.998789	P	0.49961	0.93	P	0.50440	0.641	T	0.29971	-0.9994	10	0.25751	T	0.34	.	8.9677	0.35887	0.2342:0.0:0.7658:0.0	.	703	Q9HC77	CENPJ_HUMAN	R	703	ENSP00000371308:S703R;ENSP00000441090:S703R	ENSP00000371308:S703R	S	-	3	2	CENPJ	24378067	0.021000	0.18746	0.510000	0.27712	0.280000	0.26924	0.919000	0.28692	0.361000	0.24292	-0.136000	0.14681	AGC		0.463	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		4	118	0	0	0	0.000602	0	4	118				
BRCA2	675	broad.mit.edu	37	13	32913027	32913027	+	Missense_Mutation	SNP	G	G	A	rs80358685|rs397507723|rs397507724		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:32913027G>A	ENST00000380152.3	+	11	4768	c.4535G>A	c.(4534-4536)cGt>cAt	p.R1512H	BRCA2_ENST00000544455.1_Missense_Mutation_p.R1512H			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1512	Interaction with POLH.|Required for stimulation of POLH DNA polymerization activity.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.R1512H(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CAACCCGAACGTGATGAAAAG	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		2	Substitution - Missense(2)		lung(2)	ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64	GRCh37	CD063459	BRCA2	D	rs80358685	c.(4534-4536)CGT>CAT	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							60.0	63.0	62.0					13																	32913027		2202	4297	6499	SO:0001583	missense	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32913027G>A	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4535G>A	13.37:g.32913027G>A	ENSP00000369497:p.Arg1512His	TCGA Ovarian(8;0.087)	Somatic					p.R1512H	NM_000059	NP_000050	WXS	Illumina HiSeq	Unspecified	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	11	4762	+		Lung SC(185;0.0262)	1512					O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	c.4535G>A	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.210645	0.01555	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00682	5.86;5.86	5.74	0.401	0.16338	.	0.994938	0.08162	N	0.988418	T	0.00496	0.0016	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44112	-0.9349	10	0.15499	T	0.54	.	4.6204	0.12447	0.4438:0.0:0.3493:0.207	.	1512	P51587	BRCA2_HUMAN	H	1512	ENSP00000369497:R1512H;ENSP00000439902:R1512H	ENSP00000369497:R1512H	R	+	2	0	BRCA2	31811027	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-0.425000	0.07017	0.085000	0.17107	0.563000	0.77884	CGT		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		4	58	0	0	0	0.009096	0	4	58				
RCBTB1	55213	broad.mit.edu	37	13	50123709	50123709	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:50123709C>G	ENST00000378302.2	-	9	1190	c.930G>C	c.(928-930)tgG>tgC	p.W310C	RCBTB1_ENST00000258646.3_Missense_Mutation_p.W310C|RCBTB1_ENST00000546015.1_Missense_Mutation_p.W310C	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	310					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W310C(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GGCACTGGCCCCACATGTACA	0.592																																							uc001vde.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(928-930)TGG>TGC		regulator of chromosome condensation (RCC1) and							88.0	69.0	76.0					13																	50123709		2203	4300	6503	SO:0001583	missense	55213				cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chr13:50123709C>G	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.930G>C	13.37:g.50123709C>G	ENSP00000367552:p.Trp310Cys		Somatic					p.W310C	NM_018191	NP_060661	WXS	Illumina HiSeq	Unspecified	Q8NDN9	RCBT1_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)	9	1191	-		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	310			RCC1 6.		Q8IY29|Q969U9	Missense_Mutation	SNP	ENST00000378302.2	37	c.930G>C	CCDS9418.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341609	0.81911	.	.	ENSG00000136144	ENST00000258646;ENST00000378302;ENST00000546015	D;D;D	0.85955	-2.05;-2.05;-2.05	5.15	5.15	0.70609	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.93054	0.7789	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93995	0.7270	10	0.87932	D	0	-8.7043	18.6263	0.91340	0.0:1.0:0.0:0.0	.	310	Q8NDN9	RCBT1_HUMAN	C	310	ENSP00000258646:W310C;ENSP00000367552:W310C;ENSP00000443293:W310C	ENSP00000258646:W310C	W	-	3	0	RCBTB1	49021710	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.394000	0.81467	0.462000	0.41574	TGG		0.592	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191		11	51	0	0	0	0.010729	0	11	51				
KLF12	11278	broad.mit.edu	37	13	74387368	74387368	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:74387368C>T	ENST00000377669.2	-	4	753	c.727G>A	c.(727-729)Gat>Aat	p.D243N	KLF12_ENST00000377666.4_Missense_Mutation_p.D243N|KLF12_ENST00000472022.1_5'UTR	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	243					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.D243N(1)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		GGCAGGTCATCATCATCACTG	0.438																																							uc001vjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(727-729)GAT>AAT		Kruppel-like factor 12							258.0	222.0	234.0					13																	74387368		2203	4300	6503	SO:0001583	missense	11278				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr13:74387368C>T	AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.727G>A	13.37:g.74387368C>T	ENSP00000366897:p.Asp243Asn		Somatic				KLF12_uc010aeq.2_Missense_Mutation_p.D243N|KLF12_uc001vjg.3_Missense_Mutation_p.D243N	p.D243N	NM_007249	NP_009180	WXS	Illumina HiSeq	Unspecified	Q9Y4X4	KLF12_HUMAN		GBM - Glioblastoma multiforme(99;0.00677)	5	949	-		Prostate(6;0.00217)|Breast(118;0.0838)	243					A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	ENST00000377669.2	37	c.727G>A	CCDS9449.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312631	0.95655	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.05580	3.42;3.42	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.28586	-1.0039	10	0.17369	T	0.5	.	18.6836	0.91556	0.0:1.0:0.0:0.0	.	243	Q9Y4X4	KLF12_HUMAN	N	243	ENSP00000366897:D243N;ENSP00000366894:D243N	ENSP00000344057:D243N	D	-	1	0	KLF12	73285369	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.721000	0.93114	0.655000	0.94253	GAT		0.438	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249		6	141	0	0	0	0.001984	0	6	141				
FBXL3	26224	broad.mit.edu	37	13	77589622	77589622	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:77589622G>C	ENST00000355619.5	-	4	889	c.565C>G	c.(565-567)Ctc>Gtc	p.L189V	FBXL3_ENST00000477982.1_5'UTR	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	189					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L189V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		AGTACTTTGAGAGATGGATCA	0.413																																							uc001vkd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(565-567)CTC>GTC		F-box and leucine-rich repeat protein 3							146.0	129.0	135.0					13																	77589622		2203	4300	6503	SO:0001583	missense	26224				regulation of circadian rhythm|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr13:77589622G>C	AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.565C>G	13.37:g.77589622G>C	ENSP00000347834:p.Leu189Val		Somatic					p.L189V	NM_012158	NP_036290	WXS	Illumina HiSeq	Unspecified	Q9UKT7	FBXL3_HUMAN		GBM - Glioblastoma multiforme(99;0.0521)	4	936	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)	189			LRR 2.		B2RB04|Q9P122	Missense_Mutation	SNP	ENST00000355619.5	37	c.565C>G	CCDS9457.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882368	0.91740	.	.	ENSG00000005812	ENST00000355619;ENST00000417323	T;T	0.52983	0.64;0.64	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.61578	0.2358	M	0.64997	1.995	0.80722	D	1	D	0.62365	0.991	P	0.53593	0.73	T	0.58891	-0.7556	10	0.48119	T	0.1	-10.4939	20.5827	0.99408	0.0:0.0:1.0:0.0	.	189	Q9UKT7	FBXL3_HUMAN	V	189;141	ENSP00000347834:L189V;ENSP00000412183:L141V	ENSP00000347834:L189V	L	-	1	0	FBXL3	76487623	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.430000	0.73391	2.941000	0.99782	0.655000	0.94253	CTC		0.413	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045312.3			21	116	0	0	0	0.00278	0	21	116				
ABCC4	10257	broad.mit.edu	37	13	95735399	95735399	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:95735399G>C	ENST00000376887.4	-	21	2795	c.2681C>G	c.(2680-2682)tCt>tGt	p.S894C	ABCC4_ENST00000412704.1_Missense_Mutation_p.S847C	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	894	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.S894C(2)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CTCACTTGTAGATTCCAGGCG	0.428																																							uc001vmd.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|skin(1)	4						c.(2680-2682)TCT>TGT		ATP-binding cassette, sub-family C, member 4	Cefazolin(DB01327)						82.0	88.0	86.0					13																	95735399		2203	4300	6503	SO:0001583	missense	10257				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity	g.chr13:95735399G>C	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.2681C>G	13.37:g.95735399G>C	ENSP00000366084:p.Ser894Cys		Somatic				ABCC4_uc010afk.2_Missense_Mutation_p.S847C	p.S894C	NM_005845	NP_005836	WXS	Illumina HiSeq	Unspecified	O15439	MRP4_HUMAN			21	2800	-	all_neural(89;0.0878)|Medulloblastoma(90;0.163)		894			ABC transmembrane type-1 2.		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	37	c.2681C>G	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129912	0.37630	.	.	ENSG00000125257	ENST00000412704;ENST00000376887	D;D	0.90324	-2.65;-2.65	5.29	5.29	0.74685	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.100066	0.64402	D	0.000001	D	0.90796	0.7110	M	0.71871	2.18	0.80722	D	1	B;B	0.20459	0.007;0.045	B;B	0.26693	0.017;0.072	D	0.87427	0.2386	10	0.40728	T	0.16	.	18.9106	0.92483	0.0:0.0:1.0:0.0	.	847;894	O15439-2;O15439	.;MRP4_HUMAN	C	847;894	ENSP00000388657:S847C;ENSP00000366084:S894C	ENSP00000366084:S894C	S	-	2	0	ABCC4	94533400	1.000000	0.71417	0.862000	0.33874	0.480000	0.33159	5.160000	0.64929	2.622000	0.88805	0.563000	0.77884	TCT		0.428	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845		4	125	0	0	0	0.000602	0	4	125				
ATP11A	23250	broad.mit.edu	37	13	113514624	113514624	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr13:113514624G>A	ENST00000487903.1	+	24	2839	c.2751G>A	c.(2749-2751)ctG>ctA	p.L917L	ATP11A_ENST00000283558.8_Silent_p.L917L|ATP11A_ENST00000375630.2_Silent_p.L917L|ATP11A_ENST00000375645.3_Silent_p.L917L			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	917					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L917L(2)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CCGCGTATCTGACCCTCTACA	0.468																																							uc001vsi.3		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|ovary(2)	4						c.(2749-2751)CTG>CTA		ATPase, class VI, type 11A isoform a							234.0	202.0	213.0					13																	113514624		2203	4300	6503	SO:0001819	synonymous_variant	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113514624G>A	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2751G>A	13.37:g.113514624G>A			Somatic				ATP11A_uc001vsj.3_Silent_p.L917L|ATP11A_uc001vsm.1_Silent_p.L793L|ATP11A_uc010ago.2_Intron	p.L917L	NM_015205	NP_056020	WXS	Illumina HiSeq	Unspecified	P98196	AT11A_HUMAN			24	2839	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	917			Helical; (Potential).		Q5VXT2	Silent	SNP	ENST00000487903.1	37	c.2751G>A	CCDS32011.1																																																																																				0.468	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		6	194	0	0	0	0.001984	0	6	194				
COCH	1690	broad.mit.edu	37	14	31349863	31349863	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:31349863G>A	ENST00000396618.3	+	8	608	c.552G>A	c.(550-552)caG>caA	p.Q184Q	COCH_ENST00000460581.2_Silent_p.Q72Q|RP11-829H16.3_ENST00000555108.1_RNA|COCH_ENST00000216361.4_Silent_p.Q184Q|COCH_ENST00000382493.4_5'UTR|COCH_ENST00000475087.1_Silent_p.Q184Q	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	184	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.Q184Q(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TTAATTTACAGAAGAATTTTG	0.418																																							uc001wqr.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(550-552)CAG>CAA		cochlin precursor							100.0	112.0	108.0					14																	31349863		2203	4300	6503	SO:0001819	synonymous_variant	1690				sensory perception of sound	proteinaceous extracellular matrix		g.chr14:31349863G>A		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.552G>A	14.37:g.31349863G>A			Somatic				COCH_uc001wqp.2_Silent_p.Q184Q|COCH_uc001wqq.3_Silent_p.Q184Q|uc001wqs.2_Intron|COCH_uc001wqt.1_5'UTR	p.Q184Q	NM_004086	NP_004077	WXS	Illumina HiSeq	Unspecified	O43405	COCH_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)	8	632	+	Hepatocellular(127;0.0877)|Breast(36;0.148)		184			VWFA 1.		A8K9K9|D3DS84|Q96IU6	Silent	SNP	ENST00000396618.3	37	c.552G>A	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236986	0.22711	.	.	ENSG00000100473	ENST00000468826	.	.	.	5.56	4.66	0.58398	.	.	.	.	.	T	0.70518	0.3233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69143	-0.5223	4	.	.	.	-8.5599	14.805	0.69945	0.0704:0.0:0.9296:0.0	.	.	.	.	K	24	.	.	R	+	2	0	COCH	30419614	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.779000	0.85648	2.595000	0.87683	0.650000	0.86243	AGA		0.418	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086		5	257	0	0	0	0.001168	0	5	257				
NEMF	9147	broad.mit.edu	37	14	50267175	50267175	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:50267175C>G	ENST00000298310.5	-	23	2784	c.2335G>C	c.(2335-2337)Gat>Cat	p.D779H	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000545773.1_Missense_Mutation_p.D737H|NEMF_ENST00000546046.1_Missense_Mutation_p.D758H			O60524	NEMF_HUMAN	nuclear export mediator factor	779					nuclear export (GO:0051168)	nucleus (GO:0005634)		p.D779H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						ATGGTAGTATCAGGATAATTT	0.348																																							uc001wxc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2335-2337)GAT>CAT		serologically defined colon cancer antigen 1							128.0	111.0	117.0					14																	50267175		2203	4299	6502	SO:0001583	missense	9147					cytoplasm|nucleus		g.chr14:50267175C>G	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.2335G>C	14.37:g.50267175C>G	ENSP00000298310:p.Asp779His		Somatic				SDCCAG1_uc010anj.1_Missense_Mutation_p.D779H|SDCCAG1_uc001wwz.2_5'Flank|SDCCAG1_uc001wxa.2_Missense_Mutation_p.D59H|SDCCAG1_uc010tqi.1_Missense_Mutation_p.D758H|SDCCAG1_uc001wxe.2_Missense_Mutation_p.D737H|SDCCAG1_uc001wxd.1_Missense_Mutation_p.D184H	p.D779H	NM_004713	NP_004704	WXS	Illumina HiSeq	Unspecified	O60524	NEMF_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)	23	2403	-	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)	779					A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	c.2335G>C	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024359	0.75390	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.51574	0.71;0.73;0.7;0.73	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.987;0.997;0.992;0.985	T	0.74349	-0.3694	10	0.72032	D	0.01	-20.3646	17.938	0.89018	0.0:1.0:0.0:0.0	.	758;754;737;779	O60524-3;O60524-5;O60524-4;O60524	.;.;.;NEMF_HUMAN	H	779;737;758;551;737	ENSP00000298310:D779H;ENSP00000438309:D737H;ENSP00000441016:D758H;ENSP00000452540:D737H	ENSP00000298310:D779H	D	-	1	0	NEMF	49336925	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.663000	0.68038	2.534000	0.85438	0.460000	0.39030	GAT		0.348	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713		3	105	0	0	0	0.004672	0	3	105				
SIPA1L1	26037	broad.mit.edu	37	14	72152196	72152196	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:72152196G>T	ENST00000555818.1	+	10	3570	c.3222G>T	c.(3220-3222)aaG>aaT	p.K1074N	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.K1074N|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.K1074N|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.K549N	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1074					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.K1074N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACGCCAGCAAGGGGCCTCATT	0.507																																							uc001xms.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(3220-3222)AAG>AAT		signal-induced proliferation-associated 1 like							66.0	65.0	65.0					14																	72152196		2203	4300	6503	SO:0001583	missense	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72152196G>T	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3222G>T	14.37:g.72152196G>T	ENSP00000450832:p.Lys1074Asn		Somatic				SIPA1L1_uc001xmt.2_Missense_Mutation_p.K1074N|SIPA1L1_uc001xmu.2_Missense_Mutation_p.K1074N|SIPA1L1_uc001xmv.2_Missense_Mutation_p.K1074N|SIPA1L1_uc010ttm.1_Missense_Mutation_p.K549N	p.K1074N	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	10	3570	+			1074					J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	c.3222G>T	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987316	0.35036	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;D	0.84660	-1.04;-1.04;-1.04;-1.88	5.48	0.472	0.16758	.	0.156951	0.64402	D	0.000017	T	0.73171	0.3553	L	0.36672	1.1	0.35362	D	0.788273	P;B;B;B;B	0.36392	0.551;0.148;0.146;0.214;0.281	B;B;B;B;B	0.33121	0.158;0.04;0.09;0.104;0.025	T	0.68815	-0.5309	10	0.21014	T	0.42	-28.4977	9.899	0.41335	0.4116:0.0:0.5884:0.0	.	549;1074;549;1074;1074	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	N	1074;1074;1074;549	ENSP00000370630:K1074N;ENSP00000450832:K1074N;ENSP00000351352:K1074N;ENSP00000440682:K549N	ENSP00000351352:K1074N	K	+	3	2	SIPA1L1	71221949	1.000000	0.71417	0.978000	0.43139	0.801000	0.45260	1.126000	0.31344	0.097000	0.17492	0.561000	0.74099	AAG		0.507	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		86	56	1	0	5.02048e-33	0.01441	6.27949e-33	86	56				
SERPINA4	5267	broad.mit.edu	37	14	95033575	95033575	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:95033575G>A	ENST00000557004.1	+	3	1339	c.918G>A	c.(916-918)cgG>cgA	p.R306R	SERPINA4_ENST00000298841.5_Silent_p.R306R|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000555095.1_Silent_p.R306R			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	306					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R306R(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		ACTTGTTGCGGAAGAGGTAAT	0.438																																							uc001ydk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(916-918)CGG>CGA		serine (or cysteine) proteinase inhibitor, clade							79.0	80.0	79.0					14																	95033575		2203	4300	6503	SO:0001819	synonymous_variant	5267				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chr14:95033575G>A	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.918G>A	14.37:g.95033575G>A			Somatic				SERPINA4_uc010avd.2_Silent_p.R343R|SERPINA4_uc001ydl.2_Silent_p.R306R	p.R306R	NM_006215	NP_006206	WXS	Illumina HiSeq	Unspecified	P29622	KAIN_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	3	984	+			306					Q53XB5|Q86TR9|Q96BZ5	Silent	SNP	ENST00000557004.1	37	c.918G>A	CCDS9927.1																																																																																				0.438	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		4	114	0	0	0	0.000602	0	4	114				
AHNAK2	113146	broad.mit.edu	37	14	105413013	105413013	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:105413013C>T	ENST00000333244.5	-	7	8894	c.8775G>A	c.(8773-8775)ctG>ctA	p.L2925L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2925						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L2925L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGGCCTTTCAGGTCCAGCT	0.632																																							uc010axc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(8773-8775)CTG>CTA		AHNAK nucleoprotein 2							131.0	146.0	141.0					14																	105413013		1880	4100	5980	SO:0001819	synonymous_variant	113146					nucleus		g.chr14:105413013C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8775G>A	14.37:g.105413013C>T			Somatic				AHNAK2_uc001ypx.2_Silent_p.L2825L	p.L2925L	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	8895	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2925					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	c.8775G>A	CCDS45177.1																																																																																				0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		16	388	0	0	0	0.004007	0	16	388				
AHNAK2	113146	broad.mit.edu	37	14	105413043	105413043	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr14:105413043C>G	ENST00000333244.5	-	7	8864	c.8745G>C	c.(8743-8745)caG>caC	p.Q2915H	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2915						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.Q2915H(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGACGTCTATCTGGGGGCCCT	0.652																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(8743-8745)CAG>CAC		AHNAK nucleoprotein 2							142.0	158.0	153.0					14																	105413043		1863	4084	5947	SO:0001583	missense	113146					nucleus		g.chr14:105413043C>G	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8745G>C	14.37:g.105413043C>G	ENSP00000353114:p.Gln2915His		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.Q2815H	p.Q2915H	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	8865	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2915					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.8745G>C	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	2.935	-0.220135	0.06061	.	.	ENSG00000185567	ENST00000333244	T	0.00760	5.73	4.01	1.58	0.23477	.	.	.	.	.	T	0.00637	0.0021	N	0.19112	0.55	0.09310	N	1	B	0.20261	0.043	B	0.21546	0.035	T	0.47156	-0.9139	9	0.37606	T	0.19	.	4.4566	0.11645	0.0:0.5467:0.22:0.2333	.	2915	Q8IVF2	AHNK2_HUMAN	H	2915	ENSP00000353114:Q2915H	ENSP00000353114:Q2915H	Q	-	3	2	AHNAK2	104484088	0.000000	0.05858	0.206000	0.23566	0.009000	0.06853	-0.481000	0.06552	0.637000	0.30526	0.306000	0.20318	CAG		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		17	420	0	0	0	0.006122	0	17	420				
GABRB3	2562	broad.mit.edu	37	15	26793029	26793029	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:26793029C>T	ENST00000311550.5	-	9	1444	c.1333G>A	c.(1333-1335)Gtg>Atg	p.V445M	GABRB3_ENST00000299267.4_Missense_Mutation_p.V445M|GABRB3_ENST00000545868.1_Missense_Mutation_p.V360M|GABRB3_ENST00000541819.2_Missense_Mutation_p.V501M|GABRB3_ENST00000400188.3_Missense_Mutation_p.V374M	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	445					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.V445M(2)|p.V501M(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGGCATTCACATCGGTTAGA	0.453																																							uc001zaz.2		NA																	3	Substitution - Missense(3)		lung(3)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(1333-1335)GTG>ATG		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						124.0	102.0	109.0					15																	26793029		2203	4300	6503	SO:0001583	missense	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26793029C>T		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1333G>A	15.37:g.26793029C>T	ENSP00000308725:p.Val445Met		Somatic				GABRB3_uc010uae.1_Missense_Mutation_p.V360M|GABRB3_uc001zba.2_Missense_Mutation_p.V445M|GABRB3_uc001zbb.2_Missense_Mutation_p.V501M	p.V445M	NM_000814	NP_000805	WXS	Illumina HiSeq	Unspecified	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	9	1475	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	445			Cytoplasmic (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	c.1333G>A	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243842	0.79912	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	6.03	6.03	0.97812	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94948	0.8366	M	0.89715	3.055	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.72982	0.979;0.974;0.972	D	0.95025	0.8164	10	0.72032	D	0.01	.	19.545	0.95291	0.0:1.0:0.0:0.0	.	501;445;445	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	M	445;501;445;374;360	ENSP00000308725:V445M;ENSP00000442408:V501M;ENSP00000299267:V445M;ENSP00000383049:V374M;ENSP00000439169:V360M	ENSP00000299267:V445M	V	-	1	0	GABRB3	24344122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.707000	0.84623	2.861000	0.98227	0.655000	0.94253	GTG		0.453	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			44	87	0	0	0	0.01441	0	44	87				
BUB1B	701	broad.mit.edu	37	15	40505533	40505533	+	Splice_Site	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:40505533G>A	ENST00000287598.6	+	20	2731	c.2536G>A	c.(2536-2538)Gat>Aat	p.D846N	BUB1B_ENST00000412359.3_Splice_Site_p.D860N	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	846	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D846N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CAATTTCCAGGATCTTCTCCA	0.348			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														uc001zkx.3		NA	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	Mis|N|F|S	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)			M		rhabdomyosarcoma			1	Substitution - Missense(1)		lung(1)	stomach(2)|ovary(1)|kidney(1)	4						c.(2536-2538)GAT>AAT		budding uninhibited by benzimidazoles 1 beta							83.0	81.0	82.0					15																	40505533		2203	4300	6503	SO:0001630	splice_region_variant	701	Mosaic_Variegated_Aneuploidy_Syndrome	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40505533G>A	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2536-1G>A	15.37:g.40505533G>A			Somatic					p.D846N	NM_001211	NP_001202	WXS	Illumina HiSeq	Unspecified	O60566	BUB1B_HUMAN		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)	20	2748	+		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	846			Protein kinase.		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	37	c.2536G>A	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974533	0.53720	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.23950	1.88;1.88	5.53	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);	0.146683	0.47455	N	0.000240	T	0.20088	0.0483	N	0.25245	0.725	0.40990	D	0.984844	B	0.30482	0.281	B	0.34931	0.192	T	0.05954	-1.0854	9	.	.	.	-14.0203	14.7888	0.69824	0.0701:0.0:0.9299:0.0	.	846	O60566	BUB1B_HUMAN	N	846;860;729	ENSP00000287598:D846N;ENSP00000398470:D860N	.	D	+	1	0	BUB1B	38292825	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.064000	0.64338	1.313000	0.45069	0.561000	0.74099	GAT		0.348	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4		Missense_Mutation	32	59	0	0	0	0.003271	0	32	59				
OIP5	11339	broad.mit.edu	37	15	41624440	41624440	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:41624440G>A	ENST00000220514.3	-	1	379	c.320C>T	c.(319-321)tCc>tTc	p.S107F	NUSAP1_ENST00000450318.1_5'Flank|NUSAP1_ENST00000559596.1_5'Flank|NUSAP1_ENST00000414849.2_5'Flank|NUSAP1_ENST00000560747.1_5'Flank|NUSAP1_ENST00000260359.6_5'Flank|NUSAP1_ENST00000450592.2_5'Flank|NUSAP1_ENST00000560177.1_5'Flank	NM_007280.1	NP_009211.1	O43482	MS18B_HUMAN	Opa interacting protein 5	107					cell communication (GO:0007154)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	Cajal body (GO:0015030)|chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S107F(1)		endometrium(3)|lung(1)|urinary_tract(1)	5		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GCACTCACTGGAGAAGACCAC	0.647											OREG0023073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001znp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)TCC>TTC		Opa interacting protein 5							26.0	28.0	27.0					15																	41624440		2182	4239	6421	SO:0001583	missense	11339				cell communication|cell division|CenH3-containing nucleosome assembly at centromere|mitosis	Cajal body|chromatin|chromosome, centromeric region	protein binding	g.chr15:41624440G>A	AF025441	CCDS10074.1	15q14	2011-02-23			ENSG00000104147	ENSG00000104147			20300	protein-coding gene	gene with protein product	"""MIS18 kinetochore protein homolog B (S. pombe)"", ""cancer/testis antigen 86"""	606020				9466265, 17199038	Standard	NM_007280		Approved	MIS18B, hMIS18beta, CT86	uc001znp.3	O43482	OTTHUMG00000130251	ENST00000220514.3:c.320C>T	15.37:g.41624440G>A	ENSP00000220514:p.Ser107Phe		Somatic	OREG0023073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	902	NUSAP1_uc001znq.3_5'Flank|NUSAP1_uc001znr.3_5'Flank|NUSAP1_uc001zns.3_5'Flank|NUSAP1_uc010bce.2_5'Flank|NUSAP1_uc001znt.3_5'Flank|NUSAP1_uc001znv.3_5'Flank|NUSAP1_uc001znu.3_5'Flank|NUSAP1_uc010ucw.1_5'Flank	p.S107F	NM_007280	NP_009211	WXS	Illumina HiSeq	Unspecified	O43482	MS18B_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)	1	380	-		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)	107					Q96BX7	Missense_Mutation	SNP	ENST00000220514.3	37	c.320C>T	CCDS10074.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370168	0.82573	.	.	ENSG00000104147	ENST00000220514	.	.	.	6.02	4.04	0.47022	.	0.450396	0.21282	N	0.077132	T	0.48519	0.1504	M	0.73598	2.24	0.34427	D	0.698146	P	0.38078	0.617	B	0.36289	0.221	T	0.61297	-0.7091	9	0.36615	T	0.2	-6.1389	7.3498	0.26684	0.1645:0.1536:0.6818:0.0	.	107	O43482	MS18B_HUMAN	F	107	.	ENSP00000220514:S107F	S	-	2	0	OIP5	39411732	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.519000	0.45546	1.562000	0.49601	0.655000	0.94253	TCC		0.647	OIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252576.2	NM_007280		8	54	0	0	0	0.004482	0	8	54				
PLA2G4B	100137049	broad.mit.edu	37	15	42139578	42139578	+	Missense_Mutation	SNP	C	C	T	rs145043086		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:42139578C>T	ENST00000452633.1	+	20	2343	c.1991C>T	c.(1990-1992)cCg>cTg	p.P664L	PLA2G4B_ENST00000458483.1_Missense_Mutation_p.P664L|JMJD7-PLA2G4B_ENST00000342159.4_Intron|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.P895L|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.P895L			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	664	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)	p.P895L(1)					all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CAGGGGATCCCGTTCCCACCC	0.687																																							uc010bco.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1990-1992)CCG>CTG		phospholipase A2, group IVB		C	LEU/PRO,,LEU/PRO	0,4406		0,0,2203	73.0	78.0	77.0		1991,,2684	5.1	0.9	15	dbSNP_134	77	1,8599		0,1,4299	no	missense,intron,missense	JMJD7-PLA2G4B,PLA2G4B	NM_001114633.1,NM_001198588.1,NM_005090.3	98,,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,,probably-damaging	664/782,,895/1013	42139578	1,13005	2203	4300	6503	SO:0001583	missense	8681				arachidonic acid metabolic process|calcium-mediated signaling|glycerophospholipid catabolic process|inflammatory response|parturition	cytosol|early endosome membrane|extracellular region|mitochondrial membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|calcium-dependent phospholipid binding|lysophospholipase activity	g.chr15:42139578C>T	AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1991C>T	15.37:g.42139578C>T	ENSP00000396045:p.Pro664Leu		Somatic				JMJD7-PLA2G4B_uc001zoo.3_Missense_Mutation_p.P895L|JMJD7-PLA2G4B_uc010bcn.2_Intron|JMJD7-PLA2G4B_uc001zoq.3_Missense_Mutation_p.P365L	p.P664L	NM_001114633	NP_001108105	WXS	Illumina HiSeq	Unspecified	P0C869	PA24B_HUMAN			19	2092	+			664			PLA2c.		B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	37	c.1991C>T	CCDS45241.1	.	.	.	.	.	.	.	.	.	.	.	19.53	3.844587	0.71488	0.0	1.16E-4	ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000458483;ENST00000452633	T;T;T	0.18657	2.2;2.2;2.2	5.09	5.09	0.68999	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.162448	0.43579	D	0.000551	T	0.48554	0.1506	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.951;0.999	T	0.51180	-0.8738	9	0.72032	D	0.01	-41.7892	15.7826	0.78272	0.0:1.0:0.0:0.0	.	664;895	P0C869;P0C869-6	PA24B_HUMAN;.	L	895;664;664	ENSP00000371886:P895L;ENSP00000416610:P664L;ENSP00000396045:P664L	ENSP00000371886:P895L	P	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39926870	0.998000	0.40836	0.936000	0.37596	0.422000	0.31414	5.468000	0.66743	2.551000	0.86045	0.561000	0.74099	CCG		0.687	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1	NM_001114633		50	129	0	0	0	0.01441	0	50	129				
LCMT2	9836	broad.mit.edu	37	15	43620678	43620678	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:43620678G>C	ENST00000305641.5	-	1	2125	c.2010C>G	c.(2008-2010)ttC>ttG	p.F670L	ADAL_ENST00000422466.2_5'Flank|LCMT2_ENST00000544735.1_Missense_Mutation_p.F249L|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_3'UTR|ADAL_ENST00000389651.4_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	670					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)	p.F670L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	TATGGGGGTTGAAGTAGGTAC	0.438																																							uc001zrg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2008-2010)TTC>TTG		leucine carboxyl methyltransferase 2	L-Leucine(DB00149)						120.0	115.0	117.0					15																	43620678		2201	4299	6500	SO:0001583	missense	9836				tRNA processing		methyltransferase activity|protein binding	g.chr15:43620678G>C	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.2010C>G	15.37:g.43620678G>C	ENSP00000307214:p.Phe670Leu		Somatic				LCMT2_uc010udn.1_Missense_Mutation_p.F249L|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	p.F670L	NM_014793	NP_055608	WXS	Illumina HiSeq	Unspecified	O60294	LCMT2_HUMAN		GBM - Glioblastoma multiforme(94;8.1e-07)	1	2214	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	670					Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	c.2010C>G	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	G	9.855	1.194661	0.22037	.	.	ENSG00000168806	ENST00000305641;ENST00000544735	T;T	0.17054	2.3;2.97	5.7	1.13	0.20643	.	0.201415	0.43579	N	0.000552	T	0.07007	0.0178	N	0.16743	0.435	0.32215	N	0.575978	B	0.20052	0.041	B	0.17433	0.018	T	0.24657	-1.0154	10	0.13470	T	0.59	-25.9029	2.5264	0.04692	0.2111:0.1374:0.5113:0.1402	.	670	O60294	LCMT2_HUMAN	L	670;249	ENSP00000307214:F670L;ENSP00000442022:F249L	ENSP00000307214:F670L	F	-	3	2	LCMT2	41407970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.706000	0.25690	0.330000	0.23485	0.655000	0.94253	TTC		0.438	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793		16	132	0	0	0	0.00499	0	16	132				
LCMT2	9836	broad.mit.edu	37	15	43622436	43622436	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:43622436C>G	ENST00000305641.5	-	1	367	c.252G>C	c.(250-252)caG>caC	p.Q84H	ADAL_ENST00000422466.2_5'Flank|LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Intron|ADAL_ENST00000389651.4_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	84					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)	p.Q84H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	GAGACAAGATCTGCGCGCGAA	0.647																																							uc001zrg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)CAG>CAC		leucine carboxyl methyltransferase 2	L-Leucine(DB00149)						16.0	21.0	19.0					15																	43622436		2118	4186	6304	SO:0001583	missense	9836				tRNA processing		methyltransferase activity|protein binding	g.chr15:43622436C>G	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.252G>C	15.37:g.43622436C>G	ENSP00000307214:p.Gln84His		Somatic				LCMT2_uc010udn.1_Intron|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	p.Q84H	NM_014793	NP_055608	WXS	Illumina HiSeq	Unspecified	O60294	LCMT2_HUMAN		GBM - Glioblastoma multiforme(94;8.1e-07)	1	456	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	84					Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	c.252G>C	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780925	0.49891	.	.	ENSG00000168806	ENST00000305641	T	0.32515	1.45	5.55	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.67534	0.2903	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78262	-0.2272	10	0.72032	D	0.01	-0.923	12.3711	0.55256	0.0:0.9192:0.0:0.0808	.	84	O60294	LCMT2_HUMAN	H	84	ENSP00000307214:Q84H	ENSP00000307214:Q84H	Q	-	3	2	LCMT2	41409728	1.000000	0.71417	0.789000	0.31954	0.025000	0.11179	6.143000	0.71756	1.588000	0.49971	-0.150000	0.13652	CAG		0.647	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793		4	50	0	0	0	0.000602	0	4	50				
GCNT3	9245	broad.mit.edu	37	15	59910672	59910672	+	Missense_Mutation	SNP	G	G	C	rs143474619		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:59910672G>C	ENST00000396065.1	+	3	683	c.235G>C	c.(235-237)Gag>Cag	p.E79Q	GCNT3_ENST00000560585.1_Missense_Mutation_p.E79Q	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	79					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.E79Q(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGGGGACCAAGAGGCAGTGCT	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20844	0.0		0.0	False		,,,				2504	0.0						uc002age.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(235-237)GAG>CAG		glucosaminyl (N-acetyl) transferase 3, mucin							112.0	124.0	120.0					15																	59910672		2190	4290	6480	SO:0001583	missense	9245				protein O-linked glycosylation	Golgi membrane|integral to membrane|membrane fraction	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity	g.chr15:59910672G>C	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.235G>C	15.37:g.59910672G>C	ENSP00000379377:p.Glu79Gln		Somatic				GCNT3_uc002agd.2_Missense_Mutation_p.E79Q	p.E79Q	NM_004751	NP_004742	WXS	Illumina HiSeq	Unspecified	O95395	GCNT3_HUMAN			3	684	+			79			Lumenal (Potential).			Missense_Mutation	SNP	ENST00000396065.1	37	c.235G>C	CCDS10172.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	6.364	0.435320	0.12045	.	.	ENSG00000140297	ENST00000396065	T	0.50001	0.76	6.16	1.12	0.20585	.	1.277670	0.05120	N	0.490462	T	0.41073	0.1143	L	0.55743	1.74	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.21008	-1.0258	10	0.18276	T	0.48	.	6.6913	0.23174	0.3437:0.1249:0.5314:0.0	.	79	O95395	GCNT3_HUMAN	Q	79	ENSP00000379377:E79Q	ENSP00000379377:E79Q	E	+	1	0	GCNT3	57697964	0.007000	0.16637	0.002000	0.10522	0.115000	0.19883	0.933000	0.28897	0.168000	0.19655	0.650000	0.86243	GAG		0.488	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256068.1	NM_004751		7	242	0	0	0	0.001984	0	7	242				
IGDCC4	57722	broad.mit.edu	37	15	65676690	65676690	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:65676690G>C	ENST00000352385.2	-	20	3619	c.3410C>G	c.(3409-3411)tCt>tGt	p.S1137C	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1137C(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						ACTAAAGTCAGAGTGGACAAT	0.552																																							uc002aou.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(3409-3411)TCT>TGT		immunoglobulin superfamily, DCC subclass, member							95.0	93.0	94.0					15																	65676690		2201	4299	6500	SO:0001583	missense	57722					integral to membrane|plasma membrane		g.chr15:65676690G>C		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3410C>G	15.37:g.65676690G>C	ENSP00000319623:p.Ser1137Cys		Somatic				IGDCC4_uc002aot.1_Missense_Mutation_p.S725C	p.S1137C	NM_020962	NP_066013	WXS	Illumina HiSeq	Unspecified	Q8TDY8	IGDC4_HUMAN			20	3620	-			1137			Cytoplasmic (Potential).		Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	c.3410C>G	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206234	0.79127	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.67698	-0.28	5.19	5.19	0.71726	.	0.000000	0.45867	D	0.000328	T	0.74869	0.3773	L	0.36672	1.1	0.46542	D	0.999098	D	0.89917	1.0	D	0.85130	0.997	T	0.77593	-0.2530	10	0.87932	D	0	-12.2292	15.4289	0.75077	0.0:0.0:1.0:0.0	.	1137	Q8TDY8	IGDC4_HUMAN	C	1137;866	ENSP00000319623:S1137C	ENSP00000319623:S1137C	S	-	2	0	IGDCC4	63463743	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.682000	0.84083	2.423000	0.82170	0.561000	0.74099	TCT		0.552	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962		3	142	0	0	0	0.004672	0	3	142				
THSD4	79875	broad.mit.edu	37	15	72020963	72020963	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:72020963G>T	ENST00000355327.3	+	9	1567	c.1433G>T	c.(1432-1434)gGa>gTa	p.G478V	THSD4_ENST00000357769.4_Missense_Mutation_p.G118V|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Missense_Mutation_p.G478V			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	478					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)	p.G478*(1)|p.G478E(1)|p.G478V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TACGAGGGCGGAGGGACCATG	0.507																																							uc002atb.1		NA																	3	Substitution - Missense(2)|Substitution - Nonsense(1)		lung(3)	ovary(2)	2						c.(1432-1434)GGA>GTA		thrombospondin, type I, domain containing 4							183.0	170.0	174.0					15																	72020963		1938	4135	6073	SO:0001583	missense	79875					proteinaceous extracellular matrix	metalloendopeptidase activity	g.chr15:72020963G>T	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1433G>T	15.37:g.72020963G>T	ENSP00000347484:p.Gly478Val		Somatic				THSD4_uc002atd.1_Missense_Mutation_p.G152V|THSD4_uc010ukg.1_Missense_Mutation_p.G118V|THSD4_uc002ate.2_Missense_Mutation_p.G118V	p.G478V	NM_024817	NP_079093	WXS	Illumina HiSeq	Unspecified	Q6ZMP0	THSD4_HUMAN			8	1512	+			478					B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	c.1433G>T	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346211	0.61073	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.50813	0.73;0.73;0.73	5.17	5.17	0.71159	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	L	0.51422	1.61	0.80722	D	1	D;B;P;P	0.67145	0.996;0.248;0.873;0.889	P;B;B;P	0.60345	0.873;0.103;0.412;0.526	T	0.56619	-0.7949	10	0.37606	T	0.19	.	16.1685	0.81786	0.0:0.0:1.0:0.0	.	118;118;478;478	B4E1J6;B4DR13;Q6ZMP0-2;Q6ZMP0	.;.;.;THSD4_HUMAN	V	478;478;118	ENSP00000347484:G478V;ENSP00000261862:G478V;ENSP00000350413:G118V	ENSP00000261862:G478V	G	+	2	0	THSD4	69808017	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.556000	0.53734	2.404000	0.81709	0.462000	0.41574	GGA		0.507	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817		8	184	1	0	3.09899e-07	0.004482	3.63951e-07	8	184				
MAN2C1	4123	broad.mit.edu	37	15	75654689	75654689	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:75654689C>G	ENST00000267978.5	-	8	1049	c.1003G>C	c.(1003-1005)Gag>Cag	p.E335Q	MAN2C1_ENST00000563622.1_Missense_Mutation_p.E236Q|MAN2C1_ENST00000569482.1_Missense_Mutation_p.E335Q|MAN2C1_ENST00000565683.1_Missense_Mutation_p.E335Q|MAN2C1_ENST00000563539.1_5'Flank	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	335					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.E335Q(1)		central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CTTACCATCTCCACCCAGGTG	0.617																																							uc002baf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1003-1005)GAG>CAG		mannosidase, alpha, class 2C, member 1							46.0	41.0	42.0					15																	75654689		2197	4294	6491	SO:0001583	missense	4123				mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding	g.chr15:75654689C>G	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1003G>C	15.37:g.75654689C>G	ENSP00000267978:p.Glu335Gln		Somatic				MAN2C1_uc002bag.2_Missense_Mutation_p.E335Q|MAN2C1_uc002bah.2_Missense_Mutation_p.E335Q|MAN2C1_uc010bkk.2_Missense_Mutation_p.E236Q|MAN2C1_uc010umi.1_Missense_Mutation_p.E117Q|MAN2C1_uc010umj.1_RNA	p.E335Q	NM_006715	NP_006706	WXS	Illumina HiSeq	Unspecified	Q9NTJ4	MA2C1_HUMAN			8	1020	-			335					H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	ENST00000267978.5	37	c.1003G>C	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	C	34	5.296555	0.95574	.	.	ENSG00000140400	ENST00000267978	T	0.80214	-1.35	5.45	5.45	0.79879	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	D	0.91529	0.7325	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.994;1.0	D	0.92859	0.6304	10	0.87932	D	0	-30.4224	18.2687	0.90060	0.0:1.0:0.0:0.0	.	117;335;335	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	Q	335	ENSP00000267978:E335Q	ENSP00000267978:E335Q	E	-	1	0	MAN2C1	73441742	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.582000	0.82546	2.554000	0.86153	0.561000	0.74099	GAG		0.617	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1			7	38	0	0	0	0.004482	0	7	38				
IL16	3603	broad.mit.edu	37	15	81592196	81592196	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:81592196C>T	ENST00000302987.4	+	13	2529	c.2529C>T	c.(2527-2529)atC>atT	p.I843I	IL16_ENST00000394652.2_Silent_p.I142I|IL16_ENST00000560230.1_3'UTR|IL16_ENST00000394660.2_Silent_p.I843I			Q14005	IL16_HUMAN	interleukin 16	843					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.I843I(1)|p.I797I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GGCAGAGAATCAGCTCCTTTG	0.592																																							uc002bgh.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)|skin(1)	4						c.(2527-2529)ATC>ATT		interleukin 16 isoform 2							30.0	29.0	30.0					15																	81592196		2203	4300	6503	SO:0001819	synonymous_variant	3603				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity	g.chr15:81592196C>T	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.2529C>T	15.37:g.81592196C>T			Somatic				IL16_uc010blq.1_Silent_p.I797I|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Silent_p.I885I|IL16_uc002bgg.2_Silent_p.I843I|IL16_uc002bgi.1_Silent_p.I233I|IL16_uc002bgj.2_Silent_p.I337I|IL16_uc002bgk.2_Silent_p.I142I|IL16_uc002bgl.1_Silent_p.I142I|IL16_uc010unq.1_Silent_p.I142I	p.I843I	NM_172217	NP_757366	WXS	Illumina HiSeq	Unspecified	Q14005	IL16_HUMAN			14	2905	+			843					A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Silent	SNP	ENST00000302987.4	37	c.2529C>T	CCDS42069.1																																																																																				0.592	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		5	56	0	0	0	0.000602	0	5	56				
DNM1P47	100216544	broad.mit.edu	37	15	102292797	102292797	+	RNA	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr15:102292797C>G	ENST00000561463.1	+	0	843									DNM1 pseudogene 47									p.P129A(2)									GAGCTGCTGTCCAACCTGCAC	0.597																																							uc010usj.1		NA																	2	Substitution - Missense(2)		urinary_tract(1)|lung(1)		NA						c.(385-387)CCA>GCA		RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																																						0							g.chr15:102292797C>G	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292797C>G			Somatic				uc002bxo.2_RNA|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank	p.P129A			WXS	Illumina HiSeq	Unspecified					4	444	+									Missense_Mutation	SNP	ENST00000561463.1	37	c.385C>G																																																																																					0.597	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		2	20	0	0	0	0.004672	0	2	20				
ZNF597	146434	broad.mit.edu	37	16	3486852	3486852	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:3486852G>C	ENST00000301744.4	-	4	1082	c.847C>G	c.(847-849)Ctt>Gtt	p.L283V		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L283V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						GGCAAAGCAAGATTTGGTTTC	0.453																																							uc002cvd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(847-849)CTT>GTT		zinc finger protein 597							114.0	111.0	112.0					16																	3486852		2197	4300	6497	SO:0001583	missense	146434				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:3486852G>C	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.847C>G	16.37:g.3486852G>C	ENSP00000301744:p.Leu283Val		Somatic					p.L283V	NM_152457	NP_689670	WXS	Illumina HiSeq	Unspecified	Q96LX8	ZN597_HUMAN			4	1031	-			283						Missense_Mutation	SNP	ENST00000301744.4	37	c.847C>G	CCDS10505.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107247	0.37145	.	.	ENSG00000167981	ENST00000301744	T	0.68331	-0.32	4.76	3.78	0.43462	.	0.000000	0.38778	N	0.001571	T	0.70133	0.3189	M	0.92367	3.3	0.09310	N	1	P	0.38535	0.635	B	0.30495	0.116	T	0.69221	-0.5202	10	0.59425	D	0.04	-5.2468	12.8875	0.58053	0.0:0.1649:0.8351:0.0	.	283	Q96LX8	ZN597_HUMAN	V	283	ENSP00000301744:L283V	ENSP00000301744:L283V	L	-	1	0	ZNF597	3426853	0.955000	0.32602	0.053000	0.19242	0.417000	0.31264	2.493000	0.45320	1.314000	0.45095	0.650000	0.86243	CTT		0.453	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457		4	231	0	0	0	0.009096	0	4	231				
ACSM1	116285	broad.mit.edu	37	16	20638525	20638525	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:20638525G>A	ENST00000307493.4	-	10	1480	c.1413C>T	c.(1411-1413)atC>atT	p.I471I	ACSM1_ENST00000520010.1_Silent_p.I471I|ACSM1_ENST00000219151.4_Silent_p.I122I	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	471					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.I122I(1)|p.I471I(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						AGGCATTAATGATGTCATCAC	0.488																																							uc002dhm.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|skin(1)	2						c.(1411-1413)ATC>ATT		acyl-CoA synthetase medium-chain family member							260.0	244.0	249.0					16																	20638525		2201	4300	6501	SO:0001819	synonymous_variant	116285				benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20638525G>A	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.1413C>T	16.37:g.20638525G>A			Somatic				ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Silent_p.I471I	p.I471I	NM_052956	NP_443188	WXS	Illumina HiSeq	Unspecified	Q08AH1	ACSM1_HUMAN			10	1481	-			471					Q08AH2|Q96A20	Silent	SNP	ENST00000307493.4	37	c.1413C>T	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	g	0.091	-1.166896	0.01660	.	.	ENSG00000166743	ENST00000524149	.	.	.	4.22	2.2	0.27929	.	.	.	.	.	T	0.52008	0.1708	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40776	-0.9545	4	.	.	.	.	5.0101	0.14308	0.1876:0.3354:0.477:0.0	.	.	.	.	L	143	.	.	S	-	2	0	ACSM1	20546026	1.000000	0.71417	0.686000	0.30086	0.008000	0.06430	2.507000	0.45442	0.509000	0.28195	-0.137000	0.14449	TCA		0.488	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956		9	416	0	0	0	0.004482	0	9	416				
RBBP6	5930	broad.mit.edu	37	16	24581790	24581790	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:24581790G>T	ENST00000319715.4	+	17	4211	c.3779G>T	c.(3778-3780)gGa>gTa	p.G1260V	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.G1226V	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1260					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G1260V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GGAACTGAAGGATCCAGCTCA	0.423																																							uc002dmh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(3778-3780)GGA>GTA		retinoblastoma-binding protein 6 isoform 1							92.0	94.0	94.0					16																	24581790		2187	4296	6483	SO:0001583	missense	5930				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:24581790G>T		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3779G>T	16.37:g.24581790G>T	ENSP00000317872:p.Gly1260Val		Somatic				RBBP6_uc010vcb.1_Missense_Mutation_p.G1127V|RBBP6_uc002dmi.2_Missense_Mutation_p.G1226V|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Missense_Mutation_p.G1093V	p.G1260V	NM_006910	NP_008841	WXS	Illumina HiSeq	Unspecified	Q7Z6E9	RBBP6_HUMAN		GBM - Glioblastoma multiforme(48;0.0518)	17	4819	+			1260					Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	c.3779G>T	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453086	0.63290	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.22134	2.05;1.97	6.07	6.07	0.98685	.	0.082860	0.47852	D	0.000206	T	0.36138	0.0956	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.973	T	0.01617	-1.1311	10	0.30078	T	0.28	-23.7934	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1226;1260	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	V	1260;1226	ENSP00000317872:G1260V;ENSP00000316291:G1226V	ENSP00000317872:G1260V	G	+	2	0	RBBP6	24489291	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.855000	0.62925	2.884000	0.98904	0.655000	0.94253	GGA		0.423	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910		24	39	1	0	6.32553e-13	0.004656	7.6057e-13	24	39				
NLRC5	84166	broad.mit.edu	37	16	57085490	57085490	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:57085490C>T	ENST00000262510.6	+	24	3688	c.3463C>T	c.(3463-3465)Cta>Tta	p.L1155L	RP11-322D14.2_ENST00000562970.1_RNA|NLRC5_ENST00000436936.1_Silent_p.L1155L|NLRC5_ENST00000308149.7_Silent_p.L1155L|NLRC5_ENST00000539144.1_Silent_p.L1155L	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1155					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCTGGAGACTCTACTGGACTG	0.532																																							uc002ekk.1		NA																	0				ovary(4)|skin(2)|breast(1)	7						c.(3463-3465)CTA>TTA		nucleotide-binding oligomerization domains 27							414.0	395.0	402.0					16																	57085490		2198	4300	6498	SO:0001819	synonymous_variant	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57085490C>T	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3463C>T	16.37:g.57085490C>T			Somatic				NLRC5_uc002ekn.2_Silent_p.L874L|NLRC5_uc002ekl.2_Silent_p.L960L|NLRC5_uc002ekm.2_Silent_p.L930L|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekp.1_Silent_p.L71L|NLRC5_uc002ekq.1_5'UTR|NLRC5_uc002ekr.1_Silent_p.L71L	p.L1155L	NM_032206	NP_115582	WXS	Illumina HiSeq	Unspecified	Q86WI3	NLRC5_HUMAN			24	3688	+		all_neural(199;0.225)	1155			LRR 11.		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	c.3463C>T	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	C	4.625	0.116203	0.08831	.	.	ENSG00000140853	ENST00000538805	.	.	.	5.04	1.98	0.26296	.	.	.	.	.	T	0.55097	0.1899	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48328	-0.9045	4	.	.	.	.	7.2998	0.26413	0.0:0.7262:0.0:0.2738	.	.	.	.	F	907	.	.	S	+	2	0	NLRC5	55642991	0.994000	0.37717	1.000000	0.80357	0.522000	0.34438	1.183000	0.32041	0.709000	0.31976	0.557000	0.71058	TCT		0.532	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		14	711	0	0	0	0.007413	0	14	711				
CNOT1	23019	broad.mit.edu	37	16	58619324	58619324	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:58619324C>G	ENST00000317147.5	-	8	1056	c.724G>C	c.(724-726)Gat>Cat	p.D242H	CNOT1_ENST00000569240.1_Missense_Mutation_p.D242H|CNOT1_ENST00000441024.2_Missense_Mutation_p.D242H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	242					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.D242H(2)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CCTCCGGAATCAGGCAGGATC	0.468																																							uc002env.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)	6						c.(724-726)GAT>CAT		CCR4-NOT transcription complex, subunit 1							117.0	110.0	112.0					16																	58619324		2198	4300	6498	SO:0001583	missense	23019				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol		g.chr16:58619324C>G	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.724G>C	16.37:g.58619324C>G	ENSP00000320949:p.Asp242His		Somatic				CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.D242H|CNOT1_uc002enx.2_Missense_Mutation_p.D242H|CNOT1_uc002enz.1_Intron	p.D242H	NM_016284	NP_057368	WXS	Illumina HiSeq	Unspecified	A5YKK6	CNOT1_HUMAN		Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)	8	1017	-			242					Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	c.724G>C	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418285	0.83449	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.32272	1.46;1.46	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.51652	0.1687	L	0.50333	1.59	0.80722	D	1	D;P;P	0.89917	1.0;0.838;0.911	D;P;P	0.85130	0.997;0.466;0.562	T	0.41179	-0.9523	9	.	.	.	-3.3302	19.1115	0.93318	0.0:1.0:0.0:0.0	.	242;242;242	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	H	242	ENSP00000320949:D242H;ENSP00000413113:D242H	.	D	-	1	0	CNOT1	57176825	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.509000	0.84616	0.655000	0.94253	GAT		0.468	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		4	183	0	0	0	0.009096	0	4	183				
CDH11	1009	broad.mit.edu	37	16	65038648	65038649	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:65038648_65038649CC>AA	ENST00000268603.4	-	3	739_740	c.124_125GG>TT	c.(124-126)GGc>TTc	p.G42F	CDH11_ENST00000394156.3_Missense_Mutation_p.G42F|CDH11_ENST00000566827.1_Intron|CDH11_ENST00000569624.1_5'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	42					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G42F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCCCTCCTTGCCCTTCTCATGG	0.663			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													uc002eoi.2		NA		Dom	yes		16	16q22.1	1009	T	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""			M	USP6		aneurysmal bone cysts		1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(3)|skin(1)	14						c.(124-126)GGC>TTC		cadherin 11, type 2 preproprotein																																				SO:0001583	missense	1009				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr16:65038648_65038649CC>AA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.124_125delinsAA	16.37:g.65038648_65038649delinsAA	ENSP00000268603:p.Gly42Phe	TSP Lung(24;0.17)	Somatic				CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.G42F|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Missense_Mutation_p.G42F	p.G42F	NM_001797	NP_001788	WXS	Illumina HiSeq	Unspecified	P55287	CAD11_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.205)	3	558_559	-		Ovarian(137;0.0973)	42					A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	DNP	ENST00000268603.4	37	c.124_125GG>TT	CCDS10803.1																																																																																				0.663	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664		8	18	0	0	0	0.004672	0	8	18				
IRF8	3394	broad.mit.edu	37	16	85942710	85942710	+	Missense_Mutation	SNP	G	G	A	rs34712374		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:85942710G>A	ENST00000268638.5	+	3	711	c.289G>A	c.(289-291)Gac>Aac	p.D97N	IRF8_ENST00000563180.1_Missense_Mutation_p.D97N	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	97					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.D97N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GGAAGTGACGGACCGGTCCCA	0.453																																							uc002fjh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(289-291)GAC>AAC		interferon regulatory factor 8							67.0	66.0	66.0					16																	85942710		2198	4300	6498	SO:0001583	missense	3394				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:85942710G>A	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.289G>A	16.37:g.85942710G>A	ENSP00000268638:p.Asp97Asn		Somatic				IRF8_uc002fji.2_Missense_Mutation_p.D97N|IRF8_uc010chp.2_RNA	p.D97N	NM_002163	NP_002154	WXS	Illumina HiSeq	Unspecified	Q02556	IRF8_HUMAN			3	346	+		Prostate(104;0.0771)	97			IRF tryptophan pentad repeat.		A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	c.289G>A	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302481	0.81136	.	.	ENSG00000140968	ENST00000268638	D	0.98400	-4.91	4.97	4.97	0.65823	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.200295	0.51477	D	0.000091	D	0.97288	0.9113	L	0.58354	1.805	0.80722	D	1	B;B	0.29627	0.252;0.033	B;B	0.33846	0.171;0.142	D	0.97000	0.9728	10	0.87932	D	0	-31.0555	18.5961	0.91230	0.0:0.0:1.0:0.0	rs34712374	97;97	B2R8V7;Q02556	.;IRF8_HUMAN	N	97	ENSP00000268638:D97N	ENSP00000268638:D97N	D	+	1	0	IRF8	84500211	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.282000	0.95840	2.485000	0.83878	0.555000	0.69702	GAC		0.453	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		25	44	0	0	0	0.004656	0	25	44				
FANCA	2175	broad.mit.edu	37	16	89862360	89862360	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:89862360G>C	ENST00000389301.3	-	11	990	c.960C>G	c.(958-960)ttC>ttG	p.F320L	FANCA_ENST00000568369.1_Missense_Mutation_p.F320L	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	320					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.F320L(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GGGTATGACTGAAGAACCTCT	0.522			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc002fou.1		NA	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	D|Mis|N|F|S	"""Fanconi anemia, complementation group A"""			L		AML|leukemia			1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(958-960)TTC>TTG	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group A isoform							110.0	101.0	104.0					16																	89862360		2198	4300	6498	SO:0001583	missense	2175	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding	g.chr16:89862360G>C	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.960C>G	16.37:g.89862360G>C	ENSP00000373952:p.Phe320Leu		Somatic				FANCA_uc010vpn.1_Missense_Mutation_p.F320L	p.F320L	NM_000135	NP_000126	WXS	Illumina HiSeq	Unspecified	O15360	FANCA_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.028)	11	1002	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	320					A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	c.960C>G	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	G	8.749	0.920934	0.17982	.	.	ENSG00000187741	ENST00000389301	T	0.64618	-0.11	5.31	2.92	0.33932	.	0.448691	0.20957	N	0.082630	T	0.52075	0.1712	L	0.53249	1.67	0.22112	N	0.999357	B;B	0.20887	0.049;0.049	B;B	0.17433	0.018;0.018	T	0.44952	-0.9294	10	0.41790	T	0.15	-12.3899	6.9598	0.24591	0.3808:0.0:0.6192:0.0	.	320;320	B4DRI7;O15360	.;FANCA_HUMAN	L	320	ENSP00000373952:F320L	ENSP00000373952:F320L	F	-	3	2	FANCA	88389861	0.345000	0.24835	0.004000	0.12327	0.073000	0.16967	0.545000	0.23268	1.334000	0.45468	0.650000	0.86243	TTC		0.522	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			3	91	0	0	0	0.004672	0	3	91				
CENPBD1	92806	broad.mit.edu	37	16	90038109	90038109	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:90038109C>G	ENST00000314994.3	-	1	833	c.222G>C	c.(220-222)ctG>ctC	p.L74L	AFG3L1P_ENST00000437774.1_RNA|CENPBD1_ENST00000567035.1_Intron|RP11-566K11.5_ENST00000565150.1_RNA	NM_145039.3	NP_659476.2	B2RD01	CENP1_HUMAN	CENPB DNA-binding domains containing 1	74						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L74L(2)		endometrium(1)|lung(2)	3						GAGAGGCTCTCAGAGGAGTAG	0.502																																							uc002fpr.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(220-222)CTG>CTC		CENPB DNA-binding domains containing 1							34.0	36.0	35.0					16																	90038109		2085	4245	6330	SO:0001819	synonymous_variant	92806				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr16:90038109C>G	AK056131	CCDS45556.1	16q24.3	2009-08-26			ENSG00000177946	ENSG00000177946			28272	protein-coding gene	gene with protein product							Standard	NM_145039		Approved	MGC16385	uc002fpr.3	B2RD01		ENST00000314994.3:c.222G>C	16.37:g.90038109C>G			Somatic				AFG3L1_uc002fps.1_5'Flank|AFG3L1_uc002fpt.1_5'Flank|AFG3L1_uc002fpu.1_5'Flank|AFG3L1_uc002fpv.1_5'Flank|AFG3L1_uc002fpw.1_5'Flank|AFG3L1_uc002fpx.1_5'Flank	p.L74L	NM_145039	NP_659476	WXS	Illumina HiSeq	Unspecified	B2RD01	CENP1_HUMAN			1	834	-			74						Silent	SNP	ENST00000314994.3	37	c.222G>C	CCDS45556.1																																																																																				0.502	CENPBD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421897.1	NM_145039		4	19	0	0	0	0.009096	0	4	19				
CAMTA2	23125	broad.mit.edu	37	17	4883116	4883116	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:4883116A>G	ENST00000348066.3	-	9	1624	c.1501T>C	c.(1501-1503)Ttc>Ctc	p.F501L	CAMTA2_ENST00000358183.4_Missense_Mutation_p.F501L|CAMTA2_ENST00000381311.5_Missense_Mutation_p.F503L|CAMTA2_ENST00000572543.1_Missense_Mutation_p.F506L|CAMTA2_ENST00000361571.5_Missense_Mutation_p.F500L|CAMTA2_ENST00000414043.3_Missense_Mutation_p.F524L|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	501					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.F501L(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GAAAGACTGAAGGGCTCCAGT	0.587																																							uc002gah.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1501-1503)TTC>CTC		calmodulin binding transcription activator 2							126.0	125.0	125.0					17																	4883116		2203	4300	6503	SO:0001583	missense	23125				cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding	g.chr17:4883116A>G	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1501T>C	17.37:g.4883116A>G	ENSP00000321813:p.Phe501Leu		Somatic				CAMTA2_uc010cku.1_Missense_Mutation_p.F524L|CAMTA2_uc002gag.1_Missense_Mutation_p.F500L|CAMTA2_uc002gai.1_Missense_Mutation_p.F503L|CAMTA2_uc010ckv.1_Missense_Mutation_p.F148L|CAMTA2_uc010vsu.1_Missense_Mutation_p.F314L	p.F501L	NM_015099	NP_055914	WXS	Illumina HiSeq	Unspecified	O94983	CMTA2_HUMAN			9	1609	-			501					B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	c.1501T>C	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	A	18.78	3.697496	0.68386	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.30981	2.73;1.75;1.51;1.75;1.53	5.09	5.09	0.68999	.	0.069898	0.64402	D	0.000011	T	0.35158	0.0922	L	0.29908	0.895	0.29477	N	0.856645	D;D;D;D;P	0.58268	0.965;0.965;0.982;0.969;0.954	P;P;D;D;D	0.68943	0.542;0.637;0.961;0.914;0.943	T	0.16689	-1.0394	10	0.16420	T	0.52	-18.4322	7.4617	0.27300	0.906:0.0:0.094:0.0	.	477;524;503;501;500	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	L	524;503;500;501;501	ENSP00000412886:F524L;ENSP00000370712:F503L;ENSP00000354828:F500L;ENSP00000350910:F501L;ENSP00000321813:F501L	ENSP00000321813:F501L	F	-	1	0	CAMTA2	4823840	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.224000	0.32539	2.144000	0.66660	0.533000	0.62120	TTC		0.587	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099		5	251	0	0	0	0.000602	0	5	251				
KIAA0753	9851	broad.mit.edu	37	17	6493842	6493842	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:6493842G>A	ENST00000361413.3	-	17	2907	c.2549C>T	c.(2548-2550)cCc>cTc	p.P850L	KIAA0753_ENST00000542606.1_Missense_Mutation_p.P551L|KIAA0753_ENST00000575027.1_5'UTR|KIAA0753_ENST00000572370.1_Missense_Mutation_p.P551L|KIAA0753_ENST00000589033.1_Missense_Mutation_p.P306L	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	850						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.P850L(1)		endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GCCATTACAGGGCCTTTCTAA	0.403																																							uc002gde.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2548-2550)CCC>CTC		hypothetical protein LOC9851							160.0	144.0	149.0					17																	6493842		1883	4109	5992	SO:0001583	missense	9851					centrosome		g.chr17:6493842G>A		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.2549C>T	17.37:g.6493842G>A	ENSP00000355250:p.Pro850Leu		Somatic				KIAA0753_uc010vtd.1_Missense_Mutation_p.P306L|KIAA0753_uc010clo.2_Missense_Mutation_p.P551L|KIAA0753_uc010vte.1_Missense_Mutation_p.P551L	p.P850L	NM_014804	NP_055619	WXS	Illumina HiSeq	Unspecified	Q2KHM9	K0753_HUMAN		COAD - Colon adenocarcinoma(228;0.157)	17	2908	-			850					A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	ENST00000361413.3	37	c.2549C>T	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933165	0.73442	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	T;T	0.41065	1.01;1.01	5.19	5.19	0.71726	.	0.055265	0.64402	D	0.000001	T	0.61110	0.2321	L	0.56769	1.78	0.54753	D	0.999984	D	0.89917	1.0	D	0.91635	0.999	T	0.58797	-0.7573	10	0.42905	T	0.14	-16.1951	16.6024	0.84819	0.0:0.0:1.0:0.0	.	850	Q2KHM9	K0753_HUMAN	L	850;551;306	ENSP00000355250:P850L;ENSP00000444634:P551L	ENSP00000355250:P850L	P	-	2	0	KIAA0753	6434566	1.000000	0.71417	0.997000	0.53966	0.879000	0.50718	3.914000	0.56401	2.586000	0.87340	0.655000	0.94253	CCC		0.403	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804		25	74	0	0	0	0.008361	0	25	74				
MYH1	4619	broad.mit.edu	37	17	10399410	10399410	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:10399410C>A	ENST00000226207.5	-	35	5120	c.5026G>T	c.(5026-5028)Gct>Tct	p.A1676S	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1676					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1676S(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCCACCATAGCCAGCTGTTCC	0.572																																							uc002gmo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(5026-5028)GCT>TCT		myosin, heavy chain 1, skeletal muscle, adult							90.0	78.0	82.0					17																	10399410		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10399410C>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5026G>T	17.37:g.10399410C>A	ENSP00000226207:p.Ala1676Ser		Somatic				uc002gml.1_Intron	p.A1676S	NM_005963	NP_005954	WXS	Illumina HiSeq	Unspecified	P12882	MYH1_HUMAN			35	5120	-			1676			Potential.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.5026G>T	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986435	0.74589	.	.	ENSG00000109061	ENST00000226207	T	0.78364	-1.17	5.53	5.53	0.82687	Myosin tail (1);	0.000000	0.42964	U	0.000639	T	0.79953	0.4535	M	0.70275	2.135	0.80722	D	1	B	0.20671	0.047	B	0.25884	0.064	T	0.76457	-0.2952	10	0.59425	D	0.04	.	19.8241	0.96610	0.0:1.0:0.0:0.0	.	1676	P12882	MYH1_HUMAN	S	1676	ENSP00000226207:A1676S	ENSP00000226207:A1676S	A	-	1	0	MYH1	10340135	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.846000	0.69444	2.758000	0.94735	0.655000	0.94253	GCT		0.572	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		28	67	1	0	1.17739e-12	0.005443	1.41147e-12	28	67				
MYOCD	93649	broad.mit.edu	37	17	12655756	12655756	+	Missense_Mutation	SNP	G	G	A	rs552203360		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:12655756G>A	ENST00000343344.4	+	10	1151	c.1151G>A	c.(1150-1152)cGa>cAa	p.R384Q	MYOCD_ENST00000425538.1_Missense_Mutation_p.R384Q|AC005358.1_ENST00000609971.1_Missense_Mutation_p.R288Q|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	384	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R384Q(2)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CAACAGCTTCGAATTCGGGGC	0.453																																							uc002gnn.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)	5						c.(1150-1152)CGA>CAA		myocardin isoform 2							67.0	69.0	69.0					17																	12655756		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12655756G>A	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1151G>A	17.37:g.12655756G>A	ENSP00000341835:p.Arg384Gln		Somatic				MYOCD_uc002gno.2_Missense_Mutation_p.R384Q|MYOCD_uc002gnp.1_Missense_Mutation_p.R288Q|MYOCD_uc002gnq.2_Missense_Mutation_p.R103Q	p.R384Q	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	10	1450	+			384			SAP.		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.1151G>A	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655294	0.88056	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.54279	0.61;0.58	5.68	5.68	0.88126	DNA-binding SAP (4);	0.060804	0.64402	D	0.000003	T	0.69233	0.3088	L	0.52364	1.645	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;1.0	T	0.70219	-0.4932	10	0.72032	D	0.01	-8.6895	18.5474	0.91052	0.0:0.0:1.0:0.0	.	103;288;384;384	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	Q	103;384;384;288;89	ENSP00000341835:R384Q;ENSP00000400148:R89Q	ENSP00000341835:R384Q	R	+	2	0	MYOCD	12596481	1.000000	0.71417	0.991000	0.47740	0.768000	0.43524	5.800000	0.69108	2.675000	0.91044	0.591000	0.81541	CGA		0.453	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		12	64	0	0	0	0.00245	0	12	64				
VTN	7448	broad.mit.edu	37	17	26696372	26696372	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:26696372C>T	ENST00000226218.4	-	4	1225	c.607G>A	c.(607-609)Gag>Aag	p.E203K	VTN_ENST00000438614.1_5'Flank|CTB-96E2.2_ENST00000555059.2_5'Flank|VTN_ENST00000536498.1_5'UTR|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	203					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E203K(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	ATGGGGCCCTCGATGCCCCAG	0.587																																							uc002hbc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(607-609)GAG>AAG		vitronectin precursor	Urokinase(DB00013)						90.0	85.0	87.0					17																	26696372		2203	4300	6503	SO:0001583	missense	7448				cell adhesion mediated by integrin|immune response|negative regulation of endopeptidase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein binding|positive regulation of receptor-mediated endocytosis|positive regulation of smooth muscle cell migration|positive regulation of vascular endothelial growth factor receptor signaling pathway|smooth muscle cell-matrix adhesion	alphav-beta3 integrin-vitronectin complex|extracellular space	heparin binding|integrin binding|scavenger receptor activity	g.chr17:26696372C>T	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.607G>A	17.37:g.26696372C>T	ENSP00000226218:p.Glu203Lys		Somatic				SARM1_uc010wah.1_Intron|SEBOX_uc010crk.1_5'Flank|SARM1_uc010waj.1_Intron|SARM1_uc010crl.1_5'Flank	p.E203K	NM_000638	NP_000629	WXS	Illumina HiSeq	Unspecified	P04004	VTNC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	4	756	-	all_lung(13;0.000533)|Lung NSC(42;0.00171)		203			Hemopexin-like 1.		B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	c.607G>A	CCDS11229.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.519816	0.64634	.	.	ENSG00000255604	ENST00000226218	T	0.02737	4.18	5.66	5.66	0.87406	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.142736	0.64402	D	0.000004	T	0.02418	0.0074	N	0.12569	0.235	0.52099	D	0.999944	P	0.43431	0.807	B	0.36244	0.22	T	0.68454	-0.5404	10	0.25751	T	0.34	-28.4617	19.7366	0.96208	0.0:1.0:0.0:0.0	.	203	P04004	VTNC_HUMAN	K	203	ENSP00000226218:E203K	ENSP00000226218:E203K	E	-	1	0	AC002094.1	23720499	1.000000	0.71417	0.996000	0.52242	0.957000	0.61999	5.546000	0.67243	2.667000	0.90743	0.462000	0.41574	GAG		0.587	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638		8	119	0	0	0	0.004482	0	8	119				
FOXN1	8456	broad.mit.edu	37	17	26851622	26851622	+	Silent	SNP	C	C	G	rs138510671		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:26851622C>G	ENST00000226247.2	+	2	254	c.225C>G	c.(223-225)ccC>ccG	p.P75P	FOXN1_ENST00000579795.1_Silent_p.P75P	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	75					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P75P(1)		endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					CACCAGGGCCCGAGCAAGTCC	0.667																																							uc010crm.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(223-225)CCC>CCG		forkhead box N1		C		1,4405	4.2+/-10.8	0,1,2202	35.0	39.0	37.0		225	-11.1	0.3	17	dbSNP_134	37	0,8600		0,0,4300	no	coding-synonymous	FOXN1	NM_003593.2		0,1,6502	GG,GC,CC		0.0,0.0227,0.0077		75/649	26851622	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8456				defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr17:26851622C>G	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.225C>G	17.37:g.26851622C>G			Somatic				FOXN1_uc002hbj.2_Silent_p.P75P	p.P75P	NM_003593	NP_003584	WXS	Illumina HiSeq	Unspecified	O15353	FOXN1_HUMAN			3	423	+	Lung NSC(42;0.00431)		75					B2R9Q7|O15352	Silent	SNP	ENST00000226247.2	37	c.225C>G	CCDS11232.1																																																																																				0.667	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1			10	62	0	0	0	0.010729	0	10	62				
RAB11FIP4	84440	broad.mit.edu	37	17	29758831	29758831	+	Splice_Site	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:29758831G>T	ENST00000325874.8	+	2	389	c.160G>T	c.(160-162)Gtg>Ttg	p.V54L		NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	54	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.?(1)|p.V54L(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				ATTCCCACAGGTGGAAAAACT	0.562																																							uc002hgn.1		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(1)|autonomic_ganglia(1)	skin(1)	1						c.(160-162)GTG>TTG		RAB11 family interacting protein 4 (class II)							64.0	66.0	66.0					17																	29758831		2203	4300	6503	SO:0001630	splice_region_variant	84440				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr17:29758831G>T	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.160-1G>T	17.37:g.29758831G>T			Somatic					p.V54L	NM_032932	NP_116321	WXS	Illumina HiSeq	Unspecified	Q86YS3	RFIP4_HUMAN			2	389	+		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)	54			EF-hand.		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	c.160G>T	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456414	0.63401	.	.	ENSG00000131242	ENST00000325874	T	0.27557	1.66	5.06	4.09	0.47781	EF-hand-like domain (1);	0.000000	0.49305	D	0.000154	T	0.28732	0.0712	L	0.59436	1.845	0.80722	D	1	P	0.37330	0.59	B	0.37198	0.243	T	0.04005	-1.0985	9	.	.	.	-11.9537	9.44	0.38661	0.0984:0.0:0.9016:0.0	.	54	Q86YS3	RFIP4_HUMAN	L	54	ENSP00000312837:V54L	.	V	+	1	0	RAB11FIP4	26782957	1.000000	0.71417	0.997000	0.53966	0.506000	0.33950	7.121000	0.77160	1.139000	0.42245	0.313000	0.20887	GTG		0.562	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932	Missense_Mutation	21	51	1	0	3.83957e-06	0.00278	4.43196e-06	21	51				
C17orf53	78995	broad.mit.edu	37	17	42225308	42225308	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:42225308C>G	ENST00000319977.4	+	3	374	c.137C>G	c.(136-138)tCt>tGt	p.S46C	C17orf53_ENST00000245382.6_Missense_Mutation_p.S46C|C17orf53_ENST00000585683.1_Missense_Mutation_p.S46C	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	46								p.S46C(1)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AGACCTGTCTCTTCTAGGCCA	0.572																																							uc002ifi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)TCT>TGT		hypothetical protein LOC78995							73.0	69.0	70.0					17																	42225308		2203	4300	6503	SO:0001583	missense	78995							g.chr17:42225308C>G	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.137C>G	17.37:g.42225308C>G	ENSP00000313500:p.Ser46Cys		Somatic				C17orf53_uc010czq.1_Missense_Mutation_p.S46C|C17orf53_uc002ifj.1_Missense_Mutation_p.S46C|C17orf53_uc002ifk.1_RNA	p.S46C	NM_024032	NP_076937	WXS	Illumina HiSeq	Unspecified	Q8N3J3	CQ053_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.114)	3	322	+		Breast(137;0.0364)|Prostate(33;0.0376)	46					A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	c.137C>G	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	C	2.937	-0.219825	0.06061	.	.	ENSG00000125319	ENST00000319977;ENST00000245382;ENST00000253405	T;T	0.50277	0.75;0.75	5.28	3.2	0.36748	.	0.266711	0.30126	N	0.010341	T	0.35451	0.0932	N	0.24115	0.695	0.09310	N	1	B;B;B	0.21905	0.003;0.062;0.003	B;B;B	0.23018	0.007;0.043;0.007	T	0.28235	-1.0050	10	0.37606	T	0.19	-18.1103	16.0252	0.80538	0.0:0.731:0.269:0.0	.	46;46;46	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	C	46	ENSP00000313500:S46C;ENSP00000245382:S46C	ENSP00000245382:S46C	S	+	2	0	C17orf53	39580834	0.003000	0.15002	0.035000	0.18076	0.130000	0.20726	0.791000	0.26915	1.453000	0.47775	-0.264000	0.10439	TCT		0.572	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032		4	106	0	0	0	0.000602	0	4	106				
ANKFN1	162282	broad.mit.edu	37	17	54450167	54450167	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:54450167C>T	ENST00000318698.2	+	6	806	c.771C>T	c.(769-771)ctC>ctT	p.L257L	ANKFN1_ENST00000566473.2_Silent_p.L257L	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	257								p.L257L(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						GGTATCGGCTCTACAGACGCA	0.483																																							uc002iun.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(769-771)CTC>CTT		ankyrin-repeat and fibronectin type III domain							158.0	138.0	145.0					17																	54450167		2203	4300	6503	SO:0001819	synonymous_variant	162282							g.chr17:54450167C>T	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.771C>T	17.37:g.54450167C>T			Somatic					p.L257L	NM_153228	NP_694960	WXS	Illumina HiSeq	Unspecified	Q8N957	ANKF1_HUMAN			6	806	+			257						Silent	SNP	ENST00000318698.2	37	c.771C>T	CCDS32686.1																																																																																				0.483	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		19	124	0	0	0	0.00278	0	19	124				
APPBP2	10513	broad.mit.edu	37	17	58571968	58571968	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:58571968G>A	ENST00000083182.3	-	3	525	c.238C>T	c.(238-240)Cat>Tat	p.H80Y		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	80					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)	p.H80Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			AAACAATGATGAAGCAAATGT	0.338																																							uc002iys.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)CAT>TAT		amyloid beta precursor protein-binding protein							71.0	69.0	70.0					17																	58571968		2203	4300	6503	SO:0001583	missense	10513				intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding	g.chr17:58571968G>A	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.238C>T	17.37:g.58571968G>A	ENSP00000083182:p.His80Tyr		Somatic				APPBP2_uc010ddl.1_Missense_Mutation_p.H9Y	p.H80Y	NM_006380	NP_006371	WXS	Illumina HiSeq	Unspecified	Q92624	APBP2_HUMAN	Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)		3	526	-	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		80			TPR 1.		A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	c.238C>T	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072840	0.55646	.	.	ENSG00000062725	ENST00000083182	D	0.83837	-1.77	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	L	0.33485	1.01	0.80722	D	1	P	0.35872	0.525	P	0.45377	0.478	T	0.74490	-0.3648	10	0.07482	T	0.82	-0.303	19.6161	0.95634	0.0:0.0:1.0:0.0	.	80	Q92624	APBP2_HUMAN	Y	80	ENSP00000083182:H80Y	ENSP00000083182:H80Y	H	-	1	0	APPBP2	55926750	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.431000	0.97494	2.627000	0.88993	0.585000	0.79938	CAT		0.338	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380		4	111	0	0	0	0.009096	0	4	111				
ACE	1636	broad.mit.edu	37	17	61574336	61574336	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:61574336G>T	ENST00000290866.4	+	24	3705	c.3681G>T	c.(3679-3681)acG>acT	p.T1227T	ACE_ENST00000490216.2_Silent_p.T653T|ACE_ENST00000421982.2_Silent_p.T432T|ACE_ENST00000428043.1_Intron|ACE_ENST00000413513.3_Silent_p.T612T|ACE_ENST00000290863.6_Silent_p.T653T|ACE_ENST00000577647.1_Silent_p.T653T	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1227	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.T653T(1)|p.T1227T(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	ACAACTGGACGCCGAACTCCG	0.672																																							uc002jau.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(3679-3681)ACG>ACT		angiotensin I converting enzyme 1 isoform 1	Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)						26.0	27.0	27.0					17																	61574336		2202	4295	6497	SO:0001819	synonymous_variant	1636				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding	g.chr17:61574336G>T	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3681G>T	17.37:g.61574336G>T			Somatic				ACE_uc002jav.1_Silent_p.T653T|ACE_uc010ddv.1_Silent_p.T454T|ACE_uc010wpj.1_Silent_p.T612T|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Silent_p.T432T	p.T1227T	NM_000789	NP_000780	WXS	Illumina HiSeq	Unspecified	P12821	ACE_HUMAN			24	3703	+			1227			Extracellular (Potential).|Peptidase M2 2.		B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	ENST00000290866.4	37	c.3681G>T	CCDS11637.1																																																																																				0.672	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			5	6	1	0	7.48243e-07	0.006214	8.73671e-07	5	6				
SMURF2	64750	broad.mit.edu	37	17	62568061	62568061	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:62568061T>C	ENST00000262435.9	-	10	1058	c.871A>G	c.(871-873)Atc>Gtc	p.I291V	SMURF2_ENST00000578200.1_Intron	NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	291					BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)	p.I291V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TCACAATTGATGTTGCTAAGA	0.408																																							uc002jep.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|lung(1)	4						c.(871-873)ATC>GTC		SMAD specific E3 ubiquitin protein ligase 2							78.0	73.0	75.0					17																	62568061		2203	4300	6503	SO:0001583	missense	64750				BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity	g.chr17:62568061T>C	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.871A>G	17.37:g.62568061T>C	ENSP00000262435:p.Ile291Val		Somatic				SMURF2_uc002jeq.1_Missense_Mutation_p.I50V|SMURF2_uc002jer.1_Missense_Mutation_p.I50V	p.I291V	NM_022739	NP_073576	WXS	Illumina HiSeq	Unspecified	Q9HAU4	SMUF2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;9.88e-12)		10	1259	-	Breast(5;1.32e-14)		291					Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	37	c.871A>G	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	T	11.94	1.789294	0.31685	.	.	ENSG00000108854	ENST00000262435	T	0.39229	1.09	5.51	5.51	0.81932	WW/Rsp5/WWP (1);	0.159285	0.56097	D	0.000029	T	0.26340	0.0643	N	0.12502	0.225	0.47037	D	0.999292	B	0.02656	0.0	B	0.04013	0.001	T	0.08452	-1.0721	10	0.17369	T	0.5	.	15.6183	0.76784	0.0:0.0:0.0:1.0	.	291	Q9HAU4	SMUF2_HUMAN	V	291	ENSP00000262435:I291V	ENSP00000262435:I291V	I	-	1	0	SMURF2	59998523	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.014000	0.49590	2.092000	0.63282	0.482000	0.46254	ATC		0.408	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445227.1	NM_022739		20	52	0	0	0	0.012319	0	20	52				
HELZ	9931	broad.mit.edu	37	17	65083055	65083055	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:65083055G>C	ENST00000358691.5	-	32	5550	c.5384C>G	c.(5383-5385)tCt>tGt	p.S1795C	HELZ_ENST00000580168.1_Missense_Mutation_p.S1796C	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1795						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S1795C(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AAAGTTGAAAGAAGATTGGTT	0.473																																							uc010wqk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(5386-5388)TCT>TGT		helicase with zinc finger domain							147.0	154.0	151.0					17																	65083055		2027	4189	6216	SO:0001583	missense	9931							g.chr17:65083055G>C	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5384C>G	17.37:g.65083055G>C	ENSP00000351524:p.Ser1795Cys		Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.S1795C	p.S1796C	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					32	5574	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.5387C>G	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059692	0.36373	.	.	ENSG00000198265	ENST00000358691	D	0.85861	-2.04	5.7	4.72	0.59763	.	0.364194	0.31989	N	0.006748	T	0.76793	0.4037	L	0.27053	0.805	0.34591	D	0.715461	P;P	0.45348	0.856;0.856	B;B	0.36186	0.219;0.219	D	0.84334	0.0523	10	0.72032	D	0.01	-2.6022	16.9275	0.86180	0.0:0.1277:0.8723:0.0	.	1796;1795	B7ZLW2;P42694	.;HELZ_HUMAN	C	1795	ENSP00000351524:S1795C	ENSP00000351524:S1795C	S	-	2	0	HELZ	62513517	1.000000	0.71417	0.475000	0.27278	0.956000	0.61745	7.168000	0.77570	1.376000	0.46267	0.650000	0.86243	TCT		0.473	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		10	156	0	0	0	0.006214	0	10	156				
ARSG	22901	broad.mit.edu	37	17	66364735	66364735	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:66364735C>T	ENST00000448504.2	+	7	1547	c.751C>T	c.(751-753)Cac>Tac	p.H251Y	ARSG_ENST00000582154.1_3'UTR|ARSG_ENST00000452479.2_Missense_Mutation_p.H87Y	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	251					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.H251Y(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGCCCACATGCACGTGCCCTT	0.602																																							uc002jhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(751-753)CAC>TAC		Arylsulfatase G precursor							89.0	87.0	87.0					17																	66364735		2203	4300	6503	SO:0001583	missense	22901				sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding	g.chr17:66364735C>T	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.751C>T	17.37:g.66364735C>T	ENSP00000407193:p.His251Tyr		Somatic				ARSG_uc002jhb.1_Missense_Mutation_p.H87Y	p.H251Y	NM_014960	NP_055775	WXS	Illumina HiSeq	Unspecified	Q96EG1	ARSG_HUMAN	BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		7	1547	+			251				Substrate (By similarity).	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	c.751C>T	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134081	0.77662	.	.	ENSG00000141337	ENST00000452479;ENST00000448504	.	.	.	5.26	5.26	0.73747	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.90988	0.7166	H	0.99011	4.4	0.53005	D	0.999966	D	0.89917	1.0	D	0.97110	1.0	D	0.94319	0.7552	9	0.87932	D	0	.	17.8151	0.88630	0.0:1.0:0.0:0.0	.	251	Q96EG1	ARSG_HUMAN	Y	251;150	.	ENSP00000407193:H150Y	H	+	1	0	ARSG	63876330	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	5.460000	0.66691	2.733000	0.93635	0.655000	0.94253	CAC		0.602	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960		6	143	0	0	0	0.00308	0	6	143				
UBE2O	63893	broad.mit.edu	37	17	74392500	74392500	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:74392500G>C	ENST00000319380.7	-	14	2582	c.2518C>G	c.(2518-2520)Ccg>Gcg	p.P840A	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	840					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.P840A(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TCCACAGTCGGAGAGGTGGGC	0.547																																							uc002jrm.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|skin(2)|lung(1)	5						c.(2518-2520)CCG>GCG		ubiquitin-conjugating enzyme E2O							101.0	106.0	104.0					17																	74392500		2203	4300	6503	SO:0001583	missense	63893						ATP binding|ubiquitin-protein ligase activity	g.chr17:74392500G>C	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2518C>G	17.37:g.74392500G>C	ENSP00000323687:p.Pro840Ala		Somatic				UBE2O_uc002jrn.3_Missense_Mutation_p.P840A|UBE2O_uc002jrl.3_Missense_Mutation_p.P444A	p.P840A	NM_022066	NP_071349	WXS	Illumina HiSeq	Unspecified	Q9C0C9	UBE2O_HUMAN			14	2583	-			840			Potential.		A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	37	c.2518C>G	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923887	0.52653	.	.	ENSG00000175931	ENST00000319380	D	0.84873	-1.91	4.49	4.49	0.54785	.	0.279145	0.34676	N	0.003761	D	0.86569	0.5964	L	0.27053	0.805	0.48830	D	0.999713	D	0.76494	0.999	D	0.75484	0.986	T	0.83227	-0.0065	10	0.15952	T	0.53	.	17.5355	0.87829	0.0:0.0:1.0:0.0	.	840	Q9C0C9	UBE2O_HUMAN	A	840	ENSP00000323687:P840A	ENSP00000323687:P840A	P	-	1	0	UBE2O	71904095	1.000000	0.71417	0.939000	0.37840	0.618000	0.37518	9.101000	0.94219	2.206000	0.71126	0.462000	0.41574	CCG		0.547	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066		4	178	0	0	0	0.001168	0	4	178				
PCYT2	5833	broad.mit.edu	37	17	79867409	79867409	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:79867409G>A	ENST00000538936.2	-	2	267	c.159C>T	c.(157-159)atC>atT	p.I53I	PCYT2_ENST00000331285.3_5'UTR|PCYT2_ENST00000570391.1_Silent_p.I21I|PCYT2_ENST00000571105.1_Silent_p.I53I|PCYT2_ENST00000538721.2_Silent_p.I53I|PCYT2_ENST00000570388.1_5'UTR	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	53					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)	p.I53I(1)		breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	GCACGCCTACGATGAGGTAGT	0.632																																							uc002kcf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(157-159)ATC>ATT		phosphate cytidylyltransferase 2, ethanolamine							178.0	161.0	167.0					17																	79867409		2203	4300	6503	SO:0001819	synonymous_variant	5833				phospholipid biosynthetic process		ethanolamine-phosphate cytidylyltransferase activity	g.chr17:79867409G>A	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.159C>T	17.37:g.79867409G>A			Somatic				PCYT2_uc010wva.1_Silent_p.I21I|PCYT2_uc010wvb.1_Silent_p.I21I|PCYT2_uc002kce.1_5'UTR|PCYT2_uc002kcg.1_Silent_p.I64I|PCYT2_uc002kch.1_Silent_p.I53I|PCYT2_uc002kci.1_5'UTR|PCYT2_uc010dii.1_Silent_p.I53I|PCYT2_uc010wvc.1_5'UTR	p.I53I	NM_002861	NP_002852	WXS	Illumina HiSeq	Unspecified	Q99447	PCY2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		2	222	-	all_neural(118;0.0878)|Ovarian(332;0.12)		53			Catalytic 1 (Potential).		B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Silent	SNP	ENST00000538936.2	37	c.159C>T	CCDS11791.1																																																																																				0.632	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861		5	134	0	0	0	0.001984	0	5	134				
GPS1	2873	broad.mit.edu	37	17	80014187	80014187	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:80014187G>A	ENST00000306823.6	+	9	990	c.967G>A	c.(967-969)Gag>Aag	p.E323K	GPS1_ENST00000320548.4_Missense_Mutation_p.E303K|GPS1_ENST00000578552.1_Missense_Mutation_p.E319K|GPS1_ENST00000392358.2_Missense_Mutation_p.E359K|GPS1_ENST00000355130.2_Missense_Mutation_p.E359K			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	323					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)	p.E359K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CTTGGAGCTGGAGCCACAGGT	0.582																																							uc002kdl.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(967-969)GAG>AAG		G protein pathway suppressor 1 isoform 2							110.0	118.0	115.0					17																	80014187		2203	4300	6503	SO:0001583	missense	2873				cell cycle|cullin deneddylation|inactivation of MAPK activity|JNK cascade	cytoplasm|signalosome	GTPase inhibitor activity|protein binding	g.chr17:80014187G>A		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.967G>A	17.37:g.80014187G>A	ENSP00000302873:p.Glu323Lys		Somatic				GPS1_uc002kdk.1_Missense_Mutation_p.E359K|GPS1_uc010dij.1_Missense_Mutation_p.E358K|GPS1_uc002kdm.1_Missense_Mutation_p.E303K|GPS1_uc002kdn.1_Missense_Mutation_p.E319K|GPS1_uc002kdo.1_Missense_Mutation_p.E322K|GPS1_uc010wvh.1_Missense_Mutation_p.E315K	p.E323K	NM_004127	NP_004118	WXS	Illumina HiSeq	Unspecified	Q13098	CSN1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)		9	1012	+	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		323					Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	c.967G>A	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	g	24.2	4.509493	0.85282	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000306823;ENST00000355130	.	.	.	4.96	4.96	0.65561	.	0.110952	0.64402	D	0.000011	T	0.78483	0.4290	M	0.92169	3.28	0.80722	D	1	P;P;P;P;D;P	0.54601	0.84;0.892;0.721;0.9;0.967;0.838	B;B;B;P;P;P	0.50109	0.267;0.412;0.26;0.552;0.631;0.499	D	0.85085	0.0948	9	0.62326	D	0.03	-28.975	18.25	0.89998	0.0:0.0:1.0:0.0	.	315;358;308;319;323;359	B4DND6;A8K070;Q13098-6;Q13098-5;Q13098;Q13098-7	.;.;.;.;CSN1_HUMAN;.	K	359;309;323;359	.	ENSP00000302873:E323K	E	+	1	0	GPS1	77607476	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.229000	0.95273	2.313000	0.78055	0.552000	0.68991	GAG		0.582	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492		35	189	0	0	0	0.013114	0	35	189				
FOXK2	3607	broad.mit.edu	37	17	80542037	80542037	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr17:80542037G>A	ENST00000335255.5	+	6	1426	c.1252G>A	c.(1252-1254)Gaa>Aaa	p.E418K	snoU13_ENST00000459591.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	418					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E418K(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			TGTCATCCAGGAAGCCCGGTT	0.682																																							uc002kfn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1252-1254)GAA>AAA		forkhead box K2							21.0	22.0	22.0					17																	80542037		2201	4300	6501	SO:0001583	missense	3607				embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr17:80542037G>A	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1252G>A	17.37:g.80542037G>A	ENSP00000335677:p.Glu418Lys		Somatic				FOXK2_uc002kfm.1_Missense_Mutation_p.E418K|FOXK2_uc010diu.2_Intron	p.E418K	NM_004514	NP_004505	WXS	Illumina HiSeq	Unspecified	Q01167	FOXK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)		6	1423	+	Breast(20;0.00106)|all_neural(118;0.0952)		418					A6NEP5|Q13622|Q13623|Q13624	Missense_Mutation	SNP	ENST00000335255.5	37	c.1252G>A	CCDS11813.1	.	.	.	.	.	.	.	.	.	.	G	36	5.976299	0.97162	.	.	ENSG00000141568	ENST00000535184;ENST00000335255	D	0.94000	-3.33	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.95560	0.8557	L	0.57536	1.79	0.80722	D	1	D;D	0.69078	0.989;0.997	P;D	0.68943	0.77;0.961	D	0.93940	0.7222	10	0.29301	T	0.29	.	18.8078	0.92045	0.0:0.0:1.0:0.0	.	418;418	Q01167;Q01167-2	FOXK2_HUMAN;.	K	414;418	ENSP00000335677:E418K	ENSP00000335677:E418K	E	+	1	0	FOXK2	78135326	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.466000	0.97665	2.677000	0.91161	0.655000	0.94253	GAA		0.682	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430		3	22	0	0	0	0.004672	0	3	22				
DLGAP1	9229	broad.mit.edu	37	18	3729134	3729134	+	Splice_Site	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:3729134C>A	ENST00000315677.3	-	7	2187		c.e7+1		DLGAP1_ENST00000400150.3_Splice_Site|DLGAP1_ENST00000534970.1_Splice_Site|DLGAP1_ENST00000581699.1_Splice_Site|DLGAP1_ENST00000539435.1_Splice_Site|DLGAP1_ENST00000584874.1_Splice_Site|DLGAP1_ENST00000581527.1_Splice_Site|DLGAP1_ENST00000478161.1_Splice_Site|DLGAP1_ENST00000400147.2_Splice_Site|DLGAP1_ENST00000400155.1_Splice_Site|DLGAP1_ENST00000400149.3_Splice_Site|DLGAP1_ENST00000515196.2_Splice_Site|DLGAP1_ENST00000400145.2_Splice_Site	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1						synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.?(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CGCGCACTCACCCGTGCTGCT	0.637																																							uc002kmf.2		NA																	2	Unknown(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.e4+1		discs large homolog-associated protein 1 isoform							36.0	31.0	33.0					18																	3729134		2203	4299	6502	SO:0001630	splice_region_variant	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3729134C>A	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1591+1G>T	18.37:g.3729134C>A			Somatic				DLGAP1_uc010wyz.1_Splice_Site_p.V531_splice|DLGAP1_uc002kme.1_Splice_Site_p.V229_splice|DLGAP1_uc010dkn.2_Splice_Site_p.G229_splice|DLGAP1_uc010wyw.1_Splice_Site_p.V237_splice|DLGAP1_uc010wyx.1_Splice_Site_p.G243_splice|DLGAP1_uc010wyy.1_Splice_Site_p.A243_splice|DLGAP1_uc002kmg.2_Splice_Site_p.V229_splice|DLGAP1_uc002kmk.2_Splice_Site_p.G531_splice	p.V531_splice	NM_004746	NP_004737	WXS	Illumina HiSeq	Unspecified	O14490	DLGP1_HUMAN			4	1658	-		Colorectal(8;0.0257)						A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Splice_Site	SNP	ENST00000315677.3	37	c.1591_splice	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421348	0.83559	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2624	0.98452	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DLGAP1	3719134	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.481000	0.81124	2.782000	0.95742	0.558000	0.71614	.		0.637	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		Intron	17	15	1	0	3.41278e-10	0.00499	4.0433e-10	17	15				
ARHGAP28	79822	broad.mit.edu	37	18	6889985	6889985	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:6889985C>T	ENST00000383472.4	+	13	1739	c.1635C>T	c.(1633-1635)ttC>ttT	p.F545F	ARHGAP28_ENST00000262227.3_Silent_p.F493F|ARHGAP28_ENST00000418986.1_Silent_p.F386F|ARHGAP28_ENST00000419673.2_Silent_p.F386F|ARHGAP28_ENST00000400091.2_Silent_p.F545F|ARHGAP28_ENST00000532996.1_Silent_p.F368F|ARHGAP28_ENST00000314319.3_Silent_p.F386F|ARHGAP28_ENST00000531294.1_Silent_p.F381F			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	545	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.F545F(1)|p.F386F(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				ACCTTTTCTTCAGTAGAAGCA	0.408																																							uc010wzi.1		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1102-1104)TTC>TTT		SubName: Full=Putative uncharacterized protein ARHGAP28;							149.0	144.0	146.0					18																	6889985		2203	4300	6503	SO:0001819	synonymous_variant	79822				signal transduction	intracellular		g.chr18:6889985C>T	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1635C>T	18.37:g.6889985C>T			Somatic				ARHGAP28_uc002knc.2_Silent_p.F493F|ARHGAP28_uc002knd.2_Silent_p.F386F|ARHGAP28_uc002kne.2_Silent_p.F386F|ARHGAP28_uc002knf.2_Silent_p.F377F	p.F368F			WXS	Illumina HiSeq	Unspecified	B4DXL2	B4DXL2_HUMAN			12	1342	+		Colorectal(10;0.168)	368					A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	ENST00000383472.4	37	c.1104C>T																																																																																					0.408	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108		7	157	0	0	0	0.00308	0	7	157				
ARHGAP28	79822	broad.mit.edu	37	18	6890048	6890048	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:6890048C>T	ENST00000383472.4	+	13	1802	c.1698C>T	c.(1696-1698)atC>atT	p.I566I	ARHGAP28_ENST00000262227.3_Silent_p.I514I|ARHGAP28_ENST00000418986.1_Silent_p.I407I|ARHGAP28_ENST00000419673.2_Silent_p.I407I|ARHGAP28_ENST00000400091.2_Silent_p.I566I|ARHGAP28_ENST00000532996.1_Silent_p.I389I|ARHGAP28_ENST00000314319.3_Silent_p.I407I|ARHGAP28_ENST00000531294.1_Silent_p.I402I			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	566	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.I407I(1)|p.I566I(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CCCACATCATCCGCCTAATGC	0.448																																							uc010wzi.1		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1165-1167)ATC>ATT		SubName: Full=Putative uncharacterized protein ARHGAP28;							125.0	119.0	121.0					18																	6890048		2203	4300	6503	SO:0001819	synonymous_variant	79822				signal transduction	intracellular		g.chr18:6890048C>T	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1698C>T	18.37:g.6890048C>T			Somatic				ARHGAP28_uc002knc.2_Silent_p.I514I|ARHGAP28_uc002knd.2_Silent_p.I407I|ARHGAP28_uc002kne.2_Silent_p.I407I|ARHGAP28_uc002knf.2_Silent_p.I398I	p.I389I			WXS	Illumina HiSeq	Unspecified	B4DXL2	B4DXL2_HUMAN			12	1405	+		Colorectal(10;0.168)	389					A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	ENST00000383472.4	37	c.1167C>T																																																																																					0.448	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108		6	152	0	0	0	0.001984	0	6	152				
ZNF271	10778	broad.mit.edu	37	18	32887308	32887308	+	RNA	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:32887308C>T	ENST00000399070.3	+	0	1702					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I240I(1)		large_intestine(3)|lung(9)	12						TATTCTTCATCAGAGAATTCA	0.408																																							uc002kyq.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(718-720)ATC>ATT		SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;							53.0	54.0	54.0					18																	32887308		2203	4300	6503			10778							g.chr18:32887308C>T	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32887308C>T			Somatic				ZNF271_uc002kyp.3_Silent_p.I240I|ZNF271_uc002kyr.3_Silent_p.I240I	p.I240I	NR_024565		WXS	Illumina HiSeq	Unspecified					3	1712	+								B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	Silent	SNP	ENST00000399070.3	37	c.720C>T																																																																																					0.408	ZNF271-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255767.2	NR_024565		6	109	0	0	0	0.001984	0	6	109				
SERPINB3	6317	broad.mit.edu	37	18	61328318	61328318	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:61328318C>T	ENST00000283752.5	-	2	276	c.133G>A	c.(133-135)Gcc>Acc	p.A45T	SERPINB3_ENST00000332821.8_Missense_Mutation_p.A45T|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	45					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)	p.A45T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TTGTCTTTGGCTCCTAAGAGG	0.438																																							uc002ljg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(133-135)GCC>ACC		SubName: Full=Squamous cell carcinoma antigen 2;							243.0	211.0	222.0					18																	61328318		2203	4300	6503	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61328318C>T	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.133G>A	18.37:g.61328318C>T	ENSP00000283752:p.Ala45Thr		Somatic				SERPINB3_uc002lji.2_Missense_Mutation_p.A45T|SERPINB3_uc010dqa.2_Missense_Mutation_p.A45T|SERPINB3_uc010dqb.2_Missense_Mutation_p.A45T|SERPINB3_uc010dqc.2_Missense_Mutation_p.A45T	p.A45T			WXS	Illumina HiSeq	Unspecified	P48594	SPB4_HUMAN			1	159	-			45					A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	c.133G>A	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	C	6.478	0.456458	0.12283	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.88431	-2.38;-2.38	3.1	-2.53	0.06326	Serpin domain (3);	1.521620	0.04448	N	0.372032	D	0.90031	0.6887	M	0.72118	2.19	0.09310	N	1	P;B;P;B;B	0.45176	0.852;0.423;0.673;0.423;0.423	P;B;B;B;B	0.51701	0.677;0.24;0.444;0.24;0.24	T	0.78833	-0.2048	10	0.41790	T	0.15	.	5.0009	0.14264	0.4444:0.3876:0.0:0.168	.	45;45;45;45;45	B3W5Y6;A8K847;P29508-2;P29508;Q5K684	.;.;.;SPB3_HUMAN;.	T	45	ENSP00000283752:A45T;ENSP00000329498:A45T	ENSP00000283752:A45T	A	-	1	0	SERPINB3	59479298	0.654000	0.27367	0.000000	0.03702	0.001000	0.01503	1.434000	0.34958	-0.644000	0.05465	-1.130000	0.01982	GCC		0.438	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		5	166	0	0	0	0.000602	0	5	166				
SERPINB10	5273	broad.mit.edu	37	18	61602377	61602378	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr18:61602377_61602378CC>TT	ENST00000238508.3	+	8	1154_1155	c.1095_1096CC>TT	c.(1093-1098)gtCCca>gtTTca	p.P366S	AC009802.1_ENST00000599868.1_Intron	NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	366					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P366S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GAATTAGAGTCCCATCCATTGA	0.386																																							uc010xev.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)|skin(1)	3						c.(1093-1098)GTCCCA>GTTTCA		serine (or cysteine) proteinase inhibitor, clade																																				SO:0001583	missense	5273					cytoplasm|nucleus	serine-type endopeptidase inhibitor activity	g.chr18:61602377_61602378CC>TT	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	Exception_encountered	18.37:g.61602377_61602378delinsTT	ENSP00000238508:p.Pro366Ser		Somatic				SERPINB10_uc010xew.1_Missense_Mutation_p.P366S	p.P366S	NM_005024	NP_005015	WXS	Illumina HiSeq	Unspecified	P48595	SPB10_HUMAN			8	1185_1186	+		Esophageal squamous(42;0.131)	366					Q4VAX4|Q4VAX7	Missense_Mutation	DNP	ENST00000238508.3	37	c.1095_1096CC>TT	CCDS11990.1																																																																																				0.386	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024		5	181	0	0	0	0.004672	0	5	181				
MIER2	54531	broad.mit.edu	37	19	326574	326574	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:326574C>G	ENST00000264819.4	-	6	528	c.518G>C	c.(517-519)aGa>aCa	p.R173T	MIER2_ENST00000592722.1_5'Flank	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	173					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R173T(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGCTCTCTGTCTTCATC	0.562																																							uc002lok.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(517-519)AGA>ACA		mesoderm induction early response 1, family							111.0	109.0	110.0					19																	326574		2203	4300	6503	SO:0001583	missense	54531				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr19:326574C>G	AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.518G>C	19.37:g.326574C>G	ENSP00000264819:p.Arg173Thr		Somatic					p.R173T	NM_017550	NP_060020	WXS	Illumina HiSeq	Unspecified	Q8N344	MIER2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	6	527	-		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)	173					Q9ULM7	Missense_Mutation	SNP	ENST00000264819.4	37	c.518G>C	CCDS32855.1	.	.	.	.	.	.	.	.	.	.	C	1.213	-0.629067	0.03610	.	.	ENSG00000105556	ENST00000264819	T	0.22945	1.93	4.65	0.266	0.15617	.	0.551738	0.16099	N	0.229652	T	0.13114	0.0318	N	0.22421	0.69	0.09310	N	1	B	0.20887	0.049	B	0.15484	0.013	T	0.23368	-1.0190	10	0.27082	T	0.32	-5.6411	5.149	0.15000	0.0:0.3295:0.1511:0.5194	.	173	Q8N344	MIER2_HUMAN	T	173	ENSP00000264819:R173T	ENSP00000264819:R173T	R	-	2	0	MIER2	277574	0.114000	0.22134	0.000000	0.03702	0.045000	0.14185	0.590000	0.23954	-0.196000	0.10366	-0.247000	0.11927	AGA		0.562	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451784.1	XM_041843		6	95	0	0	0	0.001168	0	6	95				
STK11	6794	broad.mit.edu	37	19	1220449	1220449	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:1220449A>T	ENST00000326873.7	+	4	1715	c.542A>T	c.(541-543)aAc>aTc	p.N181I		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	181	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> E (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39; requires 2 nucleotide substitutions).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(4)|p.N181I(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGCCGGGGAACCTGCTGCTC	0.662		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		29	Whole gene deletion(20)|Unknown(4)|Deletion - Frameshift(4)|Substitution - Missense(1)	p.0?(19)|p.Y156fs*87(4)|p.?(4)	cervix(15)|lung(10)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM002108	STK11	M		c.(541-543)AAC>ATC		serine/threonine protein kinase 11							44.0	51.0	49.0					19																	1220449		2084	4233	6317	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220449A>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.542A>T	19.37:g.1220449A>T	ENSP00000324856:p.Asn181Ile	TSP Lung(3;<1E-08)	Somatic					p.N181I	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1657	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	181		N -> E (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39; requires 2 nucleotide substitutions).	Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.542A>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.915027	0.72983	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.92048	-2.96	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98080	0.9367	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99529	1.0960	10	0.87932	D	0	-76.3308	14.9586	0.71138	1.0:0.0:0.0:0.0	.	181	Q15831	STK11_HUMAN	I	181	ENSP00000324856:N181I	ENSP00000324856:N181I	N	+	2	0	STK11	1171449	1.000000	0.71417	0.997000	0.53966	0.217000	0.24651	9.209000	0.95087	2.135000	0.66039	0.459000	0.35465	AAC		0.662	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		3	4	0	0	0	0.004672	0	3	4				
TCF3	6929	broad.mit.edu	37	19	1619133	1619133	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:1619133G>C	ENST00000262965.5	-	16	1771	c.1427C>G	c.(1426-1428)tCt>tGt	p.S476C	TCF3_ENST00000395423.3_Missense_Mutation_p.S425C|TCF3_ENST00000588136.1_Missense_Mutation_p.S476C|TCF3_ENST00000344749.5_Missense_Mutation_p.S476C|TCF3_ENST00000453954.2_Missense_Mutation_p.S392C|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S476C(2)		breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGGCCGAGACAGGTCAGG	0.657			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																		uc002ltr.2		NA		Dom	yes		19	19p13.3	6929	T	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)			L	PBX1|HLF|TFPT		pre B-ALL		2	Substitution - Missense(2)		lung(2)	lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7						c.(1426-1428)TCT>TGT		transcription factor 3 isoform E12							69.0	74.0	72.0					19																	1619133		2203	4300	6503	SO:0001583	missense	6929				B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding	g.chr19:1619133G>C	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1427C>G	19.37:g.1619133G>C	ENSP00000262965:p.Ser476Cys		Somatic				TCF3_uc002lto.2_Missense_Mutation_p.S237C|TCF3_uc002ltt.3_Missense_Mutation_p.S476C|TCF3_uc002ltq.2_Missense_Mutation_p.S425C|TCF3_uc002lts.1_Missense_Mutation_p.S392C|TCF3_uc010dso.1_RNA	p.S476C	NM_003200	NP_003191	WXS	Illumina HiSeq	Unspecified	P15923	TFE2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	16	1494	-		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)	476					Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	c.1427C>G	CCDS12074.1	.	.	.	.	.	.	.	.	.	.	G	9.999	1.232895	0.22626	.	.	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423;ENST00000536553	T;T;T	0.57907	0.37;0.37;0.37	3.89	3.89	0.44902	.	0.921443	0.08705	U	0.905758	T	0.64605	0.2613	M	0.71581	2.175	0.09310	N	1	D;D;P;B;P	0.56521	0.976;0.963;0.938;0.029;0.833	P;P;B;B;B	0.56127	0.792;0.73;0.417;0.009;0.405	T	0.51140	-0.8743	10	0.48119	T	0.1	-2.2751	8.531	0.33335	0.0:0.1652:0.6646:0.1702	.	476;150;476;425;413	P15923-2;F5GZ25;P15923;Q2TB39;Q6PJU3	.;.;TFE2_HUMAN;.;.	C	476;476;476;425;150	ENSP00000262965:S476C;ENSP00000344375:S476C;ENSP00000378813:S425C	ENSP00000262965:S476C	S	-	2	0	TCF3	1570133	0.000000	0.05858	0.046000	0.18839	0.009000	0.06853	0.437000	0.21543	1.687000	0.51057	0.561000	0.74099	TCT		0.657	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200		6	64	0	0	0	0.001984	0	6	64				
DOT1L	84444	broad.mit.edu	37	19	2222272	2222272	+	Nonsense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:2222272C>G	ENST00000398665.3	+	24	3140	c.3104C>G	c.(3103-3105)tCa>tGa	p.S1035*		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1035					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.S1035*(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCGGCTTCTCAGATCCTGAG	0.667																																							uc002lvb.3		NA																	2	Substitution - Nonsense(2)		lung(2)	pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4						c.(3103-3105)TCA>TGA		DOT1-like, histone H3 methyltransferase							35.0	43.0	41.0					19																	2222272		2067	4208	6275	SO:0001587	stop_gained	84444					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr19:2222272C>G	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3104C>G	19.37:g.2222272C>G	ENSP00000381657:p.Ser1035*		Somatic				DOT1L_uc002lvc.1_Nonsense_Mutation_p.S329*|DOT1L_uc002lve.1_3'UTR	p.S1035*	NM_032482	NP_115871	WXS	Illumina HiSeq	Unspecified	Q8TEK3	DOT1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	24	3140	+		Hepatocellular(1079;0.137)	1035					O60379|Q96JL1	Nonsense_Mutation	SNP	ENST00000398665.3	37	c.3104C>G	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.340945|6.340945	0.97489|0.97489	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000440640|ENST00000398665;ENST00000221482	.|.	.|.	.|.	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.549080	.|0.18100	.|N	.|0.151706	T|.	0.74543|.	0.3730|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81737|.	-0.0796|.	3|.	.|0.87932	.|D	.|0	-9.896|-9.896	15.2322|15.2322	0.73401|0.73401	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	822|1035	.|.	.|ENSP00000221482:S1035X	Q|S	+|+	1|2	0|0	DOT1L|DOT1L	2173272|2173272	0.997000|0.997000	0.39634|0.39634	0.914000|0.914000	0.36105|0.36105	0.174000|0.174000	0.22865|0.22865	3.863000|3.863000	0.56016|0.56016	2.274000|2.274000	0.75844|0.75844	0.462000|0.462000	0.41574|0.41574	CAG|TCA		0.667	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482		3	45	0	0	0	0.009096	0	3	45				
CREB3L3	84699	broad.mit.edu	37	19	4171672	4171672	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:4171672C>T	ENST00000078445.2	+	10	1239	c.1092C>T	c.(1090-1092)caC>caT	p.H364H	CREB3L3_ENST00000602257.1_Silent_p.H362H|CREB3L3_ENST00000252587.3_Missense_Mutation_p.T253I|CREB3L3_ENST00000602147.1_Nonsense_Mutation_p.Q329*|CREB3L3_ENST00000595923.1_Silent_p.H363H	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	364		Cleavage; by PS1. {ECO:0000250}.			positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.H364H(1)		breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACTTTGCACAACGATGCTG	0.642																																							uc002lzl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1090-1092)CAC>CAT		cAMP responsive element binding protein 3-like							66.0	78.0	74.0					19																	4171672		2199	4289	6488	SO:0001819	synonymous_variant	84699				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:4171672C>T		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.1092C>T	19.37:g.4171672C>T			Somatic				CREB3L3_uc002lzm.2_Silent_p.H354H|CREB3L3_uc010xib.1_Silent_p.H353H|CREB3L3_uc010xic.1_Nonsense_Mutation_p.Q320*	p.H364H	NM_032607	NP_115996	WXS	Illumina HiSeq	Unspecified	Q68CJ9	CR3L3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)	10	1208	+			364			Lumenal (Potential).	Cleavage; by PS1 (By similarity).	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Silent	SNP	ENST00000078445.2	37	c.1092C>T	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946564	0.53186	.	.	ENSG00000060566	ENST00000252587	T	0.78924	-1.22	3.53	2.49	0.30216	.	.	.	.	.	T	0.74145	0.3678	.	.	.	0.21627	N	0.999611	.	.	.	.	.	.	T	0.66312	-0.5955	6	0.87932	D	0	-1.3835	6.0816	0.19944	0.0:0.8604:0.0:0.1396	.	.	.	.	I	253	ENSP00000252587:T253I	ENSP00000252587:T253I	T	+	2	0	CREB3L3	4122672	0.999000	0.42202	0.957000	0.39632	0.904000	0.53231	1.327000	0.33746	1.974000	0.57490	0.561000	0.74099	ACA		0.642	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607		24	158	0	0	0	0.008361	0	24	158				
INSR	3643	broad.mit.edu	37	19	7125477	7125477	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:7125477G>T	ENST00000302850.5	-	17	3217	c.3075C>A	c.(3073-3075)ctC>ctA	p.L1025L	INSR_ENST00000341500.5_Silent_p.L1013L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1025	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.L1025L(2)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCTCTCGAAGGAGGGTGATCT	0.572																																							uc002mgd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12						c.(3073-3075)CTC>CTA		insulin receptor isoform Long precursor	Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						120.0	97.0	104.0					19																	7125477		2203	4300	6503	SO:0001819	synonymous_variant	3643				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding	g.chr19:7125477G>T	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3075C>A	19.37:g.7125477G>T			Somatic				INSR_uc002mge.1_Silent_p.L1013L	p.L1025L	NM_000208	NP_000199	WXS	Illumina HiSeq	Unspecified	P06213	INSR_HUMAN			17	3184	-			1025			Protein kinase.|Cytoplasmic (Potential).		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	c.3075C>A	CCDS12176.1																																																																																				0.572	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			8	69	1	0	7.48243e-07	0.006214	8.73671e-07	8	69				
RDH8	50700	broad.mit.edu	37	19	10132255	10132255	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:10132255C>T	ENST00000171214.1	+	6	1015	c.766C>T	c.(766-768)Cag>Tag	p.Q256*	RDH8_ENST00000591589.1_Nonsense_Mutation_p.Q276*	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	256					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.Q256*(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	CCTGCGCCGACAGACCAACAT	0.637																																							uc002mmr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(766-768)CAG>TAG		retinol dehydrogenase 8 (all-trans)	Vitamin A(DB00162)						98.0	90.0	93.0					19																	10132255		2203	4300	6503	SO:0001587	stop_gained	50700				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity	g.chr19:10132255C>T	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.766C>T	19.37:g.10132255C>T	ENSP00000171214:p.Gln256*		Somatic					p.Q256*	NM_015725	NP_056540	WXS	Illumina HiSeq	Unspecified	Q9NYR8	RDH8_HUMAN	Epithelial(33;4.24e-05)		6	1015	+			256					Q9H838	Nonsense_Mutation	SNP	ENST00000171214.1	37	c.766C>T		.	.	.	.	.	.	.	.	.	.	C	24.3	4.511479	0.85389	.	.	ENSG00000080511	ENST00000171214	.	.	.	4.56	4.56	0.56223	.	0.149889	0.45867	D	0.000328	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	14.8275	0.70125	0.0:1.0:0.0:0.0	.	.	.	.	X	256	.	ENSP00000171214:Q256X	Q	+	1	0	RDH8	9993255	1.000000	0.71417	0.971000	0.41717	0.049000	0.14656	5.504000	0.66968	2.085000	0.62840	0.297000	0.19635	CAG		0.637	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				12	14	0	0	0	0.004007	0	12	14				
KEAP1	9817	broad.mit.edu	37	19	10602581	10602581	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:10602581C>T	ENST00000171111.5	-	3	1544	c.997G>A	c.(997-999)Ggc>Agc	p.G333S	KEAP1_ENST00000393623.2_Missense_Mutation_p.G333S|KEAP1_ENST00000588024.1_5'Flank|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	333			G -> C (in a NSCLC cell line; strongly reduces interaction with NFE2L2 and reduces repression of NFE2L2-dependent gene expression). {ECO:0000269|PubMed:17020408}.		cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.G333S(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CGGAAGTAGCCGCCCGCGGTG	0.677																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(997-999)GGC>AGC		kelch-like ECH-associated protein 1							23.0	26.0	25.0					19																	10602581		2201	4298	6499	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602581C>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.997G>A	19.37:g.10602581C>T	ENSP00000171111:p.Gly333Ser		Somatic				KEAP1_uc002mop.1_Missense_Mutation_p.G51S|KEAP1_uc002mor.1_Missense_Mutation_p.G333S	p.G333S	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	1153	-			333		G -> C (in a NSCLC cell line; strongly reduces interaction with NFE2L2 and reduces repression of NFE2L2-dependent gene expression).	Kelch 1.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.997G>A	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	35	5.475979	0.96291	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.99494	-6.01;-6.01	5.52	5.52	0.82312	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99667	0.9876	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97725	1.0199	10	0.72032	D	0.01	.	16.9299	0.86188	0.0:1.0:0.0:0.0	.	333	Q14145	KEAP1_HUMAN	S	333	ENSP00000171111:G333S;ENSP00000377245:G333S	ENSP00000171111:G333S	G	-	1	0	KEAP1	10463581	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.129000	0.77225	2.609000	0.88269	0.561000	0.74099	GGC		0.677	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		15	11	0	0	0	0.006122	0	15	11				
PRKCSH	5589	broad.mit.edu	37	19	11560101	11560101	+	Silent	SNP	A	A	G	rs369863173		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:11560101A>G	ENST00000589838.1	+	16	1461	c.1461A>G	c.(1459-1461)aaA>aaG	p.K487K	PRKCSH_ENST00000252455.2_Silent_p.K487K|PRKCSH_ENST00000412601.1_Silent_p.K484K|PRKCSH_ENST00000587327.1_Silent_p.K484K|PRKCSH_ENST00000592741.1_Silent_p.K494K|PRKCSH_ENST00000591462.1_Silent_p.K484K			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	487					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.K487K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						TGTGCGGGAAAGAGACCATGG	0.692																																							uc002mrt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1459-1461)AAA>AAG		protein kinase C substrate 80K-H isoform 1		A	,	0,4406		0,0,2203	58.0	53.0	55.0		1452,1461	-1.6	0.7	19		55	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	PRKCSH	NM_001001329.1,NM_002743.2	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	484/526,487/529	11560101	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5589				innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding	g.chr19:11560101A>G		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.1461A>G	19.37:g.11560101A>G			Somatic				PRKCSH_uc002mru.2_Silent_p.K484K|PRKCSH_uc010xlz.1_Silent_p.K494K|PRKCSH_uc010dya.2_Silent_p.K269K|PRKCSH_uc010dyb.2_Silent_p.K484K	p.K487K	NM_002743	NP_002734	WXS	Illumina HiSeq	Unspecified	P14314	GLU2B_HUMAN			17	1797	+			487					A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	c.1461A>G	CCDS32911.1																																																																																				0.692	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1			18	85	0	0	0	0.008871	0	18	85				
ZNF878	729747	broad.mit.edu	37	19	12157506	12157506	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:12157506G>A	ENST00000547628.1	-	2	210	c.73C>T	c.(73-75)Cag>Tag	p.Q25*	CTD-2006C1.10_ENST00000547473.1_Nonsense_Mutation_p.Q25*|CTD-2006C1.2_ENST00000591838.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|ZNF878_ENST00000602107.1_Nonsense_Mutation_p.Q72*|CTD-2006C1.2_ENST00000591898.1_RNA	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	25	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.Q25*(2)		cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						AGATTTTTCTGGGAAGGATCC	0.478																																							uc002mta.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(214-216)CAG>TAG		zinc finger protein 878							121.0	131.0	128.0					19																	12157506		2203	4300	6503	SO:0001587	stop_gained	729747				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:12157506G>A		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.73C>T	19.37:g.12157506G>A	ENSP00000447931:p.Gln25*		Somatic					p.Q72*	NM_001080404	NP_001073873	WXS	Illumina HiSeq	Unspecified	C9JN71	ZN878_HUMAN			3	214	-			25			KRAB.			Nonsense_Mutation	SNP	ENST00000547628.1	37	c.214C>T	CCDS45984.2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998245	0.74818	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	.	.	.	0.746	0.746	0.18365	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.9564	0.24574	0.0:0.0:1.0:0.0	.	.	.	.	X	25;72	.	ENSP00000447931:Q25X	Q	-	1	0	AC022415.4;ZNF878	12018506	0.517000	0.26226	0.674000	0.29902	0.722000	0.41435	1.435000	0.34969	0.675000	0.31264	0.313000	0.20887	CAG		0.478	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1	NM_001080404		27	145	0	0	0	0.003954	0	27	145				
CTC-260E6.6	0	broad.mit.edu	37	19	20369582	20369582	+	RNA	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:20369582G>C	ENST00000593655.1	-	0	199																											ATCTTACCAGGAGACTGGATA	0.443																																							uc002nov.2		NA																	0					0						c.(373-375)AGG>AGC		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20369582G>C																													19.37:g.20369582G>C			Somatic					p.R125S	NR_003128		WXS	Illumina HiSeq	Unspecified					1	1126	+									Missense_Mutation	SNP	ENST00000593655.1	37	c.375G>C																																																																																					0.443	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			3	147	0	0	0	0.004672	0	3	147				
ZNF91	7644	broad.mit.edu	37	19	23542873	23542873	+	Missense_Mutation	SNP	C	C	G	rs1816638		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:23542873C>G	ENST00000300619.7	-	4	3113	c.2908G>C	c.(2908-2910)Gaa>Caa	p.E970Q	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.E938Q|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	970					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E970Q(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGCCACATTCTTCACATTTG	0.368																																							uc002nre.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2908-2910)GAA>CAA		zinc finger protein 91							63.0	66.0	65.0					19																	23542873		2137	4267	6404	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23542873C>G	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2908G>C	19.37:g.23542873C>G	ENSP00000300619:p.Glu970Gln		Somatic				ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.E938Q	p.E970Q	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			4	3021	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	970			C2H2-type 30.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.2908G>C	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	1.112	-0.657914	0.03454	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.07444	3.19;3.19	1.52	0.076	0.14401	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10165	0.0249	N	0.10782	0.045	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.69824	0.948;0.966	T	0.41928	-0.9481	9	0.31617	T	0.26	.	8.5883	0.33670	0.0:0.7608:0.2391:0.0	.	938;970	Q05481-2;Q05481	.;ZNF91_HUMAN	Q	970;938	ENSP00000300619:E970Q;ENSP00000380272:E938Q	ENSP00000300619:E970Q	E	-	1	0	ZNF91	23334713	0.000000	0.05858	0.502000	0.27614	0.071000	0.16799	-0.654000	0.05354	0.798000	0.33994	0.205000	0.17691	GAA		0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		5	138	0	0	0	0.001168	0	5	138				
ZNF781	163115	broad.mit.edu	37	19	38160502	38160502	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:38160502A>C	ENST00000590008.1	-	5	1400	c.548T>G	c.(547-549)aTa>aGa	p.I183R	ZNF781_ENST00000358582.4_Missense_Mutation_p.I183R|ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000593040.1_5'Flank			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I183R(1)		NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						TTGAGCAATTATTGAATGCTT	0.378																																							uc002ogy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(547-549)ATA>AGA		zinc finger protein 781							87.0	84.0	85.0					19																	38160502		2203	4300	6503	SO:0001583	missense	163115				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38160502A>C	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.548T>G	19.37:g.38160502A>C	ENSP00000466370:p.Ile183Arg		Somatic				ZNF781_uc002ogz.2_Missense_Mutation_p.I178R	p.I183R	NM_152605	NP_689818	WXS	Illumina HiSeq	Unspecified	Q8N8C0	ZN781_HUMAN			4	1290	-			183					Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	37	c.548T>G	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.325671	0.24080	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.05139	3.49	2.43	-1.76	0.08006	.	.	.	.	.	T	0.02807	0.0084	L	0.27053	0.805	0.09310	N	1	P	0.35821	0.523	B	0.26770	0.073	T	0.40098	-0.9581	9	0.25751	T	0.34	17.3846	0.4297	0.00469	0.3294:0.1732:0.1262:0.3711	.	183	Q8N8C0	ZN781_HUMAN	R	183	ENSP00000351391:I183R	ENSP00000351391:I183R	I	-	2	0	ZNF781	42852342	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.613000	0.00883	-0.701000	0.05063	-0.609000	0.04063	ATA		0.378	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605		22	103	0	0	0	0.00278	0	22	103				
PSG5	5673	broad.mit.edu	37	19	43680050	43680050	+	Silent	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:43680050G>C	ENST00000366175.3	-	3	811	c.681C>G	c.(679-681)cgC>cgG	p.R227R	PSG5_ENST00000407356.1_Silent_p.R227R|PSG5_ENST00000342951.6_Silent_p.R227R|PSG5_ENST00000407568.1_Intron|PSG5_ENST00000599812.1_Silent_p.R320R|PSG5_ENST00000404580.1_Silent_p.R227R			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	227	Ig-like C2-type 1.		R -> H (in dbSNP:rs1058285). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:1922019, ECO:0000269|PubMed:2735907, ECO:0000269|PubMed:2789512}.		female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R227R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CTGGGTCACTGCGCATGCCAC	0.493																																							uc002ovu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)	3						c.(679-681)CGC>CGG		pregnancy specific beta-1-glycoprotein 5							162.0	156.0	158.0					19																	43680050		2201	4295	6496	SO:0001819	synonymous_variant	5673				female pregnancy	extracellular region		g.chr19:43680050G>C		CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.681C>G	19.37:g.43680050G>C			Somatic				PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Intron|PSG5_uc002ovx.2_Silent_p.R227R|PSG5_uc002ovv.2_Silent_p.R320R|PSG5_uc002ovw.2_Intron	p.R227R	NM_002781	NP_002772	WXS	Illumina HiSeq	Unspecified	Q15238	PSG5_HUMAN			3	812	-		Prostate(69;0.00899)	227			Ig-like C2-type 1.		Q15239|Q96QJ1|Q9UQ75	Silent	SNP	ENST00000366175.3	37	c.681C>G	CCDS12617.1																																																																																				0.493	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1	NM_002781		79	148	0	0	0	0.01441	0	79	148				
EML2	24139	broad.mit.edu	37	19	46124837	46124837	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:46124837G>A	ENST00000245925.3	-	10	950	c.900C>T	c.(898-900)ctC>ctT	p.L300L	EML2_ENST00000586902.1_5'UTR|EML2_ENST00000536630.1_Silent_p.L447L|EML2_ENST00000589876.1_Silent_p.L300L|EML2_ENST00000587152.1_Silent_p.L501L	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	300	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.L300L(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCAGGGCGCAGAGCCCAAACA	0.682																																							uc002pcn.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(898-900)CTC>CTT		echinoderm microtubule associated protein like							42.0	44.0	43.0					19																	46124837		2201	4297	6498	SO:0001819	synonymous_variant	24139				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding	g.chr19:46124837G>A	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.900C>T	19.37:g.46124837G>A			Somatic				EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Silent_p.L184L|EML2_uc010xxl.1_Silent_p.L447L|EML2_uc010xxm.1_Silent_p.L501L|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Silent_p.L300L|EML2_uc010ekj.2_Missense_Mutation_p.S267F	p.L300L	NM_012155	NP_036287	WXS	Illumina HiSeq	Unspecified	O95834	EMAL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)	10	935	-		Ovarian(192;0.179)|all_neural(266;0.224)	300			WD 5.		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Silent	SNP	ENST00000245925.3	37	c.900C>T	CCDS12670.1																																																																																				0.682	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155		22	27	0	0	0	0.003954	0	22	27				
ARHGAP35	2909	broad.mit.edu	37	19	47422425	47422425	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:47422425G>A	ENST00000404338.3	+	1	493	c.493G>A	c.(493-495)Gat>Aat	p.D165N		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	165					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.D165N(2)									TCTTGGTATTGATGTTAGCAG	0.453																																							uc010ekv.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(493-495)GAT>AAT		glucocorticoid receptor DNA binding factor 1							108.0	98.0	101.0					19																	47422425		1923	4142	6065	SO:0001583	missense	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47422425G>A	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.493G>A	19.37:g.47422425G>A	ENSP00000385720:p.Asp165Asn		Somatic					p.D165N	NM_004491	NP_004482	WXS	Illumina HiSeq	Unspecified	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	1	493	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	165					A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	c.493G>A	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606635	0.66558	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	D	0.86694	-2.16	5.9	5.9	0.94986	.	0.044670	0.85682	D	0.000000	D	0.94614	0.8264	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94802	0.7971	10	0.87932	D	0	-31.1719	19.0536	0.93054	0.0:0.0:1.0:0.0	.	165	Q9NRY4-2	.	N	165	ENSP00000385720:D165N	ENSP00000324820:D165N	D	+	1	0	ARHGAP35	52114265	1.000000	0.71417	0.953000	0.39169	0.634000	0.38068	9.869000	0.99810	2.806000	0.96561	0.655000	0.94253	GAT		0.453	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		4	54	0	0	0	0.009096	0	4	54				
GRIN2D	2906	broad.mit.edu	37	19	48908350	48908350	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:48908350G>A	ENST00000263269.3	+	3	913	c.825G>A	c.(823-825)gtG>gtA	p.V275V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	275					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.V275V(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGTTCATGGTGGGGCCCCAGC	0.706																																							uc002pjc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(3)	6						c.(823-825)GTG>GTA		N-methyl-D-aspartate receptor subunit 2D	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)						6.0	8.0	7.0					19																	48908350		2153	4239	6392	SO:0001819	synonymous_variant	2906					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding	g.chr19:48908350G>A	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.825G>A	19.37:g.48908350G>A			Somatic					p.V275V	NM_000836	NP_000827	WXS	Illumina HiSeq	Unspecified	O15399	NMDE4_HUMAN		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	3	913	+		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)	275			Extracellular (Potential).			Silent	SNP	ENST00000263269.3	37	c.825G>A	CCDS12719.1																																																																																				0.706	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1			4	15	0	0	0	0.009096	0	4	15				
SIGLEC9	27180	broad.mit.edu	37	19	51629008	51629008	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:51629008C>T	ENST00000250360.3	+	2	643	c.576C>T	c.(574-576)acC>acT	p.T192T	SIGLEC9_ENST00000440804.3_Silent_p.T192T	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	192	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.T192T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ACCCCTCCACCACCCGCTCCT	0.657																																							uc002pvu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(574-576)ACC>ACT		sialic acid binding Ig-like lectin 9 precursor							68.0	69.0	69.0					19																	51629008		2203	4300	6503	SO:0001819	synonymous_variant	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51629008C>T	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.576C>T	19.37:g.51629008C>T			Somatic				SIGLEC9_uc010yct.1_Silent_p.T192T	p.T192T	NM_014441	NP_055256	WXS	Illumina HiSeq	Unspecified	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	2	643	+		all_neural(266;0.0529)	192			Extracellular (Potential).|Ig-like C2-type 1.		Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	c.576C>T	CCDS12825.1																																																																																				0.657	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		47	55	0	0	0	0.01441	0	47	55				
BIRC8	112401	broad.mit.edu	37	19	53793072	53793072	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:53793072C>T	ENST00000426466.1	-	1	1803	c.556G>A	c.(556-558)Gag>Aag	p.E186K		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	186					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.E186K(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		CAAAGCTTCTCCTCTTGCAGA	0.433																																							uc002qbk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(556-558)GAG>AAG		baculoviral IAP repeat-containing 8							92.0	93.0	93.0					19																	53793072		2203	4300	6503	SO:0001583	missense	112401				apoptosis		zinc ion binding	g.chr19:53793072C>T	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.556G>A	19.37:g.53793072C>T	ENSP00000412957:p.Glu186Lys		Somatic					p.E186K	NM_033341	NP_203127	WXS	Illumina HiSeq	Unspecified	Q96P09	BIRC8_HUMAN		GBM - Glioblastoma multiforme(134;0.00304)	1	1804	-			186					Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	37	c.556G>A	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341608	0.61073	.	.	ENSG00000163098	ENST00000426466	T	0.77358	-1.09	0.502	0.502	0.16932	Baculoviral inhibition of apoptosis protein repeat (1);	.	.	.	.	T	0.82093	0.4962	L	0.56769	1.78	0.45594	D	0.998536	D	0.89917	1.0	D	0.81914	0.995	T	0.79909	-0.1604	9	0.72032	D	0.01	-9.7786	6.9506	0.24542	0.0:0.9999:0.0:1.0E-4	.	186	Q96P09	BIRC8_HUMAN	K	186	ENSP00000412957:E186K	ENSP00000412957:E186K	E	-	1	0	BIRC8	58484884	1.000000	0.71417	0.290000	0.24890	0.090000	0.18270	4.871000	0.63042	0.578000	0.29487	0.420000	0.28162	GAG		0.433	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341		10	111	0	0	0	0.006214	0	10	111				
ZNF256	10172	broad.mit.edu	37	19	58455413	58455413	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:58455413C>G	ENST00000282308.3	-	2	245	c.49G>C	c.(49-51)Gag>Cag	p.E17Q	ZNF256_ENST00000598928.1_Intron	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E17Q(2)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GCCACGTCCTCAAAGGTCACA	0.507																																					NSCLC(55;1313 1552 8040 11996)	NSCLC(55;1313 1552 8040 11996)	uc002qqu.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|skin(1)	2						c.(49-51)GAG>CAG		zinc finger protein 256							149.0	125.0	133.0					19																	58455413		2203	4300	6503	SO:0001583	missense	10172				multicellular organismal development|negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58455413C>G	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.49G>C	19.37:g.58455413C>G	ENSP00000282308:p.Glu17Gln		Somatic				ZNF256_uc010euj.2_Intron	p.E17Q	NM_005773	NP_005764	WXS	Illumina HiSeq	Unspecified	Q9Y2P7	ZN256_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)	2	284	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	17			KRAB.		B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	37	c.49G>C	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370573	0.61624	.	.	ENSG00000152454	ENST00000282308	T	0.02197	4.4	2.64	1.58	0.23477	Krueppel-associated box (4);	.	.	.	.	T	0.09468	0.0233	M	0.71206	2.165	0.23984	N	0.99627	D	0.76494	0.999	D	0.72338	0.977	T	0.09292	-1.0681	9	0.51188	T	0.08	.	9.5807	0.39486	0.0:0.7828:0.2172:0.0	.	17	Q9Y2P7	ZN256_HUMAN	Q	17	ENSP00000282308:E17Q	ENSP00000282308:E17Q	E	-	1	0	ZNF256	63147225	0.071000	0.21146	0.250000	0.24296	0.516000	0.34256	0.500000	0.22562	0.655000	0.30866	0.563000	0.77884	GAG		0.507	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1			4	59	0	0	0	0.009096	0	4	59				
CYP1B1	1545	broad.mit.edu	37	2	38301556	38301556	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:38301556C>T	ENST00000260630.3	-	2	1377	c.976G>A	c.(976-978)Gac>Aac	p.D326N	CYP1B1_ENST00000407341.1_Missense_Mutation_p.D326N|CYP1B1-AS1_ENST00000589303.1_RNA|CYP1B1_ENST00000494864.1_Intron|CYP1B1-AS1_ENST00000431999.1_RNA	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	326					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.D326N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	CCGAAGATGTCAGTGATAGTG	0.632																																							uc002rqo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(976-978)GAC>AAC		cytochrome P450, family 1, subfamily B,	Estrone(DB00655)						26.0	31.0	30.0					2																	38301556		2202	4300	6502	SO:0001583	missense	1545				visual perception|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding	g.chr2:38301556C>T	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.976G>A	2.37:g.38301556C>T	ENSP00000260630:p.Asp326Asn		Somatic					p.D326N	NM_000104	NP_000095	WXS	Illumina HiSeq	Unspecified	Q16678	CP1B1_HUMAN			3	1379	-		all_hematologic(82;0.21)	326					Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	ENST00000260630.3	37	c.976G>A	CCDS1793.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207008	0.95033	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.69175	-0.38;-0.38	4.89	4.89	0.63831	.	0.047485	0.85682	D	0.000000	T	0.80732	0.4679	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82890	-0.0233	10	0.87932	D	0	.	15.6218	0.76813	0.0:1.0:0.0:0.0	.	326	Q53TK1	.	N	326	ENSP00000260630:D326N;ENSP00000384972:D326N	ENSP00000260630:D326N	D	-	1	0	CYP1B1	38155060	1.000000	0.71417	0.992000	0.48379	0.847000	0.48162	7.010000	0.76353	2.543000	0.85770	0.650000	0.86243	GAC		0.632	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104		5	12	0	0	0	0.00308	0	5	12				
SLC8A1	6546	broad.mit.edu	37	2	40656137	40656137	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:40656137G>T	ENST00000403092.1	-	2	1317	c.1284C>A	c.(1282-1284)acC>acA	p.T428T	SLC8A1_ENST00000332839.4_Silent_p.T428T|SLC8A1_ENST00000406391.2_Silent_p.T428T|SLC8A1_ENST00000402441.1_Silent_p.T428T|SLC8A1_ENST00000542024.1_Silent_p.T428T|SLC8A1_ENST00000406785.2_Silent_p.T428T|SLC8A1_ENST00000542756.1_Silent_p.T428T|SLC8A1_ENST00000405901.3_Silent_p.T428T|SLC8A1_ENST00000405269.1_Silent_p.T428T|SLC8A1_ENST00000408028.2_Silent_p.T428T			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	428	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.T428T(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGCGGATAATGGTAAGGGCCA	0.433																																							uc002rrx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1282-1284)ACC>ACA		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						103.0	88.0	93.0					2																	40656137		2203	4300	6503	SO:0001819	synonymous_variant	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656137G>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1284C>A	2.37:g.40656137G>T			Somatic				SLC8A1_uc002rry.2_Silent_p.T428T|SLC8A1_uc002rrz.2_Silent_p.T428T|SLC8A1_uc002rsa.2_Silent_p.T428T|SLC8A1_uc002rsd.3_Silent_p.T428T|SLC8A1_uc002rsb.1_Silent_p.T428T|SLC8A1_uc010fan.1_Silent_p.T428T|SLC8A1_uc002rsc.1_Silent_p.T428T	p.T428T	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	1308	-			428			Calx-beta 1.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	c.1284C>A	CCDS1806.1																																																																																				0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		5	91	1	0	3.59834e-05	0.001168	4.14167e-05	5	91				
PAPOLG	64895	broad.mit.edu	37	2	61009128	61009128	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:61009128G>A	ENST00000238714.3	+	11	1264	c.1015G>A	c.(1015-1017)Gaa>Aaa	p.E339K	PAPOLG_ENST00000483370.1_3'UTR	NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	339					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.E339K(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AATGGTAGAAGAATTTAAACA	0.403																																					GBM(183;1497 2932 21839 46797)	GBM(183;1497 2932 21839 46797)	uc002sai.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1015-1017)GAA>AAA		poly(A) polymerase gamma							136.0	126.0	129.0					2																	61009128		2203	4300	6503	SO:0001583	missense	64895				mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding	g.chr2:61009128G>A	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.1015G>A	2.37:g.61009128G>A	ENSP00000238714:p.Glu339Lys		Somatic				PAPOLG_uc002saj.2_Missense_Mutation_p.E28K|PAPOLG_uc002sak.2_5'UTR|PAPOLG_uc010fch.2_Missense_Mutation_p.E28K	p.E339K	NM_022894	NP_075045	WXS	Illumina HiSeq	Unspecified	Q9BWT3	PAPOG_HUMAN	LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)		11	1246	+	all_hematologic(2;0.0797)		339					B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	ENST00000238714.3	37	c.1015G>A	CCDS1863.1	.	.	.	.	.	.	.	.	.	.	G	36	5.814863	0.96982	.	.	ENSG00000115421	ENST00000238714;ENST00000378104;ENST00000412217	.	.	.	6.07	6.07	0.98685	Poly(A) polymerase, central domain (1);	0.000000	0.85682	D	0.000000	D	0.90717	0.7087	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92970	0.6397	9	0.87932	D	0	-34.704	20.2544	0.98414	0.0:0.0:1.0:0.0	.	28;339	E9PEP5;Q9BWT3	.;PAPOG_HUMAN	K	339;28;7	.	ENSP00000238714:E339K	E	+	1	0	PAPOLG	60862632	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.548000	0.98103	2.885000	0.99019	0.655000	0.94253	GAA		0.403	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251577.3	NM_022894		4	133	0	0	0	0.009096	0	4	133				
KIAA1841	84542	broad.mit.edu	37	2	61298824	61298824	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:61298824G>C	ENST00000402291.1	+	4	475	c.234G>C	c.(232-234)gaG>gaC	p.E78D	KIAA1841_ENST00000295031.5_Missense_Mutation_p.E78D|KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000356719.2_Missense_Mutation_p.E78D|KIAA1841_ENST00000453873.1_Missense_Mutation_p.E78D	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	78								p.E78D(2)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			CTGCTGGAGAGAGTCCTGTTG	0.393																																							uc002saw.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(232-234)GAG>GAC		KIAA1841 protein isoform a							75.0	78.0	77.0					2																	61298824		2203	4300	6503	SO:0001583	missense	84542							g.chr2:61298824G>C	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.234G>C	2.37:g.61298824G>C	ENSP00000385579:p.Glu78Asp		Somatic				KIAA1841_uc002sax.3_5'UTR|KIAA1841_uc002say.2_Missense_Mutation_p.E78D|KIAA1841_uc002sav.3_Missense_Mutation_p.E78D	p.E78D	NM_001129993	NP_001123465	WXS	Illumina HiSeq	Unspecified	Q6NSI8	K1841_HUMAN	Epithelial(17;0.193)		4	537	+			78					Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	ENST00000402291.1	37	c.234G>C	CCDS46296.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674245	0.29693	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.71	1.31	0.21738	.	0.387664	0.29572	N	0.011771	T	0.21962	0.0529	N	0.19112	0.55	0.25981	N	0.982376	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.002	T	0.12889	-1.0530	9	0.23891	T	0.37	-12.9558	5.824	0.18544	0.1386:0.1127:0.633:0.1157	.	78;78;78	Q6NSI8-2;Q6NSI8;Q6NSI8-4	.;K1841_HUMAN;.	D	78	.	ENSP00000295031:E78D	E	+	3	2	KIAA1841	61152328	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.522000	0.35921	0.341000	0.23771	0.655000	0.94253	GAG		0.393	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506		3	129	0	0	0	0.009096	0	3	129				
EXOC6B	23233	broad.mit.edu	37	2	72945355	72945355	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:72945355C>T	ENST00000272427.6	-	6	676	c.546G>A	c.(544-546)gtG>gtA	p.V182V	EXOC6B_ENST00000410104.1_Silent_p.V182V	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	182					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)		p.V182V(1)		breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						TGTCCACCATCACCTTGCAGA	0.423																																							uc010fep.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(544-546)GTG>GTA		SEC15-like 2							147.0	141.0	143.0					2																	72945355		1930	4143	6073	SO:0001819	synonymous_variant	23233				protein transport|vesicle docking involved in exocytosis	exocyst		g.chr2:72945355C>T	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.546G>A	2.37:g.72945355C>T			Somatic				EXOC6B_uc002sij.2_Silent_p.V182V	p.V182V	NM_015189	NP_056004	WXS	Illumina HiSeq	Unspecified	Q9Y2D4	EXC6B_HUMAN			6	684	-			182					B8ZZY3	Silent	SNP	ENST00000272427.6	37	c.546G>A	CCDS46333.1																																																																																				0.423	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570		19	106	0	0	0	0.008871	0	19	106				
ZNF514	84874	broad.mit.edu	37	2	95815686	95815686	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:95815686C>T	ENST00000295208.2	-	5	1006	c.544G>A	c.(544-546)Gat>Aat	p.D182N	MRPS5_ENST00000475040.1_5'Flank|ZNF514_ENST00000411425.1_Missense_Mutation_p.D182N	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D182N(1)		large_intestine(4)|lung(6)|urinary_tract(1)	11						AATTCTGTATCACATTTATAA	0.393																																							uc002sue.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(544-546)GAT>AAT		zinc finger protein 514							127.0	134.0	131.0					2																	95815686		2203	4300	6503	SO:0001583	missense	84874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:95815686C>T	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.544G>A	2.37:g.95815686C>T	ENSP00000295208:p.Asp182Asn		Somatic				ZNF514_uc002sud.1_Missense_Mutation_p.D255N	p.D182N	NM_032788	NP_116177	WXS	Illumina HiSeq	Unspecified	Q96K75	ZN514_HUMAN			5	918	-			182					Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	c.544G>A	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	C	9.368	1.069687	0.20147	.	.	ENSG00000144026	ENST00000295208;ENST00000411425	T;T	0.05258	3.47;3.47	2.92	2.04	0.26737	.	.	.	.	.	T	0.06234	0.0161	L	0.46614	1.455	0.09310	N	1	B;B	0.15930	0.005;0.015	B;B	0.13407	0.003;0.009	T	0.41360	-0.9513	9	0.17832	T	0.49	.	7.9836	0.30198	0.0:0.8716:0.0:0.1284	.	182;1	Q96K75;Q658L7	ZN514_HUMAN;.	N	182	ENSP00000295208:D182N;ENSP00000405509:D182N	ENSP00000295208:D182N	D	-	1	0	ZNF514	95179413	0.000000	0.05858	0.010000	0.14722	0.157000	0.22087	0.098000	0.15189	0.791000	0.33826	0.655000	0.94253	GAT		0.393	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788		32	258	0	0	0	0.012213	0	32	258				
KANSL3	55683	broad.mit.edu	37	2	97275266	97275266	+	Missense_Mutation	SNP	C	C	G	rs567286176		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:97275266C>G	ENST00000431828.1	-	12	1429	c.1353G>C	c.(1351-1353)ttG>ttC	p.L451F	KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000441706.2_Missense_Mutation_p.L364F|KANSL3_ENST00000599854.1_Missense_Mutation_p.L364F|KANSL3_ENST00000440133.1_Missense_Mutation_p.L245F			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	451					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L451F(1)									TGCTCTGAGTCAACCCTTCTG	0.383																																							uc002swn.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1351-1353)TTG>TTC		hypothetical protein LOC55683 isoform a							381.0	375.0	377.0					2																	97275266		1911	4134	6045	SO:0001583	missense	55683							g.chr2:97275266C>G	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1353G>C	2.37:g.97275266C>G	ENSP00000396749:p.Leu451Phe		Somatic				KIAA1310_uc002swh.3_Missense_Mutation_p.L339F|KIAA1310_uc002swi.3_Missense_Mutation_p.L352F|KIAA1310_uc002swj.3_RNA|KIAA1310_uc002swk.3_Missense_Mutation_p.L364F|KIAA1310_uc010fhz.2_Missense_Mutation_p.L245F|KIAA1310_uc002swl.3_Missense_Mutation_p.L352F|KIAA1310_uc002swm.3_RNA|KIAA1310_uc010yur.1_Missense_Mutation_p.L245F|KIAA1310_uc002swp.1_Missense_Mutation_p.L352F|KIAA1310_uc002swq.1_Missense_Mutation_p.L223F|KIAA1310_uc010fhy.1_Missense_Mutation_p.L352F	p.L451F	NM_001115016	NP_001108488	WXS	Illumina HiSeq	Unspecified	Q9P2N6	K1310_HUMAN			12	1499	-			451					A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	37	c.1353G>C	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059509	0.55325	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000440133;ENST00000444759	T;T	0.50813	0.83;0.73	5.2	2.43	0.29744	.	0.000000	0.64402	D	0.000001	T	0.50718	0.1632	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.96;0.994;0.982;0.998	T	0.42682	-0.9437	10	0.48119	T	0.1	.	8.7631	0.34687	0.0:0.7482:0.0:0.2518	.	245;451;364;339	B4E1W4;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.;.	F	364;339;451;364;245;245	ENSP00000396749:L451F;ENSP00000406207:L245F	ENSP00000346144:L364F	L	-	3	2	KIAA1310	96638993	0.996000	0.38824	0.764000	0.31436	0.986000	0.74619	0.474000	0.22148	0.210000	0.20664	-0.136000	0.14681	TTG		0.383	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991		5	435	0	0	0	0.001984	0	5	435				
EIF5B	9669	broad.mit.edu	37	2	99978250	99978250	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:99978250G>A	ENST00000289371.6	+	4	1088	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	296					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.E296K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCCTGCCTCTGAAGAGAAAGC	0.368																																					Colon(162;2388 2567 2705 3444)	Colon(162;2388 2567 2705 3444)	uc002tab.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(886-888)GAA>AAA		eukaryotic translation initiation factor 5B							97.0	94.0	95.0					2																	99978250		1838	4092	5930	SO:0001583	missense	9669				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chr2:99978250G>A	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.886G>A	2.37:g.99978250G>A	ENSP00000289371:p.Glu296Lys		Somatic					p.E296K	NM_015904	NP_056988	WXS	Illumina HiSeq	Unspecified	O60841	IF2P_HUMAN			4	1070	+			296					O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	c.886G>A	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.254093	0.39896	.	.	ENSG00000158417	ENST00000289371	T	0.47528	0.84	5.4	5.4	0.78164	.	.	.	.	.	T	0.36608	0.0973	N	0.20986	0.625	0.45056	D	0.998072	B	0.06786	0.001	B	0.04013	0.001	T	0.11036	-1.0604	8	.	.	.	-16.1875	19.3595	0.94431	0.0:0.0:1.0:0.0	.	296	O60841	IF2P_HUMAN	K	296	ENSP00000289371:E296K	.	E	+	1	0	EIF5B	99344682	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.130000	0.57964	2.818000	0.97014	0.655000	0.94253	GAA		0.368	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904		6	131	0	0	0	0.001984	0	6	131				
EIF5B	9669	broad.mit.edu	37	2	99980189	99980189	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:99980189A>C	ENST00000289371.6	+	5	1203	c.1001A>C	c.(1000-1002)aAa>aCa	p.K334T		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	334					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.K334T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						gagaagaaaaaaggaCCTAGC	0.353																																					Colon(162;2388 2567 2705 3444)	Colon(162;2388 2567 2705 3444)	uc002tab.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1000-1002)AAA>ACA		eukaryotic translation initiation factor 5B							54.0	51.0	52.0					2																	99980189		1836	4079	5915	SO:0001583	missense	9669				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chr2:99980189A>C	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1001A>C	2.37:g.99980189A>C	ENSP00000289371:p.Lys334Thr		Somatic					p.K334T	NM_015904	NP_056988	WXS	Illumina HiSeq	Unspecified	O60841	IF2P_HUMAN			5	1185	+			334					O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	c.1001A>C	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.601305	0.66445	.	.	ENSG00000158417	ENST00000289371	T	0.54866	0.55	5.75	5.75	0.90469	.	.	.	.	.	T	0.68430	0.3000	M	0.64170	1.965	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.68496	-0.5393	8	.	.	.	-20.023	13.4334	0.61068	1.0:0.0:0.0:0.0	.	334	O60841	IF2P_HUMAN	T	334	ENSP00000289371:K334T	.	K	+	2	0	EIF5B	99346621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.596000	0.90844	2.205000	0.71048	0.528000	0.53228	AAA		0.353	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904		24	29	0	0	0	0.003954	0	24	29				
EIF5B	9669	broad.mit.edu	37	2	99998629	99998629	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:99998629G>C	ENST00000289371.6	+	13	2271	c.2069G>C	c.(2068-2070)aGa>aCa	p.R690T		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	690	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.R690T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TAGTTTGATAGAGAGAATGTA	0.353																																					Colon(162;2388 2567 2705 3444)	Colon(162;2388 2567 2705 3444)	uc002tab.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(2068-2070)AGA>ACA		eukaryotic translation initiation factor 5B							155.0	139.0	144.0					2																	99998629		1820	4079	5899	SO:0001583	missense	9669				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chr2:99998629G>C	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2069G>C	2.37:g.99998629G>C	ENSP00000289371:p.Arg690Thr		Somatic					p.R690T	NM_015904	NP_056988	WXS	Illumina HiSeq	Unspecified	O60841	IF2P_HUMAN			13	2253	+			690					O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	c.2069G>C	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526982	0.27299	.	.	ENSG00000158417	ENST00000289371	T	0.69926	-0.44	5.43	5.43	0.79202	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	.	.	.	.	T	0.49098	0.1537	N	0.04787	-0.16	0.52501	D	0.999953	B	0.17852	0.024	B	0.26416	0.069	T	0.43766	-0.9371	8	.	.	.	-27.8492	19.2349	0.93855	0.0:0.0:1.0:0.0	.	690	O60841	IF2P_HUMAN	T	690	ENSP00000289371:R690T	.	R	+	2	0	EIF5B	99365061	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.059000	0.64306	2.557000	0.86248	0.563000	0.77884	AGA		0.353	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904		5	60	0	0	0	0.001984	0	5	60				
TBC1D8	11138	broad.mit.edu	37	2	101646204	101646205	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:101646204_101646205GA>AG	ENST00000376840.4	-	12	1924_1925	c.1925_1926TC>CT	c.(1924-1926)cTC>cCT	p.L642P	TBC1D8_ENST00000409318.1_Missense_Mutation_p.L657P			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	642	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.L642P(1)|p.L657P(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						GACCCTTGATGAGCTCCTCGAA	0.554																																							uc010fiv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1924-1926)CTC>CCT		TBC1 domain family, member 8																																				SO:0001583	missense	11138				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity	g.chr2:101646204_101646205GA>AG	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1925_1926delinsAG	2.37:g.101646204_101646205delinsAG	ENSP00000366036:p.Leu642Pro		Somatic				TBC1D8_uc002tau.3_Missense_Mutation_p.L399P	p.L642P	NM_001102426	NP_001095896	WXS	Illumina HiSeq	Unspecified	O95759	TBCD8_HUMAN			12	2056_2057	-			642			Rab-GAP TBC.		A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	DNP	ENST00000376840.4	37	c.1925_1926TC>CT	CCDS46375.1																																																																																				0.554	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063		24	63	0	0	0	0.004672	0	24	63				
RGPD4	285190	broad.mit.edu	37	2	108488039	108488039	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:108488039G>A	ENST00000408999.3	+	20	3656	c.3579G>A	c.(3577-3579)caG>caA	p.Q1193Q	RGPD4_ENST00000354986.4_Silent_p.Q1193Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1193					protein targeting to Golgi (GO:0000042)			p.Q1193Q(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AGTTAATACAGAGAGCTGAAG	0.388																																							uc010ywk.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(3577-3579)CAG>CAA		RANBP2-like and GRIP domain containing 4																																				SO:0001819	synonymous_variant	285190				intracellular transport		binding	g.chr2:108488039G>A	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3579G>A	2.37:g.108488039G>A			Somatic				RGPD4_uc002tdu.2_Silent_p.Q380Q|RGPD4_uc010ywl.1_RNA	p.Q1193Q	NM_182588	NP_872394	WXS	Illumina HiSeq	Unspecified	Q7Z3J3	RGPD4_HUMAN			20	3661	+			1193					B9A029	Silent	SNP	ENST00000408999.3	37	c.3579G>A	CCDS46381.1																																																																																				0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		34	36	0	0	0	0.011902	0	34	36				
EPB41L5	57669	broad.mit.edu	37	2	120900596	120900596	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:120900596G>C	ENST00000263713.5	+	19	1831	c.1617G>C	c.(1615-1617)ttG>ttC	p.L539F	EPB41L5_ENST00000443902.2_Missense_Mutation_p.L539F|EPB41L5_ENST00000452780.1_Missense_Mutation_p.L539F	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	539					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)		p.L539F(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGGTGAAGTTGACTGAGAAAT	0.348																																							uc002tmg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1615-1617)TTG>TTC		erythrocyte membrane protein band 4.1 like 5							89.0	90.0	89.0					2																	120900596		2203	4300	6503	SO:0001583	missense	57669					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding	g.chr2:120900596G>C	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1617G>C	2.37:g.120900596G>C	ENSP00000263713:p.Leu539Phe		Somatic				EPB41L5_uc010fll.2_Missense_Mutation_p.L539F|EPB41L5_uc010flm.2_Missense_Mutation_p.L343F	p.L539F	NM_020909	NP_065960	WXS	Illumina HiSeq	Unspecified	Q9HCM4	E41L5_HUMAN			19	1743	+			539					Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	37	c.1617G>C	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161289	0.57368	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000452780	D;D;D	0.85339	-1.93;-1.97;-1.96	5.18	4.28	0.50868	.	0.000000	0.42964	D	0.000628	D	0.89921	0.6855	M	0.71581	2.175	0.44366	D	0.997269	D;D;D	0.69078	0.991;0.997;0.995	D;D;P	0.68192	0.954;0.956;0.904	D	0.89124	0.3505	10	0.51188	T	0.08	.	9.7717	0.40593	0.1018:0.0:0.8982:0.0	.	539;539;539	Q9HCM4-3;Q9HCM4-4;Q9HCM4	.;.;E41L5_HUMAN	F	539	ENSP00000263713:L539F;ENSP00000393856:L539F;ENSP00000390439:L539F	ENSP00000263713:L539F	L	+	3	2	EPB41L5	120617066	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	3.489000	0.53237	1.124000	0.41980	0.591000	0.81541	TTG		0.348	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909		4	107	0	0	0	0.009096	0	4	107				
POTEE	445582	broad.mit.edu	37	2	131976380	131976380	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:131976380C>T	ENST00000356920.5	+	1	499	c.405C>T	c.(403-405)gtC>gtT	p.V135V	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_Silent_p.V135V	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	135					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.V135V(2)									GGTACCACGTCCGTGGAGAAG	0.597																																							uc002tsn.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(403-405)GTC>GTT		protein expressed in prostate, ovary, testis,							68.0	71.0	70.0					2																	131976380		2203	4300	6503	SO:0001819	synonymous_variant	445582						ATP binding	g.chr2:131976380C>T	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.405C>T	2.37:g.131976380C>T			Somatic				PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	p.V135V	NM_001083538	NP_001077007	WXS	Illumina HiSeq	Unspecified	Q6S8J3	POTEE_HUMAN			1	457	+			135					Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	c.405C>T	CCDS46414.1																																																																																				0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		31	103	0	0	0	0.003755	0	31	103				
RIF1	55183	broad.mit.edu	37	2	152303012	152303012	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:152303012G>A	ENST00000243326.5	+	19	2650	c.2167G>A	c.(2167-2169)Gca>Aca	p.A723T	RIF1_ENST00000430328.2_Missense_Mutation_p.A723T|RIF1_ENST00000453091.2_Missense_Mutation_p.A723T|RIF1_ENST00000444746.2_Missense_Mutation_p.A723T|RIF1_ENST00000428287.2_Missense_Mutation_p.A723T			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.A723T(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGCTTTGGTGGCAACAGCAGA	0.408																																							uc002txm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(2167-2169)GCA>ACA		RAP1 interacting factor 1							157.0	152.0	154.0					2																	152303012		2203	4300	6503	SO:0001583	missense	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152303012G>A	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.2167G>A	2.37:g.152303012G>A	ENSP00000243326:p.Ala723Thr		Somatic				RIF1_uc002txl.2_Missense_Mutation_p.A723T|RIF1_uc010fnv.1_Missense_Mutation_p.A687T|RIF1_uc002txn.2_Missense_Mutation_p.A723T|RIF1_uc002txo.2_Missense_Mutation_p.A723T	p.A723T	NM_018151	NP_060621	WXS	Illumina HiSeq	Unspecified	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	20	2297	+			723					A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	c.2167G>A	CCDS2194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.349810|5.349810	0.95830|0.95830	.|.	.|.	ENSG00000080345|ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328|ENST00000414861	T;T;T;T;T|.	0.67698|.	-0.28;-0.28;-0.28;-0.28;-0.28|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.058036|.	0.64402|.	D|.	0.000001|.	T|T	0.75925|0.75925	0.3916|0.3916	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	P;D|.	0.55385|.	0.917;0.971|.	B;P|.	0.49999|.	0.424;0.628|.	T|T	0.74811|0.74811	-0.3538|-0.3538	10|5	0.72032|.	D|.	0.01|.	-9.7278|-9.7278	18.8768|18.8768	0.92341|0.92341	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	723;723|.	Q5UIP0;Q5UIP0-2|.	RIF1_HUMAN;.|.	T|D	723|714	ENSP00000390181:A723T;ENSP00000414615:A723T;ENSP00000415691:A723T;ENSP00000243326:A723T;ENSP00000416123:A723T|.	ENSP00000243326:A723T|.	A|G	+|+	1|2	0|0	RIF1|RIF1	152011258|152011258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.652000|8.652000	0.91083|0.91083	2.559000|2.559000	0.86315|0.86315	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.408	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			5	230	0	0	0	0.000602	0	5	230				
ACVR1	90	broad.mit.edu	37	2	158626930	158626930	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:158626930C>T	ENST00000263640.3	-	7	1169	c.740G>A	c.(739-741)aGg>aAg	p.R247K	ACVR1_ENST00000434821.1_Missense_Mutation_p.R247K|ACVR1_ENST00000410057.2_Missense_Mutation_p.R247K|ACVR1_ENST00000409283.2_Missense_Mutation_p.R247K	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	247	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.R247K(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	TTCCGTTTCCCTGAACCATGA	0.463																																							uc002tzm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(739-741)AGG>AAG		activin A receptor, type I precursor	Adenosine triphosphate(DB00171)						220.0	192.0	201.0					2																	158626930		2203	4300	6503	SO:0001583	missense	90				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding	g.chr2:158626930C>T		CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.740G>A	2.37:g.158626930C>T	ENSP00000263640:p.Arg247Lys		Somatic				ACVR1_uc002tzn.3_Missense_Mutation_p.R247K|ACVR1_uc010fog.2_Missense_Mutation_p.R247K	p.R247K	NM_001111067	NP_001104537	WXS	Illumina HiSeq	Unspecified	Q04771	ACVR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.104)	8	1079	-			247			Cytoplasmic (Potential).|Protein kinase.			Missense_Mutation	SNP	ENST00000263640.3	37	c.740G>A	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	C	36	5.632771	0.96682	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057	D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95223	0.8451	L	0.39245	1.2	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	D	0.95410	0.8497	10	0.87932	D	0	.	20.0833	0.97789	0.0:1.0:0.0:0.0	.	247	Q04771	ACVR1_HUMAN	K	247	ENSP00000263640:R247K;ENSP00000387273:R247K;ENSP00000405004:R247K;ENSP00000387127:R247K	ENSP00000263640:R247K	R	-	2	0	ACVR1	158335176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.756000	0.94617	0.655000	0.94253	AGG		0.463	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105		47	111	0	0	0	0.01441	0	47	111				
SCN9A	6335	broad.mit.edu	37	2	167168258	167168258	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:167168258C>T	ENST00000409435.1	-	1	8	c.9G>A	c.(7-9)atG>atA	p.M3I	SCN9A_ENST00000375387.4_Missense_Mutation_p.M3I|SCN9A_ENST00000303354.6_Missense_Mutation_p.M3I|SCN9A_ENST00000409672.1_Missense_Mutation_p.M3I			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	3					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.M3I(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGGAGGCAACATTGCCATCT	0.418																																							uc010fpl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(5)|skin(2)	13						c.(7-9)ATG>ATA		sodium channel, voltage-gated, type IX, alpha	Lamotrigine(DB00555)|Lidocaine(DB00281)						68.0	66.0	66.0					2																	167168258		1893	4121	6014	SO:0001583	missense	6335					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167168258C>T	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.9G>A	2.37:g.167168258C>T	ENSP00000386330:p.Met3Ile		Somatic					p.M3I	NM_002977	NP_002968	WXS	Illumina HiSeq	Unspecified	Q15858	SCN9A_HUMAN			2	350	-			3					A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	c.9G>A	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	c	12.64	1.999216	0.35226	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.95588	-3.74;-3.75;-3.75;-3.75	5.43	4.54	0.55810	.	0.650815	0.15865	N	0.240839	D	0.90923	0.7147	L	0.32530	0.975	0.29613	N	0.846821	B	0.02656	0.0	B	0.04013	0.001	D	0.84785	0.0775	10	0.41790	T	0.15	.	9.0668	0.36469	0.0:0.778:0.0:0.222	.	3	E7EUN6	.	I	3	ENSP00000386306:M3I;ENSP00000364536:M3I;ENSP00000304748:M3I;ENSP00000386330:M3I	ENSP00000304748:M3I	M	-	3	0	SCN9A	166876504	0.001000	0.12720	0.992000	0.48379	0.975000	0.68041	0.043000	0.13971	2.541000	0.85698	0.655000	0.94253	ATG		0.418	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		35	54	0	0	0	0.00623	0	35	54				
TTN	7273	broad.mit.edu	37	2	179417425	179417425	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:179417425C>G	ENST00000591111.1	-	285	85503	c.85279G>C	c.(85279-85281)Gaa>Caa	p.E28427Q	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E21128Q|TTN_ENST00000460472.2_Missense_Mutation_p.E21003Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E27500Q|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E21195Q|TTN_ENST00000589042.1_Missense_Mutation_p.E30068Q|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28427	Fibronectin type-III 107. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E27500Q(1)|p.E27498Q(1)|p.E21003Q(1)|p.E21128Q(1)|p.E21195Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTTCCTTTCTACAACATAT	0.448																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(82498-82500)GAA>CAA		titin isoform N2-A							122.0	109.0	113.0					2																	179417425		2021	4173	6194	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179417425C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.85279G>C	2.37:g.179417425C>G	ENSP00000465570:p.Glu28427Gln		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E21195Q|TTN_uc010zfi.1_Missense_Mutation_p.E21128Q|TTN_uc010zfj.1_Missense_Mutation_p.E21003Q	p.E27500Q	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		284	82722	-			28427					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.82498G>C		.	.	.	.	.	.	.	.	.	.	C	15.93	2.979483	0.53827	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74053	0.3666	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.74791	-0.3545	9	0.87932	D	0	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	21003;21128;21195;28427	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	27500;21003;21195;21128;21000	ENSP00000343764:E27500Q;ENSP00000434586:E21003Q;ENSP00000340554:E21195Q;ENSP00000352154:E21128Q	ENSP00000340554:E21195Q	E	-	1	0	TTN	179125671	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	GAA		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	112	0	0	0	0.009096	0	4	112				
TTN	7273	broad.mit.edu	37	2	179432168	179432168	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:179432168C>T	ENST00000591111.1	-	276	73992	c.73768G>A	c.(73768-73770)Gat>Aat	p.D24590N	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D17291N|TTN_ENST00000460472.2_Missense_Mutation_p.D17166N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D23663N|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D17358N|TTN_ENST00000589042.1_Missense_Mutation_p.D26231N|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24590	Ig-like 122.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D17358N(1)|p.D23661N(1)|p.D17291N(1)|p.D17166N(1)|p.D23663N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTCCTTATCTCCTCTTAAC	0.378																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(70987-70989)GAT>AAT		titin isoform N2-A							111.0	110.0	110.0					2																	179432168		1841	4088	5929	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179432168C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.73768G>A	2.37:g.179432168C>T	ENSP00000465570:p.Asp24590Asn		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D17358N|TTN_uc010zfi.1_Missense_Mutation_p.D17291N|TTN_uc010zfj.1_Missense_Mutation_p.D17166N	p.D23663N	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	71211	-			24590					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.70987G>A		.	.	.	.	.	.	.	.	.	.	C	18.25	3.582644	0.65992	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.32	5.32	0.75619	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40546	0.1121	L	0.41415	1.275	0.48395	D	0.999642	B;B;B;B	0.18863	0.031;0.031;0.031;0.031	B;B;B;B	0.21151	0.033;0.033;0.033;0.033	T	0.28933	-1.0028	9	0.87932	D	0	.	18.9836	0.92763	0.0:1.0:0.0:0.0	.	17166;17291;17358;24590	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	23663;17166;17358;17291;17164	ENSP00000343764:D23663N;ENSP00000434586:D17166N;ENSP00000340554:D17358N;ENSP00000352154:D17291N	ENSP00000340554:D17358N	D	-	1	0	TTN	179140414	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.749000	0.62155	2.481000	0.83766	0.561000	0.74099	GAT		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	141	0	0	0	0.009096	0	4	141				
TTN	7273	broad.mit.edu	37	2	179650595	179650595	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:179650595C>T	ENST00000591111.1	-	14	2574	c.2350G>A	c.(2350-2352)Gga>Aga	p.G784R	TTN_ENST00000359218.5_Missense_Mutation_p.G738R|TTN_ENST00000460472.2_Missense_Mutation_p.G738R|TTN_ENST00000342992.6_Missense_Mutation_p.G784R|TTN_ENST00000360870.5_Missense_Mutation_p.G784R|TTN_ENST00000342175.6_Missense_Mutation_p.G738R|TTN_ENST00000589042.1_Missense_Mutation_p.G784R			Q8WZ42	TITIN_HUMAN	titin	33626					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G784R(3)|p.G738R(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTGCATTCCCTTTTGATCA	0.463																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(2350-2352)GGA>AGA		titin isoform N2-A							105.0	93.0	97.0					2																	179650595		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179650595C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2350G>A	2.37:g.179650595C>T	ENSP00000465570:p.Gly784Arg		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.G738R|TTN_uc010zfi.1_Missense_Mutation_p.G738R|TTN_uc010zfj.1_Missense_Mutation_p.G738R|TTN_uc002unb.2_Missense_Mutation_p.G784R|TTN_uc010frg.1_Missense_Mutation_p.G366R	p.G784R	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		14	2574	-			784					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.2350G>A		.	.	.	.	.	.	.	.	.	.	C	12.61	1.989397	0.35131	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.63255	-0.03;0.2;0.21;0.2;0.25	5.78	5.78	0.91487	Ribonuclease H-like (1);	.	.	.	.	T	0.55081	0.1898	L	0.29908	0.895	0.24505	N	0.994236	B;B;B;B;P	0.36412	0.006;0.006;0.006;0.001;0.552	B;B;B;B;B	0.37650	0.003;0.003;0.003;0.005;0.255	T	0.56745	-0.7928	9	0.87932	D	0	.	14.9061	0.70721	0.0:0.8573:0.1427:0.0	.	738;738;738;784;784	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	R	784;738;738;738;738;784	ENSP00000343764:G784R;ENSP00000434586:G738R;ENSP00000340554:G738R;ENSP00000352154:G738R;ENSP00000354117:G784R	ENSP00000340554:G738R	G	-	1	0	TTN	179358840	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.886000	0.48578	2.894000	0.99253	0.655000	0.94253	GGA		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		24	66	0	0	0	0.004656	0	24	66				
PARD3B	117583	broad.mit.edu	37	2	206023445	206023445	+	Splice_Site	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:206023445G>C	ENST00000406610.2	+	11	1641		c.e11-1		PARD3B_ENST00000358768.2_Intron|PARD3B_ENST00000351153.1_Splice_Site|PARD3B_ENST00000462231.1_Splice_Site|PARD3B_ENST00000349953.3_Splice_Site	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta						cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.?(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TCCCCTAACAGAAAGGAGAAC	0.478																																							uc002var.1		NA																	1	Unknown(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.e11-1		par-3 partitioning defective 3 homolog B isoform							120.0	118.0	119.0					2																	206023445		1892	4127	6019	SO:0001630	splice_region_variant	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:206023445G>C	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1435-1G>C	2.37:g.206023445G>C			Somatic				PARD3B_uc010fub.1_Splice_Site_p.K479_splice|PARD3B_uc002vao.1_Splice_Site_p.K479_splice|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Splice_Site_p.K479_splice	p.K479_splice	NM_152526	NP_689739	WXS	Illumina HiSeq	Unspecified	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	11	1642	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)						E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Splice_Site	SNP	ENST00000406610.2	37	c.1435_splice		.	.	.	.	.	.	.	.	.	.	G	20.6	4.016474	0.75161	.	.	ENSG00000116117	ENST00000406610;ENST00000351153;ENST00000349953	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1606	0.98132	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PARD3B	205731690	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	9.390000	0.97246	2.772000	0.95346	0.650000	0.86243	.		0.478	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	Intron	4	167	0	0	0	0.000602	0	4	167				
CRYGB	1419	broad.mit.edu	37	2	209007437	209007437	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:209007437C>T	ENST00000260988.4	-	3	500	c.453G>A	c.(451-453)gaG>gaA	p.E151E		NM_005210.3	NP_005201.2	P07316	CRGB_HUMAN	crystallin, gamma B	151	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens fiber cell morphogenesis (GO:0070309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)	p.E151E(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)	14				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		ACCTCCTGTACTCCCCCGGCC	0.502																																							uc002vcp.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(451-453)GAG>GAA		crystallin, gamma B							85.0	87.0	86.0					2																	209007437		2203	4300	6503	SO:0001819	synonymous_variant	1419				visual perception		structural constituent of eye lens	g.chr2:209007437C>T		CCDS2380.1	2q34	2013-02-14			ENSG00000182187	ENSG00000182187			2409	protein-coding gene	gene with protein product		123670	"""crystallin, gamma 1-2"""	CRYG2			Standard	NM_005210		Approved		uc002vcp.4	P07316	OTTHUMG00000132941	ENST00000260988.4:c.453G>A	2.37:g.209007437C>T			Somatic					p.E151E	NM_005210	NP_005201	WXS	Illumina HiSeq	Unspecified	P07316	CRGB_HUMAN		Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)	3	486	-			151			Beta/gamma crystallin 'Greek key' 4.		Q17RB5|Q53ST2	Silent	SNP	ENST00000260988.4	37	c.453G>A	CCDS2380.1																																																																																				0.502	CRYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256473.2	NM_005210		28	166	0	0	0	0.009535	0	28	166				
SPAG16	79582	broad.mit.edu	37	2	214354705	214354705	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:214354705G>C	ENST00000331683.5	+	10	1056	c.961G>C	c.(961-963)Gat>Cat	p.D321H	SPAG16_ENST00000374309.3_Missense_Mutation_p.D227H	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	321					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.D321H(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		ATTTCCCATAGATATGCAACC	0.313																																							uc002veq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(961-963)GAT>CAT		sperm associated antigen 16 isoform 1							59.0	67.0	64.0					2																	214354705		2201	4299	6500	SO:0001583	missense	79582				cilium assembly	cilium axoneme|flagellar axoneme		g.chr2:214354705G>C	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.961G>C	2.37:g.214354705G>C	ENSP00000332592:p.Asp321His		Somatic				SPAG16_uc010fuz.1_Missense_Mutation_p.D172H|SPAG16_uc002ver.2_Missense_Mutation_p.D267H|SPAG16_uc010zjk.1_Missense_Mutation_p.D227H	p.D321H	NM_024532	NP_078808	WXS	Illumina HiSeq	Unspecified	Q8N0X2	SPG16_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)	10	1053	+		Renal(323;0.00461)	321					Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	c.961G>C	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	2.262	-0.369131	0.05069	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	T;T;T	0.59906	0.29;0.23;0.68	5.93	1.6	0.23607	.	0.937914	0.08926	N	0.873670	T	0.41650	0.1168	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.21071	0.004;0.051;0.034;0.004	B;B;B;B	0.24155	0.008;0.051;0.05;0.008	T	0.35276	-0.9795	10	0.48119	T	0.1	.	5.7477	0.18130	0.2632:0.147:0.5897:0.0	.	227;172;261;321	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	H	321;227;7	ENSP00000332592:D321H;ENSP00000363428:D227H;ENSP00000416600:D7H	ENSP00000332592:D321H	D	+	1	0	SPAG16	214062950	0.071000	0.21146	0.002000	0.10522	0.023000	0.10783	0.205000	0.17356	0.410000	0.25675	0.555000	0.69702	GAT		0.313	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532		10	78	0	0	0	0.013537	0	10	78				
SPEG	10290	broad.mit.edu	37	2	220344819	220344819	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr2:220344819G>C	ENST00000312358.7	+	25	5431	c.5299G>C	c.(5299-5301)Gag>Cag	p.E1767Q	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1767	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E1767Q(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGTAGCACCCGAGATTGTCAA	0.607																																							uc010fwg.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(5299-5301)GAG>CAG		SPEG complex locus							82.0	86.0	85.0					2																	220344819		2096	4237	6333	SO:0001583	missense	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220344819G>C	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5299G>C	2.37:g.220344819G>C	ENSP00000311684:p.Glu1767Gln		Somatic					p.E1767Q	NM_005876	NP_005867	WXS	Illumina HiSeq	Unspecified	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	25	5299	+		Renal(207;0.0183)	1767			Protein kinase 1.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.5299G>C	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	g	18.39	3.613803	0.66672	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.75821	-0.97	4.55	4.55	0.56014	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42172	D	0.000741	D	0.90397	0.6994	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93356	0.6722	10	0.87932	D	0	.	17.8806	0.88839	0.0:0.0:1.0:0.0	.	1767	Q15772	SPEG_HUMAN	Q	1767	ENSP00000311684:E1767Q	ENSP00000265327:E1767Q	E	+	1	0	SPEG	220053063	1.000000	0.71417	0.961000	0.40146	0.989000	0.77384	9.493000	0.97960	2.525000	0.85131	0.604000	0.83254	GAG		0.607	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		6	105	0	0	0	0.001984	0	6	105				
PANK2	80025	broad.mit.edu	37	20	3897586	3897586	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:3897586G>C	ENST00000316562.4	+	5	1431	c.1425G>C	c.(1423-1425)atG>atC	p.M475I	PANK2_ENST00000610179.1_Missense_Mutation_p.M352I|MIR103A2_ENST00000362154.1_RNA|PANK2_ENST00000464452.1_3'UTR|PANK2_ENST00000497424.1_Missense_Mutation_p.M184I	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	475				M -> K (in Ref. 2; BAB13897). {ECO:0000305}.	aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.M475I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TTGGAAACATGATGAGCAAGG	0.418																																							uc002wkc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1423-1425)ATG>ATC		pantothenate kinase 2 isoform 1 preproprotein							90.0	76.0	81.0					20																	3897586		2203	4300	6503	SO:0001583	missense	80025				cell death|coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial intermembrane space|nucleus	ATP binding|pantothenate kinase activity|protein binding	g.chr20:3897586G>C	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1425G>C	20.37:g.3897586G>C	ENSP00000313377:p.Met475Ile		Somatic				PANK2_uc002wkb.2_Missense_Mutation_p.M184I|PANK2_uc002wkd.2_RNA|PANK2_uc002wke.2_Missense_Mutation_p.M184I|PANK2_uc002wkf.2_Missense_Mutation_p.M39I|uc002wkg.2_5'Flank|MIR103-2_hsa-mir-103-2|MI0000108_5'Flank	p.M475I	NM_153638	NP_705902	WXS	Illumina HiSeq	Unspecified	Q9BZ23	PANK2_HUMAN			5	1431	+			475	M -> K (in Ref. 2; BAB13897).				B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	c.1425G>C	CCDS13071.2	.	.	.	.	.	.	.	.	.	.	G	19.96	3.924326	0.73213	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.99488	-6.0;-6.0	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	L	0.52126	1.63	0.58432	D	0.999998	B	0.25772	0.134	B	0.38428	0.273	D	0.98216	1.0475	10	0.42905	T	0.14	.	16.3012	0.82816	0.0:0.0:1.0:0.0	.	475	Q9BZ23	PANK2_HUMAN	I	184;475;291	ENSP00000417609:M184I;ENSP00000313377:M475I	ENSP00000313377:M475I	M	+	3	0	PANK2	3845586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.563000	0.98148	2.713000	0.92767	0.655000	0.94253	ATG		0.418	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960		3	55	0	0	0	0.004672	0	3	55				
LRRN4	164312	broad.mit.edu	37	20	6022399	6022399	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:6022399G>C	ENST00000378858.4	-	5	1716	c.1492C>G	c.(1492-1494)Cag>Gag	p.Q498E		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	498					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.Q498E(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						TGGCCGGGCTGAGGCGAGCTT	0.632																																							uc002wmo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1492-1494)CAG>GAG		leucine rich repeat neuronal 4 precursor							108.0	116.0	113.0					20																	6022399		2203	4300	6503	SO:0001583	missense	164312					integral to membrane		g.chr20:6022399G>C	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.1492C>G	20.37:g.6022399G>C	ENSP00000368135:p.Gln498Glu		Somatic					p.Q498E	NM_152611	NP_689824	WXS	Illumina HiSeq	Unspecified	Q8WUT4	LRRN4_HUMAN			5	1716	-			498			Extracellular (Potential).		A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	c.1492C>G	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583275	0.28268	.	.	ENSG00000125872	ENST00000378858	T	0.57436	0.4	5.25	4.29	0.51040	.	0.921516	0.09178	N	0.837927	T	0.38108	0.1028	L	0.27053	0.805	0.09310	N	1	B	0.27791	0.189	B	0.19148	0.024	T	0.15925	-1.0420	10	0.16896	T	0.51	-6.3265	11.2485	0.49010	0.0:0.0:0.8171:0.1829	.	498	Q8WUT4	LRRN4_HUMAN	E	498	ENSP00000368135:Q498E	ENSP00000368135:Q498E	Q	-	1	0	LRRN4	5970399	0.003000	0.15002	0.009000	0.14445	0.007000	0.05969	1.282000	0.33226	1.185000	0.42971	0.561000	0.74099	CAG		0.632	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611		8	209	0	0	0	0.006214	0	8	209				
ACSS2	55902	broad.mit.edu	37	20	33508916	33508916	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:33508916G>A	ENST00000360596.2	+	10	1462	c.1251G>A	c.(1249-1251)atG>atA	p.M417I	ACSS2_ENST00000253382.5_Missense_Mutation_p.M430I|ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.M367I	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	417					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.M417I(1)|p.M430I(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTCTGCTCATGAAGTTTGGAG	0.537																																							uc002xbd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1249-1251)ATG>ATA		acyl-CoA synthetase short-chain family member 2	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						190.0	173.0	179.0					20																	33508916		2203	4300	6503	SO:0001583	missense	55902				ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding	g.chr20:33508916G>A	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1251G>A	20.37:g.33508916G>A	ENSP00000353804:p.Met417Ile		Somatic				ACSS2_uc002xbc.2_Missense_Mutation_p.M322I|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Missense_Mutation_p.M430I|ACSS2_uc002xbe.2_Missense_Mutation_p.M125I|ACSS2_uc002xbf.2_Intron	p.M417I	NM_018677	NP_061147	WXS	Illumina HiSeq	Unspecified	Q9NR19	ACSA_HUMAN			10	1372	+			417					A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	ENST00000360596.2	37	c.1251G>A	CCDS13243.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773993	0.90108	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.39592	1.07;1.07;1.07	5.53	5.53	0.82687	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.61073	0.2318	M	0.64080	1.96	0.80722	D	1	P;P	0.49447	0.924;0.815	P;P	0.58266	0.836;0.631	T	0.61322	-0.7086	10	0.87932	D	0	-11.8286	19.6556	0.95837	0.0:0.0:1.0:0.0	.	430;417	Q5QPH3;Q9NR19	.;ACSA_HUMAN	I	367;417;415;125;430	ENSP00000337190:M367I;ENSP00000353804:M417I;ENSP00000253382:M430I	ENSP00000253382:M430I	M	+	3	0	ACSS2	32972577	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.657000	0.98554	2.882000	0.98803	0.655000	0.94253	ATG		0.537	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677		9	310	0	0	0	0.008291	0	9	310				
CHD6	84181	broad.mit.edu	37	20	40122243	40122243	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:40122243C>T	ENST00000373233.3	-	10	1426	c.1249G>A	c.(1249-1251)Gat>Aat	p.D417N	CHD6_ENST00000309279.7_Missense_Mutation_p.D417N	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	417	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.D417N(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GGATCTACATCTTCCTCTAGC	0.418																																							uc002xka.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(1249-1251)GAT>AAT		chromodomain helicase DNA binding protein 6							119.0	111.0	114.0					20																	40122243		2203	4300	6503	SO:0001583	missense	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40122243C>T	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.1249G>A	20.37:g.40122243C>T	ENSP00000362330:p.Asp417Asn		Somatic				CHD6_uc002xkd.2_Missense_Mutation_p.D395N	p.D417N	NM_032221	NP_115597	WXS	Illumina HiSeq	Unspecified	Q8TD26	CHD6_HUMAN			10	1427	-		Myeloproliferative disorder(115;0.00425)	417			Chromo 2.		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	c.1249G>A	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	35	5.566179	0.96540	.	.	ENSG00000124177	ENST00000373233;ENST00000309279	T;T	0.70749	-0.51;-0.51	5.68	5.68	0.88126	Chromo domain (1);Chromo domain/shadow (2);	0.000000	0.56097	D	0.000027	D	0.85630	0.5741	M	0.81682	2.555	0.80722	D	1	D	0.65815	0.995	D	0.73380	0.98	D	0.86770	0.1972	10	0.87932	D	0	-17.6989	19.7802	0.96413	0.0:1.0:0.0:0.0	.	417	Q8TD26	CHD6_HUMAN	N	417	ENSP00000362330:D417N;ENSP00000308684:D417N	ENSP00000308684:D417N	D	-	1	0	CHD6	39555657	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.776000	0.85560	2.669000	0.90835	0.561000	0.74099	GAT		0.418	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			6	127	0	0	0	0.00308	0	6	127				
PLTP	5360	broad.mit.edu	37	20	44539798	44539798	+	Missense_Mutation	SNP	T	T	C	rs375342338		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:44539798T>C	ENST00000477313.1	-	2	787	c.193A>G	c.(193-195)Atc>Gtc	p.I65V	PLTP_ENST00000542937.1_Missense_Mutation_p.I85V|PLTP_ENST00000372431.3_Missense_Mutation_p.I65V|PLTP_ENST00000420868.2_Missense_Mutation_p.I65V|PLTP_ENST00000372420.1_5'Flank|PLTP_ENST00000354050.4_Missense_Mutation_p.I65V			P55058	PLTP_HUMAN	phospholipid transfer protein	65					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.I65V(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				TACTCAGAGATGTTGTAGTAG	0.637																																							uc002xqn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(193-195)ATC>GTC		phospholipid transfer protein isoform a		T	VAL/ILE,VAL/ILE,VAL/ILE	0,4406		0,0,2203	74.0	79.0	77.0		193,193,193	5.1	1.0	20		77	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PLTP	NM_001242920.1,NM_006227.3,NM_182676.2	29,29,29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	65/399,65/494,65/442	44539798	1,13005	2203	4300	6503	SO:0001583	missense	5360				cellular lipid metabolic process|lipid transport	extracellular region	lipid binding	g.chr20:44539798T>C	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.193A>G	20.37:g.44539798T>C	ENSP00000417138:p.Ile65Val		Somatic				PLTP_uc002xql.1_5'Flank|PLTP_uc002xqm.1_Missense_Mutation_p.I85V|PLTP_uc002xqo.1_Missense_Mutation_p.I65V|PLTP_uc002xqp.1_Missense_Mutation_p.I65V|PLTP_uc002xqq.1_Missense_Mutation_p.I34V|PLTP_uc010zxj.1_Missense_Mutation_p.I65V|PLTP_uc010ghj.1_Missense_Mutation_p.I65V	p.I65V	NM_006227	NP_006218	WXS	Illumina HiSeq	Unspecified	P55058	PLTP_HUMAN			3	273	-		Myeloproliferative disorder(115;0.0122)	65					A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	37	c.193A>G	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586990	0.86851	0.0	1.16E-4	ENSG00000100979	ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T	0.05258	3.47;3.47;3.47;3.47;3.47	5.07	5.07	0.68467	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.000000	0.85682	D	0.000000	T	0.22704	0.0548	M	0.70275	2.135	0.58432	D	0.999993	D;D;D;D;D;D	0.76494	0.994;0.994;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.85130	0.978;0.978;0.997;0.995;0.997;0.997	T	0.01496	-1.1340	10	0.27082	T	0.32	-35.9909	14.9891	0.71371	0.0:0.0:0.0:1.0	.	65;65;65;65;65;85	E7EV16;B4DRB4;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;PLTP_HUMAN;.	V	65;65;65;85;65	ENSP00000361508:I65V;ENSP00000335290:I65V;ENSP00000417138:I65V;ENSP00000440296:I85V;ENSP00000411671:I65V	ENSP00000335290:I65V	I	-	1	0	PLTP	43973205	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.177000	0.58276	2.129000	0.65627	0.383000	0.25322	ATC		0.637	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227		3	133	0	0	0	0.004672	0	3	133				
FAM65C	140876	broad.mit.edu	37	20	49209728	49209728	+	Missense_Mutation	SNP	G	G	C	rs372814425		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:49209728G>C	ENST00000327979.2	-	18	2617	c.2206C>G	c.(2206-2208)Cgc>Ggc	p.R736G	FAM65C_ENST00000045083.2_Missense_Mutation_p.R736G|FAM65C_ENST00000535356.1_Missense_Mutation_p.R740G			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	736								p.R736G(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGGAGCCTGCGGCACGCTGGC	0.587																																							uc002xvm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2206-2208)CGC>GGC		hypothetical protein LOC140876							33.0	37.0	36.0					20																	49209728		1968	4155	6123	SO:0001583	missense	140876							g.chr20:49209728G>C	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2206C>G	20.37:g.49209728G>C	ENSP00000332663:p.Arg736Gly		Somatic				FAM65C_uc010zyt.1_Missense_Mutation_p.R740G|FAM65C_uc010zyu.1_RNA	p.R736G	NM_080829	NP_543019	WXS	Illumina HiSeq	Unspecified	Q96MK2	FA65C_HUMAN			18	2524	-			736					Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	c.2206C>G	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131628	0.37630	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	D;D;D	0.81659	-1.52;-1.52;-1.52	4.76	2.62	0.31277	.	0.620826	0.13001	U	0.421647	T	0.77572	0.4150	M	0.66939	2.045	0.09310	N	1	B;B	0.31193	0.032;0.312	B;B	0.34385	0.076;0.181	T	0.66035	-0.6023	10	0.33940	T	0.23	-12.383	9.213	0.37331	0.0:0.1415:0.5663:0.2921	.	740;736	F5H0X2;Q96MK2	.;FA65C_HUMAN	G	736;736;740	ENSP00000332663:R736G;ENSP00000045083:R736G;ENSP00000439802:R740G	ENSP00000045083:R736G	R	-	1	0	FAM65C	48643135	0.985000	0.35326	0.999000	0.59377	0.912000	0.54170	1.057000	0.30492	1.109000	0.41680	0.561000	0.74099	CGC		0.587	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1			18	37	0	0	0	0.004656	0	18	37				
C20orf166-AS1	253868	broad.mit.edu	37	20	61143770	61143770	+	RNA	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr20:61143770C>T	ENST00000475015.1	-	0	568				C20orf166-AS1_ENST00000412495.1_RNA|C20orf166-AS1_ENST00000436101.1_RNA			Q96NR2	C2AS1_HUMAN	C20orf166 antisense RNA 1									p.E26E(1)									AACCGCTGCTCTCCTGCGTCC	0.662																																							uc002ycz.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(76-78)GAG>GAA		hypothetical protein LOC253868							98.0	89.0	92.0					20																	61143770		2203	4299	6502			253868							g.chr20:61143770C>T	AK054875		20q13.33	2012-10-12	2012-08-15	2011-08-10	ENSG00000174403	ENSG00000174403		"""Long non-coding RNAs"""	26393	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 200"", ""non-protein coding RNA 335"", ""C20orf166 antisense RNA 1 (non-protein coding)"""	C20orf200, NCRNA00335			Standard	NR_033263		Approved	FLJ30313	uc002ycz.3	Q96NR2	OTTHUMG00000048002		20.37:g.61143770C>T			Somatic				C20orf200_uc002ycy.2_RNA	p.E26E	NM_152757	NP_689970	WXS	Illumina HiSeq	Unspecified			BRCA - Breast invasive adenocarcinoma(19;7.17e-06)		3	569	-	Breast(26;2.05e-08)							Q52LN1	Silent	SNP	ENST00000475015.1	37	c.78G>A																																																																																					0.662	C20orf166-AS1-002	KNOWN	basic	antisense	antisense	OTTHUMT00000109266.2	NR_033263		9	129	0	0	0	0.008291	0	9	129				
SETD4	54093	broad.mit.edu	37	21	37420692	37420692	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr21:37420692C>G	ENST00000399215.1	-	4	1582	c.210G>C	c.(208-210)gaG>gaC	p.E70D	SETD4_ENST00000399207.1_Missense_Mutation_p.E70D|SETD4_ENST00000399205.1_Missense_Mutation_p.E46D|SETD4_ENST00000481477.1_Intron|SETD4_ENST00000399212.1_Missense_Mutation_p.E46D|SETD4_ENST00000332131.4_Missense_Mutation_p.E70D|SETD4_ENST00000399201.1_Missense_Mutation_p.E46D|SETD4_ENST00000399208.2_Missense_Mutation_p.E70D			Q9NVD3	SETD4_HUMAN	SET domain containing 4	70	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)	p.E70D(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						TCATCTGTCCCTCCTGGCCAA	0.473																																							uc002yuw.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(208-210)GAG>GAC		SET domain containing 4 isoform a							245.0	206.0	219.0					21																	37420692		2203	4300	6503	SO:0001583	missense	54093							g.chr21:37420692C>G	AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.210G>C	21.37:g.37420692C>G	ENSP00000382163:p.Glu70Asp		Somatic				SETD4_uc002yux.1_Missense_Mutation_p.E46D|SETD4_uc002yuu.2_Intron|SETD4_uc002yuv.2_Missense_Mutation_p.E70D|SETD4_uc002yuy.2_Missense_Mutation_p.E70D|SETD4_uc002yuz.2_Missense_Mutation_p.E46D|SETD4_uc002yva.2_Missense_Mutation_p.E46D	p.E70D	NM_017438	NP_059134	WXS	Illumina HiSeq	Unspecified	Q9NVD3	SETD4_HUMAN			4	1583	-			70			SET.		B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Missense_Mutation	SNP	ENST00000399215.1	37	c.210G>C	CCDS13640.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087615	0.36855	.	.	ENSG00000185917	ENST00000399215;ENST00000399212;ENST00000332131;ENST00000399205;ENST00000399208;ENST00000399201;ENST00000399207;ENST00000424303;ENST00000429161;ENST00000446166;ENST00000442559	D;D;D;D;D;D;D;T;T;T;T	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;2.39;2.39;2.39;2.39	5.25	3.09	0.35607	SET domain (1);	0.307941	0.34906	N	0.003581	T	0.75568	0.3867	M	0.65498	2.005	0.34129	D	0.665012	P;P;B;P	0.40360	0.714;0.528;0.451;0.583	B;B;B;B	0.39562	0.303;0.277;0.135;0.303	T	0.73496	-0.3964	10	0.16896	T	0.51	-13.3082	3.7719	0.08645	0.2457:0.5685:0.0:0.1858	.	46;70;46;70	A8MTS1;C9JWV5;Q9NVD3-3;Q9NVD3	.;.;.;SETD4_HUMAN	D	70;46;70;46;70;46;70;70;70;46;46	ENSP00000382163:E70D;ENSP00000382161:E46D;ENSP00000329189:E70D;ENSP00000382156:E46D;ENSP00000382159:E70D;ENSP00000382152:E46D;ENSP00000382158:E70D;ENSP00000399998:E70D;ENSP00000396837:E70D;ENSP00000413318:E46D;ENSP00000394822:E46D	ENSP00000329189:E70D	E	-	3	2	SETD4	36342562	0.998000	0.40836	1.000000	0.80357	0.721000	0.41392	0.664000	0.25068	1.161000	0.42604	0.563000	0.77884	GAG		0.473	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438		139	229	0	0	0	0.01441	0	139	229				
TRPM2	7226	broad.mit.edu	37	21	45846542	45846542	+	Splice_Site	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr21:45846542G>C	ENST00000397928.1	+	26	4240		c.e26-1		AP001065.2_ENST00000423310.1_RNA|TRPM2_ENST00000397932.2_Splice_Site|TRPM2_ENST00000300482.5_Splice_Site|TRPM2_ENST00000300481.9_Splice_Site|TRPM2_ENST00000498430.1_Splice_Site	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TTTTGCGACAGACGGAGTTCC	0.587																																							uc002zet.1		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.e27-1		transient receptor potential cation channel,							84.0	88.0	87.0					21																	45846542		2203	4300	6503	SO:0001630	splice_region_variant	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45846542G>C	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.3796-1G>C	21.37:g.45846542G>C			Somatic				TRPM2_uc002zeu.1_Splice_Site_p.T1266_splice|TRPM2_uc002zew.1_Splice_Site_p.T1266_splice|TRPM2_uc010gpt.1_Splice_Site_p.T1316_splice|TRPM2_uc002zex.1_Splice_Site_p.T1052_splice|TRPM2_uc002zey.1_Splice_Site_p.T779_splice|uc011afe.1_5'Flank|TRPM2_uc011aff.1_Intron	p.T1266_splice	NM_003307	NP_003298	WXS	Illumina HiSeq	Unspecified	O94759	TRPM2_HUMAN			27	4009	+								D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Splice_Site	SNP	ENST00000397928.1	37	c.3796_splice	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	7.012	0.556938	0.13436	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932;ENST00000540347	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.075	0.80962	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRPM2	44670970	0.999000	0.42202	0.134000	0.22075	0.006000	0.05464	3.894000	0.56250	2.206000	0.71126	0.655000	0.94253	.		0.587	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	Intron	3	153	0	0	0	0.009096	0	3	153				
COL18A1	80781	broad.mit.edu	37	21	46908346	46908346	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr21:46908346G>T	ENST00000359759.4	+	17	3177	c.3156G>T	c.(3154-3156)ctG>ctT	p.L1052L	COL18A1_ENST00000400337.2_Silent_p.L637L|COL18A1_ENST00000355480.5_Silent_p.L817L			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1052	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)	p.L817L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTCCCGGCCTGCCGGGACTTA	0.607																																							uc011afs.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(3154-3156)CTG>CTT		alpha 1 type XVIII collagen isoform 3 precursor							90.0	99.0	96.0					21																	46908346		1988	4139	6127	SO:0001819	synonymous_variant	80781				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding	g.chr21:46908346G>T		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3156G>T	21.37:g.46908346G>T			Somatic				COL18A1_uc002zhg.2_Silent_p.L637L|COL18A1_uc002zhi.2_Silent_p.L817L	p.L1052L	NM_130444	NP_569711	WXS	Illumina HiSeq	Unspecified	P39060	COIA1_HUMAN		Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)	17	3177	+			1052			Triple-helical region 4 (COL4).		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37	c.3156G>T																																																																																					0.607	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			8	129	1	0	0.000274275	0.004482	0.000313901	8	129				
PI4KA	5297	broad.mit.edu	37	22	21174157	21174157	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:21174157C>G	ENST00000572273.1	-	6	617	c.387G>C	c.(385-387)ctG>ctC	p.L129L	PI4KA_ENST00000255882.6_Silent_p.L187L			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	129					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.L129L(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGATTCCTATCAGGCATGGGA	0.428																																					GBM(136;1332 1831 3115 23601 50806)	GBM(136;1332 1831 3115 23601 50806)	uc002zsz.3		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4						c.(385-387)CTG>CTC		phosphatidylinositol 4-kinase type 3 alpha							141.0	131.0	134.0					22																	21174157		2203	4300	6503	SO:0001819	synonymous_variant	5297				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr22:21174157C>G	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.387G>C	22.37:g.21174157C>G			Somatic				PI4KA_uc010gsq.1_Silent_p.L187L	p.L129L	NM_058004	NP_477352	WXS	Illumina HiSeq	Unspecified	P42356	PI4KA_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		6	618	-	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	129					Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37	c.387G>C																																																																																					0.428	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004		4	207	0	0	0	0.001168	0	4	207				
CRKL	1399	broad.mit.edu	37	22	21288146	21288146	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:21288146C>G	ENST00000354336.3	+	2	900	c.391C>G	c.(391-393)Ctg>Gtg	p.L131V		NM_005207.3	NP_005198.1	P46109	CRKL_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog-like	131	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of MAPKK activity (GO:0000186)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|heart development (GO:0007507)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|parathyroid gland development (GO:0060017)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|thymus development (GO:0048538)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	poly(A) RNA binding (GO:0044822)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.L131V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)	14	all_cancers(11;1.16e-25)|all_epithelial(7;3.37e-24)|Lung NSC(8;7.25e-16)|all_lung(8;1.37e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.176)			TGTACGGACTCTGTATGATTT	0.463																																					Pancreas(85;3 1441 23889 42519 42763)	Pancreas(85;3 1441 23889 42519 42763)	uc002ztf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(391-393)CTG>GTG		v-crk sarcoma virus CT10 oncogene homolog							119.0	122.0	121.0					22																	21288146		2203	4300	6503	SO:0001583	missense	1399				JNK cascade|Ras protein signal transduction	cytosol	protein tyrosine kinase activity|SH3/SH2 adaptor activity|signal transducer activity	g.chr22:21288146C>G		CCDS13785.1	22q11.21	2013-07-09	2013-07-09		ENSG00000099942	ENSG00000099942		"""SH2 domain containing"""	2363	protein-coding gene	gene with protein product		602007				8361759, 8798523	Standard	NM_005207		Approved		uc002ztf.2	P46109	OTTHUMG00000150807	ENST00000354336.3:c.391C>G	22.37:g.21288146C>G	ENSP00000346300:p.Leu131Val		Somatic				CRKL_uc002ztg.1_RNA	p.L131V	NM_005207	NP_005198	WXS	Illumina HiSeq	Unspecified	P46109	CRKL_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.176)		2	900	+	all_cancers(11;1.16e-25)|all_epithelial(7;3.37e-24)|Lung NSC(8;7.25e-16)|all_lung(8;1.37e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	131			SH3 1.		A8KA44|D3DX35	Missense_Mutation	SNP	ENST00000354336.3	37	c.391C>G	CCDS13785.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.836836	0.71373	.	.	ENSG00000099942	ENST00000354336	T	0.61627	0.09	5.33	5.33	0.75918	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	L	0.61218	1.895	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.74057	-0.3787	10	0.51188	T	0.08	.	16.5084	0.84278	0.0:1.0:0.0:0.0	.	131	P46109	CRKL_HUMAN	V	131	ENSP00000346300:L131V	ENSP00000346300:L131V	L	+	1	2	CRKL	19618146	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	4.943000	0.63554	2.502000	0.84385	0.655000	0.94253	CTG		0.463	CRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320158.1	NM_005207		23	161	0	0	0	0.00278	0	23	161				
MYO18B	84700	broad.mit.edu	37	22	26317265	26317265	+	Silent	SNP	A	A	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:26317265A>G	ENST00000407587.2	+	34	5578	c.5409A>G	c.(5407-5409)agA>agG	p.R1803R	MYO18B_ENST00000335473.7_Silent_p.R1802R|MYO18B_ENST00000536101.1_Silent_p.R1802R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1802	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1803R(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GACTTCGGAGAGACCTCAGGA	0.547																																							uc003abz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(5404-5406)AGA>AGG		myosin XVIIIB							46.0	47.0	46.0					22																	26317265		2031	4171	6202	SO:0001819	synonymous_variant	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26317265A>G	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5409A>G	22.37:g.26317265A>G			Somatic				MYO18B_uc003aca.1_Silent_p.R1683R|MYO18B_uc010guy.1_Silent_p.R1684R|MYO18B_uc010guz.1_Silent_p.R1682R|MYO18B_uc011aka.1_Silent_p.R956R|MYO18B_uc011akb.1_Silent_p.R1315R	p.R1802R	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			34	5656	+			1802			Tail.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37	c.5406A>G																																																																																					0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		2	8	0	0	0	0.004672	0	2	8				
NF2	4771	broad.mit.edu	37	22	30077432	30077432	+	Missense_Mutation	SNP	G	G	C	rs74315505		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:30077432G>C	ENST00000338641.4	+	15	2020	c.1579G>C	c.(1579-1581)Gaa>Caa	p.E527Q	NF2_ENST00000403435.1_Missense_Mutation_p.E498Q|NF2_ENST00000334961.7_Missense_Mutation_p.E444Q|NF2_ENST00000413209.2_Intron|NF2_ENST00000397789.3_Missense_Mutation_p.E527Q|NF2_ENST00000353887.4_Missense_Mutation_p.E444Q|NF2_ENST00000361166.4_Missense_Mutation_p.E527Q|NF2_ENST00000361452.4_Missense_Mutation_p.E486Q|NF2_ENST00000361676.4_Missense_Mutation_p.E485Q|NF2_ENST00000403999.3_Missense_Mutation_p.E527Q|NF2_ENST00000347330.5_3'UTR	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	527					actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(4)|p.E527fs*22(2)|p.E527Q(2)|p.K525fs*18(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CGGCAGAGTGGAATACATGGA	0.527			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																														uc003age.3		NA	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	D|Mis|N|F|S|O	neurofibromatosis type 2 gene			O		meningioma|acoustic neuroma	meningioma|acoustic neuroma|renal 		9	Unknown(4)|Deletion - Frameshift(3)|Substitution - Missense(2)	p.E527fs*22(2)|p.?(2)|p.G502_I577del(1)|p.K525fs*18(1)	soft_tissue(3)|lung(2)|large_intestine(1)|meninges(1)|central_nervous_system(1)|stomach(1)	meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728	GRCh37	CM941107	NF2	M	rs74315505	c.(1579-1581)GAA>CAA		neurofibromin 2 isoform 1							95.0	94.0	95.0					22																	30077432		2203	4300	6503	SO:0001583	missense	4771	Neurofibromatosis_type_2	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	g.chr22:30077432G>C	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1579G>C	22.37:g.30077432G>C	ENSP00000344666:p.Glu527Gln		Somatic				NF2_uc003afy.3_Missense_Mutation_p.E527Q|NF2_uc003afz.3_Missense_Mutation_p.E444Q|NF2_uc003agf.3_Missense_Mutation_p.E527Q|NF2_uc003agb.3_Missense_Mutation_p.E450Q|NF2_uc003agc.3_Missense_Mutation_p.E489Q|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Missense_Mutation_p.E527Q|NF2_uc003aga.3_Missense_Mutation_p.E485Q|NF2_uc003agh.3_Missense_Mutation_p.E486Q|NF2_uc003agi.3_Missense_Mutation_p.E444Q|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Missense_Mutation_p.E489Q|NF2_uc010gvp.2_Missense_Mutation_p.E191Q|NF2_uc011akq.1_Missense_Mutation_p.E153Q	p.E527Q	NM_000268	NP_000259	WXS	Illumina HiSeq	Unspecified	P35240	MERL_HUMAN			15	2022	+			527					O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	SNP	ENST00000338641.4	37	c.1579G>C	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	34	5.359518	0.95854	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	D;D;D;D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	6.03	6.03	0.97812	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90655	0.7069	M	0.72118	2.19	0.80722	D	1	P;P;P;P;P;D;D;D	0.76494	0.885;0.548;0.861;0.603;0.776;0.999;0.995;0.993	P;B;P;P;P;D;D;D	0.67382	0.734;0.328;0.615;0.513;0.517;0.917;0.951;0.917	D	0.89071	0.3469	9	.	.	.	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	502;498;486;527;527;485;444;527	B7Z4B6;P35240-8;P35240-5;P35240;P35240-2;P35240-6;P35240-4;P35240-3	.;.;.;MERL_HUMAN;.;.;.;.	Q	527;498;486;502;527;444;444;527;485;527	ENSP00000344666:E527Q;ENSP00000384029:E498Q;ENSP00000354897:E486Q;ENSP00000384797:E527Q;ENSP00000335652:E444Q;ENSP00000340626:E444Q;ENSP00000380891:E527Q;ENSP00000355183:E485Q;ENSP00000354529:E527Q	.	E	+	1	0	NF2	28407432	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.824000	0.99380	2.854000	0.98071	0.655000	0.94253	GAA		0.527	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268		5	134	0	0	0	0.001168	0	5	134				
SFI1	9814	broad.mit.edu	37	22	31927083	31927083	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:31927083G>A	ENST00000400288.2	+	4	411	c.306G>A	c.(304-306)atG>atA	p.M102I	SFI1_ENST00000540643.1_Intron|SFI1_ENST00000443326.1_Intron|SFI1_ENST00000432498.1_Missense_Mutation_p.M102I|SFI1_ENST00000414585.1_Intron|SFI1_ENST00000400289.1_Intron|SFI1_ENST00000443011.1_Intron	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	102					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGATTCGAATGACTTTTGGAA	0.338																																							uc003ale.2		NA																	0				central_nervous_system(1)	1						c.(304-306)ATG>ATA		spindle assembly associated Sfi1 homolog isoform							118.0	111.0	113.0					22																	31927083		1831	4079	5910	SO:0001583	missense	9814				G2/M transition of mitotic cell cycle	centriole|cytosol		g.chr22:31927083G>A	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.306G>A	22.37:g.31927083G>A	ENSP00000383145:p.Met102Ile		Somatic				SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Missense_Mutation_p.M102I|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron	p.M102I	NM_001007467	NP_001007468	WXS	Illumina HiSeq	Unspecified	A8K8P3	SFI1_HUMAN			4	699	+			102					A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	c.306G>A	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833683	0.32421	.	.	ENSG00000198089	ENST00000432498;ENST00000400288;ENST00000450787	T;T;T	0.22945	3.12;3.13;1.93	4.26	2.14	0.27477	.	0.591763	0.16262	N	0.222182	T	0.12135	0.0295	N	0.08118	0	0.80722	D	1	P;P	0.35612	0.459;0.512	B;B	0.35278	0.11;0.199	T	0.10636	-1.0621	10	0.49607	T	0.09	.	6.8735	0.24133	0.2142:0.0:0.7858:0.0	.	102;102	A8K8P3-2;A8K8P3	.;SFI1_HUMAN	I	102;102;53	ENSP00000402679:M102I;ENSP00000383145:M102I;ENSP00000389364:M53I	ENSP00000383145:M102I	M	+	3	0	SFI1	30257083	0.993000	0.37304	0.995000	0.50966	0.984000	0.73092	1.242000	0.32755	0.554000	0.29061	0.442000	0.29010	ATG		0.338	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775		7	169	0	0	0	0.004482	0	7	169				
MIEF1	54471	broad.mit.edu	37	22	39910294	39910294	+	Nonsense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr22:39910294C>G	ENST00000325301.2	+	6	1782	c.1358C>G	c.(1357-1359)tCa>tGa	p.S453*	MIEF1_ENST00000402881.1_Intron|MIEF1_ENST00000404569.1_Nonsense_Mutation_p.S453*	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	453					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)	p.S453*(1)									CTGTATTGCTCATTGTCTGAG	0.532											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003axx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(1357-1359)TCA>TGA		hypothetical protein LOC54471							99.0	98.0	98.0					22																	39910294		2203	4300	6503	SO:0001587	stop_gained	54471					integral to membrane|mitochondrion		g.chr22:39910294C>G	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.1358C>G	22.37:g.39910294C>G	ENSP00000327124:p.Ser453*		Somatic	OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	889	SMCR7L_uc003axw.2_Intron|SMCR7L_uc003axy.2_Nonsense_Mutation_p.S275*	p.S453*	NM_019008	NP_061881	WXS	Illumina HiSeq	Unspecified	Q9NQG6	SMC7L_HUMAN			6	1856	+	Melanoma(58;0.04)		453					Q7L890|Q9BUI3	Nonsense_Mutation	SNP	ENST00000325301.2	37	c.1358C>G	CCDS13995.1	.	.	.	.	.	.	.	.	.	.	C	41	8.844007	0.98974	.	.	ENSG00000100335	ENST00000325301;ENST00000404569	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.52501	D	0.99995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6244	0.99512	0.0:1.0:0.0:0.0	.	.	.	.	X	453	.	.	S	+	2	0	SMCR7L	38240240	1.000000	0.71417	0.973000	0.42090	0.744000	0.42396	7.803000	0.85983	2.879000	0.98667	0.650000	0.86243	TCA		0.532	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321325.1	NM_019008		3	152	0	0	0	0.000602	0	3	152				
SRGAP3	9901	broad.mit.edu	37	3	9101977	9101977	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:9101977G>C	ENST00000383836.3	-	6	1166	c.739C>G	c.(739-741)Ctg>Gtg	p.L247V	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.L247V	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	247	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L247V(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GTGGCTGCCAGATTGAGCAAG	0.502			T	RAF1	pilocytic astrocytoma																																		uc003brf.1		NA		Dom	yes		3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3			M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(4)	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9						c.(739-741)CTG>GTG		SLIT-ROBO Rho GTPase activating protein 3							225.0	197.0	206.0					3																	9101977		2203	4300	6503	SO:0001583	missense	9901				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr3:9101977G>C	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.739C>G	3.37:g.9101977G>C	ENSP00000373347:p.Leu247Val		Somatic				SRGAP3_uc003brg.1_Missense_Mutation_p.L247V|SRGAP3_uc003bri.1_RNA|SRGAP3_uc003brk.2_Missense_Mutation_p.L247V|SRGAP3_uc003brj.1_Missense_Mutation_p.L107V	p.L247V	NM_014850	NP_055665	WXS	Illumina HiSeq	Unspecified	O43295	SRGP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0563)	6	1415	-			247					Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	c.739C>G	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192825	0.78902	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.13901	2.55;2.55	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000002	T	0.33990	0.0882	M	0.73319	2.225	0.58432	D	0.999999	D;B;P;P	0.69078	0.997;0.116;0.928;0.882	D;B;P;B	0.72625	0.978;0.103;0.632;0.428	T	0.02026	-1.1227	10	0.46703	T	0.11	.	11.9313	0.52847	0.0807:0.0:0.9193:0.0	.	247;116;247;247	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	V	247;247;127	ENSP00000373347:L247V;ENSP00000353587:L247V	ENSP00000353587:L247V	L	-	1	2	SRGAP3	9076977	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	6.452000	0.73485	2.462000	0.83206	0.460000	0.39030	CTG		0.502	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3			5	138	0	0	0	0.001984	0	5	138				
IQSEC1	9922	broad.mit.edu	37	3	12961967	12961967	+	Silent	SNP	C	C	G	rs146107147		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:12961967C>G	ENST00000273221.4	-	6	2241	c.2025G>C	c.(2023-2025)cgG>cgC	p.R675R		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	675	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R675R(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTTCATTTTCCGCTCGGGCT	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19918	0.0		0.001	False		,,,				2504	0.0						uc003bxt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2023-2025)CGG>CGC		IQ motif and Sec7 domain 1 isoform b		C	,	2,4404	4.2+/-10.8	0,2,2201	190.0	178.0	182.0		1983,2025	-1.8	1.0	3	dbSNP_134	182	13,8587	9.8+/-36.6	0,13,4287	no	coding-synonymous,coding-synonymous	IQSEC1	NM_001134382.1,NM_014869.4	,	0,15,6488	GG,GC,CC		0.1512,0.0454,0.1153	,	661/1115,675/964	12961967	15,12991	2203	4300	6503	SO:0001819	synonymous_variant	9922				regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity	g.chr3:12961967C>G	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2025G>C	3.37:g.12961967C>G			Somatic				IQSEC1_uc003bxu.3_Silent_p.R553R|IQSEC1_uc011auw.1_Silent_p.R661R	p.R675R	NM_014869	NP_055684	WXS	Illumina HiSeq	Unspecified	Q6DN90	IQEC1_HUMAN			6	2034	-			675			SEC7.		O94863|Q96D85	Silent	SNP	ENST00000273221.4	37	c.2025G>C	CCDS33703.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.492	0.862284	0.17178	4.54E-4	0.001512	ENSG00000144711	ENST00000450726	.	.	.	4.75	-1.8	0.07907	.	.	.	.	.	T	0.57007	0.2024	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52764	-0.8532	4	.	.	.	.	10.8549	0.46794	0.1519:0.2649:0.5832:0.0	.	.	.	.	Q	676	.	.	E	-	1	0	IQSEC1	12936967	0.948000	0.32251	0.983000	0.44433	0.840000	0.47671	0.054000	0.14205	-0.498000	0.06632	-0.264000	0.10439	GAA		0.582	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869		6	180	0	0	0	0.001168	0	6	180				
OXSM	54995	broad.mit.edu	37	3	25833286	25833286	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:25833286G>C	ENST00000280701.3	+	2	874	c.775G>C	c.(775-777)Gat>Cat	p.D259H	OXSM_ENST00000449808.1_3'UTR|NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000420173.2_Intron	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	259					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)	p.D259H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CACAAACTCAGATCCCAAGTT	0.483																																							uc003cdn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(775-777)GAT>CAT		3-oxoacyl-ACP synthase, mitochondrial isoform 1							76.0	78.0	77.0					3																	25833286		2203	4300	6503	SO:0001583	missense	54995				acyl-CoA metabolic process|medium-chain fatty acid biosynthetic process|short-chain fatty acid biosynthetic process	mitochondrion	3-oxoacyl-[acyl-carrier-protein] synthase activity	g.chr3:25833286G>C	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.775G>C	3.37:g.25833286G>C	ENSP00000280701:p.Asp259His		Somatic				NGLY1_uc011awo.1_5'Flank|OXSM_uc011awp.1_5'UTR|OXSM_uc010hfh.2_Intron	p.D259H	NM_017897	NP_060367	WXS	Illumina HiSeq	Unspecified	Q9NWU1	OXSM_HUMAN			2	882	+			259						Missense_Mutation	SNP	ENST00000280701.3	37	c.775G>C	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311687	0.40895	.	.	ENSG00000151093	ENST00000280701	.	.	.	6.16	6.16	0.99307	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (2);	0.335103	0.37304	N	0.002152	T	0.59348	0.2187	M	0.67953	2.075	0.80722	D	1	B	0.20887	0.049	B	0.23419	0.046	T	0.60378	-0.7275	9	0.87932	D	0	-34.1207	8.1268	0.31003	0.1802:0.0:0.8198:0.0	.	259	Q9NWU1	OXSM_HUMAN	H	259	.	ENSP00000280701:D259H	D	+	1	0	OXSM	25808290	0.997000	0.39634	0.976000	0.42696	0.986000	0.74619	2.942000	0.49018	2.937000	0.99478	0.650000	0.86243	GAT		0.483	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897		9	122	0	0	0	0.006214	0	9	122				
AZI2	64343	broad.mit.edu	37	3	28379446	28379446	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:28379446C>G	ENST00000479665.1	-	4	952	c.421G>C	c.(421-423)Gag>Cag	p.E141Q	AZI2_ENST00000334100.6_Missense_Mutation_p.E141Q|AZI2_ENST00000457172.1_Missense_Mutation_p.E141Q|AZI2_ENST00000420543.2_Missense_Mutation_p.E141Q|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	141	Homodimerization. {ECO:0000250}.				dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)		p.E141Q(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						GTTTCCACCTCTGTCCTCAGC	0.328																																							uc003ceb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(421-423)GAG>CAG		5-azacytidine induced 2 isoform a							108.0	103.0	105.0					3																	28379446		2203	4300	6503	SO:0001583	missense	64343					mitochondrion|plasma membrane		g.chr3:28379446C>G	AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.421G>C	3.37:g.28379446C>G	ENSP00000419371:p.Glu141Gln		Somatic				AZI2_uc003cec.2_Missense_Mutation_p.E29Q|AZI2_uc003ced.2_Missense_Mutation_p.E141Q|AZI2_uc003cee.3_Missense_Mutation_p.E141Q|AZI2_uc003ceg.2_Missense_Mutation_p.E141Q|AZI2_uc011axd.1_Missense_Mutation_p.E141Q|AZI2_uc003cef.2_Missense_Mutation_p.E141Q	p.E141Q	NM_022461	NP_071906	WXS	Illumina HiSeq	Unspecified	Q9H6S1	AZI2_HUMAN			4	953	-			141			Potential.		A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Missense_Mutation	SNP	ENST00000479665.1	37	c.421G>C	CCDS2647.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921800	0.73213	.	.	ENSG00000163512	ENST00000479665;ENST00000334100;ENST00000420543;ENST00000457172;ENST00000414162	.	.	.	5.85	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	L	0.47716	1.5	0.45791	D	0.998678	D;D;P;D	0.89917	1.0;0.971;0.947;0.998	D;P;P;D	0.87578	0.998;0.651;0.74;0.972	T	0.66184	-0.5987	9	0.29301	T	0.29	-10.4334	15.1635	0.72803	0.0:0.9322:0.0:0.0678	.	141;141;141;141	Q9H6S1-3;C9JB40;C9JVK8;Q9H6S1	.;.;.;AZI2_HUMAN	Q	141	.	ENSP00000335609:E141Q	E	-	1	0	AZI2	28354450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.376000	0.73141	1.482000	0.48325	0.585000	0.79938	GAG		0.328	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252998.2	NM_203326		3	58	0	0	0	0.009096	0	3	58				
COL7A1	1294	broad.mit.edu	37	3	48605555	48605555	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:48605555C>G	ENST00000328333.8	-	105	7950	c.7843G>C	c.(7843-7845)Gat>Cat	p.D2615H	COL7A1_ENST00000454817.1_Missense_Mutation_p.D2583H	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2615	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D2615H(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AAGCCAACATCTCCTTTTTCT	0.542																																							uc003ctz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(7843-7845)GAT>CAT		alpha 1 type VII collagen precursor							85.0	80.0	82.0					3																	48605555		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48605555C>G	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7843G>C	3.37:g.48605555C>G	ENSP00000332371:p.Asp2615His		Somatic					p.D2615H	NM_000094	NP_000085	WXS	Illumina HiSeq	Unspecified	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	105	7844	-			2615			Triple-helical region.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.7843G>C	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	9.965	1.223769	0.22457	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.94330	-3.4;-3.4	5.29	5.29	0.74685	.	0.139041	0.32258	N	0.006346	D	0.94693	0.8288	L	0.39397	1.21	0.42205	D	0.991789	D	0.71674	0.998	D	0.70935	0.971	D	0.94253	0.7495	10	0.39692	T	0.17	.	17.1265	0.86715	0.0:1.0:0.0:0.0	.	2615	Q02388	CO7A1_HUMAN	H	2615;2583	ENSP00000332371:D2615H;ENSP00000412569:D2583H	ENSP00000332371:D2615H	D	-	1	0	COL7A1	48580559	1.000000	0.71417	0.990000	0.47175	0.032000	0.12392	3.823000	0.55715	2.480000	0.83734	0.563000	0.77884	GAT		0.542	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		15	109	0	0	0	0.004007	0	15	109				
PRICKLE2	166336	broad.mit.edu	37	3	64148775	64148775	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:64148775C>T	ENST00000295902.6	-	3	760	c.175G>A	c.(175-177)Gag>Aag	p.E59K	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.E115K	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	59	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.E59K(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGGACTTTCTCTTCTGGGAGA	0.488																																							uc003dmf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(175-177)GAG>AAG		prickle-like 2							218.0	204.0	208.0					3																	64148775		2203	4300	6503	SO:0001583	missense	166336					cytoplasm|nuclear membrane	zinc ion binding	g.chr3:64148775C>T	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.175G>A	3.37:g.64148775C>T	ENSP00000295902:p.Glu59Lys		Somatic					p.E59K	NM_198859	NP_942559	WXS	Illumina HiSeq	Unspecified	Q7Z3G6	PRIC2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)	3	761	-		Lung NSC(201;0.136)	59			PET.		Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	c.175G>A	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420686	0.83559	.	.	ENSG00000163637	ENST00000295902;ENST00000498162	D;D	0.88124	-2.34;-2.34	5.62	5.62	0.85841	PET domain (2);	0.084838	0.49916	D	0.000131	D	0.86180	0.5871	L	0.51422	1.61	0.80722	D	1	B	0.11235	0.004	B	0.23150	0.044	T	0.81475	-0.0916	10	0.56958	D	0.05	-36.9271	19.6702	0.95909	0.0:1.0:0.0:0.0	.	59	Q7Z3G6	PRIC2_HUMAN	K	59	ENSP00000295902:E59K;ENSP00000419951:E59K	ENSP00000295902:E59K	E	-	1	0	PRICKLE2	64123815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.665000	0.90641	0.650000	0.86243	GAG		0.488	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859		12	275	0	0	0	0.010729	0	12	275				
SPICE1	152185	broad.mit.edu	37	3	113225439	113225439	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:113225439C>T	ENST00000295872.4	-	2	273	c.14G>A	c.(13-15)aGa>aAa	p.R5K		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	5					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)		p.R5K(2)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GCGGTTCACTCTGACAAATGA	0.378																																							uc003eag.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(13-15)AGA>AAA		coiled-coil domain containing 52							124.0	108.0	113.0					3																	113225439		2203	4300	6503	SO:0001583	missense	152185				cell division|mitosis	centriole|spindle	protein binding	g.chr3:113225439C>T	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.14G>A	3.37:g.113225439C>T	ENSP00000295872:p.Arg5Lys		Somatic				CCDC52_uc003eaf.3_RNA|CCDC52_uc011bie.1_Missense_Mutation_p.R17K|CCDC52_uc003eai.1_Missense_Mutation_p.R5K	p.R5K	NM_144718	NP_653319	WXS	Illumina HiSeq	Unspecified	Q8N0Z3	SPICE_HUMAN			2	305	-			5					D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	c.14G>A	CCDS2973.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057698	0.76074	.	.	ENSG00000163611	ENST00000295872;ENST00000495812;ENST00000480527;ENST00000496859	T	0.38560	1.13	5.7	4.83	0.62350	.	0.169956	0.51477	D	0.000099	T	0.33294	0.0858	L	0.45137	1.4	0.36679	D	0.878919	B;B	0.23937	0.049;0.094	B;B	0.19946	0.013;0.027	T	0.30446	-0.9978	10	0.40728	T	0.16	-17.7668	9.6228	0.39732	0.0:0.9075:0.0:0.0925	.	17;5	B4DJN7;Q8N0Z3	.;SPICE_HUMAN	K	5	ENSP00000295872:R5K	ENSP00000295872:R5K	R	-	2	0	SPICE1	114708129	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	2.149000	0.42244	2.693000	0.91896	0.585000	0.79938	AGA		0.378	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718		4	37	0	0	0	0.000602	0	4	37				
ATP6V1A	523	broad.mit.edu	37	3	113528247	113528247	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:113528247G>C	ENST00000273398.3	+	15	1935	c.1827G>C	c.(1825-1827)caG>caC	p.Q609H	ATP6V1A_ENST00000461496.1_3'UTR|ATP6V1A_ENST00000538620.1_Missense_Mutation_p.Q576H	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	609					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.Q609Q(1)|p.Q609H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AAGACATGCAGAATGCATTCC	0.393																																							uc003eao.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		urinary_tract(1)|lung(1)	ovary(2)|skin(1)	3						c.(1825-1827)CAG>CAC		ATPase, H+ transporting, lysosomal V1 subunit A							107.0	103.0	104.0					3																	113528247		2203	4300	6503	SO:0001583	missense	523				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr3:113528247G>C	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1827G>C	3.37:g.113528247G>C	ENSP00000273398:p.Gln609His		Somatic				ATP6V1A_uc011bik.1_Missense_Mutation_p.Q576H	p.Q609H	NM_001690	NP_001681	WXS	Illumina HiSeq	Unspecified	P38606	VATA_HUMAN			15	1893	+			609					B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	ENST00000273398.3	37	c.1827G>C	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594433	0.66219	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	T;T	0.77489	-1.1;-1.1	5.51	2.75	0.32379	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.107851	0.64402	D	0.000005	T	0.73032	0.3535	M	0.65498	2.005	0.58432	D	0.999998	B	0.10296	0.003	B	0.18263	0.021	T	0.68538	-0.5382	10	0.46703	T	0.11	-9.0099	9.4345	0.38630	0.2752:0.0:0.7248:0.0	.	609	P38606	VATA_HUMAN	H	326;609;576	ENSP00000273398:Q609H;ENSP00000439874:Q576H	ENSP00000273398:Q609H	Q	+	3	2	ATP6V1A	115010937	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.239000	0.58694	0.716000	0.32124	-0.380000	0.06706	CAG		0.393	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690		9	93	0	0	0	0.010729	0	9	93				
PARP15	165631	broad.mit.edu	37	3	122335957	122335957	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:122335957G>A	ENST00000464300.2	+	6	1012	c.946G>A	c.(946-948)Gaa>Aaa	p.E316K	PARP15_ENST00000310366.4_Missense_Mutation_p.E82K|PARP15_ENST00000483793.1_Missense_Mutation_p.E190K|PARP15_ENST00000493645.1_Missense_Mutation_p.E82K|PARP15_ENST00000465304.1_3'UTR	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	316	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.E316K(1)|p.E82K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		TATAGCCACTGAACAGGTAGA	0.353																																							uc003efm.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5						c.(946-948)GAA>AAA		poly (ADP-ribose) polymerase family, member 15							152.0	149.0	150.0					3																	122335957		2203	4300	6503	SO:0001583	missense	165631				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity	g.chr3:122335957G>A	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.946G>A	3.37:g.122335957G>A	ENSP00000417214:p.Glu316Lys		Somatic				PARP15_uc003efn.2_Missense_Mutation_p.E190K|PARP15_uc003efo.1_Missense_Mutation_p.E63K|PARP15_uc003efp.1_Missense_Mutation_p.E82K|PARP15_uc011bjt.1_Missense_Mutation_p.E82K	p.E316K	NM_001113523	NP_001106995	WXS	Illumina HiSeq	Unspecified	Q460N3	PAR15_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	6	1012	+			294			Macro 2.		J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	c.946G>A	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836441	0.50951	.	.	ENSG00000173200	ENST00000464300;ENST00000483793;ENST00000542823;ENST00000310366;ENST00000493645	T;T;T;T	0.24350	1.86;2.34;1.86;1.86	4.41	4.41	0.53225	Appr-1-p processing (2);	0.000000	0.34046	N	0.004308	T	0.59582	0.2204	M	0.92970	3.365	0.25985	N	0.982322	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.998;0.997;0.993;0.983;0.999	T	0.59731	-0.7399	10	0.41790	T	0.15	.	15.7221	0.77721	0.0:0.0:1.0:0.0	.	82;82;63;190;294	B7ZL48;Q460N3-2;F5H8I1;C9J7L3;Q460N3	.;.;.;.;PAR15_HUMAN	K	316;190;63;82;82	ENSP00000417214:E316K;ENSP00000417785:E190K;ENSP00000308436:E82K;ENSP00000419488:E82K	ENSP00000308436:E82K	E	+	1	0	PARP15	123818647	1.000000	0.71417	0.218000	0.23776	0.100000	0.18952	4.293000	0.59037	2.306000	0.77630	0.561000	0.74099	GAA		0.353	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615		6	203	0	0	0	0.001984	0	6	203				
ZIC4	84107	broad.mit.edu	37	3	147113672	147113672	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:147113672C>G	ENST00000383075.3	-	3	1167	c.655G>C	c.(655-657)Gaa>Caa	p.E219Q	ZIC4_ENST00000484399.1_Missense_Mutation_p.E219Q|ZIC4_ENST00000525172.2_Missense_Mutation_p.E269Q|ZIC4_ENST00000425731.3_Missense_Mutation_p.E257Q|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000473123.1_Missense_Mutation_p.E219Q	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	219						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E219Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TTGAGATTTTCTGATCTAGCA	0.532																																							uc003ewd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(655-657)GAA>CAA		zinc finger protein of the cerebellum 4							72.0	84.0	80.0					3																	147113672		2183	4298	6481	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147113672C>G	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.655G>C	3.37:g.147113672C>G	ENSP00000372553:p.Glu219Gln		Somatic				ZIC4_uc003ewc.1_Missense_Mutation_p.E149Q|ZIC4_uc011bno.1_Missense_Mutation_p.E269Q	p.E219Q	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	928	-			219			C2H2-type 3.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.655G>C	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045098	0.93685	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	D;D;D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29;-4.29;-4.29	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000267	D	0.96137	0.8741	N	0.11560	0.145	0.80722	D	1	P;D	0.63046	0.92;0.992	B;D	0.63597	0.383;0.916	D	0.97967	1.0341	10	0.87932	D	0	.	18.8843	0.92370	0.0:1.0:0.0:0.0	.	269;219	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	Q	219;257;269;219;219;219	ENSP00000372553:E219Q;ENSP00000397695:E257Q;ENSP00000435509:E269Q;ENSP00000417855:E219Q;ENSP00000420775:E219Q;ENSP00000420627:E219Q	ENSP00000372553:E219Q	E	-	1	0	ZIC4	148596362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.460000	0.83146	0.561000	0.74099	GAA		0.532	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			4	165	0	0	0	0.009096	0	4	165				
AADACL2	344752	broad.mit.edu	37	3	151475041	151475041	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:151475041G>C	ENST00000356517.3	+	5	974	c.865G>C	c.(865-867)Gag>Cag	p.E289Q	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	289						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.E289Q(1)|p.E267Q(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TCTTCTTCCTGAGAAGTATAG	0.413																																							uc003ezc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(865-867)GAG>CAG		arylacetamide deacetylase-like 2 precursor							99.0	105.0	103.0					3																	151475041		2203	4297	6500	SO:0001583	missense	344752					extracellular region|integral to membrane	carboxylesterase activity	g.chr3:151475041G>C	BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.865G>C	3.37:g.151475041G>C	ENSP00000348911:p.Glu289Gln		Somatic				AADACL2_uc010hvn.2_Missense_Mutation_p.E76Q	p.E289Q	NM_207365	NP_997248	WXS	Illumina HiSeq	Unspecified	Q6P093	ADCL2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		5	985	+			289					Q5HYJ4	Missense_Mutation	SNP	ENST00000356517.3	37	c.865G>C	CCDS3161.2	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811040	0.70797	.	.	ENSG00000197953	ENST00000356517	T	0.58652	0.32	4.9	1.92	0.25849	.	0.291299	0.38217	N	0.001762	T	0.64832	0.2634	M	0.70787	2.145	0.34867	D	0.743197	D	0.55385	0.971	P	0.56278	0.795	T	0.70139	-0.4954	10	0.45353	T	0.12	-1.8686	8.2881	0.31941	0.1003:0.0:0.7717:0.128	.	289	Q6P093	ADCL2_HUMAN	Q	289	ENSP00000348911:E289Q	ENSP00000348911:E289Q	E	+	1	0	AADACL2	152957731	1.000000	0.71417	0.846000	0.33378	0.929000	0.56500	3.455000	0.52993	0.194000	0.20326	0.591000	0.81541	GAG		0.413	AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342288.3	NM_207365		6	110	0	0	0	0.001168	0	6	110				
PTX3	5806	broad.mit.edu	37	3	157160340	157160340	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:157160340C>G	ENST00000295927.3	+	3	863	c.718C>G	c.(718-720)Ctc>Gtc	p.L240V	VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	240	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)	p.L240V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CCAGCTGTATCTCAGCTACCA	0.473																																							uc003fbl.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(718-720)CTC>GTC		pentraxin 3 precursor							108.0	99.0	102.0					3																	157160340		2203	4300	6503	SO:0001583	missense	5806				inflammatory response	extracellular region		g.chr3:157160340C>G	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.718C>G	3.37:g.157160340C>G	ENSP00000295927:p.Leu240Val		Somatic				VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	p.L240V	NM_002852	NP_002843	WXS	Illumina HiSeq	Unspecified	P26022	PTX3_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		3	861	+			240			Pentaxin.		B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	c.718C>G	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234011	0.58886	.	.	ENSG00000163661	ENST00000295927	T	0.60548	0.18	5.71	5.71	0.89125	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.718967	0.13578	N	0.377593	T	0.77745	0.4176	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74864	-0.3519	10	0.48119	T	0.1	-16.2109	19.8576	0.96767	0.0:1.0:0.0:0.0	.	240	P26022	PTX3_HUMAN	V	240	ENSP00000295927:L240V	ENSP00000295927:L240V	L	+	1	0	PTX3	158643034	1.000000	0.71417	0.993000	0.49108	0.558000	0.35554	2.809000	0.47971	2.696000	0.92011	0.655000	0.94253	CTC		0.473	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852		3	111	0	0	0	0.009096	0	3	111				
GNB4	59345	broad.mit.edu	37	3	179132738	179132738	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:179132738G>C	ENST00000232564.3	-	6	651	c.365C>G	c.(364-366)tCt>tGt	p.S122C	GNB4_ENST00000465153.1_5'Flank|GNB4_ENST00000468623.1_Missense_Mutation_p.S122C	NM_021629.3	NP_067642.1	Q9HAV0	GBB4_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 4	122					cell death (GO:0008219)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.S122C(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	16	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			GTTATATATAGAGCAGATGTT	0.473																																					Melanoma(105;1405 1491 7265 20440 33721)	Melanoma(105;1405 1491 7265 20440 33721)	uc003fjv.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(364-366)TCT>TGT		guanine nucleotide-binding protein, beta-4							165.0	171.0	169.0					3																	179132738		2203	4300	6503	SO:0001583	missense	59345				cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity	g.chr3:179132738G>C	AF300648	CCDS3230.1	3q27.1	2013-01-10			ENSG00000114450	ENSG00000114450		"""WD repeat domain containing"""	20731	protein-coding gene	gene with protein product		610863				10644457, 11842130	Standard	NM_021629		Approved		uc003fjv.4	Q9HAV0	OTTHUMG00000157440	ENST00000232564.3:c.365C>G	3.37:g.179132738G>C	ENSP00000232564:p.Ser122Cys		Somatic				GNB4_uc003fju.3_Missense_Mutation_p.S33C	p.S122C	NM_021629	NP_067642	WXS	Illumina HiSeq	Unspecified	Q9HAV0	GBB4_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)		6	645	-	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		122			WD 2.		B3KMH5|D3DNR8	Missense_Mutation	SNP	ENST00000232564.3	37	c.365C>G	CCDS3230.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996618	0.93167	.	.	ENSG00000114450	ENST00000232564;ENST00000468623	T;T	0.60299	0.2;0.2	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.000000	0.85682	D	0.000000	T	0.77512	0.4141	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.992	T	0.79546	-0.1759	10	0.87932	D	0	-36.088	19.4892	0.95044	0.0:0.0:1.0:0.0	.	122;122	Q9HAV0;A8K3F6	GBB4_HUMAN;.	C	122	ENSP00000232564:S122C;ENSP00000419693:S122C	ENSP00000232564:S122C	S	-	2	0	GNB4	180615432	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	9.717000	0.98755	2.663000	0.90544	0.655000	0.94253	TCT		0.473	GNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258218.1	NM_021629		27	196	0	0	0	0.005443	0	27	196				
YEATS2	55689	broad.mit.edu	37	3	183508768	183508768	+	Splice_Site	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:183508768G>A	ENST00000305135.5	+	21	3292	c.3097G>A	c.(3097-3099)Gga>Aga	p.G1033R		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1033					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.G1033R(1)|p.G1033*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CACAGTATCCGGTGAGTTGCA	0.527																																							uc003fly.2		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(3)|large_intestine(1)	4						c.(3097-3099)GGA>AGA		YEATS domain containing 2							93.0	100.0	98.0					3																	183508768		1994	4173	6167	SO:0001630	splice_region_variant	55689				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding	g.chr3:183508768G>A	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3097+1G>A	3.37:g.183508768G>A			Somatic				YEATS2_uc003flz.2_Missense_Mutation_p.D112N	p.G1033R	NM_018023	NP_060493	WXS	Illumina HiSeq	Unspecified	Q9ULM3	YETS2_HUMAN	all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		21	3292	+	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		1033					A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	c.3097G>A	CCDS43175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.66|11.66	1.705690|1.705690	0.30232|0.30232	.|.	.|.	ENSG00000163872|ENSG00000163872	ENST00000421660;ENST00000305135|ENST00000432781	T|.	0.35973|.	1.28|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55401|0.55401	0.1918|0.1918	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.50833|0.50833	-0.8781|-0.8781	10|5	0.66056|.	D|.	0.02|.	-11.3915|-11.3915	16.8055|16.8055	0.85626|0.85626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1033|.	Q9ULM3|.	YETS2_HUMAN|.	R|Q	1033|218	ENSP00000306983:G1033R|.	ENSP00000306983:G1033R|.	G|R	+|+	1|2	0|0	YEATS2|YEATS2	184991462|184991462	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.176000|0.176000	0.22953|0.22953	5.879000|5.879000	0.69690|0.69690	2.505000|2.505000	0.84491|0.84491	0.585000|0.585000	0.79938|0.79938	GGA|CGA		0.527	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	Missense_Mutation	30	75	0	0	0	0.006999	0	30	75				
FETUB	26998	broad.mit.edu	37	3	186370114	186370114	+	Silent	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr3:186370114G>T	ENST00000265029.3	+	7	944	c.843G>T	c.(841-843)gtG>gtT	p.V281V	RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Silent_p.V216V|FETUB_ENST00000382136.3_Silent_p.V244V|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000539949.1_Silent_p.V133V|FETUB_ENST00000450521.1_Silent_p.V281V	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	281					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)	p.V281V(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		TTCCCAAGGTGGAAGAATCCC	0.468																																							uc010hyq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(841-843)GTG>GTT		fetuin B precursor							98.0	111.0	107.0					3																	186370114		2203	4300	6503	SO:0001819	synonymous_variant	26998					extracellular space	cysteine-type endopeptidase inhibitor activity	g.chr3:186370114G>T	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.843G>T	3.37:g.186370114G>T			Somatic				FETUB_uc011brz.1_Silent_p.V133V|FETUB_uc003fqn.2_Silent_p.V281V|FETUB_uc003fqo.2_Silent_p.V176V|FETUB_uc010hyr.2_Silent_p.V244V|FETUB_uc010hys.2_Silent_p.V133V|FETUB_uc003fqp.3_Silent_p.V216V	p.V281V	NM_014375	NP_055190	WXS	Illumina HiSeq	Unspecified	Q9UGM5	FETUB_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)	8	1104	+	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		281					B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Silent	SNP	ENST00000265029.3	37	c.843G>T	CCDS3279.1																																																																																				0.468	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375		75	150	1	0	6.85908e-49	0.01441	8.6058e-49	75	150				
BOD1L1	259282	broad.mit.edu	37	4	13605037	13605037	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:13605037G>C	ENST00000040738.5	-	10	3622	c.3487C>G	c.(3487-3489)Caa>Gaa	p.Q1163E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1163						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q1163E(1)									TCATCCTTTTGAACAGTGGCA	0.373																																							uc003gmz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)	6						c.(3487-3489)CAA>GAA		biorientation of chromosomes in cell division							99.0	107.0	104.0					4																	13605037		2203	4300	6503	SO:0001583	missense	259282						DNA binding	g.chr4:13605037G>C	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3487C>G	4.37:g.13605037G>C	ENSP00000040738:p.Gln1163Glu		Somatic				BOD1L_uc010idr.1_Missense_Mutation_p.Q500E	p.Q1163E	NM_148894	NP_683692	WXS	Illumina HiSeq	Unspecified	Q8NFC6	BOD1L_HUMAN			10	3604	-			1163					Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.3487C>G	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	0.293	-0.978990	0.02197	.	.	ENSG00000038219	ENST00000040738	T	0.06528	3.29	5.54	1.83	0.25207	.	0.431535	0.17216	N	0.182515	T	0.03095	0.0091	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.46992	-0.9151	10	0.02654	T	1	-0.0203	4.0873	0.09953	0.3334:0.1681:0.4986:0.0	.	1163	Q8NFC6	BOD1L_HUMAN	E	1163	ENSP00000040738:Q1163E	ENSP00000040738:Q1163E	Q	-	1	0	BOD1L	13214135	0.000000	0.05858	0.088000	0.20740	0.019000	0.09904	0.059000	0.14322	0.283000	0.22279	-0.137000	0.14449	CAA		0.373	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		16	150	0	0	0	0.006122	0	16	150				
NCAPG	64151	broad.mit.edu	37	4	17818967	17818967	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:17818967C>T	ENST00000251496.2	+	6	1035	c.859C>T	c.(859-861)Cgg>Tgg	p.R287W		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	287					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R287W(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GTTGCTCCATCGGTTGGATGT	0.408																																							uc003gpp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(859-861)CGG>TGG		chromosome condensation protein G							144.0	137.0	140.0					4																	17818967		2203	4300	6503	SO:0001583	missense	64151				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding	g.chr4:17818967C>T	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.859C>T	4.37:g.17818967C>T	ENSP00000251496:p.Arg287Trp		Somatic				NCAPG_uc011bxj.1_5'UTR	p.R287W	NM_022346	NP_071741	WXS	Illumina HiSeq	Unspecified	Q9BPX3	CND3_HUMAN		STAD - Stomach adenocarcinoma(129;0.18)	6	1035	+			287			HEAT 5.		Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	37	c.859C>T	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.161971	0.38217	.	.	ENSG00000109805	ENST00000251496	T	0.34472	1.36	5.75	3.98	0.46160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.33381	0.0861	M	0.81239	2.535	0.53688	D	0.999976	P	0.39003	0.654	B	0.23018	0.043	T	0.23762	-1.0179	10	0.59425	D	0.04	-10.606	9.3857	0.38340	0.367:0.5678:0.0:0.0652	.	287	Q9BPX3	CND3_HUMAN	W	287	ENSP00000251496:R287W	ENSP00000251496:R287W	R	+	1	2	NCAPG	17428065	0.999000	0.42202	0.993000	0.49108	0.826000	0.46750	0.595000	0.24029	0.737000	0.32582	-0.169000	0.13324	CGG		0.408	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346		10	167	0	0	0	0.010729	0	10	167				
KLHL5	51088	broad.mit.edu	37	4	39082722	39082722	+	Splice_Site	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:39082722G>C	ENST00000504108.1	+	3	987		c.e3-1		KLHL5_ENST00000359687.2_Splice_Site|KLHL5_ENST00000261425.3_Splice_Site|KLHL5_ENST00000381930.3_Splice_Site|KLHL5_ENST00000261426.5_Splice_Site|KLHL5_ENST00000508137.2_Splice_Site	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.?(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						TGTGTTCACAGATTGGTGCTC	0.363																																							uc003gts.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e3-1		kelch-like 5 isoform 1							101.0	99.0	100.0					4																	39082722		2203	4300	6503	SO:0001630	splice_region_variant	51088					cytoplasm|cytoskeleton	actin binding	g.chr4:39082722G>C	AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.705-1G>C	4.37:g.39082722G>C			Somatic				KLHL5_uc003gtp.2_Splice_Site_p.R189_splice|KLHL5_uc003gtq.2_Splice_Site_p.R48_splice|KLHL5_uc003gtr.1_Splice_Site_p.R235_splice|KLHL5_uc003gtt.2_Splice_Site_p.R174_splice	p.R235_splice	NM_015990	NP_057074	WXS	Illumina HiSeq	Unspecified	Q96PQ7	KLHL5_HUMAN			3	780	+								A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Splice_Site	SNP	ENST00000504108.1	37	c.705_splice	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331520	0.81690	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2254	0.93816	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLHL5	38759117	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.813000	0.99286	2.542000	0.85734	0.591000	0.81541	.		0.363	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1		Intron	5	141	0	0	0	0.000602	0	5	141				
UGDH	7358	broad.mit.edu	37	4	39505518	39505518	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:39505518C>T	ENST00000316423.6	-	11	1693	c.1351G>A	c.(1351-1353)Gaa>Aaa	p.E451K	UGDH_ENST00000507089.1_Missense_Mutation_p.E354K|UGDH_ENST00000506179.1_Missense_Mutation_p.E451K|UGDH_ENST00000501493.2_Missense_Mutation_p.E384K	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	451					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.E451K(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						GTTTGTAGTTCATTGTGGAGC	0.388																																							uc003guk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(1351-1353)GAA>AAA		UDP-glucose dehydrogenase	NADH(DB00157)						98.0	94.0	96.0					4																	39505518		2203	4300	6503	SO:0001583	missense	7358				glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity	g.chr4:39505518C>T	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.1351G>A	4.37:g.39505518C>T	ENSP00000319501:p.Glu451Lys		Somatic				UGDH_uc011byp.1_Missense_Mutation_p.E354K|UGDH_uc003gul.1_Missense_Mutation_p.E384K	p.E451K	NM_003359	NP_003350	WXS	Illumina HiSeq	Unspecified	O60701	UGDH_HUMAN			11	1667	-			451					B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	c.1351G>A	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	C	6.702	0.498093	0.12762	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000507089	D;T;D;D	0.82167	-1.58;-0.99;-1.58;-1.58	5.62	5.62	0.85841	NAD(P)-binding domain (1);	0.166015	0.52532	D	0.000065	T	0.61362	0.2341	N	0.01874	-0.695	0.49582	D	0.999806	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.63350	-0.6657	10	0.02654	T	1	-1.8139	18.6782	0.91537	0.0:1.0:0.0:0.0	.	384;451	B3KUU2;O60701	.;UGDH_HUMAN	K	451;384;451;354	ENSP00000319501:E451K;ENSP00000422909:E384K;ENSP00000421757:E451K;ENSP00000426560:E354K	ENSP00000319501:E451K	E	-	1	0	UGDH	39181913	0.998000	0.40836	0.541000	0.28102	0.734000	0.41952	3.378000	0.52432	2.648000	0.89879	0.650000	0.86243	GAA		0.388	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359		4	86	0	0	0	0.001168	0	4	86				
GABRA2	2555	broad.mit.edu	37	4	46307713	46307713	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:46307713G>T	ENST00000510861.1	-	7	748	c.575C>A	c.(574-576)tCa>tAa	p.S192*	GABRA2_ENST00000507069.1_Nonsense_Mutation_p.S192*|GABRA2_ENST00000356504.1_Nonsense_Mutation_p.S192*|GABRA2_ENST00000540012.1_Nonsense_Mutation_p.S137*|GABRA2_ENST00000381620.4_Nonsense_Mutation_p.S192*|GABRA2_ENST00000514090.1_Nonsense_Mutation_p.S192*|GABRA2_ENST00000515082.1_Nonsense_Mutation_p.S192*			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	192					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.S192*(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	AGTGACCTCTGAAGTTGTATA	0.363																																							uc003gxc.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(574-576)TCA>TAA		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						88.0	87.0	87.0					4																	46307713		2203	4300	6503	SO:0001587	stop_gained	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46307713G>T		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.575C>A	4.37:g.46307713G>T	ENSP00000421828:p.Ser192*		Somatic				GABRA2_uc010igc.2_Nonsense_Mutation_p.S192*|GABRA2_uc011bzc.1_Nonsense_Mutation_p.S137*|GABRA2_uc003gxe.2_Nonsense_Mutation_p.S192*	p.S192*	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			6	1248	-			192			Extracellular (Probable).		A8K0U7|B7Z1H8|Q59G14	Nonsense_Mutation	SNP	ENST00000510861.1	37	c.575C>A	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	36	5.857031	0.97030	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	.	.	.	5.76	5.76	0.90799	.	0.141899	0.49305	D	0.000151	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	18.9453	0.92620	0.0:0.0:1.0:0.0	.	.	.	.	X	192;192;192;192;137;192;192	.	ENSP00000348897:S192X	S	-	2	0	GABRA2	46002470	1.000000	0.71417	0.981000	0.43875	0.855000	0.48748	5.652000	0.67959	2.721000	0.93114	0.655000	0.94253	TCA		0.363	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			33	41	1	0	4.3181e-19	0.013726	5.25455e-19	33	41				
REST	5978	broad.mit.edu	37	4	57777211	57777211	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:57777211C>T	ENST00000309042.7	+	2	721	c.407C>T	c.(406-408)tCa>tTa	p.S136L		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	136					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S136L(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					ATTTACAGTTCAAATAAAGAT	0.473																																							uc003hch.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9						c.(406-408)TCA>TTA		RE1-silencing transcription factor							65.0	65.0	65.0					4																	57777211		2203	4300	6503	SO:0001583	missense	5978				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	g.chr4:57777211C>T	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.407C>T	4.37:g.57777211C>T	ENSP00000311816:p.Ser136Leu		Somatic				REST_uc003hci.2_Missense_Mutation_p.S136L|REST_uc003hcj.1_Missense_Mutation_p.S136L|REST_uc010ihf.2_5'UTR	p.S136L	NM_005612	NP_005603	WXS	Illumina HiSeq	Unspecified	Q13127	REST_HUMAN			2	754	+	Glioma(25;0.08)|all_neural(26;0.181)		136					A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	37	c.407C>T	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089905	0.36855	.	.	ENSG00000084093	ENST00000456010;ENST00000309042;ENST00000358605	T	0.08634	3.07	6.02	6.02	0.97574	.	0.641780	0.14532	N	0.313809	T	0.09247	0.0228	L	0.44542	1.39	0.18873	N	0.999988	B;P	0.36315	0.089;0.547	B;B	0.30316	0.075;0.114	T	0.37150	-0.9718	10	0.18710	T	0.47	-4.5899	18.3138	0.90210	0.0:1.0:0.0:0.0	.	136;136	Q13127-2;Q13127	.;REST_HUMAN	L	136	ENSP00000311816:S136L	ENSP00000311816:S136L	S	+	2	0	REST	57471968	0.001000	0.12720	0.143000	0.22291	0.026000	0.11368	0.882000	0.28186	2.865000	0.98341	0.655000	0.94253	TCA		0.473	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612		7	132	0	0	0	0.001984	0	7	132				
MOB1B	92597	broad.mit.edu	37	4	71844961	71844961	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:71844961G>T	ENST00000309395.2	+	5	727	c.526G>T	c.(526-528)Gaa>Taa	p.E176*	MOB1B_ENST00000511449.1_Intron|MOB1B_ENST00000396051.2_Nonsense_Mutation_p.E181*	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	176					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)	p.E176*(1)									GCTTCAGGAGGAAGCACATCT	0.393																																							uc003hfw.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(526-528)GAA>TAA		MOB1, Mps One Binder kinase activator-like 1A							154.0	154.0	154.0					4																	71844961		2203	4300	6503	SO:0001587	stop_gained	92597				hippo signaling cascade|protein autophosphorylation	cytoplasm|nucleus	kinase activator activity|kinase binding|metal ion binding	g.chr4:71844961G>T	BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.526G>T	4.37:g.71844961G>T	ENSP00000310189:p.Glu176*		Somatic				MOBKL1A_uc011cba.1_Nonsense_Mutation_p.E181*	p.E176*	NM_173468	NP_775739	WXS	Illumina HiSeq	Unspecified	Q7L9L4	MOL1A_HUMAN	Lung(101;0.235)		5	716	+		all_hematologic(202;0.21)	176					B2R8U6|B4DRY3|Q8IY23	Nonsense_Mutation	SNP	ENST00000309395.2	37	c.526G>T	CCDS34002.1	.	.	.	.	.	.	.	.	.	.	G	37	6.486009	0.97607	.	.	ENSG00000173542	ENST00000309395;ENST00000396051	.	.	.	5.51	5.51	0.81932	.	0.044306	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.767	19.4191	0.94713	0.0:0.0:1.0:0.0	.	.	.	.	X	176;181	.	ENSP00000310189:E176X	E	+	1	0	MOBKL1A	72063825	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.581000	0.87130	0.655000	0.94253	GAA		0.393	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362634.1	NM_173468		23	152	1	0	1.55469e-16	0.00333	1.88053e-16	23	152				
THAP9	79725	broad.mit.edu	37	4	83829085	83829085	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:83829085G>A	ENST00000302236.5	+	4	779	c.728G>A	c.(727-729)aGa>aAa	p.R243K	LIN54_ENST00000505905.1_5'Flank	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	243					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)	p.R243K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				TCCATCCTCAGAACGTAAGTG	0.313																																							uc003hnt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5						c.(727-729)AGA>AAA		THAP domain containing 9							70.0	73.0	72.0					4																	83829085		2203	4299	6502	SO:0001583	missense	79725						DNA binding|metal ion binding	g.chr4:83829085G>A	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.728G>A	4.37:g.83829085G>A	ENSP00000305533:p.Arg243Lys		Somatic				THAP9_uc003hns.1_Missense_Mutation_p.R99K|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_5'UTR	p.R243K	NM_024672	NP_078948	WXS	Illumina HiSeq	Unspecified	Q9H5L6	THAP9_HUMAN			4	847	+		Hepatocellular(203;0.114)	243					B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	c.728G>A	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737387	0.49045	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	T	0.33654	1.4	3.73	3.73	0.42828	.	0.786745	0.10785	N	0.634446	T	0.37210	0.0995	L	0.40543	1.245	0.24656	N	0.993493	D	0.55172	0.97	P	0.48627	0.584	T	0.12016	-1.0564	9	.	.	.	-24.1819	11.5028	0.50448	0.0:0.1825:0.8175:0.0	.	243	Q9H5L6	THAP9_HUMAN	K	243	ENSP00000305533:R243K	.	R	+	2	0	THAP9	84048109	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.979000	0.40608	2.362000	0.80069	0.655000	0.94253	AGA		0.313	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672		4	90	0	0	0	0.009096	0	4	90				
JADE1	79960	broad.mit.edu	37	4	129792527	129792527	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:129792527T>C	ENST00000226319.6	+	11	1919	c.1639T>C	c.(1639-1641)Tcc>Ccc	p.S547P	PHF17_ENST00000452328.2_Missense_Mutation_p.S535P|PHF17_ENST00000512960.1_Missense_Mutation_p.S547P	NM_199320.2	NP_955352.1												p.S547P(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TTCTTCCTGCTCCTCCTCCTC	0.413																																							uc003igk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1639-1641)TCC>CCC		PHD finger protein 17 long isoform							172.0	163.0	166.0					4																	129792527		2203	4300	6503	SO:0001583	missense	79960				apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding	g.chr4:129792527T>C																												ENST00000226319.6:c.1639T>C	4.37:g.129792527T>C	ENSP00000226319:p.Ser547Pro		Somatic				PHF17_uc003igl.2_Missense_Mutation_p.S535P|PHF17_uc011cgy.1_Missense_Mutation_p.S547P	p.S547P	NM_199320	NP_955352	WXS	Illumina HiSeq	Unspecified	Q6IE81	JADE1_HUMAN			11	1919	+			547			Poly-Ser.			Missense_Mutation	SNP	ENST00000226319.6	37	c.1639T>C	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	T	12.20	1.867558	0.32977	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.41065	1.01;1.02;1.01	4.59	0.671	0.17929	.	0.430293	0.20778	N	0.085850	T	0.16085	0.0387	N	0.08118	0	0.80722	D	1	P;B	0.40250	0.709;0.002	B;B	0.36289	0.221;0.002	T	0.06445	-1.0826	9	.	.	.	.	3.9376	0.09313	0.128:0.0709:0.1339:0.6672	.	535;547	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	P	547;535;547;547	ENSP00000226319:S547P;ENSP00000388015:S535P;ENSP00000425730:S547P	.	S	+	1	0	PHF17	130011977	0.990000	0.36364	0.975000	0.42487	0.893000	0.52053	1.829000	0.39121	0.043000	0.15746	-1.001000	0.02504	TCC		0.413	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1			8	352	0	0	0	0.00308	0	8	352				
TIGD4	201798	broad.mit.edu	37	4	153691681	153691681	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:153691681G>A	ENST00000304337.2	-	2	1296	c.476C>T	c.(475-477)tCg>tTg	p.S159L		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	159						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S159L(1)		breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					CCAGACAGTCGAAGGGTCTAC	0.358																																							uc003imy.2		NA																	1	Substitution - Missense(1)	p.S159S(1)	lung(1)	ovary(1)	1						c.(475-477)TCG>TTG		tigger transposable element derived 4							43.0	47.0	46.0					4																	153691681		2202	4298	6500	SO:0001583	missense	201798				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding	g.chr4:153691681G>A	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.476C>T	4.37:g.153691681G>A	ENSP00000355162:p.Ser159Leu		Somatic					p.S159L	NM_145720	NP_663772	WXS	Illumina HiSeq	Unspecified	Q8IY51	TIGD4_HUMAN			2	1258	-	all_hematologic(180;0.093)		159					Q96LP5	Missense_Mutation	SNP	ENST00000304337.2	37	c.476C>T	CCDS34079.1	.	.	.	.	.	.	.	.	.	.	G	7.111	0.576076	0.13623	.	.	ENSG00000169989	ENST00000304337	T	0.15256	2.44	6.03	6.03	0.97812	.	0.177936	0.27460	N	0.019263	T	0.06600	0.0169	N	0.04880	-0.145	0.30948	N	0.725013	B	0.30068	0.267	B	0.14023	0.01	T	0.17899	-1.0354	10	0.08381	T	0.77	-16.0731	10.5512	0.45090	0.1433:0.0:0.8567:0.0	.	159	Q8IY51	TIGD4_HUMAN	L	159	ENSP00000355162:S159L	ENSP00000355162:S159L	S	-	2	0	TIGD4	153911131	0.972000	0.33761	0.970000	0.41538	0.996000	0.88848	1.984000	0.40658	2.861000	0.98227	0.655000	0.94253	TCG		0.358	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720		6	67	0	0	0	0.001168	0	6	67				
TRIM2	23321	broad.mit.edu	37	4	154215474	154215474	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:154215474C>G	ENST00000437508.2	+	5	743	c.542C>G	c.(541-543)tCt>tGt	p.S181C	TRIM2_ENST00000338700.5_Missense_Mutation_p.S208C|TRIM2_ENST00000494872.1_3'UTR	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	181					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S181C(1)|p.S208C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GAAATAGATTCTGCTCTTCAG	0.388																																							uc003ing.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(541-543)TCT>TGT		tripartite motif-containing 2 isoform 2							87.0	86.0	86.0					4																	154215474		2203	4300	6503	SO:0001583	missense	23321					cytoplasm	zinc ion binding	g.chr4:154215474C>G	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.542C>G	4.37:g.154215474C>G	ENSP00000415812:p.Ser181Cys		Somatic				TRIM2_uc003inh.2_Missense_Mutation_p.S208C	p.S181C	NM_001130067	NP_001123539	WXS	Illumina HiSeq	Unspecified	Q9C040	TRIM2_HUMAN		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)	5	743	+	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)	181					D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	c.542C>G	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257497	0.80246	.	.	ENSG00000109654	ENST00000437508;ENST00000338700;ENST00000433687	T;T;T	0.71461	-0.55;-0.57;-0.18	6.17	6.17	0.99709	B-box, C-terminal (1);	0.049389	0.85682	D	0.000000	T	0.75302	0.3831	L	0.47716	1.5	0.58432	D	0.999999	P;P	0.50943	0.94;0.94	P;P	0.50231	0.635;0.635	T	0.73445	-0.3980	10	0.48119	T	0.1	-2.4823	20.8794	0.99867	0.0:1.0:0.0:0.0	.	208;181	D3DP09;Q9C040	.;TRIM2_HUMAN	C	181;208;95	ENSP00000415812:S181C;ENSP00000339659:S208C;ENSP00000400375:S95C	ENSP00000339659:S208C	S	+	2	0	TRIM2	154434924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.336000	0.79245	2.941000	0.99782	0.655000	0.94253	TCT		0.388	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1			5	99	0	0	0	0.001984	0	5	99				
GUCY1A3	2982	broad.mit.edu	37	4	156634681	156634681	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:156634681C>G	ENST00000296518.7	+	7	1727	c.1518C>G	c.(1516-1518)ctC>ctG	p.L506L	GUCY1A3_ENST00000455639.2_Silent_p.L506L|GUCY1A3_ENST00000513574.1_Silent_p.L506L|GUCY1A3_ENST00000393832.3_Silent_p.L248L|GUCY1A3_ENST00000511507.1_Silent_p.L506L|GUCY1A3_ENST00000506455.1_Silent_p.L506L|GUCY1A3_ENST00000511108.1_Silent_p.L506L			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	506	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.L506L(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TCACCATGCTCAATGCACTGT	0.502																																							uc003iov.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1516-1518)CTC>CTG		guanylate cyclase 1, soluble, alpha 3 isoform A							72.0	62.0	65.0					4																	156634681		2203	4300	6503	SO:0001819	synonymous_variant	2982				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity	g.chr4:156634681C>G		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1518C>G	4.37:g.156634681C>G			Somatic				GUCY1A3_uc010iqc.2_Silent_p.L506L|GUCY1A3_uc003iow.2_Silent_p.L506L|GUCY1A3_uc010iqd.2_Silent_p.L505L|GUCY1A3_uc003iox.2_Silent_p.L506L|GUCY1A3_uc003ioz.2_Silent_p.L271L|GUCY1A3_uc003ioy.2_Silent_p.L506L|GUCY1A3_uc010iqe.2_Silent_p.L271L|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Silent_p.L506L	p.L506L	NM_000856	NP_000847	WXS	Illumina HiSeq	Unspecified	Q02108	GCYA3_HUMAN		COAD - Colon adenocarcinoma(41;0.17)	8	2054	+	all_hematologic(180;0.24)	Renal(120;0.0854)	506			Guanylate cyclase.		D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	ENST00000296518.7	37	c.1518C>G	CCDS34085.1																																																																																				0.502	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			4	52	0	0	0	0.000602	0	4	52				
TMEM144	55314	broad.mit.edu	37	4	159161476	159161476	+	Silent	SNP	C	C	T	rs570773863		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:159161476C>T	ENST00000296529.6	+	10	1228	c.708C>T	c.(706-708)ttC>ttT	p.F236F	TMEM144_ENST00000503404.1_3'UTR	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	236						integral component of membrane (GO:0016021)		p.F236F(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TTGCGCACTTCAGTGGCATCT	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		19190	0.0		0.0	False		,,,				2504	0.001						uc003ipx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(706-708)TTC>TTT		transmembrane protein 144							127.0	114.0	118.0					4																	159161476		2203	4300	6503	SO:0001819	synonymous_variant	55314					integral to membrane		g.chr4:159161476C>T	AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.708C>T	4.37:g.159161476C>T			Somatic				TMEM144_uc010iqi.2_RNA	p.F236F	NM_018342	NP_060812	WXS	Illumina HiSeq	Unspecified	Q7Z5S9	TM144_HUMAN		COAD - Colon adenocarcinoma(41;0.0539)	10	1228	+	all_hematologic(180;0.24)	Renal(120;0.0854)	236			Helical; (Potential).		D3DP24|Q49A05|Q9NUT3	Silent	SNP	ENST00000296529.6	37	c.708C>T	CCDS3799.1																																																																																				0.343	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342		5	90	0	0	0	0.001168	0	5	90				
SH3RF1	57630	broad.mit.edu	37	4	170017808	170017808	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:170017808C>G	ENST00000284637.9	-	12	2870	c.2529G>C	c.(2527-2529)caG>caC	p.Q843H		NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	843	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q843H(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CTGCCTCACTCTGAGGAGGAT	0.393																																							uc003isa.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(2527-2529)CAG>CAC		SH3 domain containing ring finger 1							115.0	102.0	106.0					4																	170017808		2203	4300	6503	SO:0001583	missense	57630					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding	g.chr4:170017808C>G	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2529G>C	4.37:g.170017808C>G	ENSP00000284637:p.Gln843His		Somatic					p.Q843H	NM_020870	NP_065921	WXS	Illumina HiSeq	Unspecified	Q7Z6J0	SH3R1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)	12	2864	-		Prostate(90;0.00267)|Renal(120;0.0183)	843			SH3 4.		Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	ENST00000284637.9	37	c.2529G>C	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969494	0.74246	.	.	ENSG00000154447	ENST00000284637	T	0.50548	0.74	5.65	5.65	0.86999	Src homology-3 domain (4);	0.162607	0.56097	D	0.000030	T	0.61961	0.2389	L	0.52126	1.63	0.58432	D	0.999998	D	0.71674	0.998	D	0.70487	0.969	T	0.62525	-0.6836	10	0.62326	D	0.03	-17.2375	13.9539	0.64135	0.0:0.9273:0.0:0.0727	.	843	Q7Z6J0	SH3R1_HUMAN	H	843	ENSP00000284637:Q843H	ENSP00000284637:Q843H	Q	-	3	2	SH3RF1	170254383	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.584000	0.60971	2.658000	0.90341	0.557000	0.71058	CAG		0.393	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870		3	103	0	0	0	0.004672	0	3	103				
ACSL1	2180	broad.mit.edu	37	4	185697770	185697770	+	Silent	SNP	G	G	C	rs372828590		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:185697770G>C	ENST00000515030.1	-	7	949	c.624C>G	c.(622-624)ctC>ctG	p.L208L	ACSL1_ENST00000281455.2_Silent_p.L208L|ACSL1_ENST00000504900.1_Silent_p.L208L|ACSL1_ENST00000454703.2_Silent_p.L37L|ACSL1_ENST00000437665.3_Silent_p.L37L|ACSL1_ENST00000507295.1_Silent_p.L174L|ACSL1_ENST00000504342.1_Silent_p.L208L|ACSL1_ENST00000513317.1_Silent_p.L208L			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	208					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.L208L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCTCTAATAAGAGTTTGGCCT	0.418																																							uc003iww.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(622-624)CTC>CTG		acyl-CoA synthetase long-chain family member 1	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						99.0	99.0	99.0					4																	185697770		2203	4300	6503	SO:0001819	synonymous_variant	2180				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr4:185697770G>C	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.624C>G	4.37:g.185697770G>C			Somatic				ACSL1_uc011ckm.1_Silent_p.L37L|ACSL1_uc003iwt.1_Silent_p.L208L|ACSL1_uc003iwu.1_Silent_p.L208L|ACSL1_uc011ckn.1_Silent_p.L174L|ACSL1_uc003iwv.1_Silent_p.L208L|ACSL1_uc010ise.1_5'Flank	p.L208L	NM_001995	NP_001986	WXS	Illumina HiSeq	Unspecified	P33121	ACSL1_HUMAN		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	7	918	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)	208			Cytoplasmic (Potential).		B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Silent	SNP	ENST00000515030.1	37	c.624C>G	CCDS3839.1																																																																																				0.418	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995		4	92	0	0	0	0.000602	0	4	92				
TRIP13	9319	broad.mit.edu	37	5	895027	895027	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:895027T>C	ENST00000166345.3	+	2	574	c.218T>C	c.(217-219)gTg>gCg	p.V73A	BRD9_ENST00000467963.1_5'Flank|BRD9_ENST00000483173.1_5'Flank|BRD9_ENST00000435709.2_5'Flank	NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	73					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)	p.V73A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			GTGCAGTCTGTGTCTATTATT	0.368																																							uc003jbr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GTG>GCG		thyroid hormone receptor interactor 13							89.0	87.0	88.0					5																	895027		2203	4300	6503	SO:0001583	missense	9319				double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity	g.chr5:895027T>C	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.218T>C	5.37:g.895027T>C	ENSP00000166345:p.Val73Ala		Somatic				BRD9_uc003jbn.2_5'Flank|BRD9_uc011cmb.1_5'Flank|BRD9_uc003jbo.2_5'Flank|BRD9_uc003jbq.2_5'Flank|BRD9_uc011cmc.1_5'Flank|TRIP13_uc010ite.1_Missense_Mutation_p.V73A	p.V73A	NM_004237	NP_004228	WXS	Illumina HiSeq	Unspecified	Q15645	PCH2_HUMAN	Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)		2	328	+			73					C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	c.218T>C	CCDS3858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.05|16.05	3.014105|3.014105	0.54468|0.54468	.|.	.|.	ENSG00000071539|ENSG00000071539	ENST00000513435|ENST00000166345;ENST00000354240	.|T	.|0.35605	.|1.3	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.120814	.|0.56097	.|D	.|0.000026	T|T	0.37046|0.37046	0.0989|0.0989	M|M	0.64567|0.64567	1.98|1.98	0.58432|0.58432	D|D	0.999999|0.999999	.|P	.|0.44241	.|0.829	.|B	.|0.38378	.|0.272	T|T	0.42632|0.42632	-0.9440|-0.9440	5|10	.|0.87932	.|D	.|0	-10.7427|-10.7427	14.4312|14.4312	0.67251|0.67251	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|73	.|Q15645	.|PCH2_HUMAN	R|A	69|73	.|ENSP00000166345:V73A	.|ENSP00000166345:V73A	C|V	+|+	1|2	0|0	TRIP13|TRIP13	948027|948027	1.000000|1.000000	0.71417|0.71417	0.955000|0.955000	0.39395|0.39395	0.787000|0.787000	0.44495|0.44495	7.231000|7.231000	0.78106|0.78106	1.904000|1.904000	0.55121|0.55121	0.533000|0.533000	0.62120|0.62120	TGT|GTG		0.368	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237		33	88	0	0	0	0.003271	0	33	88				
NKD2	85409	broad.mit.edu	37	5	1038130	1038130	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:1038130C>T	ENST00000296849.5	+	10	1227	c.998C>T	c.(997-999)tCc>tTc	p.S333F	NKD2_ENST00000382730.2_Intron|NKD2_ENST00000274150.4_3'UTR	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	333	Interaction with TGFA.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)	p.S333F(1)		breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			TTCCTCAAGTCCCCCAAGGGC	0.711																																							uc003jbt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(997-999)TCC>TTC		naked cuticle homolog 2							9.0	10.0	10.0					5																	1038130		2134	4190	6324	SO:0001583	missense	85409				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding	g.chr5:1038130C>T	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.998C>T	5.37:g.1038130C>T	ENSP00000296849:p.Ser333Phe		Somatic				NKD2_uc010itf.1_3'UTR	p.S333F	NM_033120	NP_149111	WXS	Illumina HiSeq	Unspecified	Q969F2	NKD2_HUMAN	Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)		10	1003	+	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		333			Interaction with TGFA.		Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	c.998C>T	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467923	0.43839	.	.	ENSG00000145506	ENST00000296849	T	0.64260	-0.09	3.84	3.84	0.44239	.	0.000000	0.64402	D	0.000001	T	0.77164	0.4090	M	0.78456	2.415	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80067	-0.1537	10	0.87932	D	0	-8.5999	11.242	0.48974	0.0:1.0:0.0:0.0	.	333	Q969F2	NKD2_HUMAN	F	333	ENSP00000296849:S333F	ENSP00000296849:S333F	S	+	2	0	NKD2	1091130	0.991000	0.36638	0.989000	0.46669	0.503000	0.33858	2.760000	0.47581	1.705000	0.51264	0.305000	0.20034	TCC		0.711	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120		5	11	0	0	0	0.004482	0	5	11				
GOLPH3	64083	broad.mit.edu	37	5	32135777	32135777	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:32135777C>A	ENST00000265070.6	-	3	688	c.373G>T	c.(373-375)Gat>Tat	p.D125Y	GOLPH3_ENST00000512668.1_5'UTR|Y_RNA_ENST00000363195.1_RNA	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	125					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)	p.D125Y(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						GTTGGAGCATCTGACTTACAG	0.373																																							uc003jhp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(373-375)GAT>TAT		golgi phosphoprotein 3							101.0	97.0	98.0					5																	32135777		2203	4300	6503	SO:0001583	missense	64083				cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding	g.chr5:32135777C>A	AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.373G>T	5.37:g.32135777C>A	ENSP00000265070:p.Asp125Tyr		Somatic					p.D125Y	NM_022130	NP_071413	WXS	Illumina HiSeq	Unspecified	Q9H4A6	GOLP3_HUMAN			3	658	-			125					Q9UIW5	Missense_Mutation	SNP	ENST00000265070.6	37	c.373G>T	CCDS3896.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953384	0.92660	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	5.38	5.38	0.77491	.	0.045265	0.85682	D	0.000000	D	0.84023	0.5381	M	0.85197	2.74	0.80722	D	1	D	0.64830	0.994	D	0.70016	0.967	D	0.85324	0.1086	9	0.56958	D	0.05	-11.2177	19.5482	0.95308	0.0:1.0:0.0:0.0	.	125	Q9H4A6	GOLP3_HUMAN	Y	125;108	.	ENSP00000265070:D125Y	D	-	1	0	GOLPH3	32171534	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.729000	0.84864	2.704000	0.92352	0.644000	0.83932	GAT		0.373	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207363.2	NM_022130		45	80	1	0	6.08268e-21	0.01441	7.44667e-21	45	80				
ADAMTS12	81792	broad.mit.edu	37	5	33684050	33684050	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:33684050C>T	ENST00000504830.1	-	4	1080	c.745G>A	c.(745-747)Gag>Aag	p.E249K	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.E249K|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	249	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E249K(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACCAGTGTCTCCACCCATCTC	0.527										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(745-747)GAG>AAG		ADAM metallopeptidase with thrombospondin type 1							132.0	122.0	125.0					5																	33684050		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33684050C>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.745G>A	5.37:g.33684050C>T	ENSP00000422554:p.Glu249Lys	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.E249K	p.E249K	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			4	908	-			249			Peptidase M12B.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.745G>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	36	5.626606	0.96671	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	D;D	0.89939	-2.59;-2.59	4.86	4.86	0.63082	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.95424	0.8514	M	0.88842	2.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95985	0.8981	10	0.87932	D	0	.	18.5475	0.91053	0.0:1.0:0.0:0.0	.	249;249	P58397-3;P58397	.;ATS12_HUMAN	K	249	ENSP00000422554:E249K;ENSP00000344847:E249K	ENSP00000344847:E249K	E	-	1	0	ADAMTS12	33719807	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.538000	0.82048	2.685000	0.91497	0.544000	0.68410	GAG		0.527	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		12	76	0	0	0	0.010729	0	12	76				
ADAMTS12	81792	broad.mit.edu	37	5	33881537	33881537	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:33881537C>T	ENST00000504830.1	-	2	511	c.176G>A	c.(175-177)cGa>cAa	p.R59Q	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R59Q|ADAMTS12_ENST00000515401.1_Missense_Mutation_p.R59Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	59					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R59Q(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGCATCTACTCGGACTGGACC	0.488										HNSCC(64;0.19)																													uc003jia.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(175-177)CGA>CAA		ADAM metallopeptidase with thrombospondin type 1							118.0	121.0	120.0					5																	33881537		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33881537C>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.176G>A	5.37:g.33881537C>T	ENSP00000422554:p.Arg59Gln	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.R59Q|ADAMTS12_uc003jib.1_Missense_Mutation_p.R59Q	p.R59Q	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			2	339	-			59					A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.176G>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	9.995	1.231927	0.22626	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.07216	3.21;3.21;3.21	5.51	-2.1	0.07210	Peptidase M12B, propeptide (1);	0.440671	0.22301	N	0.061877	T	0.08044	0.0201	L	0.45051	1.395	0.09310	N	1	B;B;B	0.25312	0.068;0.113;0.123	B;B;B	0.28385	0.012;0.019;0.089	T	0.27640	-1.0068	10	0.42905	T	0.14	.	12.9994	0.58666	0.0:0.3804:0.0:0.6196	.	59;59;59	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	Q	59	ENSP00000422554:R59Q;ENSP00000344847:R59Q;ENSP00000421638:R59Q	ENSP00000344847:R59Q	R	-	2	0	ADAMTS12	33917294	0.038000	0.19896	0.279000	0.24732	0.365000	0.29674	0.035000	0.13797	-0.324000	0.08589	-0.373000	0.07131	CGA		0.488	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		29	211	0	0	0	0.009535	0	29	211				
SRFBP1	153443	broad.mit.edu	37	5	121355964	121355964	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:121355964G>A	ENST00000339397.4	+	6	606	c.534G>A	c.(532-534)aaG>aaA	p.K178K		NM_152546.2	NP_689759.2			serum response factor binding protein 1									p.K178K(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TATTGGCGAAGAAACCAATAC	0.343																																							uc003kst.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(532-534)AAG>AAA		serum response factor binding protein 1							113.0	104.0	106.0					5																	121355964		1863	4089	5952	SO:0001819	synonymous_variant	153443				regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm		g.chr5:121355964G>A	AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.534G>A	5.37:g.121355964G>A			Somatic					p.K178K	NM_152546	NP_689759	WXS	Illumina HiSeq	Unspecified	Q8NEF9	SRFB1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)	6	606	+		all_cancers(142;0.0124)|Prostate(80;0.0322)	178						Silent	SNP	ENST00000339397.4	37	c.534G>A	CCDS43354.1																																																																																				0.343	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546		36	64	0	0	0	0.005524	0	36	64				
GDF9	2661	broad.mit.edu	37	5	132197487	132197487	+	Missense_Mutation	SNP	G	G	A	rs370012885		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:132197487G>A	ENST00000378673.2	-	3	2025	c.1159C>T	c.(1159-1161)Cca>Tca	p.P387S	GDF9_ENST00000464378.1_5'Flank|GDF9_ENST00000296875.2_Missense_Mutation_p.P387S			O60383	GDF9_HUMAN	growth differentiation factor 9	387					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.P387S(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTGCCCTTGGACAGTCCCCT	0.502																																							uc003kxz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1159-1161)CCA>TCA		growth differentiation factor 9 precursor							129.0	99.0	109.0					5																	132197487		2203	4300	6503	SO:0001583	missense	2661				female gamete generation|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr5:132197487G>A		CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.1159C>T	5.37:g.132197487G>A	ENSP00000367942:p.Pro387Ser		Somatic				GDF9_uc011cxj.1_Missense_Mutation_p.P299S	p.P387S	NM_005260	NP_005251	WXS	Illumina HiSeq	Unspecified	O60383	GDF9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		2	1411	-		all_cancers(142;0.105)|Breast(839;0.198)	387					Q4VAW5	Missense_Mutation	SNP	ENST00000378673.2	37	c.1159C>T	CCDS4162.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685166	0.88639	.	.	ENSG00000164404	ENST00000378673;ENST00000296875	D;D	0.83992	-1.79;-1.79	6.13	6.13	0.99165	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91270	0.7248	M	0.70108	2.13	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90640	0.4574	10	0.66056	D	0.02	.	20.4352	0.99089	0.0:0.0:1.0:0.0	.	387	O60383	GDF9_HUMAN	S	387	ENSP00000367942:P387S;ENSP00000296875:P387S	ENSP00000296875:P387S	P	-	1	0	GDF9	132225386	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	9.415000	0.97375	2.932000	0.99384	0.644000	0.83932	CCA		0.502	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133060.2	NM_005260		4	90	0	0	0	0.000602	0	4	90				
SMAD5	4090	broad.mit.edu	37	5	135496714	135496714	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:135496714C>T	ENST00000545279.1	+	4	933	c.573C>T	c.(571-573)agC>agT	p.S191S	SMAD5_ENST00000545620.1_Silent_p.S191S|SMAD5_ENST00000514641.2_3'UTR	NM_001001419.1|NM_005903.5	NP_001001419.1|NP_005894.3	Q99717	SMAD5_HUMAN	SMAD family member 5	191					BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)	p.S191S(1)		central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTCCAAACAGCCCTTATCCCC	0.483																																							uc003lbj.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(571-573)AGC>AGT		SMAD family member 5							251.0	260.0	257.0					5																	135496714		1938	4146	6084	SO:0001819	synonymous_variant	4090				BMP signaling pathway|embryonic pattern specification|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding	g.chr5:135496714C>T	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000545279.1:c.573C>T	5.37:g.135496714C>T			Somatic				SMAD5_uc003lbk.1_Silent_p.S191S|SMAD5_uc003lbl.1_Silent_p.S191S	p.S191S	NM_001001419	NP_001001419	WXS	Illumina HiSeq	Unspecified	Q99717	SMAD5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		5	1017	+			191					O14688|Q15798|Q9UQA1	Silent	SNP	ENST00000545279.1	37	c.573C>T		.	.	.	.	.	.	.	.	.	.	C	9.831	1.188496	0.21954	.	.	ENSG00000113658	ENST00000507637	.	.	.	5.59	2.79	0.32731	.	.	.	.	.	T	0.58892	0.2154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51601	-0.8685	4	.	.	.	.	9.7579	0.40515	0.0:0.6414:0.0:0.3586	.	.	.	.	S	14	.	.	P	+	1	0	SMAD5	135524613	0.347000	0.24853	0.999000	0.59377	0.985000	0.73830	-0.295000	0.08298	0.278000	0.22164	0.650000	0.86243	CCC		0.483	SMAD5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005903		78	166	0	0	0	0.01441	0	78	166				
MATR3	9782	broad.mit.edu	37	5	138661216	138661216	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:138661216G>C	ENST00000394805.3	+	13	2571	c.2236G>C	c.(2236-2238)Gaa>Caa	p.E746Q	MATR3_ENST00000502929.1_Missense_Mutation_p.E794Q|MATR3_ENST00000510056.1_Missense_Mutation_p.E746Q|MATR3_ENST00000504203.1_Missense_Mutation_p.E408Q|MATR3_ENST00000502499.1_Missense_Mutation_p.E408Q|MATR3_ENST00000503811.1_Missense_Mutation_p.E458Q|MATR3_ENST00000361059.2_Missense_Mutation_p.E746Q|MATR3_ENST00000509990.1_Missense_Mutation_p.E746Q|MATR3_ENST00000394800.2_Missense_Mutation_p.E794Q	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	746					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)	p.E182Q(1)|p.E746Q(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACCAGGTGCTGAATCTTCTGA	0.408																																							uc003ldu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2236-2238)GAA>CAA		matrin 3							95.0	95.0	95.0					5																	138661216		2203	4300	6503	SO:0001583	missense	9782					nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding	g.chr5:138661216G>C	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.2236G>C	5.37:g.138661216G>C	ENSP00000378284:p.Glu746Gln		Somatic				MATR3_uc003ldt.2_Missense_Mutation_p.E408Q|MATR3_uc003ldw.2_Missense_Mutation_p.E794Q|MATR3_uc003ldx.2_Missense_Mutation_p.E746Q|MATR3_uc010jfc.2_Missense_Mutation_p.E746Q|MATR3_uc011czb.1_Missense_Mutation_p.E458Q|MATR3_uc003ldz.2_Missense_Mutation_p.E746Q|MATR3_uc003lea.2_Missense_Mutation_p.E746Q|MATR3_uc003leb.2_Missense_Mutation_p.E408Q|MATR3_uc003lec.2_Missense_Mutation_p.E423Q	p.E746Q	NM_199189	NP_954659	WXS	Illumina HiSeq	Unspecified	P43243	MATR3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		16	2663	+			746					B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	37	c.2236G>C	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678084	0.68042	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000504203;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000502499;ENST00000510056;ENST00000503811;ENST00000337359	T;T;T;T;T;T;T;T;T	0.76578	-0.98;-0.98;-0.98;-1.03;-1.03;-0.98;-0.98;-1.03;-1.03	4.51	4.51	0.55191	.	0.429079	0.27143	N	0.020736	T	0.77824	0.4188	N	0.14661	0.345	0.41815	D	0.989994	B;P;B;D;P	0.65815	0.396;0.516;0.396;0.995;0.516	B;B;B;D;B	0.68353	0.05;0.188;0.05;0.957;0.188	T	0.79127	-0.1931	10	0.39692	T	0.17	-7.9041	15.9513	0.79840	0.0:0.0:1.0:0.0	.	458;746;458;794;746	B7ZAV5;D6REM6;B4DRS1;A8MXP9;P43243	.;.;.;.;MATR3_HUMAN	Q	746;746;408;794;794;746;408;746;458;182	ENSP00000423533:E746Q;ENSP00000354346:E746Q;ENSP00000421218:E408Q;ENSP00000422319:E794Q;ENSP00000378279:E794Q;ENSP00000378284:E746Q;ENSP00000426030:E408Q;ENSP00000426743:E746Q;ENSP00000423587:E458Q	ENSP00000338208:E182Q	E	+	1	0	MATR3	138689115	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.956000	0.76013	2.506000	0.84524	0.557000	0.71058	GAA		0.408	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834		5	123	0	0	0	0.000602	0	5	123				
PCDHA8	56140	broad.mit.edu	37	5	140222271	140222271	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:140222271C>T	ENST00000531613.1	+	1	1365	c.1365C>T	c.(1363-1365)ttC>ttT	p.F455F	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.F455F|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	455	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F455F(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCGGCGTTCGCGCAGCCCG	0.672																																							uc003lhs.2		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1363-1365)TTC>TTT		protocadherin alpha 8 isoform 1 precursor							59.0	61.0	60.0					5																	140222271		2194	4266	6460	SO:0001819	synonymous_variant	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140222271C>T	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1365C>T	5.37:g.140222271C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.F455F	p.F455F	NM_018911	NP_061734	WXS	Illumina HiSeq	Unspecified	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1365	+			455			Cadherin 4.|Extracellular (Potential).		B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	c.1365C>T	CCDS54919.1																																																																																				0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		17	97	0	0	0	0.007413	0	17	97				
PCDHB3	56132	broad.mit.edu	37	5	140482231	140482231	+	Missense_Mutation	SNP	C	C	G	rs369272197		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:140482231C>G	ENST00000231130.2	+	1	1998	c.1998C>G	c.(1996-1998)ttC>ttG	p.F666L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	666	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F666L(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACGGCTTCTCCCAGCCCT	0.697																																							uc003lio.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1996-1998)TTC>TTG		protocadherin beta 3 precursor		C	LEU/PHE	1,4349		0,1,2174	45.0	49.0	47.0		1998	2.4	1.0	5		47	0,8474		0,0,4237	no	missense	PCDHB3	NM_018937.2	22	0,1,6411	GG,GC,CC		0.0,0.023,0.0078	probably-damaging	666/797	140482231	1,12823	2175	4237	6412	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140482231C>G	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1998C>G	5.37:g.140482231C>G	ENSP00000231130:p.Phe666Leu		Somatic				uc003lin.2_5'Flank	p.F666L	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1998	+			666			Extracellular (Potential).|Cadherin 6.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.1998C>G	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950227	0.34377	2.3E-4	0.0	ENSG00000113205	ENST00000231130	T	0.46819	0.86	4.29	2.41	0.29592	Cadherin (2);	.	.	.	.	T	0.36608	0.0973	L	0.43701	1.375	0.32169	N	0.581975	B	0.27679	0.185	B	0.23852	0.049	T	0.47289	-0.9129	9	0.72032	D	0.01	.	6.6931	0.23183	0.0:0.6087:0.0:0.3913	.	666	Q9Y5E6	PCDB3_HUMAN	L	666	ENSP00000231130:F666L	ENSP00000231130:F666L	F	+	3	2	PCDHB3	140462415	0.977000	0.34250	0.999000	0.59377	0.977000	0.68977	0.230000	0.17852	0.888000	0.36160	0.485000	0.47835	TTC		0.697	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		6	102	0	0	0	0.00308	0	6	102				
PCDHB10	56126	broad.mit.edu	37	5	140574422	140574422	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:140574422T>C	ENST00000239446.4	+	1	2481	c.2297T>C	c.(2296-2298)tTc>tCc	p.F766S		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	766					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F766S(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCAGTGAGTTCAAGTTCTTG	0.522																																							uc003lix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2296-2298)TTC>TCC		protocadherin beta 10 precursor							66.0	74.0	71.0					5																	140574422		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140574422T>C	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2297T>C	5.37:g.140574422T>C	ENSP00000239446:p.Phe766Ser		Somatic					p.F766S	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2471	+			766			Cytoplasmic (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.2297T>C	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.234686	0.58886	.	.	ENSG00000120324	ENST00000239446	T	0.54479	0.57	3.42	3.42	0.39159	.	.	.	.	.	T	0.77232	0.4100	H	0.94698	3.57	0.36774	D	0.883944	D	0.76494	0.999	D	0.71656	0.974	D	0.85491	0.1185	9	0.87932	D	0	.	11.3336	0.49490	0.0:0.0:0.0:1.0	.	766	Q9UN67	PCDBA_HUMAN	S	766	ENSP00000239446:F766S	ENSP00000239446:F766S	F	+	2	0	PCDHB10	140554606	0.169000	0.23002	0.897000	0.35233	0.008000	0.06430	2.480000	0.45206	1.565000	0.49641	0.373000	0.22412	TTC		0.522	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		53	88	0	0	0	0.01441	0	53	88				
PCDHB14	56122	broad.mit.edu	37	5	140603931	140603931	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:140603931C>T	ENST00000239449.4	+	1	854	c.854C>T	c.(853-855)tCa>tTa	p.S285L	PCDHB14_ENST00000515856.2_Missense_Mutation_p.S132L	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	285	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S285L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCATGCATCAGAAGATATT	0.393																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(853-855)TCA>TTA		protocadherin beta 14 precursor							44.0	47.0	46.0					5																	140603931		2202	4300	6502	SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140603931C>T	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.854C>T	5.37:g.140603931C>T	ENSP00000239449:p.Ser285Leu		Somatic				PCDHB14_uc011dal.1_Missense_Mutation_p.S132L	p.S285L	NM_018934	NP_061757	WXS	Illumina HiSeq	Unspecified	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	854	+			285			Extracellular (Potential).|Cadherin 3.		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	c.854C>T	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	12.67	2.007932	0.35415	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.64991	-0.13;-0.13	4.75	4.75	0.60458	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.69967	0.3170	M	0.85777	2.775	0.09310	N	1	P	0.40681	0.727	B	0.39935	0.314	T	0.68443	-0.5407	9	0.59425	D	0.04	.	17.7472	0.88424	0.0:1.0:0.0:0.0	.	285	Q9Y5E9	PCDBE_HUMAN	L	132;285	ENSP00000444518:S132L;ENSP00000239449:S285L	ENSP00000239449:S285L	S	+	2	0	PCDHB14	140584115	0.000000	0.05858	0.067000	0.19924	0.577000	0.36160	0.075000	0.14686	2.354000	0.79902	0.655000	0.94253	TCA		0.393	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		34	64	0	0	0	0.012213	0	34	64				
PCDHGB3	56102	broad.mit.edu	37	5	140750376	140750376	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:140750376G>C	ENST00000576222.1	+	1	546	c.415G>C	c.(415-417)Gag>Cag	p.E139Q	PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	139	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAATATCACTGAGCTGGAAAT	0.448																																							uc003ljw.1		NA																	0					0						c.(415-417)GAG>CAG		protocadherin gamma subfamily B, 3 isoform 1							133.0	133.0	133.0					5																	140750376		1944	4139	6083	SO:0001583	missense	56102				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140750376G>C	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.415G>C	5.37:g.140750376G>C	ENSP00000461862:p.Glu139Gln		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Missense_Mutation_p.E139Q	p.E139Q	NM_018924	NP_061747	WXS	Illumina HiSeq	Unspecified	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	415	+			139			Extracellular (Potential).|Cadherin 2.		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.415G>C	CCDS58980.1																																																																																				0.448	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		4	283	0	0	0	0.009096	0	4	283				
RBM27	54439	broad.mit.edu	37	5	145631429	145631429	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:145631429C>G	ENST00000265271.5	+	9	1601	c.1435C>G	c.(1435-1437)Ctg>Gtg	p.L479V	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	479					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L479V(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCTACCCCTCTGGTTCCAGG	0.552																																							uc003lnz.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|pancreas(1)	3						c.(1435-1437)CTG>GTG		RNA binding motif protein 27							239.0	221.0	226.0					5																	145631429		1568	3582	5150	SO:0001583	missense	54439				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr5:145631429C>G	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1435C>G	5.37:g.145631429C>G	ENSP00000265271:p.Leu479Val		Somatic				RBM27_uc003lny.2_Intron	p.L479V	NM_018989	NP_061862	WXS	Illumina HiSeq	Unspecified	Q9P2N5	RBM27_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	1601	+			479					Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	c.1435C>G	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317892	0.23994	.	.	ENSG00000091009	ENST00000265271	T	0.49139	0.79	4.99	4.13	0.48395	.	0.000000	0.32952	N	0.005444	T	0.43077	0.1231	N	0.14661	0.345	0.28526	N	0.912802	P	0.52842	0.956	P	0.62184	0.899	T	0.26395	-1.0104	10	0.17369	T	0.5	-6.1416	9.3703	0.38250	0.0:0.9038:0.0:0.0962	.	479	Q9P2N5	RBM27_HUMAN	V	479	ENSP00000265271:L479V	ENSP00000265271:L479V	L	+	1	2	RBM27	145611622	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.347000	0.52200	1.334000	0.45468	0.655000	0.94253	CTG		0.552	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128		6	297	0	0	0	0.001984	0	6	297				
G3BP1	10146	broad.mit.edu	37	5	151173756	151173756	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:151173756A>G	ENST00000394123.3	+	5	533	c.388A>G	c.(388-390)Atc>Gtc	p.I130V	G3BP1_ENST00000543466.1_Intron|G3BP1_ENST00000356245.3_Missense_Mutation_p.I130V			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	130	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.I130V(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			TCACAATGATATCTTCAGATA	0.333																																							uc003lun.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(388-390)ATC>GTC		Ras-GTPase-activating protein SH3-domain-binding							128.0	132.0	131.0					5																	151173756		2203	4300	6503	SO:0001583	missense	10146				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding	g.chr5:151173756A>G	BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.388A>G	5.37:g.151173756A>G	ENSP00000377681:p.Ile130Val		Somatic				G3BP1_uc003lum.2_Missense_Mutation_p.I130V|G3BP1_uc011dcu.1_Intron|G3BP1_uc010jhz.2_Intron|G3BP1_uc003luq.2_5'Flank	p.I130V	NM_005754	NP_005745	WXS	Illumina HiSeq	Unspecified	Q13283	G3BP1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		5	559	+		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	130			NTF2.		Q5HYE9	Missense_Mutation	SNP	ENST00000394123.3	37	c.388A>G	CCDS4319.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.412972	0.42817	.	.	ENSG00000145907	ENST00000394123;ENST00000356245;ENST00000507878	T;T	0.78126	-1.15;-1.15	5.27	5.27	0.74061	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.051876	0.85682	D	0.000000	T	0.75148	0.3810	M	0.67569	2.06	0.80722	D	1	B	0.22276	0.067	B	0.17979	0.02	T	0.71052	-0.4704	10	0.23891	T	0.37	-20.3428	15.4726	0.75453	1.0:0.0:0.0:0.0	.	130	Q13283	G3BP1_HUMAN	V	130;130;140	ENSP00000377681:I130V;ENSP00000348578:I130V	ENSP00000348578:I130V	I	+	1	0	G3BP1	151153949	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.953000	0.70290	2.117000	0.64856	0.379000	0.24179	ATC		0.333	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1	NM_005754		30	117	0	0	0	0.003271	0	30	117				
SLIT3	6586	broad.mit.edu	37	5	168149326	168149326	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:168149326C>T	ENST00000519560.1	-	23	2837	c.2418G>A	c.(2416-2418)ctG>ctA	p.L806L	SLIT3_ENST00000404867.3_Silent_p.L806L|CTC-558O2.1_ENST00000522615.1_RNA|SLIT3_ENST00000332966.8_Silent_p.L806L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	806					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.L806L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTTGTAGCTCAGGATCCTGT	0.512																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(2416-2418)CTG>CTA		slit homolog 3 precursor							183.0	164.0	170.0					5																	168149326		2203	4300	6503	SO:0001819	synonymous_variant	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168149326C>T	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2418G>A	5.37:g.168149326C>T			Somatic				SLIT3_uc010jjg.2_Silent_p.L806L	p.L806L	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		23	2838	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	806			LRR 19.		A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	c.2418G>A	CCDS4369.1																																																																																				0.512	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		4	53	0	0	0	0.009096	0	4	53				
GPRIN1	114787	broad.mit.edu	37	5	176025029	176025029	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:176025029C>T	ENST00000303991.4	-	2	1984	c.1807G>A	c.(1807-1809)Gag>Aag	p.E603K		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	603					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.E603K(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTTTTCCCTCTGGGATAGCT	0.572																																							uc003meo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1807-1809)GAG>AAG		G protein-regulated inducer of neurite outgrowth							72.0	74.0	73.0					5																	176025029		2203	4300	6503	SO:0001583	missense	114787					growth cone|plasma membrane		g.chr5:176025029C>T	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1807G>A	5.37:g.176025029C>T	ENSP00000305839:p.Glu603Lys		Somatic					p.E603K	NM_052899	NP_443131	WXS	Illumina HiSeq	Unspecified	Q7Z2K8	GRIN1_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		2	1982	-	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	603					C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	c.1807G>A	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765212	0.31228	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.09255	3.0	4.26	1.0	0.19881	.	0.448959	0.16623	N	0.206406	T	0.08670	0.0215	M	0.63428	1.95	0.09310	N	1	P	0.38677	0.642	B	0.35278	0.199	T	0.22103	-1.0226	10	0.07325	T	0.83	0.1258	7.1907	0.25824	0.2559:0.4852:0.259:0.0	.	603	Q7Z2K8	GRIN1_HUMAN	K	603	ENSP00000305839:E603K	ENSP00000305839:E603K	E	-	1	0	GPRIN1	175957635	0.000000	0.05858	0.030000	0.17652	0.009000	0.06853	0.936000	0.28938	0.739000	0.32628	0.455000	0.32223	GAG		0.572	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899		16	80	0	0	0	0.004007	0	16	80				
RNF130	55819	broad.mit.edu	37	5	179407141	179407141	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr5:179407141C>A	ENST00000261947.4	-	4	1151	c.753G>T	c.(751-753)aaG>aaT	p.K251N	RNF130_ENST00000522208.2_Missense_Mutation_p.K251N|RNF130_ENST00000521389.1_Missense_Mutation_p.K251N	NM_001280801.1	NP_001267730.1			ring finger protein 130									p.K251N(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTCACCCTTCTTTACTGTCC	0.398																																					GBM(24;432 554 38471 39699 51728)	GBM(24;432 554 38471 39699 51728)	uc003mll.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(751-753)AAG>AAT		ring finger protein 130 precursor							265.0	223.0	238.0					5																	179407141		2203	4300	6503	SO:0001583	missense	55819				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr5:179407141C>A	AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.753G>T	5.37:g.179407141C>A	ENSP00000261947:p.Lys251Asn		Somatic				RNF130_uc003mlm.1_Missense_Mutation_p.K251N	p.K251N	NM_018434	NP_060904	WXS	Illumina HiSeq	Unspecified	Q86XS8	GOLI_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		4	1160	-	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	251			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000261947.4	37	c.753G>T		.	.	.	.	.	.	.	.	.	.	C	13.38	2.220878	0.39201	.	.	ENSG00000113269	ENST00000522208;ENST00000521389;ENST00000261947	T;T;T	0.06449	3.31;3.3;3.32	5.19	-0.825	0.10809	.	0.047285	0.85682	D	0.000000	T	0.15998	0.0385	M	0.64404	1.975	0.51233	D	0.99991	D;D	0.71674	0.998;0.996	D;D	0.67900	0.954;0.943	T	0.00766	-1.1575	10	0.87932	D	0	.	9.4507	0.38725	0.0:0.6319:0.0:0.3681	.	268;251	Q59EL1;Q86XS8	.;GOLI_HUMAN	N	251	ENSP00000429509:K251N;ENSP00000430237:K251N;ENSP00000261947:K251N	ENSP00000261947:K251N	K	-	3	2	RNF130	179339747	1.000000	0.71417	0.936000	0.37596	0.156000	0.22039	1.632000	0.37102	0.033000	0.15463	-0.982000	0.02568	AAG		0.398	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374205.1	NM_018434		6	173	1	0	2.0095e-06	0.001984	2.32618e-06	6	173				
EXOC2	55770	broad.mit.edu	37	6	637753	637753	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:637753C>T	ENST00000230449.4	-	2	201	c.66G>A	c.(64-66)acG>acA	p.T22T	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	22	IPT/TIG.				cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T22T(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TTGTGACCTTCGTCCATGGTA	0.532																																							uc003mtd.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(4)|ovary(2)|pancreas(1)	7						c.(64-66)ACG>ACA		Sec5 protein							136.0	133.0	134.0					6																	637753		2203	4300	6503	SO:0001819	synonymous_variant	55770				exocytosis|protein transport			g.chr6:637753C>T	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.66G>A	6.37:g.637753C>T			Somatic				EXOC2_uc003mte.2_Silent_p.T22T|EXOC2_uc011dho.1_Intron	p.T22T	NM_018303	NP_060773	WXS	Illumina HiSeq	Unspecified	Q96KP1	EXOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)	2	200	-	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)	22			IPT/TIG.		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Silent	SNP	ENST00000230449.4	37	c.66G>A	CCDS34327.1																																																																																				0.532	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303		6	231	0	0	0	0.001984	0	6	231				
MYLK4	340156	broad.mit.edu	37	6	2685595	2685595	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:2685595G>A	ENST00000274643.7	-	6	822	c.480C>T	c.(478-480)caC>caT	p.H160H	MYLK4_ENST00000268446.5_Silent_p.H160H	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H160H(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				TGAGGTTCGCGTGGTCCAGCT	0.577																																							uc003mty.3		NA																	2	Substitution - coding silent(2)		lung(2)	breast(3)|ovary(1)	4						c.(478-480)CAC>CAT		myosin light chain kinase family, member 4							260.0	195.0	217.0					6																	2685595		2203	4300	6503	SO:0001819	synonymous_variant	340156						ATP binding|protein serine/threonine kinase activity	g.chr6:2685595G>A		CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.480C>T	6.37:g.2685595G>A			Somatic					p.H160H	NM_001012418	NP_001012418	WXS	Illumina HiSeq	Unspecified	Q86YV6	MYLK4_HUMAN			6	777	-	Ovarian(93;0.0412)	all_hematologic(90;0.0897)	160			Protein kinase.		A2RUC0|Q5TAW2	Silent	SNP	ENST00000274643.7	37	c.480C>T	CCDS34330.1																																																																																				0.577	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418		106	175	0	0	0	0.01441	0	106	175				
OR2H1	26716	broad.mit.edu	37	6	29430097	29430097	+	Missense_Mutation	SNP	G	G	C	rs189150803	byFrequency	TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:29430097G>C	ENST00000377136.1	+	4	1016	c.551G>C	c.(550-552)cGa>cCa	p.R184P	OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000396792.2_Missense_Mutation_p.R184P|OR2H1_ENST00000377133.1_Missense_Mutation_p.R184P|OR2H1_ENST00000442615.1_Missense_Mutation_p.R184P|OR2H1_ENST00000377132.1_Missense_Mutation_p.R184P			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	184				R -> G (in Ref. 8; AAC00188). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R184P(1)		large_intestine(5)|lung(12)	17						TCTCTGATTCGACTCTCCTGT	0.502																																							uc003nmi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(550-552)CGA>CCA		olfactory receptor, family 2, subfamily H,							189.0	194.0	192.0					6																	29430097		1511	2709	4220	SO:0001583	missense	26716				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29430097G>C	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.551G>C	6.37:g.29430097G>C	ENSP00000366340:p.Arg184Pro		Somatic				OR2H1_uc003nmj.1_Missense_Mutation_p.R184P|OR2H1_uc010jri.1_Missense_Mutation_p.R106P	p.R184P	NM_030883	NP_112145	WXS	Illumina HiSeq	Unspecified	Q9GZK4	OR2H1_HUMAN			3	994	+			184	R -> G (in Ref. 6; AAC00188).		Extracellular (Potential).		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	ENST00000377136.1	37	c.551G>C	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	g	5.186	0.219934	0.09863	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.00145	8.67;8.67;8.67;8.67;8.67	2.81	-2.45	0.06481	GPCR, rhodopsin-like superfamily (1);	0.924765	0.08788	N	0.893590	T	0.00109	0.0003	L	0.48218	1.51	0.09310	N	1	D	0.55605	0.972	P	0.62435	0.902	T	0.38394	-0.9663	10	0.87932	D	0	.	6.0707	0.19887	0.5191:0.1376:0.3433:0.0	.	184	Q9GZK4	OR2H1_HUMAN	P	184	ENSP00000366340:R184P;ENSP00000366337:R184P;ENSP00000393254:R184P;ENSP00000366336:R184P;ENSP00000380010:R184P	ENSP00000366336:R184P	R	+	2	0	OR2H1	29538076	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-1.391000	0.02525	-0.674000	0.05253	-2.281000	0.00270	CGA		0.502	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3			8	297	0	0	0	0.004482	0	8	297				
IER3	8870	broad.mit.edu	37	6	30708997	30708997	+	IGR	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:30708997C>T	ENST00000259874.5	-	0	1244				FLOT1_ENST00000376389.3_Silent_p.Q108Q|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000470643.1_5'UTR|FLOT1_ENST00000456573.2_Intron	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3						anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.Q108Q(1)		NS(1)	1						TGATGGCCCTCTGGTGGCCCT	0.597																																							uc003nrm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(322-324)CAG>CAA		flotillin 1							81.0	89.0	86.0					6																	30708997		1507	2709	4216	SO:0001628	intergenic_variant	10211					centriolar satellite|endosome|integral to membrane|melanosome|membrane fraction		g.chr6:30708997C>T	AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265		6.37:g.30708997C>T			Somatic				FLOT1_uc011dmr.1_Intron	p.Q108Q	NM_005803	NP_005794	WXS	Illumina HiSeq	Unspecified	O75955	FLOT1_HUMAN			5	488	-			108					Q5SU30|Q92691|Q93044	Silent	SNP	ENST00000259874.5	37	c.324G>A	CCDS4689.1																																																																																				0.597	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2			8	111	0	0	0	0.00308	0	8	111				
FKBPL	63943	broad.mit.edu	37	6	32097038	32097038	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:32097038C>G	ENST00000375156.3	-	2	790	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000468502.1_5'Flank|ATF6B_ENST00000375201.4_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	174					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.E174Q(1)									AGCTGAAGCTCTGCTTCCTCA	0.572																																							uc003nzr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(520-522)GAG>CAG		WAF-1/CIP1 stabilizing protein 39							130.0	130.0	130.0					6																	32097038		2203	4300	6503	SO:0001583	missense	63943				response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr6:32097038C>G	AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.520G>C	6.37:g.32097038C>G	ENSP00000364298:p.Glu174Gln		Somatic				ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	p.E174Q	NM_022110	NP_071393	WXS	Illumina HiSeq	Unspecified	Q9UIM3	FKBPL_HUMAN			2	790	-			174					A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	c.520G>C	CCDS4738.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719515	0.30503	.	.	ENSG00000204315	ENST00000375156	D	0.81659	-1.52	5.38	3.58	0.41010	.	0.633514	0.15415	N	0.263559	T	0.37100	0.0991	N	0.08118	0	0.31956	N	0.609046	B	0.22276	0.067	B	0.21151	0.033	T	0.05022	-1.0911	10	0.14252	T	0.57	-6.2797	6.7249	0.23350	0.0:0.7248:0.1796:0.0957	.	174	Q9UIM3	FKBPL_HUMAN	Q	174	ENSP00000364298:E174Q	ENSP00000364298:E174Q	E	-	1	0	FKBPL	32205016	0.887000	0.30362	0.938000	0.37757	0.977000	0.68977	1.462000	0.35266	0.808000	0.34231	0.462000	0.41574	GAG		0.572	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			7	305	0	0	0	0.001984	0	7	305				
AGER	177	broad.mit.edu	37	6	32150773	32150773	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:32150773C>G	ENST00000375076.4	-	6	637	c.536G>C	c.(535-537)aGa>aCa	p.R179T	AGER_ENST00000375065.5_Intron|AGER_ENST00000375069.3_Missense_Mutation_p.R78T|XXbac-BPG300A18.13_ENST00000559458.1_RNA|AGER_ENST00000375055.2_Missense_Mutation_p.R179T|AGER_ENST00000375067.3_Missense_Mutation_p.R165T|AGER_ENST00000438221.2_Missense_Mutation_p.R195T|AGER_ENST00000375070.3_Missense_Mutation_p.R210T|RNF5_ENST00000427134.2_Intron	NM_001136.4|NM_001206929.1|NM_001206932.1	NP_001127.1|NP_001193858.1|NP_001193861.1	Q15109	RAGE_HUMAN	advanced glycosylation end product-specific receptor	179	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|neuron projection development (GO:0031175)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|response to wounding (GO:0009611)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor activity (GO:0004872)|S100 protein binding (GO:0044548)|transmembrane signaling receptor activity (GO:0004888)	p.R179T(1)		breast(1)|endometrium(1)|lung(5)|pancreas(2)	9						CTCAGGGTGTCTCCTGGTCTG	0.572																																							uc003oal.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(535-537)AGA>ACA		advanced glycosylation end product-specific							87.0	80.0	82.0					6																	32150773		1510	2709	4219	SO:0001583	missense	177				cell surface receptor linked signaling pathway|inflammatory response|innate immune response|neuron projection development|positive regulation of NF-kappaB transcription factor activity	integral to plasma membrane	S100 alpha binding|transmembrane receptor activity	g.chr6:32150773C>G	M91211	CCDS4746.1, CCDS4747.1, CCDS56417.1, CCDS56418.1, CCDS75429.1	6p21.3	2013-01-29			ENSG00000204305	ENSG00000204305		"""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	320	protein-coding gene	gene with protein product		600214				7713518	Standard	NM_001136		Approved	RAGE	uc003oap.2	Q15109	OTTHUMG00000031120	ENST00000375076.4:c.536G>C	6.37:g.32150773C>G	ENSP00000364217:p.Arg179Thr		Somatic				AGER_uc003oak.1_5'Flank|AGER_uc003oar.2_Missense_Mutation_p.R78T|AGER_uc011dpm.1_Missense_Mutation_p.R78T|AGER_uc011dpn.1_Missense_Mutation_p.R78T|AGER_uc010jtv.1_Missense_Mutation_p.R179T|AGER_uc011dpo.1_Missense_Mutation_p.R92T|AGER_uc003oam.1_Intron|AGER_uc003oan.1_Missense_Mutation_p.R165T|AGER_uc003oap.1_Missense_Mutation_p.R195T|AGER_uc003oat.1_Missense_Mutation_p.R195T|AGER_uc003oao.1_RNA|AGER_uc003oaq.1_Missense_Mutation_p.R165T|AGER_uc010jtw.1_RNA|AGER_uc003oas.1_Missense_Mutation_p.R179T|AGER_uc003oau.1_Missense_Mutation_p.R179T|AGER_uc011dpp.1_Missense_Mutation_p.R179T|AGER_uc011dpq.1_Missense_Mutation_p.R195T	p.R179T	NM_001136	NP_001127	WXS	Illumina HiSeq	Unspecified	Q15109	RAGE_HUMAN			6	560	-			179			Extracellular (Potential).|Ig-like C2-type 1.		A2BFI7|A6NKF0|A7Y2U9|B0V176|Q15279|Q3L1R4|Q3L1R5|Q3L1R6|Q3L1R7|Q3L1R8|Q3L1S0|Q86SN1|Q9H2X7|Q9Y3R3|V5R6A3	Missense_Mutation	SNP	ENST00000375076.4	37	c.536G>C	CCDS4746.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.074196	0.55646	.	.	ENSG00000204305	ENST00000375067;ENST00000375055;ENST00000375076;ENST00000375070;ENST00000438221;ENST00000375069;ENST00000450110;ENST00000375056	T;T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.15	4.28	0.50868	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.359418	0.24861	N	0.035001	T	0.78457	0.4286	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.992;0.997;0.999;0.997;0.999;0.998;0.999;0.999;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.87578	0.987;0.94;0.998;0.971;0.98;0.973;0.994;0.972;0.989;0.989;0.997;0.988	T	0.78038	-0.2360	10	0.37606	T	0.19	-11.6068	9.3898	0.38365	0.0:0.901:0.0:0.099	.	195;179;179;78;179;179;195;179;165;195;165;179	B5A981;B5A980;C9J0M2;A8MS87;A7Y2U9;Q15109-3;Q3L1R7;Q3L1R6;Q3L1R5;Q3L1R8;Q15109-2;Q15109	.;.;.;.;.;.;.;.;.;.;.;RAGE_HUMAN	T	165;179;179;210;195;78;192;195	ENSP00000364208:R165T;ENSP00000364195:R179T;ENSP00000364217:R179T;ENSP00000364211:R210T;ENSP00000387887:R195T;ENSP00000364210:R78T;ENSP00000398466:R192T;ENSP00000364196:R195T	ENSP00000364195:R179T	R	-	2	0	AGER	32258751	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.550000	0.36223	1.178000	0.42870	0.462000	0.41574	AGA		0.572	AGER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076200.1	NM_001136		19	88	0	0	0	0.008871	0	19	88				
AGER	177	broad.mit.edu	37	6	32150922	32150922	+	Silent	SNP	C	C	T	rs188057660	byFrequency	TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:32150922C>T	ENST00000375076.4	-	5	578	c.477G>A	c.(475-477)ttG>ttA	p.L159L	AGER_ENST00000375065.5_Intron|AGER_ENST00000375069.3_Silent_p.L58L|XXbac-BPG300A18.13_ENST00000559458.1_RNA|AGER_ENST00000375055.2_Silent_p.L159L|AGER_ENST00000375067.3_Silent_p.L145L|AGER_ENST00000438221.2_Silent_p.L175L|AGER_ENST00000375070.3_Silent_p.L190L|RNF5_ENST00000427134.2_Intron	NM_001136.4|NM_001206929.1|NM_001206932.1	NP_001127.1|NP_001193858.1|NP_001193861.1	Q15109	RAGE_HUMAN	advanced glycosylation end product-specific receptor	159	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|neuron projection development (GO:0031175)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|response to wounding (GO:0009611)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor activity (GO:0004872)|S100 protein binding (GO:0044548)|transmembrane signaling receptor activity (GO:0004888)	p.L159L(1)		breast(1)|endometrium(1)|lung(5)|pancreas(2)	9						GCTTCCCATCCAAGTGCCAGC	0.552																																							uc003oal.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(475-477)TTG>TTA		advanced glycosylation end product-specific							89.0	95.0	93.0					6																	32150922		1511	2709	4220	SO:0001819	synonymous_variant	177				cell surface receptor linked signaling pathway|inflammatory response|innate immune response|neuron projection development|positive regulation of NF-kappaB transcription factor activity	integral to plasma membrane	S100 alpha binding|transmembrane receptor activity	g.chr6:32150922C>T	M91211	CCDS4746.1, CCDS4747.1, CCDS56417.1, CCDS56418.1, CCDS75429.1	6p21.3	2013-01-29			ENSG00000204305	ENSG00000204305		"""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	320	protein-coding gene	gene with protein product		600214				7713518	Standard	NM_001136		Approved	RAGE	uc003oap.2	Q15109	OTTHUMG00000031120	ENST00000375076.4:c.477G>A	6.37:g.32150922C>T			Somatic				AGER_uc003oak.1_5'Flank|AGER_uc003oar.2_Silent_p.L58L|AGER_uc011dpm.1_Silent_p.L58L|AGER_uc011dpn.1_Silent_p.L58L|AGER_uc010jtv.1_Silent_p.L159L|AGER_uc011dpo.1_Silent_p.L72L|AGER_uc003oam.1_Intron|AGER_uc003oan.1_Silent_p.L145L|AGER_uc003oap.1_Silent_p.L175L|AGER_uc003oat.1_Silent_p.L175L|AGER_uc003oao.1_RNA|AGER_uc003oaq.1_Silent_p.L145L|AGER_uc010jtw.1_RNA|AGER_uc003oas.1_Silent_p.L159L|AGER_uc003oau.1_Silent_p.L159L|AGER_uc011dpp.1_Silent_p.L159L|AGER_uc011dpq.1_Silent_p.L175L|AGER_uc011dpr.1_Silent_p.L159L	p.L159L	NM_001136	NP_001127	WXS	Illumina HiSeq	Unspecified	Q15109	RAGE_HUMAN			5	501	-			159			Extracellular (Potential).|Ig-like C2-type 1.		A2BFI7|A6NKF0|A7Y2U9|B0V176|Q15279|Q3L1R4|Q3L1R5|Q3L1R6|Q3L1R7|Q3L1R8|Q3L1S0|Q86SN1|Q9H2X7|Q9Y3R3|V5R6A3	Silent	SNP	ENST00000375076.4	37	c.477G>A	CCDS4746.1																																																																																				0.552	AGER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076200.1	NM_001136		6	111	0	0	0	0.00308	0	6	111				
RGL2	5863	broad.mit.edu	37	6	33263957	33263957	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:33263957C>T	ENST00000497454.1	-	6	1111	c.616G>A	c.(616-618)Gac>Aac	p.D206N	RGL2_ENST00000437840.2_5'UTR|RGL2_ENST00000444031.2_Missense_Mutation_p.D124N|PFDN6_ENST00000463584.1_Intron	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	206	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.D206N(1)		breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						CGGATGAGGTCAGCGCTGCCC	0.652																																							uc003odv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|lung(1)|breast(1)|pancreas(1)	6						c.(616-618)GAC>AAC		ral guanine nucleotide dissociation							91.0	105.0	100.0					6																	33263957		2203	4300	6503	SO:0001583	missense	5863				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity	g.chr6:33263957C>T		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.616G>A	6.37:g.33263957C>T	ENSP00000420211:p.Asp206Asn		Somatic				RGL2_uc003odu.2_5'UTR|RGL2_uc010jur.2_Intron|RGL2_uc003odw.2_Missense_Mutation_p.D124N|RGL2_uc011drb.1_Missense_Mutation_p.D124N	p.D206N	NM_004761	NP_004752	WXS	Illumina HiSeq	Unspecified	O15211	RGL2_HUMAN			6	749	-			206			N-terminal Ras-GEF.		B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	37	c.616G>A	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	C	8.277	0.814640	0.16607	.	.	ENSG00000237441	ENST00000497454;ENST00000421215;ENST00000444031	T;T	0.28666	1.6;1.6	4.88	4.88	0.63580	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.293434	0.35067	N	0.003480	T	0.08714	0.0216	L	0.34521	1.04	0.35127	D	0.767578	B;B	0.29531	0.001;0.247	B;B	0.28139	0.002;0.086	T	0.02560	-1.1141	10	0.02654	T	1	.	13.4	0.60876	0.0:1.0:0.0:0.0	.	124;206	B4DG72;O15211	.;RGL2_HUMAN	N	206;70;124	ENSP00000420211:D206N;ENSP00000403070:D124N	ENSP00000400083:D70N	D	-	1	0	RGL2	33371935	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.837000	0.55820	2.512000	0.84698	0.643000	0.83706	GAC		0.652	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2			11	282	0	0	0	0.00245	0	11	282				
FGD2	221472	broad.mit.edu	37	6	36993601	36993601	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:36993601G>A	ENST00000274963.8	+	14	1663	c.1492G>A	c.(1492-1494)Gaa>Aaa	p.E498K		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	498					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.E498K(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						CTACCGGGCCGAACTGAAATA	0.622																																							uc010jwp.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						c.(1492-1494)GAA>AAA		FYVE, RhoGEF and PH domain containing 2							137.0	108.0	118.0					6																	36993601		2203	4300	6503	SO:0001583	missense	221472				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr6:36993601G>A	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1492G>A	6.37:g.36993601G>A	ENSP00000274963:p.Glu498Lys		Somatic				FGD2_uc003ong.2_Missense_Mutation_p.E220K|FGD2_uc011dtv.1_Missense_Mutation_p.E126K|FGD2_uc003onj.1_Missense_Mutation_p.E75K	p.E498K	NM_173558	NP_775829	WXS	Illumina HiSeq	Unspecified	Q7Z6J4	FGD2_HUMAN			14	1663	+			498			FYVE-type.		Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	c.1492G>A	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	g	5.623	0.299688	0.10622	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	T	0.71817	-0.6	5.2	-1.5	0.08691	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	1.441390	0.04632	N	0.403842	T	0.16685	0.0401	N	0.02697	-0.525	0.09310	N	1	B;B	0.21821	0.009;0.061	B;B	0.15484	0.005;0.013	T	0.07712	-1.0758	10	0.08599	T	0.76	-0.3539	6.3498	0.21369	0.274:0.3331:0.3929:0.0	.	498;75	Q7Z6J4;Q7Z6J4-2	FGD2_HUMAN;.	K	498;126	ENSP00000274963:E498K	ENSP00000274963:E498K	E	+	1	0	FGD2	37101579	0.003000	0.15002	0.016000	0.15963	0.015000	0.08874	0.065000	0.14466	-0.240000	0.09696	-1.096000	0.02151	GAA		0.622	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558		5	73	0	0	0	0.000602	0	5	73				
TTBK1	84630	broad.mit.edu	37	6	43251404	43251404	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:43251404C>T	ENST00000259750.4	+	14	3009	c.2926C>T	c.(2926-2928)Cga>Tga	p.R976*		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	976					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R976*(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GGAGGGGGCCCGAGCGCCCCT	0.687																																							uc003ouq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(2926-2928)CGA>TGA		tau tubulin kinase 1							23.0	28.0	26.0					6																	43251404		2203	4298	6501	SO:0001587	stop_gained	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43251404C>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2926C>T	6.37:g.43251404C>T	ENSP00000259750:p.Arg976*		Somatic					p.R976*	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		14	3205	+			976					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Nonsense_Mutation	SNP	ENST00000259750.4	37	c.2926C>T	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688675	0.88639	.	.	ENSG00000146216	ENST00000259750	.	.	.	5.14	2.17	0.27698	.	1.278200	0.05317	N	0.525938	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	5.1699	0.15105	0.1582:0.6097:0.0:0.2321	.	.	.	.	X	976	.	ENSP00000259750:R976X	R	+	1	2	TTBK1	43359382	0.000000	0.05858	0.005000	0.12908	0.123000	0.20343	0.265000	0.18515	0.107000	0.17824	0.462000	0.41574	CGA		0.687	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			28	34	0	0	0	0.007291	0	28	34				
GSTA3	2940	broad.mit.edu	37	6	52764737	52764737	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:52764737C>G	ENST00000211122.3	-	5	474	c.409G>C	c.(409-411)Gaa>Caa	p.E137Q	GSTA3_ENST00000370968.1_Missense_Mutation_p.E87Q	NM_000847.4	NP_000838.3	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	137	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.E137Q(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)	10	Lung NSC(77;0.0912)				Glutathione(DB00143)	CCTACTTTTTCGAAGGCAGGG	0.448																																							uc003pbb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)GAA>CAA		glutathione S-transferase alpha 3	Glutathione(DB00143)						236.0	219.0	225.0					6																	52764737		2203	4300	6503	SO:0001583	missense	2940				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52764737C>G	AF020919	CCDS4947.1	6p12.2	2012-06-21	2008-11-26		ENSG00000174156	ENSG00000174156	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4628	protein-coding gene	gene with protein product		605449	"""glutathione S-transferase A3"""			8307579, 9480897	Standard	NM_000847		Approved		uc003pbb.3	Q16772	OTTHUMG00000014865	ENST00000211122.3:c.409G>C	6.37:g.52764737C>G	ENSP00000211122:p.Glu137Gln		Somatic				GSTA3_uc010jzq.2_Missense_Mutation_p.E81Q	p.E137Q	NM_000847	NP_000838	WXS	Illumina HiSeq	Unspecified	Q16772	GSTA3_HUMAN			5	488	-	Lung NSC(77;0.0912)		137			GST C-terminal.		O43468|Q068V6|Q8WWA8|Q9H415	Missense_Mutation	SNP	ENST00000211122.3	37	c.409G>C	CCDS4947.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311120	0.81358	.	.	ENSG00000174156	ENST00000370968;ENST00000211122;ENST00000431899	T;T;T	0.08896	3.04;3.04;3.08	3.91	3.91	0.45181	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.125602	0.50627	D	0.000104	T	0.32346	0.0826	H	0.94847	3.59	0.48901	D	0.999728	D	0.89917	1.0	D	0.97110	1.0	T	0.52719	-0.8538	10	0.87932	D	0	.	16.0138	0.80422	0.0:1.0:0.0:0.0	.	137	Q16772	GSTA3_HUMAN	Q	87;137;87	ENSP00000360007:E87Q;ENSP00000211122:E137Q;ENSP00000399142:E87Q	ENSP00000211122:E137Q	E	-	1	0	GSTA3	52872696	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	5.933000	0.70130	2.168000	0.68352	0.591000	0.81541	GAA;GAA;GAG		0.448	GSTA3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040933.1			8	450	0	0	0	0.00308	0	8	450				
MYO6	4646	broad.mit.edu	37	6	76551060	76551060	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:76551060G>A	ENST00000369977.3	+	9	920	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K	MYO6_ENST00000369985.4_Missense_Mutation_p.E261K|MYO6_ENST00000369981.3_Missense_Mutation_p.E261K|MYO6_ENST00000369975.1_Missense_Mutation_p.E261K	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	261	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)	p.E261K(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AGATATTAGAGAAAAACTTCA	0.378																																							uc003pih.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|pancreas(1)	2						c.(781-783)GAA>AAA		myosin VI							85.0	87.0	86.0					6																	76551060		2203	4300	6503	SO:0001583	missense	4646				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding	g.chr6:76551060G>A	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.781G>A	6.37:g.76551060G>A	ENSP00000358994:p.Glu261Lys		Somatic				MYO6_uc003pig.1_Missense_Mutation_p.E261K|MYO6_uc003pii.1_Missense_Mutation_p.E261K	p.E261K	NM_004999	NP_004990	WXS	Illumina HiSeq	Unspecified	Q9UM54	MYO6_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.223)	9	1060	+		all_hematologic(105;0.189)	261			Myosin head-like.		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	c.781G>A	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800470	0.31869	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	5.13	5.13	0.70059	.	0.101582	0.64402	D	0.000002	T	0.65302	0.2678	N	0.13327	0.33	0.53005	D	0.999961	B;B	0.20459	0.002;0.045	B;B	0.24006	0.003;0.05	T	0.63161	-0.6699	10	0.15499	T	0.54	.	14.2314	0.65895	0.0:0.1492:0.8507:0.0	.	261;261	Q9UM54-2;Q9UM54-1	.;.	K	261	ENSP00000358998:E261K;ENSP00000359002:E261K;ENSP00000358994:E261K;ENSP00000358992:E261K	ENSP00000358992:E261K	E	+	1	0	MYO6	76607780	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.504000	0.45416	2.380000	0.81148	0.563000	0.77884	GAA		0.378	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999		5	60	0	0	0	0.000602	0	5	60				
IMPG1	3617	broad.mit.edu	37	6	76660781	76660781	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:76660781G>C	ENST00000369950.3	-	13	1511	c.1322C>G	c.(1321-1323)tCt>tGt	p.S441C	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.S441C(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CAGGGAGGTAGAGGCCATAGC	0.438																																					Pancreas(37;839 1141 2599 26037)	Pancreas(37;839 1141 2599 26037)	uc003pik.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1321-1323)TCT>TGT		interphotoreceptor matrix proteoglycan 1							103.0	101.0	102.0					6																	76660781		2203	4300	6503	SO:0001583	missense	3617				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity	g.chr6:76660781G>C	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1322C>G	6.37:g.76660781G>C	ENSP00000358966:p.Ser441Cys		Somatic					p.S441C	NM_001563	NP_001554	WXS	Illumina HiSeq	Unspecified	Q17R60	IMPG1_HUMAN			13	1452	-		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)	441						Missense_Mutation	SNP	ENST00000369950.3	37	c.1322C>G	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	8.215	0.801128	0.16397	.	.	ENSG00000112706	ENST00000369950	T	0.22539	1.95	5.51	2.62	0.31277	.	0.503338	0.18114	N	0.151276	T	0.18130	0.0435	L	0.59436	1.845	0.20074	N	0.999934	D	0.76494	0.999	P	0.61132	0.884	T	0.05146	-1.0903	10	0.72032	D	0.01	.	4.5374	0.12040	0.1822:0.0:0.6431:0.1747	.	441	Q17R60	IMPG1_HUMAN	C	441	ENSP00000358966:S441C	ENSP00000358966:S441C	S	-	2	0	IMPG1	76717501	0.017000	0.18338	0.011000	0.14972	0.005000	0.04900	1.303000	0.33470	0.702000	0.31825	-0.266000	0.10368	TCT		0.438	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563		4	101	0	0	0	0.009096	0	4	101				
AIM1	202	broad.mit.edu	37	6	106968226	106968226	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:106968226G>A	ENST00000369066.3	+	2	2406	c.1919G>A	c.(1918-1920)aGa>aAa	p.R640K		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R640K(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CAGGGCAGCAGAACACCCCTG	0.532																																							uc003prh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9						c.(1918-1920)AGA>AAA		absent in melanoma 1							64.0	63.0	63.0					6																	106968226		2203	4300	6503	SO:0001583	missense	202						sugar binding	g.chr6:106968226G>A	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1919G>A	6.37:g.106968226G>A	ENSP00000358062:p.Arg640Lys		Somatic					p.R640K	NM_001624	NP_001615	WXS	Illumina HiSeq	Unspecified	Q9Y4K1	AIM1_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	2	2406	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	640					Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	c.1919G>A	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	G	9.479	1.097617	0.20552	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.70749	-0.51	5.86	-6.43	0.01926	.	2.033850	0.02288	N	0.070024	T	0.23210	0.0561	N	0.22421	0.69	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.11012	-1.0605	10	0.06494	T	0.89	.	7.7147	0.28698	0.5159:0.1969:0.2872:0.0	.	640	Q9Y4K1	AIM1_HUMAN	K	1048;640	ENSP00000358062:R640K	ENSP00000285105:R1048K	R	+	2	0	AIM1	107074919	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.249000	0.08842	-1.297000	0.02351	-0.345000	0.07892	AGA		0.532	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			8	90	0	0	0	0.00308	0	8	90				
REV3L	5980	broad.mit.edu	37	6	111695225	111695225	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:111695225C>A	ENST00000358835.3	-	14	4787	c.4333G>T	c.(4333-4335)Gga>Tga	p.G1445*	REV3L_ENST00000368802.3_Nonsense_Mutation_p.G1445*|REV3L_ENST00000435970.1_Nonsense_Mutation_p.G1367*|REV3L_ENST00000368805.1_Nonsense_Mutation_p.G1445*			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1445					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.G1367*(1)|p.G1445*(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GCTGTATTTCCCGGAGAACAA	0.428								DNA polymerases (catalytic subunits)																															uc003puy.3		NA																	2	Substitution - Nonsense(2)		lung(2)	large_intestine(2)|ovary(2)|skin(2)	6						c.(4333-4335)GGA>TGA	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA polymerase zeta							129.0	117.0	121.0					6																	111695225		2203	4300	6503	SO:0001587	stop_gained	5980				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding	g.chr6:111695225C>A	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4333G>T	6.37:g.111695225C>A	ENSP00000351697:p.Gly1445*		Somatic				REV3L_uc003pux.3_Nonsense_Mutation_p.G1367*|REV3L_uc003puz.3_Nonsense_Mutation_p.G1367*	p.G1445*	NM_002912	NP_002903	WXS	Illumina HiSeq	Unspecified	O60673	DPOLZ_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)	13	4656	-		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)	1445					O43214|Q5TC33	Nonsense_Mutation	SNP	ENST00000358835.3	37	c.4333G>T	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	47	13.792624	0.99763	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	.	.	.	6.03	3.99	0.46301	.	2.811560	0.01478	N	0.016577	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-2.7758	8.429	0.32746	0.0:0.7112:0.1584:0.1305	.	.	.	.	X	1445;1445;1445;1367	.	ENSP00000351697:G1445X	G	-	1	0	REV3L	111801918	1.000000	0.71417	0.988000	0.46212	0.950000	0.60333	2.271000	0.43364	1.524000	0.49035	0.557000	0.71058	GGA		0.428	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912		56	133	1	0	6.3091e-27	0.01441	7.81864e-27	56	133				
VGLL2	245806	broad.mit.edu	37	6	117589584	117589584	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:117589584G>A	ENST00000326274.5	+	2	511	c.321G>A	c.(319-321)ctG>ctA	p.L107L	VGLL2_ENST00000352536.3_Silent_p.L107L	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	107					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.L107L(1)		central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		GCAGGGCCCTGAGCCAACCCA	0.597																																							uc003pxn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(319-321)CTG>CTA		vestigial-like 2 isoform 1							43.0	43.0	43.0					6																	117589584		2203	4300	6503	SO:0001819	synonymous_variant	245806				transcription, DNA-dependent	nucleus		g.chr6:117589584G>A	AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.321G>A	6.37:g.117589584G>A			Somatic				VGLL2_uc003pxo.2_Silent_p.L107L	p.L107L	NM_182645	NP_872586	WXS	Illumina HiSeq	Unspecified	Q8N8G2	VGLL2_HUMAN		GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)	2	511	+			107					Q8WWX1	Silent	SNP	ENST00000326274.5	37	c.321G>A	CCDS5115.1																																																																																				0.597	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041975.2	NM_153453		6	47	0	0	0	0.001984	0	6	47				
MCM9	254394	broad.mit.edu	37	6	119245037	119245037	+	Nonsense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:119245037G>C	ENST00000316316.6	-	3	846	c.560C>G	c.(559-561)tCa>tGa	p.S187*	MCM9_ENST00000316068.3_Nonsense_Mutation_p.S187*	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	187					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.S187*(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		AGACAAGCCTGAGAGGCAAGT	0.418																																							uc003pyh.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(559-561)TCA>TGA		minichromosome maintenance complex component 9							102.0	97.0	98.0					6																	119245037		2203	4300	6503	SO:0001587	stop_gained	254394				DNA replication		ATP binding|DNA binding|nucleoside-triphosphatase activity	g.chr6:119245037G>C	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.560C>G	6.37:g.119245037G>C	ENSP00000314505:p.Ser187*		Somatic					p.S187*	NM_153255	NP_694987	WXS	Illumina HiSeq	Unspecified	Q9NXL9	MCM9_HUMAN		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)	3	823	-		all_cancers(87;0.122)|all_epithelial(87;0.179)	187					B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Nonsense_Mutation	SNP	ENST00000316316.6	37	c.560C>G	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	G	39	7.525236	0.98339	.	.	ENSG00000111877	ENST00000316316;ENST00000316068	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	19.7747	0.96386	0.0:0.0:1.0:0.0	.	.	.	.	X	187	.	ENSP00000312870:S187X	S	-	2	0	MCM9	119286736	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	9.055000	0.93873	2.668000	0.90789	0.563000	0.77884	TCA		0.418	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255		3	115	0	0	0	0.004672	0	3	115				
VIP	7432	broad.mit.edu	37	6	153076459	153076459	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:153076459C>T	ENST00000367244.3	+	4	458	c.286C>T	c.(286-288)Caa>Taa	p.Q96*	VIP_ENST00000367243.3_Nonsense_Mutation_p.Q96*	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	96				QL -> PP (in Ref. 8; AAA61286). {ECO:0000305}.	body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)	p.Q96*(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		ACTCTTGGGTCAACTTTCTGC	0.318																																							uc003qpe.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(286-288)CAA>TAA		vasoactive intestinal peptide isoform 1							62.0	64.0	63.0					6																	153076459		2203	4300	6503	SO:0001587	stop_gained	7432				body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity	g.chr6:153076459C>T		CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.286C>T	6.37:g.153076459C>T	ENSP00000356213:p.Gln96*		Somatic				VIP_uc003qpf.2_Nonsense_Mutation_p.Q96*|VIP_uc010kjd.2_Nonsense_Mutation_p.Q96*	p.Q96*	NM_003381	NP_003372	WXS	Illumina HiSeq	Unspecified	P01282	VIP_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)	4	458	+		Ovarian(120;0.0654)	96	QL -> PP (in Ref. 8; AAA61286).				Q5TCY8|Q5TCY9|Q96QK3	Nonsense_Mutation	SNP	ENST00000367244.3	37	c.286C>T	CCDS5240.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.435938|6.435938	0.97564|0.97564	.|.	.|.	ENSG00000146469|ENSG00000146469	ENST00000367244;ENST00000367243|ENST00000431366	.|.	.|.	.|.	6.04|6.04	5.15|5.15	0.70609|0.70609	.|.	0.053674|.	0.85682|.	D|.	0.000000|.	.|T	.|0.53222	.|0.1783	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.53012	.|-0.8498	.|3	0.46703|.	T|.	0.11|.	-24.7888|-24.7888	13.0345|13.0345	0.58862|0.58862	0.1325:0.7526:0.1149:0.0|0.1325:0.7526:0.1149:0.0	.|.	.|.	.|.	.|.	X|L	96|45	.|.	ENSP00000356212:Q96X|.	Q|S	+|+	1|2	0|0	VIP|VIP	153118152|153118152	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	4.512000|4.512000	0.60469|0.60469	2.873000|2.873000	0.98535|0.98535	0.643000|0.643000	0.83706|0.83706	CAA|TCA		0.318	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042751.1			6	53	0	0	0	0.004482	0	6	53				
FBXO5	26271	broad.mit.edu	37	6	153296529	153296529	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:153296529C>T	ENST00000229758.3	-	2	389	c.331G>A	c.(331-333)Gaa>Aaa	p.E111K	FBXO5_ENST00000367241.3_Missense_Mutation_p.E65K|FBXO5_ENST00000477822.1_5'Flank	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	111					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.E111K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CGCTTGCTTTCAGTTTCAAGT	0.383																																					NSCLC(121;372 1757 17721 17977 29669)	NSCLC(121;372 1757 17721 17977 29669)	uc003qpg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(331-333)GAA>AAA		F-box only protein 5 isoform a							167.0	163.0	164.0					6																	153296529		2203	4300	6503	SO:0001583	missense	26271				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding	g.chr6:153296529C>T	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.331G>A	6.37:g.153296529C>T	ENSP00000229758:p.Glu111Lys		Somatic				FBXO5_uc003qph.2_Missense_Mutation_p.E65K	p.E111K	NM_012177	NP_036309	WXS	Illumina HiSeq	Unspecified	Q9UKT4	FBX5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)	2	440	-		Ovarian(120;0.125)	111					B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	ENST00000229758.3	37	c.331G>A	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633889	0.47049	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.58940	0.3;0.3	5.4	4.46	0.54185	.	0.444709	0.26979	N	0.021537	T	0.34542	0.0901	L	0.59436	1.845	0.30415	N	0.778725	B	0.10296	0.003	B	0.12837	0.008	T	0.31888	-0.9927	10	0.51188	T	0.08	-14.3194	10.2196	0.43190	0.0:0.8883:0.0:0.1117	.	111	Q9UKT4	FBX5_HUMAN	K	111;65	ENSP00000229758:E111K;ENSP00000356210:E65K	ENSP00000229758:E111K	E	-	1	0	FBXO5	153338222	0.988000	0.35896	0.946000	0.38457	0.825000	0.46686	2.544000	0.45761	1.026000	0.39733	0.655000	0.94253	GAA		0.383	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1			15	104	0	0	0	0.004007	0	15	104				
SYNJ2	8871	broad.mit.edu	37	6	158487540	158487540	+	Silent	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:158487540C>A	ENST00000355585.4	+	12	1665	c.1590C>A	c.(1588-1590)atC>atA	p.I530I	SYNJ2_ENST00000449859.2_Silent_p.I458I|SYNJ2_ENST00000367121.3_Silent_p.I530I|SYNJ2_ENST00000367122.2_Silent_p.I530I	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	530					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.I530I(1)		biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCAAGCGGATCCGGATTGCTA	0.547																																							uc003qqx.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1588-1590)ATC>ATA		synaptojanin 2							99.0	90.0	93.0					6																	158487540		2203	4300	6503	SO:0001819	synonymous_variant	8871						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr6:158487540C>A	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1590C>A	6.37:g.158487540C>A			Somatic				SYNJ2_uc011efm.1_RNA|SYNJ2_uc003qqw.1_Silent_p.I530I|SYNJ2_uc003qqy.1_Silent_p.I243I|SYNJ2_uc011efn.1_Silent_p.I458I|SYNJ2_uc010kjo.1_Silent_p.I479I|SYNJ2_uc003qqz.1_Silent_p.I147I	p.I530I	NM_003898	NP_003889	WXS	Illumina HiSeq	Unspecified	O15056	SYNJ2_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)	12	1665	+			530			Catalytic (By similarity).		Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	c.1590C>A	CCDS5254.1																																																																																				0.547	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2			13	153	1	0	9.05144e-12	0.001855	1.08189e-11	13	153				
MAP3K4	4216	broad.mit.edu	37	6	161470151	161470151	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr6:161470151T>G	ENST00000392142.4	+	3	995	c.847T>G	c.(847-849)Ttt>Gtt	p.F283V	MAP3K4_ENST00000366920.2_Missense_Mutation_p.F283V|MAP3K4_ENST00000348824.7_Missense_Mutation_p.F283V|MAP3K4_ENST00000366919.2_Missense_Mutation_p.F283V	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	283					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.F283V(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CCAGGACTTCTTTTTATATAC	0.433																																							uc003qtn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(847-849)TTT>GTT		mitogen-activated protein kinase kinase kinase 4							62.0	64.0	63.0					6																	161470151		2203	4299	6502	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161470151T>G	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.847T>G	6.37:g.161470151T>G	ENSP00000375986:p.Phe283Val		Somatic				MAP3K4_uc010kkc.1_Missense_Mutation_p.F283V|MAP3K4_uc003qto.2_Missense_Mutation_p.F283V|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	p.F283V	NM_005922	NP_005913	WXS	Illumina HiSeq	Unspecified	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	3	989	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	283					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.847T>G	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.957232	0.73902	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	6.16	6.16	0.99307	.	0.063724	0.64402	D	0.000006	T	0.23649	0.0572	L	0.47716	1.5	0.46203	D	0.998923	P;P	0.42078	0.726;0.77	B;B	0.39217	0.294;0.219	T	0.03221	-1.1059	10	0.46703	T	0.11	-29.7663	16.8061	0.85666	0.0:0.0:0.0:1.0	.	283;283	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	V	283	ENSP00000355886:F283V;ENSP00000375986:F283V;ENSP00000355887:F283V;ENSP00000297332:F283V	ENSP00000297332:F283V	F	+	1	0	MAP3K4	161390141	1.000000	0.71417	0.973000	0.42090	0.959000	0.62525	5.948000	0.70249	2.367000	0.80283	0.528000	0.53228	TTT		0.433	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			7	76	0	0	0	0.004482	0	7	76				
DNAH11	8701	broad.mit.edu	37	7	21923947	21923947	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:21923947C>T	ENST00000409508.3	+	76	12457	c.12426C>T	c.(12424-12426)atC>atT	p.I4142I	DNAH11_ENST00000328843.6_Silent_p.I4149I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4149					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I4149I(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTGGTGAGATCATGTATGGAG	0.448									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(12445-12447)ATC>ATT		dynein, axonemal, heavy chain 11							103.0	104.0	103.0					7																	21923947		2117	4257	6374	SO:0001819	synonymous_variant	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21923947C>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.12426C>T	7.37:g.21923947C>T			Somatic					p.I4149I	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			77	12478	+			4149					Q9UJ82	Silent	SNP	ENST00000409508.3	37	c.12447C>T																																																																																					0.448	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		11	74	0	0	0	0.013537	0	11	74				
AOAH	313	broad.mit.edu	37	7	36656065	36656065	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:36656065C>T	ENST00000258749.5	-	11	1166	c.767G>A	c.(766-768)gGa>gAa	p.G256E	AOAH_ENST00000535891.1_Missense_Mutation_p.G224E|AOAH_ENST00000431169.1_Missense_Mutation_p.G256E	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	256					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)	p.G256E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						CAAAATGATTCCCCTGGGCTG	0.448																																							uc003tfh.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(766-768)GGA>GAA		acyloxyacyl hydrolase precursor							78.0	70.0	73.0					7																	36656065		2203	4300	6503	SO:0001583	missense	313				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity	g.chr7:36656065C>T	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.767G>A	7.37:g.36656065C>T	ENSP00000258749:p.Gly256Glu		Somatic				AOAH_uc010kxf.2_Missense_Mutation_p.G256E|AOAH_uc011kba.1_Missense_Mutation_p.G224E	p.G256E	NM_001637	NP_001628	WXS	Illumina HiSeq	Unspecified	P28039	AOAH_HUMAN			11	1168	-			256					A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	c.767G>A	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923271	0.52653	.	.	ENSG00000136250	ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;D;D	0.85411	1.17;-1.83;-1.98	4.83	4.83	0.62350	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.000000	0.64402	D	0.000003	D	0.89880	0.6843	.	.	.	0.80722	D	1	B;D;P	0.63880	0.053;0.993;0.618	B;P;B	0.56514	0.038;0.8;0.285	D	0.91210	0.4998	9	0.87932	D	0	-10.0788	14.9585	0.71138	0.0:1.0:0.0:0.0	.	224;256;256	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	E	224;256;256;256	ENSP00000441101:G224E;ENSP00000258749:G256E;ENSP00000405683:G256E	ENSP00000258749:G256E	G	-	2	0	AOAH	36622590	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.165000	0.58196	2.486000	0.83907	0.655000	0.94253	GGA		0.448	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637		4	33	0	0	0	0.001168	0	4	33				
YAE1D1	57002	broad.mit.edu	37	7	39610115	39610115	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:39610115G>C	ENST00000223273.2	+	2	183	c.140G>C	c.(139-141)aGa>aCa	p.R47T	YAE1D1_ENST00000469737.1_3'UTR|YAE1D1_ENST00000448268.1_Missense_Mutation_p.R47T|YAE1D1_ENST00000432096.2_Missense_Mutation_p.R47T	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	47								p.R47T(1)									GAAGGTTATAGAGATGGAATA	0.368																																							uc003thc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)AGA>ACA		hypothetical protein LOC57002							115.0	117.0	117.0					7																	39610115		2203	4300	6503	SO:0001583	missense	57002							g.chr7:39610115G>C	AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.140G>C	7.37:g.39610115G>C	ENSP00000223273:p.Arg47Thr		Somatic					p.R47T	NM_020192	NP_064577	WXS	Illumina HiSeq	Unspecified	Q9NRH1	CG036_HUMAN			2	149	+			47					A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	ENST00000223273.2	37	c.140G>C	CCDS5459.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917704	0.73098	.	.	ENSG00000241127	ENST00000223273;ENST00000448268;ENST00000432096	T;T;T	0.53423	0.62;0.62;0.62	6.02	6.02	0.97574	Essential protein Yae1, N-terminal (1);	0.209962	0.48286	D	0.000188	T	0.72969	0.3527	M	0.82323	2.585	0.45806	D	0.998689	D	0.89917	1.0	D	0.87578	0.998	T	0.74556	-0.3626	10	0.62326	D	0.03	-3.9399	18.7178	0.91682	0.0:0.0:1.0:0.0	.	47	Q9NRH1	CG036_HUMAN	T	47	ENSP00000223273:R47T;ENSP00000400511:R47T;ENSP00000395777:R47T	ENSP00000223273:R47T	R	+	2	0	C7orf36	39576640	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.780000	0.75063	2.857000	0.98124	0.650000	0.86243	AGA		0.368	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250586.1	NM_020192		4	154	0	0	0	0.009096	0	4	154				
CDK13	8621	broad.mit.edu	37	7	40134077	40134077	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:40134077C>G	ENST00000181839.4	+	14	4642	c.4037C>G	c.(4036-4038)tCt>tGt	p.S1346C	CDK13_ENST00000340829.5_Missense_Mutation_p.S1286C	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1346					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.S1346C(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TCTTTCTCTTCTGCTCCTTAT	0.428																																							uc003thh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)	5						c.(4036-4038)TCT>TGT		cell division cycle 2-like 5 isoform 1							173.0	174.0	174.0					7																	40134077		2203	4300	6503	SO:0001583	missense	8621				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr7:40134077C>G	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.4037C>G	7.37:g.40134077C>G	ENSP00000181839:p.Ser1346Cys		Somatic				CDK13_uc003thi.3_Missense_Mutation_p.S1286C|CDK13_uc003thj.2_Missense_Mutation_p.S397C|CDK13_uc003thk.2_Missense_Mutation_p.S279C	p.S1346C	NM_003718	NP_003709	WXS	Illumina HiSeq	Unspecified	Q14004	CDK13_HUMAN			14	4319	+			1346					Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	37	c.4037C>G	CCDS5461.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.540770	0.45280	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.48836	0.8;0.8	5.54	4.57	0.56435	.	.	.	.	.	T	0.49287	0.1548	L	0.43152	1.355	0.26836	N	0.968478	P;P	0.51791	0.948;0.913	P;B	0.47376	0.545;0.343	T	0.44034	-0.9354	8	.	.	.	-7.2164	17.0806	0.86597	0.1354:0.8646:0.0:0.0	.	1286;1346	Q14004-2;Q14004	.;CDK13_HUMAN	C	1346;1286	ENSP00000181839:S1346C;ENSP00000340557:S1286C	.	S	+	2	0	CDK13	40100602	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.144000	0.71762	2.603000	0.88011	0.655000	0.94253	TCT		0.428	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718		4	139	0	0	0	0.000602	0	4	139				
DYNC1I1	1780	broad.mit.edu	37	7	95614143	95614143	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:95614143G>C	ENST00000324972.6	+	8	841	c.648G>C	c.(646-648)ttG>ttC	p.L216F	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.L196F|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.L179F|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.L199F|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.L199F|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.L179F	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	216					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.L216F(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAAGAGAGTTGACAGAGGAAG	0.368																																							uc003uoc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(646-648)TTG>TTC		dynein, cytoplasmic 1, intermediate chain 1							80.0	85.0	83.0					7																	95614143		2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95614143G>C	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.648G>C	7.37:g.95614143G>C	ENSP00000320130:p.Leu216Phe		Somatic				DYNC1I1_uc003uod.3_Missense_Mutation_p.L199F|DYNC1I1_uc003uob.2_Missense_Mutation_p.L179F|DYNC1I1_uc003uoe.3_Missense_Mutation_p.L196F|DYNC1I1_uc010lfl.2_Missense_Mutation_p.L205F	p.L216F	NM_004411	NP_004402	WXS	Illumina HiSeq	Unspecified	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		8	925	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		216					B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.648G>C	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742605	0.69418	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.76316	-1.01;2.53;-1.01;-1.01;-1.01;-1.01	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000002	D	0.90546	0.7037	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.982	D;D;D;D;P	0.77557	0.978;0.99;0.99;0.978;0.82	D	0.92198	0.5765	10	0.62326	D	0.03	-12.0798	18.4496	0.90699	0.0:0.0:1.0:0.0	.	199;196;199;216;179	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	F	199;216;179;196;179;199	ENSP00000392337:L199F;ENSP00000320130:L216F;ENSP00000438377:L179F;ENSP00000398118:L196F;ENSP00000352348:L179F;ENSP00000412444:L199F	ENSP00000320130:L216F	L	+	3	2	DYNC1I1	95452079	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	3.137000	0.50562	2.648000	0.89879	0.655000	0.94253	TTG		0.368	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		40	67	0	0	0	0.009718	0	40	67				
MUC17	140453	broad.mit.edu	37	7	100683576	100683576	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:100683576C>A	ENST00000306151.4	+	3	8943	c.8879C>A	c.(8878-8880)aCc>aAc	p.T2960N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2960	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T2960N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACACCTGTCACCACTTCTGCT	0.483																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8878-8880)ACC>AAC		mucin 17 precursor							207.0	215.0	212.0					7																	100683576		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683576C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8879C>A	7.37:g.100683576C>A	ENSP00000302716:p.Thr2960Asn		Somatic				MUC17_uc010lho.1_RNA	p.T2960N	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	8932	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2960			Extracellular (Potential).|Ser-rich.|48.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8879C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	7.834	0.720485	0.15372	.	.	ENSG00000169876	ENST00000306151	T	0.03580	3.88	1.22	0.0928	0.14474	.	.	.	.	.	T	0.06142	0.0159	L	0.34521	1.04	0.09310	N	1	P	0.51653	0.947	P	0.55965	0.788	T	0.41215	-0.9521	9	0.35671	T	0.21	.	6.8004	0.23748	0.0:0.7037:0.2963:0.0	.	2960	Q685J3	MUC17_HUMAN	N	2960	ENSP00000302716:T2960N	ENSP00000302716:T2960N	T	+	2	0	MUC17	100470296	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.025000	0.12413	0.034000	0.15491	0.121000	0.15741	ACC		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		131	236	1	0	8.93811e-64	0.01441	1.13197e-63	131	236				
NUP205	23165	broad.mit.edu	37	7	135310104	135310104	+	Splice_Site	SNP	G	G	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:135310104G>T	ENST00000285968.6	+	32	4697		c.e32+1			NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.?(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ATCTAAAATGGTAAGGCTTTC	0.368																																							uc003vsw.2		NA																	1	Unknown(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.e32+1		nucleoporin 205kDa							67.0	70.0	69.0					7																	135310104		2203	4300	6503	SO:0001630	splice_region_variant	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135310104G>T	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4671+1G>T	7.37:g.135310104G>T			Somatic				NUP205_uc003vsx.2_Splice_Site	p.M1557_splice	NM_015135	NP_055950	WXS	Illumina HiSeq	Unspecified	Q92621	NU205_HUMAN			32	4702	+								A6H8X3|Q86YC1	Splice_Site	SNP	ENST00000285968.6	37	c.4671_splice	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510449	0.85389	.	.	ENSG00000155561	ENST00000285968	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP205	134960644	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.451000	0.97610	2.767000	0.95098	0.563000	0.77884	.		0.368	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		Intron	46	73	1	0	9.52127e-25	0.01441	1.17633e-24	46	73				
GSTK1	373156	broad.mit.edu	37	7	142960620	142960620	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:142960620C>A	ENST00000358406.5	+	1	85	c.14C>A	c.(13-15)cCg>cAg	p.P5Q	AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000479303.1_Missense_Mutation_p.P5Q|GSTK1_ENST00000443571.2_Missense_Mutation_p.P5Q|GSTK1_ENST00000409500.3_Missense_Mutation_p.P5Q|GSTK1_ENST00000494735.1_3'UTR	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	5					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)	p.P5Q(2)		lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	GGGCCCCTGCCGCGCACCGTG	0.677																																							uc003wci.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(13-15)CCG>CAG		glutathione S-transferase kappa 1 isoform a	Glutathione(DB00143)						50.0	54.0	53.0					7																	142960620		2203	4300	6503	SO:0001583	missense	373156					outer membrane-bounded periplasmic space|peroxisome	glutathione transferase activity|identical protein binding|protein disulfide oxidoreductase activity	g.chr7:142960620C>A		CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.14C>A	7.37:g.142960620C>A	ENSP00000351181:p.Pro5Gln		Somatic				GSTK1_uc011ksy.1_Missense_Mutation_p.P5Q|GSTK1_uc003wcj.2_Missense_Mutation_p.P5Q|GSTK1_uc011ksz.1_Missense_Mutation_p.P5Q	p.P5Q	NM_015917	NP_057001	WXS	Illumina HiSeq	Unspecified	Q9Y2Q3	GSTK1_HUMAN			1	99	+	Melanoma(164;0.059)		5					B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	ENST00000358406.5	37	c.14C>A	CCDS5877.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501285	0.64298	.	.	ENSG00000197448	ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	5.49	4.62	0.57501	Thioredoxin-like fold (1);	0.281782	0.36628	N	0.002492	T	0.62171	0.2406	M	0.71581	2.175	0.20196	N	0.999922	D;D;D;B	0.65815	0.979;0.971;0.995;0.44	P;P;D;B	0.63793	0.828;0.795;0.918;0.267	T	0.55134	-0.8188	9	0.33141	T	0.24	-15.7146	11.14	0.48398	0.0:0.9135:0.0:0.0865	.	5;5;5;5	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	Q	5	.	ENSP00000351181:P5Q	P	+	2	0	GSTK1	142670742	0.813000	0.29090	0.341000	0.25589	0.208000	0.24298	1.444000	0.35068	1.302000	0.44855	-0.306000	0.09157	CCG		0.677	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327091.1	NM_015917		6	133	1	0	8.12818e-05	0.001984	9.32894e-05	6	133				
SLC4A2	6522	broad.mit.edu	37	7	150773144	150773144	+	Silent	SNP	C	C	G	rs150666646	byFrequency	TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:150773144C>G	ENST00000485713.1	+	22	4556	c.3516C>G	c.(3514-3516)ctC>ctG	p.L1172L	FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Silent_p.L1158L|SLC4A2_ENST00000392826.2_Silent_p.L1163L|SLC4A2_ENST00000413384.2_Silent_p.L1172L|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Silent_p.L1090L	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1172	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)	p.L1172L(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCAGCTGCTCTGCCTGGCCC	0.667																																							uc003wit.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(3514-3516)CTC>CTG		solute carrier family 4, anion exchanger, member							78.0	75.0	76.0					7																	150773144		2203	4300	6503	SO:0001819	synonymous_variant	6522				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity	g.chr7:150773144C>G		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3516C>G	7.37:g.150773144C>G			Somatic				SLC4A2_uc011kve.1_Silent_p.L1163L|SLC4A2_uc003wiu.3_Silent_p.L1158L|SLC4A2_uc003wiv.3_Silent_p.L366L|uc011kvf.1_Missense_Mutation_p.E101Q	p.L1172L	NM_003040	NP_003031	WXS	Illumina HiSeq	Unspecified	P04920	B3A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	22	3772	+			1172			Membrane (anion exchange).|Helical; (Potential).		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	ENST00000485713.1	37	c.3516C>G	CCDS5917.1																																																																																				0.667	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040		4	102	0	0	0	0.009096	0	4	102				
PTPRN2	5799	broad.mit.edu	37	7	157387990	157387990	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr7:157387990C>T	ENST00000389418.4	-	17	2445	c.2436G>A	c.(2434-2436)agG>agA	p.R812R	PTPRN2_ENST00000389416.4_Silent_p.R795R|PTPRN2_ENST00000404321.2_Silent_p.R835R|PTPRN2_ENST00000389413.3_Silent_p.R783R|PTPRN2_ENST00000409483.1_Silent_p.R774R	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	812	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R812R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACGCGGGGTTCCTCGGGTCGT	0.532																																							uc003wno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(2434-2436)AGG>AGA		protein tyrosine phosphatase, receptor type, N							59.0	65.0	63.0					7																	157387990		2203	4300	6503	SO:0001819	synonymous_variant	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157387990C>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2436G>A	7.37:g.157387990C>T			Somatic				PTPRN2_uc003wnp.2_Silent_p.R795R|PTPRN2_uc003wnq.2_Silent_p.R783R|PTPRN2_uc003wnr.2_Silent_p.R774R|PTPRN2_uc011kwa.1_Silent_p.R835R	p.R812R	NM_002847	NP_002838	WXS	Illumina HiSeq	Unspecified	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	17	2557	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	812			Cytoplasmic (Potential).|Tyrosine-protein phosphatase.		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	37	c.2436G>A	CCDS5947.1																																																																																				0.532	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			6	91	0	0	0	0.001984	0	6	91				
CLU	1191	broad.mit.edu	37	8	27462598	27462598	+	Silent	SNP	G	G	A	rs367733866		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:27462598G>A	ENST00000316403.10	-	5	1077	c.672C>T	c.(670-672)cgC>cgT	p.R224R	CLU_ENST00000405140.3_Silent_p.R224R|CLU_ENST00000546343.1_Silent_p.R235R|CLU_ENST00000560366.1_Silent_p.R276R|CLU_ENST00000523500.1_Silent_p.R224R			P10909	CLUS_HUMAN	clusterin	224				R -> L (in Ref. 3; BAG36598). {ECO:0000305}.	blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)	p.R276R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		TGCGGACGATGCGGGACTTGG	0.602																																							uc003xfw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(670-672)CGC>CGT		clusterin isoform 2							124.0	116.0	119.0					8																	27462598		2203	4300	6503	SO:0001819	synonymous_variant	1191				chaperone-mediated protein folding|complement activation, classical pathway|innate immune response|lipid metabolic process|negative regulation of apoptosis|negative regulation of protein homooligomerization|platelet activation|platelet degranulation|positive regulation of NF-kappaB transcription factor activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|response to misfolded protein|response to virus|reverse cholesterol transport	chromaffin granule|cytosol|endoplasmic reticulum|microsome|mitochondrial membrane|nucleus|perinuclear region of cytoplasm|platelet alpha granule lumen|spherical high-density lipoprotein particle	misfolded protein binding|ubiquitin protein ligase binding	g.chr8:27462598G>A	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.672C>T	8.37:g.27462598G>A			Somatic				CLU_uc010lux.1_Silent_p.R89R|CLU_uc003xfx.1_Silent_p.R224R|CLU_uc003xfy.1_Silent_p.R235R|CLU_uc003xfz.1_Silent_p.R276R	p.R224R	NM_203339	NP_976084	WXS	Illumina HiSeq	Unspecified	P10909	CLUS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)	4	730	-		Ovarian(32;2.61e-05)	224	R -> L (in Ref. 3; BAG36598).				B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Silent	SNP	ENST00000316403.10	37	c.672C>T	CCDS47832.1	.	.	.	.	.	.	.	.	.	.	G	3.141	-0.176287	0.06380	.	.	ENSG00000120885	ENST00000522098	.	.	.	4.45	2.31	0.28768	.	.	.	.	.	T	0.25306	0.0615	.	.	.	0.20563	N	0.999889	.	.	.	.	.	.	T	0.18681	-1.0329	4	.	.	.	-18.1241	4.4711	0.11714	0.1431:0.2305:0.6264:0.0	.	.	.	.	Y	87	.	.	H	-	1	0	CLU	27518515	0.848000	0.29623	0.755000	0.31263	0.370000	0.29829	1.173000	0.31920	0.918000	0.36919	0.563000	0.77884	CAT		0.602	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831		24	82	0	0	0	0.005443	0	24	82				
FNTA	2339	broad.mit.edu	37	8	42919285	42919285	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:42919285G>C	ENST00000302279.3	+	3	522	c.328G>C	c.(328-330)Gat>Cat	p.D110H	FNTA_ENST00000342116.4_Intron|FNTA_ENST00000524546.1_3'UTR|RP11-598P20.5_ENST00000534420.1_Missense_Mutation_p.D67H|FNTA_ENST00000529687.1_5'UTR	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	110					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)	p.D110H(1)		cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			CCTGCAGCGTGATGAAAGAAG	0.383																																							uc003xps.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(328-330)GAT>CAT		farnesyltransferase, CAAX box, alpha isoform a							199.0	186.0	191.0					8																	42919285		2203	4300	6503	SO:0001583	missense	2339				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity	g.chr8:42919285G>C	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.328G>C	8.37:g.42919285G>C	ENSP00000303423:p.Asp110His		Somatic				FNTA_uc003xpt.2_Missense_Mutation_p.D19H|FNTA_uc003xpu.2_Intron|FNTA_uc003xpv.2_RNA	p.D110H	NM_002027	NP_002018	WXS	Illumina HiSeq	Unspecified	P49354	FNTA_HUMAN	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)		3	376	+	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	110					A6NJW0|Q53XJ9|Q9UDC1	Missense_Mutation	SNP	ENST00000302279.3	37	c.328G>C	CCDS6140.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696201	0.88830	.	.	ENSG00000254673;ENSG00000168522;ENSG00000168522;ENSG00000168522	ENST00000534420;ENST00000302279;ENST00000531266;ENST00000533336	.	.	.	5.05	5.05	0.67936	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.65626	0.2709	M	0.73962	2.25	0.80722	D	1	P;P	0.51537	0.923;0.946	B;P	0.47941	0.346;0.562	T	0.72067	-0.4402	9	0.66056	D	0.02	-28.3435	15.8992	0.79359	0.0:0.0:1.0:0.0	.	19;110	A8MVX8;P49354	.;FNTA_HUMAN	H	67;110;92;48	.	ENSP00000303423:D110H	D	+	1	0	FNTA;RP11-598P20.5	43038442	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	9.536000	0.98067	2.335000	0.79485	0.555000	0.69702	GAT		0.383	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027		6	239	0	0	0	0.001168	0	6	239				
SLCO5A1	81796	broad.mit.edu	37	8	70617448	70617448	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:70617448G>A	ENST00000260126.4	-	6	2146	c.1440C>T	c.(1438-1440)ccC>ccT	p.P480P	SLCO5A1_ENST00000524945.1_Silent_p.P480P|SLCO5A1_ENST00000530307.1_Silent_p.P425P	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	480						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P480P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CACCAGCACTGGGGACGATAA	0.408																																							uc003xyl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(1438-1440)CCC>CCT		solute carrier organic anion transporter family,							59.0	61.0	60.0					8																	70617448		2203	4300	6503	SO:0001819	synonymous_variant	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70617448G>A	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1440C>T	8.37:g.70617448G>A			Somatic				SLCO5A1_uc010lzb.2_Silent_p.P425P|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Silent_p.P480P|SLCO5A1_uc010lzc.2_Silent_p.P425P	p.P480P	NM_030958	NP_112220	WXS	Illumina HiSeq	Unspecified	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		6	2147	-	Breast(64;0.0654)		480			Helical; Name=8; (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Silent	SNP	ENST00000260126.4	37	c.1440C>T	CCDS6205.1																																																																																				0.408	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		4	85	0	0	0	0.009096	0	4	85				
ZFHX4	79776	broad.mit.edu	37	8	77764427	77764427	+	Missense_Mutation	SNP	C	C	A	rs529488460		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:77764427C>A	ENST00000521891.2	+	10	5718	c.5270C>A	c.(5269-5271)cCa>cAa	p.P1757Q	ZFHX4_ENST00000050961.6_Missense_Mutation_p.P1712Q|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P1712Q|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P1731Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1712	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P1757Q(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTGGGCTTGCCAGGCTCTGCC	0.512										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(5134-5136)CCA>CAA		zinc finger homeodomain 4							46.0	43.0	44.0					8																	77764427		2060	4230	6290	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764427C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5270C>A	8.37:g.77764427C>A	ENSP00000430497:p.Pro1757Gln	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.P1757Q|ZFHX4_uc003yaw.1_Missense_Mutation_p.P1712Q	p.P1712Q	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5522	+			1712			Gln-rich.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.5135C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	13.20	2.166758	0.38217	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50277	0.75;0.8;0.77;0.76	4.71	4.71	0.59529	.	0.000000	0.44285	U	0.000477	T	0.47875	0.1469	L	0.47716	1.5	0.40669	D	0.982197	P;P;P	0.44429	0.745;0.835;0.835	B;B;B	0.43728	0.247;0.429;0.429	T	0.49570	-0.8926	10	0.40728	T	0.16	.	18.2749	0.90080	0.0:1.0:0.0:0.0	.	1712;1712;1757	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Q	1757;1757;1712;1712;1731	ENSP00000430497:P1757Q;ENSP00000399605:P1712Q;ENSP00000050961:P1712Q;ENSP00000430848:P1731Q	ENSP00000050961:P1712Q	P	+	2	0	ZFHX4	77926982	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	5.780000	0.68956	2.631000	0.89168	0.632000	0.83419	CCA		0.512	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		21	39	1	0	2.39556e-15	0.00278	2.88898e-15	21	39				
FAM83H	286077	broad.mit.edu	37	8	144812586	144812586	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:144812586A>C	ENST00000388913.3	-	2	292	c.167T>G	c.(166-168)cTg>cGg	p.L56R	MIR4664_ENST00000583819.1_RNA	NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	56					biomineral tissue development (GO:0031214)			p.L56R(1)		central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TTCAGGGCACAGGAAGTCTGG	0.617																																							uc003yzk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(166-168)CTG>CGG		FAM83H							64.0	69.0	67.0					8																	144812586		2042	4186	6228	SO:0001583	missense	286077				biomineral tissue development			g.chr8:144812586A>C	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.167T>G	8.37:g.144812586A>C	ENSP00000373565:p.Leu56Arg		Somatic				FAM83H_uc010mfk.1_5'Flank	p.L56R	NM_198488	NP_940890	WXS	Illumina HiSeq	Unspecified	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		2	236	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		56					A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	c.167T>G	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	a	22.0	4.229037	0.79688	.	.	ENSG00000180921	ENST00000388913	T	0.34859	1.34	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000005	T	0.66327	0.2778	M	0.90705	3.14	0.48341	D	0.99963	D	0.89917	1.0	D	0.97110	1.0	T	0.74711	-0.3573	10	0.87932	D	0	.	13.9502	0.64111	1.0:0.0:0.0:0.0	.	56	Q6ZRV2	FA83H_HUMAN	R	56	ENSP00000373565:L56R	ENSP00000373565:L56R	L	-	2	0	FAM83H	144884574	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.179000	0.94861	1.966000	0.57179	0.459000	0.35465	CTG		0.617	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488		26	115	0	0	0	0.005443	0	26	115				
FBXL6	26233	broad.mit.edu	37	8	145581359	145581359	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:145581359G>A	ENST00000331890.5	-	2	568	c.504C>T	c.(502-504)ggC>ggT	p.G168G	SLC52A2_ENST00000527078.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.G168G|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000526524.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	168					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)	p.G168G(1)		endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGGCAGGCCGGCCGACCAGCG	0.687																																							uc003zcb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(502-504)GGC>GGT		F-box and leucine-rich repeat protein 6 isoform							19.0	21.0	21.0					8																	145581359		2198	4298	6496	SO:0001819	synonymous_variant	26233				proteolysis		ubiquitin-protein ligase activity	g.chr8:145581359G>A	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.504C>T	8.37:g.145581359G>A			Somatic				C8ORFK29_uc011llb.1_5'Flank|C8ORFK29_uc010mfw.2_5'Flank|C8ORFK29_uc003zby.3_5'Flank|FBXL6_uc003zbz.2_5'UTR|FBXL6_uc003zca.2_Silent_p.G168G|FBXL6_uc010mfx.2_5'UTR|GPR172A_uc003zcc.1_5'Flank|GPR172A_uc003zcd.1_5'Flank|GPR172A_uc003zce.1_5'Flank|GPR172A_uc010mfy.1_5'Flank|GPR172A_uc003zcf.1_5'Flank|GPR172A_uc011llc.1_5'Flank	p.G168G	NM_012162	NP_036294	WXS	Illumina HiSeq	Unspecified	Q8N531	FBXL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)		2	529	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		168					Q53G43|Q9H5W9|Q9UKC7	Silent	SNP	ENST00000331890.5	37	c.504C>T	CCDS6422.1																																																																																				0.687	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555		10	50	0	0	0	0.010729	0	10	50				
RPL8	6132	broad.mit.edu	37	8	146015223	146015223	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr8:146015223C>A	ENST00000262584.3	-	6	972	c.740G>T	c.(739-741)cGg>cTg	p.R247L	RPL8_ENST00000394920.2_Missense_Mutation_p.R247L|RPL8_ENST00000529163.1_5'UTR|RPL8_ENST00000527914.1_Missense_Mutation_p.R138L|RPL8_ENST00000528957.1_Missense_Mutation_p.R247L|ZNF34_ENST00000429371.2_5'Flank|ZNF34_ENST00000343459.4_5'Flank	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	247					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.R247L(1)		kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		CTTGGTTCCCCGGAGACGTCC	0.587																																							uc003zeb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(739-741)CGG>CTG		ribosomal protein L8							135.0	140.0	139.0					8																	146015223		2203	4300	6503	SO:0001583	missense	6132				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	rRNA binding|structural constituent of ribosome	g.chr8:146015223C>A	Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.740G>T	8.37:g.146015223C>A	ENSP00000262584:p.Arg247Leu		Somatic				RPL8_uc003zdz.2_RNA|RPL8_uc003zea.2_Missense_Mutation_p.R211L|RPL8_uc003zec.2_Missense_Mutation_p.R247L	p.R247L	NM_033301	NP_150644	WXS	Illumina HiSeq	Unspecified	P62917	RL8_HUMAN	Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)	6	851	-	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		247					A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Missense_Mutation	SNP	ENST00000262584.3	37	c.740G>T	CCDS6433.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260615	0.80246	.	.	ENSG00000161016	ENST00000394920;ENST00000527914;ENST00000262584;ENST00000534813;ENST00000533397	T;T;T	0.47869	0.83;0.83;0.83	4.74	4.74	0.60224	Translation protein SH3-like (1);	0.000000	0.85682	D	0.000000	T	0.62648	0.2445	M	0.72353	2.195	0.80722	D	1	D;P	0.59357	0.985;0.914	P;P	0.56474	0.799;0.494	T	0.68303	-0.5444	10	0.87932	D	0	-13.0149	15.6573	0.77150	0.0:1.0:0.0:0.0	.	247;211	P62917;E9PIZ3	RL8_HUMAN;.	L	247;138;247;211;226	ENSP00000378378:R247L;ENSP00000262584:R247L;ENSP00000435313:R226L	ENSP00000262584:R247L	R	-	2	0	RPL8	145986027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.678000	0.74508	2.364000	0.80123	0.555000	0.69702	CGG		0.587	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382948.1	NM_000973		10	593	1	0	0.00829132	0.008291	0.00935668	10	593				
PSIP1	11168	broad.mit.edu	37	9	15486913	15486913	+	Nonsense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:15486913G>C	ENST00000380733.4	-	5	648	c.305C>G	c.(304-306)tCa>tGa	p.S102*	PSIP1_ENST00000397519.2_Nonsense_Mutation_p.S102*|PSIP1_ENST00000380738.4_Nonsense_Mutation_p.S102*|PSIP1_ENST00000380716.4_Nonsense_Mutation_p.S102*|PSIP1_ENST00000380715.1_Nonsense_Mutation_p.S102*			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	102					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)	p.S102*(2)		breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TGATGCATTTGATTGTTTAGT	0.289																																							uc003zlv.3		NA																	2	Substitution - Nonsense(2)		lung(2)	breast(1)	1						c.(304-306)TCA>TGA		PC4 and SFRS1 interacting protein 1 isoform 2							132.0	121.0	125.0					9																	15486913		2203	4299	6502	SO:0001587	stop_gained	11168				initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity	g.chr9:15486913G>C	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.305C>G	9.37:g.15486913G>C	ENSP00000370109:p.Ser102*		Somatic				PSIP1_uc003zlw.3_Nonsense_Mutation_p.S102*|PSIP1_uc003zlz.3_Nonsense_Mutation_p.S102*|PSIP1_uc003zma.3_Nonsense_Mutation_p.S102*|PSIP1_uc003zly.2_Nonsense_Mutation_p.S102*	p.S102*	NM_033222	NP_150091	WXS	Illumina HiSeq	Unspecified	O75475	PSIP1_HUMAN		GBM - Glioblastoma multiforme(50;2.38e-06)	5	635	-			102					D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Nonsense_Mutation	SNP	ENST00000380733.4	37	c.305C>G	CCDS6479.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693679	0.88735	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	.	.	.	5.14	5.14	0.70334	.	0.825613	0.10966	N	0.614436	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	11.7291	0.51726	0.0:0.0:0.8118:0.1882	.	.	.	.	X	102	.	ENSP00000370091:S102X	S	-	2	0	PSIP1	15476913	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.340000	0.52143	2.548000	0.85928	0.650000	0.86243	TCA		0.289	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222		18	82	0	0	0	0.006122	0	18	82				
BNC2	54796	broad.mit.edu	37	9	16437286	16437286	+	Silent	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:16437286C>T	ENST00000380672.4	-	6	963	c.906G>A	c.(904-906)gaG>gaA	p.E302E	BNC2_ENST00000380667.2_Silent_p.E235E|BNC2_ENST00000545497.1_Silent_p.E207E|BNC2_ENST00000380666.2_Silent_p.E302E	NM_017637.5	NP_060107.3			basonuclin 2									p.E302E(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GATTGCTGTTCTCTAAGTGAG	0.473																																							uc003zml.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(904-906)GAG>GAA		basonuclin 2							244.0	229.0	234.0					9																	16437286		2203	4300	6503	SO:0001819	synonymous_variant	54796				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding	g.chr9:16437286C>T	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.906G>A	9.37:g.16437286C>T			Somatic				BNC2_uc011lmw.1_Silent_p.E207E|BNC2_uc003zmm.2_Silent_p.E260E|BNC2_uc003zmq.1_Silent_p.E316E|BNC2_uc003zmr.1_Silent_p.E339E|BNC2_uc003zmp.1_Silent_p.E330E|BNC2_uc010mij.1_Silent_p.E224E|BNC2_uc011lmv.1_Silent_p.E128E|BNC2_uc003zmo.1_Silent_p.E224E|BNC2_uc003zmj.2_Silent_p.E67E|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Silent_p.E67E|BNC2_uc003zmn.1_Silent_p.E67E	p.E302E	NM_017637	NP_060107	WXS	Illumina HiSeq	Unspecified	Q6ZN30	BNC2_HUMAN		GBM - Glioblastoma multiforme(50;9.01e-08)	6	1046	-			302						Silent	SNP	ENST00000380672.4	37	c.906G>A	CCDS6482.2																																																																																				0.473	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637		12	195	0	0	0	0.00245	0	12	195				
TOPORS	10210	broad.mit.edu	37	9	32543115	32543115	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:32543115C>G	ENST00000360538.2	-	3	1524	c.1408G>C	c.(1408-1410)Gac>Cac	p.D470H	TOPORS_ENST00000379858.1_Missense_Mutation_p.D405H	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	470	Interaction with SUMO1.|Interaction with TOP1.|Interaction with p53/TP53.|Required for sumoylation and localization to discrete nuclear foci.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D470H(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TCATCACTGTCATTATTTAGG	0.408																																							uc003zrb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(1408-1410)GAC>CAC		topoisomerase I binding, arginine/serine-rich							137.0	123.0	128.0					9																	32543115		2203	4300	6503	SO:0001583	missense	10210				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:32543115C>G	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1408G>C	9.37:g.32543115C>G	ENSP00000353735:p.Asp470His		Somatic				TOPORS_uc003zrc.2_Missense_Mutation_p.D403H	p.D470H	NM_005802	NP_005793	WXS	Illumina HiSeq	Unspecified	Q9NS56	TOPRS_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)	3	1575	-			470			Interaction with p53/TP53.|Required for sumoylation and localization to discrete nuclear foci.|Interaction with SUMO1.|Interaction with TOP1.		O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	c.1408G>C	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	C	2.727	-0.265385	0.05754	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.16743	2.32;2.33	5.35	5.35	0.76521	.	0.000000	0.51477	D	0.000084	T	0.25232	0.0613	N	0.24115	0.695	0.36909	D	0.890816	D	0.76494	0.999	D	0.64042	0.921	T	0.04723	-1.0931	10	0.46703	T	0.11	-4.637	13.6848	0.62508	0.0:0.845:0.155:0.0	.	470	Q9NS56	TOPRS_HUMAN	H	470;405	ENSP00000353735:D470H;ENSP00000369187:D405H	ENSP00000353735:D470H	D	-	1	0	TOPORS	32533115	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	3.976000	0.56867	2.770000	0.95276	0.650000	0.86243	GAC		0.408	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802		9	106	0	0	0	0.006214	0	9	106				
UBAP1	51271	broad.mit.edu	37	9	34242054	34242054	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:34242054C>G	ENST00000297661.4	+	4	1266	c.1031C>G	c.(1030-1032)tCt>tGt	p.S344C	UBAP1_ENST00000536252.1_Missense_Mutation_p.S344C|UBAP1_ENST00000359544.2_Missense_Mutation_p.S344C|UBAP1_ENST00000540348.1_Missense_Mutation_p.S344C|UBAP1_ENST00000543944.1_Missense_Mutation_p.S380C|UBAP1_ENST00000545103.1_Missense_Mutation_p.S408C|UBAP1_ENST00000379186.4_Missense_Mutation_p.S344C	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	344					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)	p.S408C(1)|p.S344C(1)		endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			CCTTCCCTCTCTGTTTTGTCT	0.507																																					NSCLC(109;1074 1634 14978 20375 39620)	NSCLC(109;1074 1634 14978 20375 39620)	uc003ztx.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1030-1032)TCT>TGT		ubiquitin associated protein 1							100.0	101.0	101.0					9																	34242054		2203	4300	6503	SO:0001583	missense	51271					cytoplasm		g.chr9:34242054C>G	AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.1031C>G	9.37:g.34242054C>G	ENSP00000297661:p.Ser344Cys		Somatic				UBAP1_uc010mka.1_Missense_Mutation_p.S380C|UBAP1_uc003zty.2_Missense_Mutation_p.S344C|UBAP1_uc011loi.1_Missense_Mutation_p.S380C|UBAP1_uc011loj.1_Missense_Mutation_p.S408C|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Missense_Mutation_p.S344C	p.S344C	NM_016525	NP_057609	WXS	Illumina HiSeq	Unspecified	Q9NZ09	UBAP1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00272)		4	1266	+			344					B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Missense_Mutation	SNP	ENST00000297661.4	37	c.1031C>G	CCDS6550.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869654	0.72065	.	.	ENSG00000165006	ENST00000545103;ENST00000543944;ENST00000536252;ENST00000540348;ENST00000297661;ENST00000379186;ENST00000359544	T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2	6.01	6.01	0.97437	.	0.358091	0.31484	N	0.007579	T	0.68109	0.2965	L	0.36672	1.1	0.39445	D	0.9673	D;D;D;D	0.76494	0.999;0.989;0.999;0.971	P;P;D;P	0.65443	0.855;0.735;0.935;0.729	T	0.68481	-0.5397	10	0.54805	T	0.06	-4.8801	18.6966	0.91603	0.0:1.0:0.0:0.0	.	408;380;408;344	F5GXE2;F5H0J8;B7Z8N9;Q9NZ09	.;.;.;UBAP1_HUMAN	C	408;380;344;344;344;344;344	ENSP00000441024:S408C;ENSP00000439806:S380C;ENSP00000440456:S344C;ENSP00000439976:S344C;ENSP00000297661:S344C;ENSP00000368484:S344C;ENSP00000352541:S344C	ENSP00000297661:S344C	S	+	2	0	UBAP1	34232054	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	3.792000	0.55476	2.852000	0.98041	0.643000	0.83706	TCT		0.507	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001084.1			5	158	0	0	0	0.001984	0	5	158				
RUSC2	9853	broad.mit.edu	37	9	35561270	35561270	+	Missense_Mutation	SNP	G	G	C	rs371824519		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:35561270G>C	ENST00000455600.1	+	12	5011	c.4442G>C	c.(4441-4443)gGa>gCa	p.G1481A	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1481	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)	p.G1481A(1)		NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GGGCGAGCTGGAGGAGACTGG	0.652																																							uc003zww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4441-4443)GGA>GCA		RUN and SH3 domain containing 2							49.0	61.0	57.0					9																	35561270		2203	4300	6503	SO:0001583	missense	9853					cytosol		g.chr9:35561270G>C	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.4442G>C	9.37:g.35561270G>C	ENSP00000393922:p.Gly1481Ala		Somatic				RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.G1481A	p.G1481A	NM_014806	NP_055621	WXS	Illumina HiSeq	Unspecified	Q8N2Y8	RUSC2_HUMAN	Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)		12	4697	+			1481			SH3.		A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	c.4442G>C	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	9.729	1.161809	0.21538	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.17528	2.27;2.27	5.39	2.46	0.29980	Src homology-3 domain (3);Variant SH3 (1);	0.454767	0.24669	N	0.036578	T	0.10937	0.0267	L	0.28014	0.82	0.09310	N	1	B	0.20164	0.042	B	0.25506	0.061	T	0.23691	-1.0181	10	0.46703	T	0.11	0.7482	5.084	0.14673	0.261:0.1517:0.5873:0.0	.	1481	Q8N2Y8	RUSC2_HUMAN	A	1481	ENSP00000355177:G1481A;ENSP00000393922:G1481A	ENSP00000355177:G1481A	G	+	2	0	RUSC2	35551270	0.918000	0.31147	0.022000	0.16811	0.895000	0.52256	2.248000	0.43160	0.314000	0.23086	0.650000	0.86243	GGA		0.652	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462		3	49	0	0	0	0.004672	0	3	49				
TLN1	7094	broad.mit.edu	37	9	35707217	35707217	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:35707217C>T	ENST00000314888.9	-	37	5160	c.4807G>A	c.(4807-4809)Gcc>Acc	p.A1603T	TLN1_ENST00000464379.1_Intron|TLN1_ENST00000540444.1_Missense_Mutation_p.A1603T	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1603	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.A1603T(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATTGTCTTGGCAGAGATCACA	0.642																																							uc003zxt.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13						c.(4807-4809)GCC>ACC		talin 1							42.0	49.0	47.0					9																	35707217		2203	4300	6503	SO:0001583	missense	7094				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding	g.chr9:35707217C>T	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4807G>A	9.37:g.35707217C>T	ENSP00000316029:p.Ala1603Thr		Somatic					p.A1603T	NM_006289	NP_006280	WXS	Illumina HiSeq	Unspecified	Q9Y490	TLN1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		37	5161	-	all_epithelial(49;0.167)		1603			Interaction with SYNM.		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	c.4807G>A	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555639	0.86231	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.14893	2.47;2.47	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	M	0.82630	2.6	0.80722	D	1	P	0.45827	0.867	B	0.42112	0.376	T	0.24941	-1.0146	10	0.62326	D	0.03	-14.3733	19.7999	0.96502	0.0:1.0:0.0:0.0	.	1603	Q9Y490	TLN1_HUMAN	T	1603	ENSP00000316029:A1603T;ENSP00000442981:A1603T	ENSP00000316029:A1603T	A	-	1	0	TLN1	35697217	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.810000	0.86072	2.691000	0.91804	0.561000	0.74099	GCC		0.642	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		34	26	0	0	0	0.006999	0	34	26				
NPR2	4882	broad.mit.edu	37	9	35794089	35794089	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:35794089G>C	ENST00000342694.2	+	2	1117	c.862G>C	c.(862-864)Gag>Cag	p.E288Q		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	288					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.E288Q(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ggccctcagagaggcctttca	0.577																																							uc003zyd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|stomach(1)	3						c.(862-864)GAG>CAG		natriuretic peptide receptor B precursor	Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)						26.0	29.0	28.0					9																	35794089		2202	4300	6502	SO:0001583	missense	4882				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity	g.chr9:35794089G>C	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.862G>C	9.37:g.35794089G>C	ENSP00000341083:p.Glu288Gln		Somatic				NPR2_uc010mlb.2_Missense_Mutation_p.E288Q	p.E288Q	NM_003995	NP_003986	WXS	Illumina HiSeq	Unspecified	P20594	ANPRB_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		2	862	+	all_epithelial(49;0.161)		288			Extracellular (Potential).		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	c.862G>C	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839995	0.32513	.	.	ENSG00000159899	ENST00000342694	D	0.83837	-1.77	4.11	2.16	0.27623	Extracellular ligand-binding receptor (1);	0.175410	0.27266	N	0.020142	T	0.66479	0.2793	N	0.17838	0.53	0.31137	N	0.707016	P;B	0.36789	0.57;0.391	B;B	0.32211	0.142;0.083	T	0.62595	-0.6821	10	0.11182	T	0.66	.	13.406	0.60913	0.0:0.2593:0.7407:0.0	.	288;288	P20594-2;P20594	.;ANPRB_HUMAN	Q	288	ENSP00000341083:E288Q	ENSP00000341083:E288Q	E	+	1	0	NPR2	35784089	0.979000	0.34478	1.000000	0.80357	0.999000	0.98932	0.876000	0.28092	0.441000	0.26529	0.655000	0.94253	GAG		0.577	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1			3	40	0	0	0	0.004672	0	3	40				
GNAQ	2776	broad.mit.edu	37	9	80430572	80430572	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:80430572C>G	ENST00000286548.4	-	3	658	c.436G>C	c.(436-438)Gat>Cat	p.D146H	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	146					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.D146H(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CGTCGTCTATCATAGCATTCC	0.388			Mis		uveal melanoma																																		uc004akw.2		NA		Dom	yes		9	9q21	2776	Mis	"""guanine nucleotide binding protein (G protein), q polypeptide"""			E			uveal melanoma		1	Substitution - Missense(1)		lung(1)	eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193						c.(436-438)GAT>CAT		guanine nucleotide binding protein (G protein),							125.0	112.0	116.0					9																	80430572		2203	4298	6501	SO:0001583	missense	2776				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	g.chr9:80430572C>G		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.436G>C	9.37:g.80430572C>G	ENSP00000286548:p.Asp146His		Somatic				GNAQ_uc011lso.1_5'UTR	p.D146H	NM_002072	NP_002063	WXS	Illumina HiSeq	Unspecified	P50148	GNAQ_HUMAN			3	477	-			146					O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	37	c.436G>C	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.851637	0.71719	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.89123	-2.47;-2.47	6.01	6.01	0.97437	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.91476	0.7309	M	0.85462	2.755	0.80722	D	1	B	0.14438	0.01	B	0.23018	0.043	D	0.87631	0.2516	10	0.72032	D	0.01	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	146	P50148	GNAQ_HUMAN	H	146;117	ENSP00000286548:D146H;ENSP00000391501:D117H	ENSP00000286548:D146H	D	-	1	0	GNAQ	79620392	1.000000	0.71417	0.870000	0.34147	0.992000	0.81027	6.076000	0.71267	2.861000	0.98227	0.650000	0.86243	GAT		0.388	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072		3	49	0	0	0	0.009096	0	3	49				
TGFBR1	7046	broad.mit.edu	37	9	101908883	101908883	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:101908883C>T	ENST00000374994.4	+	7	1364	c.1247C>T	c.(1246-1248)tCc>tTc	p.S416F	TGFBR1_ENST00000374990.2_Missense_Mutation_p.S339F|TGFBR1_ENST00000552516.1_Missense_Mutation_p.S420F|TGFBR1_ENST00000550253.1_Missense_Mutation_p.S347F|RNA5SP290_ENST00000517133.1_RNA	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	416	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S416F(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CGACGATGTTCCATTGGTGGT	0.373																																							uc004azc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1246-1248)TCC>TTC		transforming growth factor, beta receptor I							258.0	255.0	256.0					9																	101908883		2203	4300	6503	SO:0001583	missense	7046				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding	g.chr9:101908883C>T		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1247C>T	9.37:g.101908883C>T	ENSP00000364133:p.Ser416Phe		Somatic				TGFBR1_uc004azd.2_Missense_Mutation_p.S339F|TGFBR1_uc011lvc.1_Missense_Mutation_p.S347F	p.S416F	NM_004612	NP_004603	WXS	Illumina HiSeq	Unspecified	P36897	TGFR1_HUMAN			7	1323	+		Acute lymphoblastic leukemia(62;0.0559)	416			Protein kinase.|Cytoplasmic (Potential).		Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	c.1247C>T	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265476	0.59431	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	5.33	5.33	0.75918	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90321	0.6972	L	0.55990	1.75	0.80722	D	1	P;B	0.42827	0.791;0.144	B;B	0.37731	0.257;0.089	D	0.88611	0.3156	10	0.10377	T	0.69	.	18.167	0.89731	0.0:1.0:0.0:0.0	.	339;416	P36897-3;P36897	.;TGFR1_HUMAN	F	416;378;339;420;347	ENSP00000364133:S416F;ENSP00000364129:S339F;ENSP00000447297:S420F;ENSP00000450052:S347F	ENSP00000364129:S339F	S	+	2	0	TGFBR1	100948704	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.798000	0.62510	2.651000	0.90000	0.467000	0.42956	TCC		0.373	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3			12	376	0	0	0	0.003163	0	12	376				
GRIN3A	116443	broad.mit.edu	37	9	104357089	104357090	+	Intron	DNP	TC	TC	AT			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:104357089_104357090TC>AT	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.S42C	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.S42C(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCCTCCACGCTCAGAGACCCTG	0.55																																							uc004bbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(121-126)CTGAGC>CTATGC		protein phosphatase 3 regulatory subunit B, beta	Cyclosporine(DB00091)																																			SO:0001627	intron_variant	5535						calcium ion binding	g.chr9:104357089_104357090TC>AT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767_2767delinsAT	9.37:g.104357089_104357090delinsAT			Somatic				GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_Intron	p.S42C	NM_147180	NP_671709	WXS	Illumina HiSeq	Unspecified	Q96LZ3	CANB2_HUMAN			1	194_195	-		Acute lymphoblastic leukemia(62;0.0527)	39			EF-hand 1.|1.		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	DNP	ENST00000361820.3	37	c.123_124GA>AT	CCDS6758.1																																																																																				0.550	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			63	98	0	0	0	0.004672	0	63	98				
OR13C8	138802	broad.mit.edu	37	9	107332060	107332060	+	Silent	SNP	G	G	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:107332060G>C	ENST00000335040.1	+	1	612	c.612G>C	c.(610-612)ctG>ctC	p.L204L		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L204L(3)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						GGTCGAATCTGATTGTTCTGG	0.353																																							uc011lvo.1		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)|skin(1)	2						c.(610-612)CTG>CTC		olfactory receptor, family 13, subfamily C,							224.0	217.0	219.0					9																	107332060		2203	4300	6503	SO:0001819	synonymous_variant	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107332060G>C		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.612G>C	9.37:g.107332060G>C			Somatic					p.L204L	NM_001004483	NP_001004483	WXS	Illumina HiSeq	Unspecified	Q8NGS7	O13C8_HUMAN			1	612	+			204			Helical; Name=5; (Potential).		Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	c.612G>C	CCDS35090.1																																																																																				0.353	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			6	204	0	0	0	0.001984	0	6	204				
OR13C8	138802	broad.mit.edu	37	9	107332126	107332126	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:107332126G>A	ENST00000335040.1	+	1	678	c.678G>A	c.(676-678)ctG>ctA	p.L226L		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L226L(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						CCACTATTCTGAGGATTCCTT	0.398																																							uc011lvo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(676-678)CTG>CTA		olfactory receptor, family 13, subfamily C,							151.0	147.0	148.0					9																	107332126		2203	4300	6503	SO:0001819	synonymous_variant	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107332126G>A		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.678G>A	9.37:g.107332126G>A			Somatic					p.L226L	NM_001004483	NP_001004483	WXS	Illumina HiSeq	Unspecified	Q8NGS7	O13C8_HUMAN			1	678	+			226			Cytoplasmic (Potential).		Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	c.678G>A	CCDS35090.1																																																																																				0.398	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			7	142	0	0	0	0.001984	0	7	142				
OR13C8	138802	broad.mit.edu	37	9	107332309	107332309	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:107332309G>A	ENST00000335040.1	+	1	861	c.861G>A	c.(859-861)atG>atA	p.M287I		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M287I(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						ATGGAGTGATGACTCCCATGC	0.413																																							uc011lvo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(859-861)ATG>ATA		olfactory receptor, family 13, subfamily C,							93.0	83.0	86.0					9																	107332309		2203	4300	6503	SO:0001583	missense	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107332309G>A		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.861G>A	9.37:g.107332309G>A	ENSP00000334068:p.Met287Ile		Somatic					p.M287I	NM_001004483	NP_001004483	WXS	Illumina HiSeq	Unspecified	Q8NGS7	O13C8_HUMAN			1	861	+			287			Helical; Name=7; (Potential).		Q5VVG0|Q96R44	Missense_Mutation	SNP	ENST00000335040.1	37	c.861G>A	CCDS35090.1	.	.	.	.	.	.	.	.	.	.	G	9.963	1.223434	0.22457	.	.	ENSG00000186943	ENST00000335040	T	0.00026	8.94	4.9	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	0.437153	0.22536	N	0.058789	T	0.00039	0.0001	N	0.01809	-0.71	0.29336	N	0.866343	B	0.14805	0.011	B	0.15870	0.014	T	0.00335	-1.1808	10	0.34782	T	0.22	.	7.7435	0.28856	0.0873:0.0:0.7502:0.1625	.	287	Q8NGS7	O13C8_HUMAN	I	287	ENSP00000334068:M287I	ENSP00000334068:M287I	M	+	3	0	OR13C8	106372130	0.002000	0.14202	0.306000	0.25113	0.945000	0.59286	0.131000	0.15870	0.733000	0.32492	0.561000	0.74099	ATG		0.413	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			7	100	0	0	0	0.00308	0	7	100				
OR13C9	286362	broad.mit.edu	37	9	107379953	107379953	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:107379953G>A	ENST00000259362.1	-	1	532	c.533C>T	c.(532-534)tCa>tTa	p.S178L		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S178L(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						AATTTCACATGAGAAATGATT	0.438																																							uc011lvr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(532-534)TCA>TTA		olfactory receptor, family 13, subfamily C,							128.0	107.0	114.0					9																	107379953		2203	4300	6503	SO:0001583	missense	286362				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107379953G>A		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.533C>T	9.37:g.107379953G>A	ENSP00000259362:p.Ser178Leu		Somatic					p.S178L	NM_001001956	NP_001001956	WXS	Illumina HiSeq	Unspecified	Q8NGT0	O13C9_HUMAN			1	533	-			178			Extracellular (Potential).		Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	c.533C>T	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	G	9.740	1.164682	0.21538	.	.	ENSG00000136839	ENST00000259362	T	0.00039	8.85	4.51	0.354	0.16063	GPCR, rhodopsin-like superfamily (1);	1.125910	0.06848	N	0.796917	T	0.00073	0.0002	N	0.04705	-0.18	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.01679	-1.1297	10	0.11485	T	0.65	.	4.143	0.10203	0.2833:0.3436:0.373:0.0	.	178	Q8NGT0	O13C9_HUMAN	L	178	ENSP00000259362:S178L	ENSP00000259362:S178L	S	-	2	0	OR13C9	106419774	0.000000	0.05858	0.104000	0.21259	0.958000	0.62258	0.405000	0.21015	0.178000	0.19917	0.643000	0.83706	TCA		0.438	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1			5	141	0	0	0	0.000602	0	5	141				
EPB41L4B	54566	broad.mit.edu	37	9	112015721	112015721	+	Splice_Site	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:112015721C>G	ENST00000374566.3	-	12	1796	c.1279G>C	c.(1279-1281)Gca>Cca	p.A427P	EPB41L4B_ENST00000374557.4_Splice_Site_p.A427P	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	427					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)	p.A427P(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AACACACAACCTTTGAACGTT	0.428																																							uc004bdz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1279-1281)GCA>CCA		erythrocyte membrane protein band 4.1 like 4B							155.0	152.0	153.0					9																	112015721		1872	4111	5983	SO:0001630	splice_region_variant	54566					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton	g.chr9:112015721C>G	AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1279+1G>C	9.37:g.112015721C>G			Somatic				EPB41L4B_uc004bea.2_Missense_Mutation_p.A427P	p.A427P	NM_019114	NP_061987	WXS	Illumina HiSeq	Unspecified	Q9H329	E41LB_HUMAN			12	1574	-			427					Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	37	c.1279G>C	CCDS43859.1	.	.	.	.	.	.	.	.	.	.	C	32	5.179295	0.94846	.	.	ENSG00000095203	ENST00000262536;ENST00000374566;ENST00000374557;ENST00000311609	D;D	0.84298	-1.83;-1.83	5.5	5.5	0.81552	.	0.000000	0.39615	N	0.001306	D	0.85496	0.5710	L	0.27053	0.805	0.80722	D	1	B;D	0.69078	0.042;0.997	B;P	0.56088	0.07;0.791	D	0.83786	0.0228	9	.	.	.	.	19.7739	0.96383	0.0:1.0:0.0:0.0	.	427;427	Q9H329-2;Q9H329	.;E41LB_HUMAN	P	112;427;427;349	ENSP00000363694:A427P;ENSP00000363685:A427P	.	A	-	1	0	EPB41L4B	111055542	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.782000	0.68973	2.744000	0.94065	0.655000	0.94253	GCA		0.428	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	Missense_Mutation	18	111	0	0	0	0.008871	0	18	111				
LMX1B	4010	broad.mit.edu	37	9	129453345	129453345	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:129453345C>G	ENST00000373474.4	+	3	564	c.557C>G	c.(556-558)tCc>tGc	p.S186C	LMX1B_ENST00000526117.1_Missense_Mutation_p.S186C|LMX1B_ENST00000355497.5_Missense_Mutation_p.S186C|LMX1B_ENST00000561065.1_Missense_Mutation_p.S163C|LMX1B_ENST00000425646.2_Missense_Mutation_p.S163C			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	186					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S186C(1)|p.S163C(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						GAGTCCGACTCCGGTGAGGCC	0.667									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)	Pancreas(110;1796 2278 18357 20466)	uc004bqj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(487-489)TCC>TGC		LIM homeobox transcription factor 1, beta							34.0	28.0	30.0					9																	129453345		2197	4299	6496	SO:0001583	missense	4010	Nail-Patella_Syndrome	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:129453345C>G	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.557C>G	9.37:g.129453345C>G	ENSP00000362573:p.Ser186Cys		Somatic				LMX1B_uc004bqi.2_Missense_Mutation_p.S163C|LMX1B_uc011maa.1_Missense_Mutation_p.S163C	p.S163C	NM_002316	NP_002307	WXS	Illumina HiSeq	Unspecified	O60663	LMX1B_HUMAN			3	538	+			163					F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	c.488C>G	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034881	0.75617	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	T;T;D;T	0.87650	-1.26;-1.26;-2.28;-1.26	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.92361	0.7576	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.94;0.987;0.997	D	0.91589	0.5285	10	0.36615	T	0.2	.	17.0706	0.86572	0.0:1.0:0.0:0.0	.	163;163;186	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	C	186;186;186;163	ENSP00000436930:S186C;ENSP00000362573:S186C;ENSP00000347684:S186C;ENSP00000390923:S163C	ENSP00000347684:S186C	S	+	2	0	LMX1B	128493166	1.000000	0.71417	0.975000	0.42487	0.515000	0.34225	5.970000	0.70431	2.243000	0.73865	0.491000	0.48974	TCC		0.667	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2			4	23	0	0	0	0.009096	0	4	23				
NOTCH1	4851	broad.mit.edu	37	9	139400074	139400074	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr9:139400074C>A	ENST00000277541.6	-	25	4349	c.4274G>T	c.(4273-4275)tGc>tTc	p.C1425F		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1425	EGF-like 36. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C1426F(1)|p.C1425F(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CAGGATGTGGCACAAGAGCCC	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(4273-4275)TGC>TTC		notch1 preproprotein							20.0	25.0	23.0					9																	139400074		1948	4128	6076	SO:0001583	missense	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139400074C>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.4274G>T	9.37:g.139400074C>A	ENSP00000277541:p.Cys1425Phe	HNSCC(8;0.001)	Somatic				NOTCH1_uc004cia.1_Missense_Mutation_p.C655F	p.C1425F	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	25	4274	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	1425			Extracellular (Potential).|EGF-like 36.		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.4274G>T	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275831	0.80580	.	.	ENSG00000148400	ENST00000277541	D	0.90069	-2.61	4.45	4.45	0.53987	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.96399	0.8825	H	0.97186	3.955	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.98054	1.0389	10	0.87932	D	0	.	16.0817	0.81010	0.0:1.0:0.0:0.0	.	1425	P46531	NOTC1_HUMAN	F	1425	ENSP00000277541:C1425F	ENSP00000277541:C1425F	C	-	2	0	NOTCH1	138519895	1.000000	0.71417	0.999000	0.59377	0.822000	0.46500	7.330000	0.79181	2.013000	0.59113	0.579000	0.79373	TGC		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		9	21	1	0	1.58986e-06	0.008291	1.85102e-06	9	21				
PHKA2	5256	broad.mit.edu	37	X	18924680	18924680	+	Silent	SNP	C	C	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:18924680C>G	ENST00000379942.4	-	25	3404	c.2739G>C	c.(2737-2739)ctG>ctC	p.L913L		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	913					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.L913L(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TCCGGAGTCTCAGCATCTCCA	0.587																																							uc004cyv.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2737-2739)CTG>CTC		phosphorylase kinase, alpha 2 (liver)							105.0	94.0	98.0					X																	18924680		2203	4300	6503	SO:0001819	synonymous_variant	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18924680C>G		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2739G>C	X.37:g.18924680C>G			Somatic				PHKA2_uc004cyu.3_Silent_p.L211L|PHKA2_uc010nfe.1_5'Flank|PHKA2_uc010nff.1_5'Flank	p.L913L	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			25	3169	-	Hepatocellular(33;0.183)		913					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	ENST00000379942.4	37	c.2739G>C	CCDS14190.1																																																																																				0.587	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		3	91	0	0	0	0.004672	0	3	91				
CXorf22	170063	broad.mit.edu	37	X	35988982	35988982	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:35988982T>C	ENST00000297866.5	+	11	1978	c.1912T>C	c.(1912-1914)Tat>Cat	p.Y638H		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	638								p.Y638H(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TGAAAACTATTATGCAATGTA	0.318																																							uc004ddj.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|ovary(1)	3						c.(1912-1914)TAT>CAT		hypothetical protein LOC170063							37.0	34.0	35.0					X																	35988982		2202	4292	6494	SO:0001583	missense	170063							g.chrX:35988982T>C	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1912T>C	X.37:g.35988982T>C	ENSP00000297866:p.Tyr638His		Somatic				CXorf22_uc010ngv.2_RNA	p.Y638H	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			11	1971	+			638					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.1912T>C	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	14.95	2.687688	0.48097	.	.	ENSG00000165164	ENST00000297866	T	0.24723	1.84	5.0	5.0	0.66597	.	0.068238	0.64402	D	0.000011	T	0.47838	0.1467	M	0.78049	2.395	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.41538	-0.9503	10	0.27082	T	0.32	-28.012	10.1216	0.42623	0.0:0.0:0.0:1.0	.	638	Q6ZTR5	CX022_HUMAN	H	638	ENSP00000297866:Y638H	ENSP00000297866:Y638H	Y	+	1	0	CXorf22	35898903	1.000000	0.71417	0.013000	0.15412	0.004000	0.04260	4.674000	0.61612	1.656000	0.50722	0.477000	0.44152	TAT		0.318	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		9	2	0	0	0	0.010729	0	9	2				
DCAF12L2	340578	broad.mit.edu	37	X	125299513	125299513	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:125299513C>A	ENST00000360028.2	-	1	421	c.395G>T	c.(394-396)cGc>cTc	p.R132L	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.R132L			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	132								p.R132L(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GAGGGGGATGCGCGTGATGTG	0.637																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(394-396)CGC>CTC		DDB1 and CUL4 associated factor 12-like 2							87.0	81.0	83.0					X																	125299513		2203	4300	6503	SO:0001583	missense	340578							g.chrX:125299513C>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.395G>T	X.37:g.125299513C>A	ENSP00000353128:p.Arg132Leu		Somatic					p.R132L	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	422	-			132					B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.395G>T	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	c	3.401	-0.122314	0.06795	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.37752	1.18;1.18	3.89	-2.93	0.05598	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.27765	0.0683	L	0.48642	1.525	0.09310	N	1	P	0.37276	0.589	B	0.35182	0.197	T	0.10314	-1.0635	9	0.39692	T	0.17	.	10.1894	0.43017	0.0:0.2684:0.0:0.7316	.	132	Q5VW00	DC122_HUMAN	L	132	ENSP00000441489:R132L;ENSP00000353128:R132L	ENSP00000353128:R132L	R	-	2	0	DCAF12L2	125127194	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	1.508000	0.35769	-0.994000	0.03463	-0.302000	0.09304	CGC		0.637	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		4	90	1	0	0.00116845	0.001168	0.00132227	4	90				
DCAF12L1	139170	broad.mit.edu	37	X	125685236	125685236	+	Silent	SNP	T	T	G			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:125685236T>G	ENST00000371126.1	-	1	1598	c.1356A>C	c.(1354-1356)gcA>gcC	p.A452A		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	452								p.A452A(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CATGGAGGCCTGCAGGGAGAG	0.547																																							uc004eul.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(1354-1356)GCA>GCC		DDB1 and CUL4 associated factor 12-like 1							71.0	73.0	72.0					X																	125685236		2203	4300	6503	SO:0001819	synonymous_variant	139170							g.chrX:125685236T>G	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1356A>C	X.37:g.125685236T>G			Somatic					p.A452A	NM_178470	NP_848565	WXS	Illumina HiSeq	Unspecified	Q5VU92	DC121_HUMAN			1	1607	-			452					Q8IYK3	Silent	SNP	ENST00000371126.1	37	c.1356A>C	CCDS14610.1																																																																																				0.547	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		4	65	0	0	0	0.000602	0	4	65				
LDOC1	23641	broad.mit.edu	37	X	140270933	140270933	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:140270933G>A	ENST00000370526.2	-	1	377	c.274C>T	c.(274-276)Cta>Tta	p.L92L	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	92					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)		p.L92L(1)		endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					AGGCTGATTAGGAATGCCACC	0.582																																							uc004fbj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(274-276)CTA>TTA		leucine zipper, down-regulated in cancer 1							147.0	120.0	130.0					X																	140270933		2203	4300	6503	SO:0001819	synonymous_variant	23641				negative regulation of cell proliferation	nucleus	protein binding	g.chrX:140270933G>A	AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.274C>T	X.37:g.140270933G>A			Somatic					p.L92L	NM_012317	NP_036449	WXS	Illumina HiSeq	Unspecified	O95751	LDOC1_HUMAN			1	378	-	Acute lymphoblastic leukemia(192;7.65e-05)		92					Q6IAR6	Silent	SNP	ENST00000370526.2	37	c.274C>T	CCDS14672.1																																																																																				0.582	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317		4	109	0	0	0	0.001168	0	4	109				
HCFC1	3054	broad.mit.edu	37	X	153223608	153223608	+	Silent	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrX:153223608G>A	ENST00000310441.7	-	11	2862	c.1896C>T	c.(1894-1896)atC>atT	p.I632I	HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000369984.4_Silent_p.I632I|HCFC1_ENST00000354233.3_Silent_p.I563I	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	632	Interaction with SIN3A.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.I632I(1)|p.I535I(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCACTGTGATGATAGGGCGGG	0.612																																							uc004fjp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1894-1896)ATC>ATT		host cell factor 1							80.0	83.0	82.0					X																	153223608		2174	4249	6423	SO:0001819	synonymous_variant	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153223608G>A		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1896C>T	X.37:g.153223608G>A			Somatic					p.I632I	NM_005334	NP_005325	WXS	Illumina HiSeq	Unspecified	P51610	HCFC1_HUMAN			11	2424	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		632			Interaction with SIN3A.		Q6P4G5	Silent	SNP	ENST00000310441.7	37	c.1896C>T	CCDS44020.1																																																																																				0.612	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		7	30	0	0	0	0.008291	0	7	30				
UTY	7404	broad.mit.edu	37	Y	15372253	15372253	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chrY:15372253G>A	ENST00000331397.4	-	26	4758	c.3751C>T	c.(3751-3753)Cag>Tag	p.Q1251*	UTY_ENST00000537580.1_Nonsense_Mutation_p.Q1172*|UTY_ENST00000382896.4_Nonsense_Mutation_p.Q1296*	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	1251					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)	p.Q1251*(2)		kidney(1)|lung(6)	7						CTCAATGTCTGATATTGCTTC	0.363																																					Colon(103;1740 2135 40732 45171)	Colon(103;1740 2135 40732 45171)	uc004fsx.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(3751-3753)CAG>TAG		tetratricopeptide repeat protein isoform 3							87.0	87.0	87.0					Y																	15372253		611	1953	2564	SO:0001587	stop_gained	7404				chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chrY:15372253G>A	AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.3751C>T	Y.37:g.15372253G>A	ENSP00000328939:p.Gln1251*		Somatic				UTY_uc004fsw.1_Nonsense_Mutation_p.Q914*|UTY_uc010nwx.1_Nonsense_Mutation_p.Q308*	p.Q1251*	NM_007125	NP_009056	WXS	Illumina HiSeq	Unspecified	O14607	UTY_HUMAN			26	4756	-			1251					A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Nonsense_Mutation	SNP	ENST00000331397.4	37	c.3751C>T	CCDS14783.1																																																																																				0.363	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088394.1	NM_182660		11	54	0	0	0	0.010729	0	11	54				
SYT11	23208	broad.mit.edu	37	1	155851017	155851018	+	Frame_Shift_Del	DEL	CG	CG	-	rs574258732		TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:155851017_155851018delCG	ENST00000368324.4	+	4	1267_1268	c.1014_1015delCG	c.(1012-1017)tacggcfs	p.YG338fs	SYT11_ENST00000539162.1_Frame_Shift_Del_p.YG31fs	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	338	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			ACGTCTACTACGGCAGAAAGCG	0.455																																							uc001fmg.2		NA																	0				ovary(1)|skin(1)	2						c.(1012-1017)TACGGCfs		synaptotagmin XI																																				SO:0001589	frameshift_variant	23208					cell junction|synaptic vesicle membrane	protein binding|transporter activity	g.chr1:155851017_155851018delCG	D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.1014_1015delCG	1.37:g.155851017_155851018delCG	ENSP00000357307:p.Tyr338fs		Somatic				SYT11_uc010pgq.1_Frame_Shift_Del_p.Y31fs	p.Y338fs	NM_152280	NP_689493	WXS	Illumina HiSeq	Unspecified	Q9BT88	SYT11_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.000162)		4	1277_1278	+	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		338_339			C2 2.|Cytoplasmic (Potential).		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Frame_Shift_Del	DEL	ENST00000368324.4	37	c.1014_1015delCG	CCDS1122.1																																																																																				0.455	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280		10	765	NA	NA	NA	NA	NA	10	765	---	---	---	---
NES	10763	broad.mit.edu	37	1	156646400	156646403	+	Frame_Shift_Del	DEL	GCGG	GCGG	-			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	GCGG	GCGG	-	-	GCGG	GCGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr1:156646400_156646403delGCGG	ENST00000368223.3	-	1	786_789	c.654_657delCCGC	c.(652-657)gcccgcfs	p.AR218fs		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	218	Coil 2B.|Rod.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCGGCCCTCGCGGGCACCCTGCA	0.755																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(652-657)GCCCGCfs		nestin																																				SO:0001589	frameshift_variant	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156646400_156646403delGCGG	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.654_657delCCGC	1.37:g.156646400_156646403delGCGG	ENSP00000357206:p.Ala218fs		Somatic					p.A218fs	NM_006617	NP_006608	WXS	Illumina HiSeq	Unspecified	P48681	NEST_HUMAN			1	787_790	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		218_219			Coil 2B.|Rod.		O00552|Q3LIF5|Q5SYZ6	Frame_Shift_Del	DEL	ENST00000368223.3	37	c.654_657delCCGC	CCDS1151.1																																																																																				0.755	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		6	12	NA	NA	NA	NA	NA	6	12	---	---	---	---
POLR2C	5432	broad.mit.edu	37	16	57503120	57503121	+	Frame_Shift_Ins	INS	-	-	A			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr16:57503120_57503121insA	ENST00000219252.5	+	5	640_641	c.302_303insA	c.(301-306)ttcaccfs	p.FT101fs	POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	101					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						TCGGTGGAGTTCACCCTCGATG	0.589																																							uc002elt.1		NA																	0					0						c.(301-303)TTCfs		DNA directed RNA polymerase II polypeptide C																																				SO:0001589	frameshift_variant	5432				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr16:57503120_57503121insA		CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	Exception_encountered	16.37:g.57503120_57503121insA	ENSP00000219252:p.Phe101fs		Somatic				POLR2C_uc010vhq.1_Frame_Shift_Ins_p.F101fs	p.F101fs	NM_032940	NP_116558	WXS	Illumina HiSeq	Unspecified	P19387	RPB3_HUMAN			5	388_389	+			101					O15161	Frame_Shift_Ins	INS	ENST00000219252.5	37	c.302_303insA	CCDS10782.1																																																																																				0.589	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940		42	104	NA	NA	NA	NA	NA	42	104	---	---	---	---
DOT1L	84444	broad.mit.edu	37	19	2210737	2210737	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:2210737delG	ENST00000398665.3	+	14	1270	c.1234delG	c.(1234-1236)gggfs	p.G412fs	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	412	Required for interaction with nucleosomes and DNA.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCAAGCGCGGGCGCCCCAA	0.607																																							uc002lvb.3		NA																	0				pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4						c.(1234-1236)GGGfs		DOT1-like, histone H3 methyltransferase							60.0	74.0	70.0					19																	2210737		1990	4149	6139	SO:0001589	frameshift_variant	84444					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr19:2210737delG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1234delG	19.37:g.2210737delG	ENSP00000381657:p.Gly412fs		Somatic				DOT1L_uc002lvc.1_5'Flank	p.G412fs	NM_032482	NP_115871	WXS	Illumina HiSeq	Unspecified	Q8TEK3	DOT1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	14	1270	+		Hepatocellular(1079;0.137)	412			Required for interaction with nucleosomes and DNA.		O60379|Q96JL1	Frame_Shift_Del	DEL	ENST00000398665.3	37	c.1234delG	CCDS42460.1																																																																																				0.607	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482		16	113	NA	NA	NA	NA	NA	16	113	---	---	---	---
SIGLEC5	8778	broad.mit.edu	37	19	52130914	52130914	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr19:52130914delG	ENST00000534261.2	-	7	1482	c.1083delC	c.(1081-1083)cccfs	p.P361fs	SIGLEC5_ENST00000429354.3_Frame_Shift_Del_p.P361fs|SIGLEC5_ENST00000570106.2_Frame_Shift_Del_p.P361fs|SIGLEC5_ENST00000222107.4_Frame_Shift_Del_p.P361fs|SIGLEC5_ENST00000599649.1_Frame_Shift_Del_p.P361fs			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	361					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		AGCACAGGGAGGGGGCCGGCC	0.677																																							uc002pxe.2		NA																	0				skin(2)|breast(1)|central_nervous_system(1)	4						c.(1081-1083)CCCfs		sialic acid binding Ig-like lectin 5 precursor							11.0	14.0	13.0					19																	52130914		2191	4289	6480	SO:0001589	frameshift_variant	8778				cell adhesion	integral to membrane	sugar binding	g.chr19:52130914delG	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1083delC	19.37:g.52130914delG	ENSP00000473238:p.Pro361fs		Somatic					p.P361fs	NM_003830	NP_003821	WXS	Illumina HiSeq	Unspecified	O15389	SIGL5_HUMAN		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)	6	1222	-		all_neural(266;0.0726)	361			Extracellular (Potential).			Frame_Shift_Del	DEL	ENST00000534261.2	37	c.1083delC	CCDS33088.1																																																																																				0.677	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830		10	15	NA	NA	NA	NA	NA	10	15	---	---	---	---
SH3D19	152503	broad.mit.edu	37	4	152096011	152096011	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4486-01A-01D-1265-08	TCGA-49-4486-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3ac132c3-4889-4dc3-8b3d-0ef98065a858	ee2aab05-2f1d-406d-834c-f1b011b7b6eb	g.chr4:152096011delG	ENST00000409252.2	-	6	1212	c.505delC	c.(505-507)cgafs	p.R169fs	SH3D19_ENST00000427414.2_Frame_Shift_Del_p.R169fs|SH3D19_ENST00000409598.4_Frame_Shift_Del_p.R169fs|SH3D19_ENST00000604030.1_5'Flank|SH3D19_ENST00000514152.1_Frame_Shift_Del_p.R169fs|SH3D19_ENST00000304527.4_Frame_Shift_Del_p.R169fs|SH3D19_ENST00000424281.1_Frame_Shift_Del_p.R169fs|SH3D19_ENST00000455740.1_Frame_Shift_Del_p.R169fs			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	169	Pro-rich.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)	p.R166R(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCTGCGAGTCGGGGAGGAACA	0.582																																							uc010ipl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(505-507)CGAfs		SH3 domain containing 19 isoform a							161.0	177.0	171.0					4																	152096011		2203	4300	6503	SO:0001589	frameshift_variant	152503				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding	g.chr4:152096011delG	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.505delC	4.37:g.152096011delG	ENSP00000386848:p.Arg169fs		Somatic				SH3D19_uc003imc.2_Frame_Shift_Del_p.R169fs|SH3D19_uc003ime.2_Frame_Shift_Del_p.R169fs|SH3D19_uc010ipm.2_Frame_Shift_Del_p.R169fs	p.R169fs	NM_001009555	NP_001009555	WXS	Illumina HiSeq	Unspecified	Q5HYK7	SH319_HUMAN			7	1595	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)	169			Pro-rich.		B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Frame_Shift_Del	DEL	ENST00000409252.2	37	c.505delC	CCDS34077.2																																																																																				0.582	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555		179	321	NA	NA	NA	NA	NA	179	321	---	---	---	---
