#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ACTRT2	140625	broad.mit.edu	37	1	2939237	2939237	+	Silent	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:2939237C>A	ENST00000378404.2	+	1	1192	c.987C>A	c.(985-987)atC>atA	p.I329I		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	329						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.I329I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		ACACCCCCATCAAGATCACGG	0.622																																							uc001ajz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(985-987)ATC>ATA		actin-related protein M2							59.0	66.0	63.0					1																	2939237		2203	4300	6503	SO:0001819	synonymous_variant	140625					cytoplasm|cytoskeleton		g.chr1:2939237C>A	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.987C>A	1.37:g.2939237C>A			Somatic					p.I329I	NM_080431	NP_536356	WXS	Illumina HiSeq	Unspecified	Q8TDY3	ACTT2_HUMAN		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)	1	1192	+	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	329					B1AN52|Q8NHS6|Q8TDG1	Silent	SNP	ENST00000378404.2	37	c.987C>A	CCDS45.1																																																																																				0.622	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431		25	78	1	0	3.78316e-11	0.00623	5.06249e-11	25	78				
CSMD2	114784	broad.mit.edu	37	1	34286094	34286094	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:34286094C>T	ENST00000373381.4	-	8	1351	c.1175G>A	c.(1174-1176)gGc>gAc	p.G392D		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	352	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G352D(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TAGTCTTTTGCCCCTTTCGGG	0.463																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(1054-1056)GGC>GAC		CUB and Sushi multiple domains 2							191.0	188.0	189.0					1																	34286094		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34286094C>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1175G>A	1.37:g.34286094C>T	ENSP00000362479:p.Gly392Asp		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.G392D	p.G352D	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			8	1084	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	352			Extracellular (Potential).|Sushi 2.		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37	c.1055G>A		.	.	.	.	.	.	.	.	.	.	C	29.3	4.994802	0.93167	.	.	ENSG00000121904	ENST00000373381	T	0.70164	-0.46	5.66	5.66	0.87406	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.90369	0.6986	H	0.99859	4.855	0.80722	D	1	D;P	0.57571	0.98;0.661	P;B	0.62740	0.906;0.375	D	0.94637	0.7827	10	0.87932	D	0	.	18.7321	0.91739	0.0:1.0:0.0:0.0	.	352;392	Q7Z408;E7EUA6	CSMD2_HUMAN;.	D	392	ENSP00000362479:G392D	ENSP00000241312:G352D	G	-	2	0	CSMD2	34058681	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.796000	0.85898	2.669000	0.90835	0.655000	0.94253	GGC		0.463	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		5	352	0	0	0	0.001168	0	5	352				
RLF	6018	broad.mit.edu	37	1	40701712	40701712	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:40701712G>A	ENST00000372771.4	+	8	1365	c.1338G>A	c.(1336-1338)ccG>ccA	p.P446P		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	446					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P446P(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AAAATGCACCGGTTCCAAATT	0.373																																							uc001cfc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1336-1338)CCG>CCA		rearranged L-myc fusion							84.0	96.0	92.0					1																	40701712		2202	4300	6502	SO:0001819	synonymous_variant	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40701712G>A		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1338G>A	1.37:g.40701712G>A			Somatic				RLF_uc001cfd.3_Silent_p.P137P	p.P446P	NM_012421	NP_036553	WXS	Illumina HiSeq	Unspecified	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		8	1369	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	446					Q14CQ1|Q9NU60	Silent	SNP	ENST00000372771.4	37	c.1338G>A	CCDS448.1																																																																																				0.373	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		4	165	0	0	0	0.009096	0	4	165				
ELTD1	64123	broad.mit.edu	37	1	79357333	79357333	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:79357333G>A	ENST00000370742.3	-	14	1949	c.1886C>T	c.(1885-1887)aCc>aTc	p.T629I		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	629					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.T629I(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GATCCAGGTGGTGCCGAGAAG	0.463																																							uc001diq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1885-1887)ACC>ATC		EGF, latrophilin and seven transmembrane domain							64.0	65.0	64.0					1																	79357333		1972	4144	6116	SO:0001583	missense	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79357333G>A	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1886C>T	1.37:g.79357333G>A	ENSP00000359778:p.Thr629Ile		Somatic					p.T629I	NM_022159	NP_071442	WXS	Illumina HiSeq	Unspecified	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	14	2042	-			629			Helical; Name=6; (Potential).		B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	c.1886C>T	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.218176	0.39201	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	T;T	0.35421	1.31;1.31	5.59	5.59	0.84812	GPCR, family 2-like (1);	0.185125	0.48767	D	0.000172	T	0.05868	0.0153	N	0.01446	-0.86	0.32566	N	0.530391	B	0.17852	0.024	B	0.23419	0.046	T	0.24368	-1.0162	9	.	.	.	.	12.8706	0.57962	0.0745:0.0:0.9255:0.0	.	629	Q9HBW9	ELTD1_HUMAN	I	629;87	ENSP00000359778:T629I;ENSP00000383813:T87I	.	T	-	2	0	ELTD1	79129921	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	5.720000	0.68470	2.612000	0.88384	0.655000	0.94253	ACC		0.463	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159		7	33	0	0	0	0.006214	0	7	33				
DNTTIP2	30836	broad.mit.edu	37	1	94342195	94342195	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:94342195G>A	ENST00000436063.2	-	2	1353	c.1296C>T	c.(1294-1296)aaC>aaT	p.N432N	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.N432N(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		CCTGAGATGTGTTGGGCGCAG	0.388																																							uc001dqf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1294-1296)AAC>AAT		deoxynucleotidyltransferase, terminal,							226.0	218.0	221.0					1																	94342195		1970	4159	6129	SO:0001819	synonymous_variant	30836				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr1:94342195G>A	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1296C>T	1.37:g.94342195G>A			Somatic				DNTTIP2_uc010otm.1_RNA|DNTTIP2_uc009wdo.1_Silent_p.N227N	p.N432N	NM_014597	NP_055412	WXS	Illumina HiSeq	Unspecified	Q5QJE6	TDIF2_HUMAN		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)	2	1334	-		all_lung(203;0.0111)|Lung NSC(277;0.0347)	432					Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Silent	SNP	ENST00000436063.2	37	c.1296C>T	CCDS44174.1																																																																																				0.388	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597		56	226	0	0	0	0.01441	0	56	226				
COL11A1	1301	broad.mit.edu	37	1	103352528	103352528	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:103352528C>A	ENST00000370096.3	-	63	5005	c.4693G>T	c.(4693-4695)Gca>Tca	p.A1565S	COL11A1_ENST00000358392.2_Missense_Mutation_p.A1577S|COL11A1_ENST00000353414.4_Missense_Mutation_p.A1526S|COL11A1_ENST00000512756.1_Missense_Mutation_p.A1449S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1565					cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.A1565S(1)|p.A1577S(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTATCATCTGCATCTGCTTGC	0.393																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4693-4695)GCA>TCA		alpha 1 type XI collagen isoform A							190.0	175.0	180.0					1																	103352528		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103352528C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4693G>T	1.37:g.103352528C>A	ENSP00000359114:p.Ala1565Ser		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.A761S|COL11A1_uc001dum.2_Missense_Mutation_p.A1577S|COL11A1_uc001dun.2_Missense_Mutation_p.A1526S|COL11A1_uc009weh.2_Missense_Mutation_p.A1449S	p.A1565S	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	63	5011	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1565					B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.4693G>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.677555	0.47886	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	5.53	4.62	0.57501	.	0.371673	0.30101	N	0.010412	T	0.64023	0.2561	L	0.36672	1.1	0.50039	D	0.999848	B;B;B;B;B	0.33171	0.131;0.206;0.4;0.278;0.073	B;B;B;B;B	0.30855	0.039;0.085;0.121;0.057;0.059	T	0.65307	-0.6200	10	0.10377	T	0.69	.	14.3092	0.66405	0.0:0.9285:0.0:0.0715	.	1449;1526;1577;1565;785	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1565;1577;1526;785;1449	ENSP00000359114:A1565S;ENSP00000351163:A1577S;ENSP00000302551:A1526S;ENSP00000426533:A1449S	ENSP00000302551:A1526S	A	-	1	0	COL11A1	103125116	1.000000	0.71417	0.976000	0.42696	0.979000	0.70002	3.354000	0.52254	1.349000	0.45751	0.313000	0.20887	GCA		0.393	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		16	92	1	0	1.5739e-10	0.004007	2.05646e-10	16	92				
NTRK1	4914	broad.mit.edu	37	1	156849038	156849038	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:156849038C>A	ENST00000524377.1	+	15	1971	c.1930C>A	c.(1930-1932)Ctg>Atg	p.L644M	NTRK1_ENST00000368196.3_Missense_Mutation_p.L638M|NTRK1_ENST00000358660.3_Missense_Mutation_p.L641M|NTRK1_ENST00000392302.2_Missense_Mutation_p.L608M	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	644	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L608M(1)|p.L644M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CCTGGCGGGTCTGCATTTTGT	0.632			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													uc001fqh.1		NA		Dom	yes		1	1q21-q22	4914	T	"""neurotrophic tyrosine kinase, receptor, type 1"""			E	TPM3|TPR|TFG		papillary thyroid		2	Substitution - Missense(2)		lung(2)	lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17						c.(1930-1932)CTG>ATG		neurotrophic tyrosine kinase, receptor, type 1	Imatinib(DB00619)						57.0	52.0	53.0					1																	156849038		2203	4300	6503	SO:0001583	missense	4914				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr1:156849038C>A	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1930C>A	1.37:g.156849038C>A	ENSP00000431418:p.Leu644Met	TSP Lung(10;0.080)	Somatic				NTRK1_uc001fqf.1_Missense_Mutation_p.L608M|NTRK1_uc009wsi.1_Missense_Mutation_p.L343M|NTRK1_uc001fqi.1_Missense_Mutation_p.L638M|NTRK1_uc009wsk.1_Missense_Mutation_p.L641M	p.L644M	NM_002529	NP_002520	WXS	Illumina HiSeq	Unspecified	P04629	NTRK1_HUMAN			15	1986	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		644			Cytoplasmic (Potential).|Protein kinase.		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	c.1930C>A	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253903	0.59212	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	4.37	2.48	0.30137	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.369966	0.19487	N	0.113074	T	0.76018	0.3929	N	0.20685	0.6	0.54753	D	0.999988	B;B;D;D	0.76494	0.278;0.219;0.999;0.994	B;B;D;D	0.72338	0.375;0.131;0.977;0.963	T	0.77346	-0.2622	10	0.62326	D	0.03	.	8.9266	0.35643	0.0:0.8162:0.0:0.1838	.	641;638;644;608	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	M	608;638;644;641	ENSP00000376120:L608M;ENSP00000357179:L638M;ENSP00000431418:L644M;ENSP00000351486:L641M	ENSP00000351486:L641M	L	+	1	2	NTRK1	155115662	0.999000	0.42202	0.566000	0.28421	0.922000	0.55478	4.757000	0.62213	0.593000	0.29745	0.561000	0.74099	CTG		0.632	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529		13	38	1	0	0.00136819	0.013537	0.00146328	13	38				
CD1A	909	broad.mit.edu	37	1	158226831	158226831	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:158226831G>T	ENST00000289429.5	+	4	1393	c.860G>T	c.(859-861)gGc>gTc	p.G287V		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	287	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)		p.G287V(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	AGTCTAGAGGGCCAGGACATC	0.592																																							uc001frt.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(859-861)GGC>GTC		CD1A antigen precursor	Antithymocyte globulin(DB00098)						69.0	65.0	66.0					1																	158226831		2203	4300	6503	SO:0001583	missense	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158226831G>T	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.860G>T	1.37:g.158226831G>T	ENSP00000289429:p.Gly287Val		Somatic					p.G287V	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			4	1393	+	all_hematologic(112;0.0378)		287			Extracellular (Potential).|Ig-like.		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	c.860G>T	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	-	10.94	1.491976	0.26774	.	.	ENSG00000158477	ENST00000289429	T	0.14766	2.48	3.84	-5.15	0.02866	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (1);	0.402896	0.18428	N	0.141526	T	0.16938	0.0407	M	0.86953	2.85	0.09310	N	0.999999	D	0.67145	0.996	D	0.69307	0.963	T	0.01428	-1.1357	10	0.87932	D	0	-5.1518	5.9912	0.19465	0.6011:0.0:0.2563:0.1425	.	287	P06126	CD1A_HUMAN	V	287	ENSP00000289429:G287V	ENSP00000289429:G287V	G	+	2	0	CD1A	156493455	0.000000	0.05858	0.002000	0.10522	0.148000	0.21650	-0.869000	0.04232	-1.406000	0.02045	0.491000	0.48974	GGC		0.592	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763		32	72	1	0	2.49991e-28	0.003271	4.19683e-28	32	72				
SEC16B	89866	broad.mit.edu	37	1	177911130	177911130	+	Missense_Mutation	SNP	C	C	T	rs139593986	byFrequency	TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:177911130C>T	ENST00000308284.6	-	16	2016	c.1927G>A	c.(1927-1929)Gtg>Atg	p.V643M	RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	643					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.V644M(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GCCTGGGACACGAGGCCATAA	0.512													C|||	4	0.000798722	0.0	0.0	5008	,	,		19584	0.004		0.0	False		,,,				2504	0.0						uc001gli.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1927-1929)GTG>ATG		leucine zipper transcription regulator 2		C	MET/VAL	1,3925		0,1,1962	74.0	72.0	73.0		1927	-0.4	0.0	1	dbSNP_134	73	0,8306		0,0,4153	yes	missense	SEC16B	NM_033127.2	21	0,1,6115	TT,TC,CC		0.0,0.0255,0.0082	benign	643/1061	177911130	1,12231	1963	4153	6116	SO:0001583	missense	89866				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		g.chr1:177911130C>T	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1927G>A	1.37:g.177911130C>T	ENSP00000308339:p.Val643Met		Somatic				SEC16B_uc001glk.1_Missense_Mutation_p.V320M|SEC16B_uc009wwy.1_Missense_Mutation_p.V198M|SEC16B_uc001glh.1_Missense_Mutation_p.V302M|SEC16B_uc009wwz.1_Missense_Mutation_p.V302M|SEC16B_uc001glj.1_Missense_Mutation_p.V644M	p.V643M	NM_033127	NP_149118	WXS	Illumina HiSeq	Unspecified	Q96JE7	SC16B_HUMAN			16	2017	-			643					A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	c.1927G>A	CCDS44281.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	16.33	3.091661	0.55968	2.55E-4	0.0	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.15372	2.43	5.66	-0.394	0.12434	.	1.126930	0.06486	N	0.733772	T	0.20333	0.0489	L	0.43923	1.385	0.09310	N	1	P;D;P;D	0.69078	0.908;0.997;0.464;0.997	P;P;B;P	0.51833	0.458;0.681;0.136;0.681	T	0.21586	-1.0241	10	0.44086	T	0.13	-0.1273	4.5441	0.12073	0.0:0.2937:0.1771:0.5292	.	198;644;643;340	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	M	643;327;358	ENSP00000308339:V643M	ENSP00000239472:V358M	V	-	1	0	AL359075.1	176177753	0.000000	0.05858	0.005000	0.12908	0.995000	0.86356	0.011000	0.13264	0.008000	0.14787	0.655000	0.94253	GTG		0.512	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		23	44	0	0	0	0.00278	0	23	44				
TOR1AIP2	163590	broad.mit.edu	37	1	179820234	179820234	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:179820234C>A	ENST00000367612.3	-	4	686	c.299G>T	c.(298-300)gGg>gTg	p.G100V	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.G100V	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0								p.G100V(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						GAGGTGATGCCCTTTTCCGCC	0.458																																							uc001gnk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(298-300)GGG>GTG		torsin A interacting protein 2							101.0	87.0	92.0					1																	179820234		2203	4300	6503	SO:0001583	missense	163590					endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:179820234C>A		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.299G>T	1.37:g.179820234C>A	ENSP00000356584:p.Gly100Val		Somatic				TOR1AIP2_uc001gnl.2_Missense_Mutation_p.G100V	p.G100V	NM_145034	NP_659471	WXS	Illumina HiSeq	Unspecified	Q8NFQ8	TOIP2_HUMAN			4	687	-			100					Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	c.299G>T	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627583	0.66901	.	.	ENSG00000169905	ENST00000367612	T	0.24908	1.83	5.79	0.536	0.17138	.	0.413281	0.20590	N	0.089372	T	0.27594	0.0678	L	0.51422	1.61	0.09310	N	0.999992	D	0.54772	0.968	P	0.52909	0.713	T	0.08351	-1.0726	10	0.41790	T	0.15	-0.5124	4.6105	0.12401	0.0:0.5153:0.152:0.3326	.	100	Q8NFQ8	TOIP2_HUMAN	V	100	ENSP00000356584:G100V	ENSP00000356584:G100V	G	-	2	0	TOR1AIP2	178086857	0.004000	0.15560	0.000000	0.03702	0.435000	0.31806	1.222000	0.32515	0.098000	0.17522	0.655000	0.94253	GGG		0.458	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034		43	105	1	0	4.16155e-14	0.00874	5.85151e-14	43	105				
CACNA1E	777	broad.mit.edu	37	1	181745281	181745281	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:181745281C>A	ENST00000367573.2	+	38	5184	c.5184C>A	c.(5182-5184)taC>taA	p.Y1728*	CACNA1E_ENST00000526775.1_Nonsense_Mutation_p.Y1709*|CACNA1E_ENST00000360108.3_Nonsense_Mutation_p.Y1709*|CACNA1E_ENST00000358338.5_Nonsense_Mutation_p.Y1660*|CACNA1E_ENST00000357570.5_Nonsense_Mutation_p.Y1679*|CACNA1E_ENST00000367567.4_Nonsense_Mutation_p.Y1335*|CACNA1E_ENST00000367570.1_Nonsense_Mutation_p.Y1728*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1728					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.Y1728*(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACTTTGAGTACCTGACTCGGG	0.567																																							uc001gow.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(5182-5184)TAC>TAA		calcium channel, voltage-dependent, R type,							193.0	197.0	196.0					1																	181745281		2026	4203	6229	SO:0001587	stop_gained	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181745281C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5184C>A	1.37:g.181745281C>A	ENSP00000356545:p.Tyr1728*		Somatic				CACNA1E_uc009wxs.2_Nonsense_Mutation_p.Y1616*|CACNA1E_uc001gox.1_Nonsense_Mutation_p.Y954*|CACNA1E_uc009wxt.2_Nonsense_Mutation_p.Y954*	p.Y1728*	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			38	5349	+			1728			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Nonsense_Mutation	SNP	ENST00000367573.2	37	c.5184C>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	52	19.341278	0.99918	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.83	2.98	0.34508	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6653	0.45726	0.0:0.7925:0.0:0.2075	.	.	.	.	X	1728;1709;1679;1660;1335;1709;1728	.	ENSP00000350183:Y1679X	Y	+	3	2	CACNA1E	180011904	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.111000	0.50360	0.395000	0.25257	-0.136000	0.14681	TAC		0.567	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		40	252	1	0	9.9191e-30	0.00874	1.68564e-29	40	252				
CRB1	23418	broad.mit.edu	37	1	197390454	197390454	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:197390454G>T	ENST00000367400.3	+	6	1631	c.1496G>T	c.(1495-1497)gGc>gTc	p.G499V	CRB1_ENST00000367399.2_Missense_Mutation_p.G387V|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000538660.1_Missense_Mutation_p.G499V|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.G430V|CRB1_ENST00000543483.1_Missense_Mutation_p.G198V|CRB1_ENST00000544212.1_5'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	499	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G499V(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GTCAAAAGTGGCTCAGTGACA	0.502																																							uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(1495-1497)GGC>GTC		crumbs homolog 1 precursor							107.0	99.0	102.0					1																	197390454		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197390454G>T		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1496G>T	1.37:g.197390454G>T	ENSP00000356370:p.Gly499Val		Somatic				CRB1_uc010poz.1_Missense_Mutation_p.G430V|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.G387V|CRB1_uc010ppb.1_Missense_Mutation_p.G499V|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.G148V	p.G499V	NM_201253	NP_957705	WXS	Illumina HiSeq	Unspecified	P82279	CRUM1_HUMAN			6	1631	+			499			Extracellular (Potential).|Laminin G-like 1.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.1496G>T	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	4.456	0.084393	0.08583	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000367401	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.56	-3.0	0.05480	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.81669	0.4871	M	0.68317	2.08	0.09310	N	0.999999	D;P;D;B;P	0.55800	0.958;0.765;0.973;0.078;0.827	P;P;P;B;B	0.59825	0.757;0.545;0.864;0.079;0.322	T	0.70163	-0.4947	9	0.27785	T	0.31	.	4.7606	0.13106	0.3946:0.1098:0.4151:0.0805	.	499;430;387;148;499	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	V	430;499;499;387;198;148	ENSP00000438786:G430V;ENSP00000438091:G499V;ENSP00000356370:G499V;ENSP00000356369:G387V;ENSP00000439579:G198V	ENSP00000356369:G387V	G	+	2	0	CRB1	195657077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.154000	0.10130	-0.406000	0.07588	-0.143000	0.13931	GGC		0.502	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		32	54	1	0	8.4185e-14	0.012213	1.17774e-13	32	54				
TMEM9	252839	broad.mit.edu	37	1	201120964	201120964	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:201120964C>T	ENST00000367330.1	-	2	599	c.83G>A	c.(82-84)cGg>cAg	p.R28Q	TMEM9_ENST00000485839.2_Missense_Mutation_p.R28Q|TMEM9_ENST00000367333.2_Missense_Mutation_p.R28Q|TMEM9_ENST00000367332.1_Missense_Mutation_p.R31Q|TMEM9_ENST00000367334.5_Missense_Mutation_p.R28Q			Q9P0T7	TMEM9_HUMAN	transmembrane protein 9	28					transport (GO:0006810)	integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)		p.R28Q(1)		liver(1)|lung(1)|stomach(1)	3		Breast(1374;0.000301)				GCATTTGCACCGGATATCTTC	0.488																																							uc001gvw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(82-84)CGG>CAG		transmembrane protein 9 precursor							178.0	171.0	173.0					1																	201120964		2203	4300	6503	SO:0001583	missense	252839				transport	integral to membrane|late endosome membrane|lysosomal membrane		g.chr1:201120964C>T		CCDS1408.1, CCDS73001.1	1q41	2008-02-05			ENSG00000116857	ENSG00000116857			18823	protein-coding gene	gene with protein product							Standard	NM_001288565		Approved	TMEM9A	uc001gvy.3	Q9P0T7	OTTHUMG00000035831	ENST00000367330.1:c.83G>A	1.37:g.201120964C>T	ENSP00000356299:p.Arg28Gln		Somatic				TMEM9_uc001gvx.2_Missense_Mutation_p.R28Q|TMEM9_uc001gvy.2_Missense_Mutation_p.R28Q|TMEM9_uc010ppo.1_Missense_Mutation_p.R53Q|TMEM9_uc001gvz.2_Missense_Mutation_p.R31Q|TMEM9_uc001gwa.2_Missense_Mutation_p.R28Q|TMEM9_uc010ppp.1_Missense_Mutation_p.R28Q	p.R28Q	NM_016456	NP_057540	WXS	Illumina HiSeq	Unspecified	Q9P0T7	TMEM9_HUMAN			3	405	-		Breast(1374;0.000301)	28			Extracellular (Potential).		B1ALM6|Q96NQ9|Q9BQF5	Missense_Mutation	SNP	ENST00000367330.1	37	c.83G>A	CCDS1408.1	.	.	.	.	.	.	.	.	.	.	C	34	5.349035	0.95807	.	.	ENSG00000116857	ENST00000367334;ENST00000367332;ENST00000367330;ENST00000367329;ENST00000367333;ENST00000455367;ENST00000435310;ENST00000414605	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.78641	0.4315	M	0.66297	2.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.997;0.997	D;D;D;D	0.83275	0.984;0.996;0.968;0.968	T	0.80046	-0.1546	9	0.87932	D	0	-26.3394	17.9237	0.88976	0.0:1.0:0.0:0.0	.	28;53;31;28	B4DJZ4;B4E1H4;B1ALM5;Q9P0T7	.;.;.;TMEM9_HUMAN	Q	28;31;28;28;31;28;28;53	.	ENSP00000356298:R28Q	R	-	2	0	TMEM9	199387587	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.500000	0.81588	2.663000	0.90544	0.563000	0.77884	CGG		0.488	TMEM9-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087160.1	NM_016456		13	212	0	0	0	0.004007	0	13	212				
PLEKHA6	22874	broad.mit.edu	37	1	204237400	204237400	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:204237400C>T	ENST00000272203.3	-	4	459	c.143G>A	c.(142-144)cGc>cAc	p.R48H	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.R48H	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	48								p.R48H(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGAGTGTGAGCGCTTGCCAAA	0.612																																							uc001hau.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(142-144)CGC>CAC		phosphoinositol 3-phosphate-binding protein-3							113.0	94.0	100.0					1																	204237400		2203	4300	6503	SO:0001583	missense	22874							g.chr1:204237400C>T	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.143G>A	1.37:g.204237400C>T	ENSP00000272203:p.Arg48His		Somatic					p.R48H	NM_014935	NP_055750	WXS	Illumina HiSeq	Unspecified	Q9Y2H5	PKHA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)		4	460	-	all_cancers(21;0.0222)|Breast(84;0.179)		48					A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	c.143G>A	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195625	0.94960	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.14391	2.51;2.51	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	M	0.84683	2.71	0.58432	D	0.999999	D	0.67145	0.996	D	0.70487	0.969	T	0.46693	-0.9173	10	0.87932	D	0	-22.5876	19.3649	0.94458	0.0:1.0:0.0:0.0	.	48	Q9Y2H5	PKHA6_HUMAN	H	48	ENSP00000272203:R48H;ENSP00000402046:R48H	ENSP00000272203:R48H	R	-	2	0	PLEKHA6	202504023	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.452000	0.73485	2.659000	0.90383	0.655000	0.94253	CGC		0.612	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935		25	57	0	0	0	0.004656	0	25	57				
C1orf95	375057	broad.mit.edu	37	1	226784558	226784558	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:226784558C>G	ENST00000366788.3	+	2	363	c.258C>G	c.(256-258)gaC>gaG	p.D86E	C1orf95_ENST00000366789.4_Missense_Mutation_p.D86E	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	86						integral component of membrane (GO:0016021)		p.D86E(1)		large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		ACCTCCCGGACAGGCATGTGT	0.612																																							uc010pvn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(256-258)GAC>GAG		hypothetical protein LOC375057							143.0	130.0	134.0					1																	226784558		2203	4300	6503	SO:0001583	missense	375057					integral to membrane		g.chr1:226784558C>G	AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.258C>G	1.37:g.226784558C>G	ENSP00000355752:p.Asp86Glu		Somatic					p.D86E	NM_001003665	NP_001003665	WXS	Illumina HiSeq	Unspecified	Q69YW2	CA095_HUMAN		GBM - Glioblastoma multiforme(131;0.113)	2	363	+	Breast(184;0.133)	Prostate(94;0.0885)	86					A6NGL2	Missense_Mutation	SNP	ENST00000366788.3	37	c.258C>G	CCDS31044.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414470	0.42817	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	5.68	4.76	0.60689	.	0.061993	0.64402	D	0.000005	T	0.34861	0.0912	N	0.04880	-0.145	0.44862	D	0.997871	B	0.16603	0.018	B	0.23716	0.048	T	0.18524	-1.0334	9	0.12430	T	0.62	-9.0E-4	13.7352	0.62813	0.0:0.9254:0.0:0.0746	.	86	Q69YW2	CA095_HUMAN	E	86	.	ENSP00000355752:D86E	D	+	3	2	C1orf95	224851181	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.206000	0.51098	2.669000	0.90835	0.561000	0.74099	GAC		0.612	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665		6	242	0	0	0	0.004482	0	6	242				
OBSCN	84033	broad.mit.edu	37	1	228565299	228565299	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:228565299A>G	ENST00000422127.1	+	102	23433	c.23389A>G	c.(23389-23391)Atg>Gtg	p.M7797V	OBSCN_ENST00000366707.4_Missense_Mutation_p.M5431V|OBSCN_ENST00000570156.2_Missense_Mutation_p.M8754V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7797	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.M8379V(1)|p.M8509V(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTCCGAGAACATGATCATCAC	0.552																																							uc009xez.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(23389-23391)ATG>GTG		obscurin, cytoskeletal calmodulin and							94.0	97.0	96.0					1																	228565299		2183	4280	6463	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228565299A>G	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.23389A>G	1.37:g.228565299A>G	ENSP00000409493:p.Met7797Val		Somatic				OBSCN_uc001hsr.1_Missense_Mutation_p.M2426V	p.M7797V	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			102	23433	+		Prostate(94;0.0405)	7797			Protein kinase 2.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.23389A>G	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.04|12.04	1.818493|1.818493	0.32145|0.32145	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000422127;ENST00000366707	.|T;T	.|0.33654	.|1.4;1.4	5.14|5.14	-0.0725|-0.0725	0.13739|0.13739	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|.	.|.	.|.	.|.	T|T	0.17280|0.17280	0.0415|0.0415	N|N	0.10809|0.10809	0.05|0.05	0.80722|0.80722	D|D	1|1	.|B	.|0.28128	.|0.201	.|B	.|0.24701	.|0.055	T|T	0.04495|0.04495	-1.0947|-1.0947	5|9	.|0.54805	.|T	.|0.06	.|.	7.0821|7.0821	0.25237|0.25237	0.5187:0.2458:0.0:0.2355|0.5187:0.2458:0.0:0.2355	.|.	.|7797	.|Q5VST9	.|OBSCN_HUMAN	R|V	2413|7797;5431	.|ENSP00000409493:M7797V;ENSP00000355668:M5431V	.|ENSP00000355668:M5431V	H|M	+|+	2|1	0|0	OBSCN|OBSCN	226631922|226631922	1.000000|1.000000	0.71417|0.71417	0.847000|0.847000	0.33407|0.33407	0.040000|0.040000	0.13550|0.13550	1.621000|1.621000	0.36986|0.36986	-0.277000|-0.277000	0.09193|0.09193	-0.991000|-0.991000	0.02546|0.02546	CAT|ATG		0.552	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		13	62	0	0	0	0.013537	0	13	62				
TRIM67	440730	broad.mit.edu	37	1	231349585	231349585	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:231349585G>A	ENST00000366653.5	+	9	2148	c.2148G>A	c.(2146-2148)ggG>ggA	p.G716G	TRIM67_ENST00000366652.2_Silent_p.G716G|TRIM67_ENST00000444294.3_Silent_p.G714G|TRIM67_ENST00000449018.3_Silent_p.G654G			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	716	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.G716G(2)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TGTGCAAGGGGGCCACCGTGG	0.592																																							uc009xfn.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|breast(1)|kidney(1)	4						c.(2146-2148)GGG>GGA		tripartite motif-containing 67							100.0	109.0	106.0					1																	231349585		2079	4207	6286	SO:0001819	synonymous_variant	440730					cytoplasm|cytoskeleton	zinc ion binding	g.chr1:231349585G>A	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2148G>A	1.37:g.231349585G>A			Somatic					p.G716G	NM_001004342	NP_001004342	WXS	Illumina HiSeq	Unspecified	Q6ZTA4	TRI67_HUMAN			9	2190	+	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)	716			B30.2/SPRY.		Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	37	c.2148G>A	CCDS44333.1																																																																																				0.592	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342		24	158	0	0	0	0.010818	0	24	158				
PCNXL2	80003	broad.mit.edu	37	1	233344406	233344406	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:233344406T>A	ENST00000258229.9	-	13	2955	c.2721A>T	c.(2719-2721)agA>agT	p.R907S	PCNXL2_ENST00000488780.2_Missense_Mutation_p.R40S|PCNXL2_ENST00000430153.1_Missense_Mutation_p.R206S	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	907						integral component of membrane (GO:0016021)		p.R907S(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AATAGATTGGTCTGCTATATG	0.398																																							uc001hvl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(2719-2721)AGA>AGT		pecanex-like 2							125.0	119.0	121.0					1																	233344406		1885	4110	5995	SO:0001583	missense	80003					integral to membrane		g.chr1:233344406T>A	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2721A>T	1.37:g.233344406T>A	ENSP00000258229:p.Arg907Ser		Somatic				PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA|PCNXL2_uc001hvq.1_Missense_Mutation_p.R206S	p.R907S	NM_014801	NP_055616	WXS	Illumina HiSeq	Unspecified	A6NKB5	PCX2_HUMAN			13	2956	-		all_cancers(173;0.0347)|Prostate(94;0.137)	907			Helical; (Potential).		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.2721A>T	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.374747	0.82573	.	.	ENSG00000135749	ENST00000258229;ENST00000488780;ENST00000518351;ENST00000430153	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.6	4.48	0.54585	.	.	.	.	.	D	0.89164	0.6637	M	0.85197	2.74	0.47819	D	0.999527	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.89081	0.3476	9	0.87932	D	0	.	9.2201	0.37370	0.0:0.1448:0.0:0.8552	.	206;907	A6NKB5-2;A6NKB5	.;PCX2_HUMAN	S	907;40;76;206	ENSP00000258229:R907S;ENSP00000430820:R40S;ENSP00000429231:R76S;ENSP00000394703:R206S	ENSP00000258229:R907S	R	-	3	2	PCNXL2	231411029	0.993000	0.37304	1.000000	0.80357	0.980000	0.70556	0.215000	0.17562	0.964000	0.38108	0.533000	0.62120	AGA		0.398	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		12	65	0	0	0	0.003163	0	12	65				
RYR2	6262	broad.mit.edu	37	1	237813354	237813354	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:237813354G>T	ENST00000366574.2	+	50	8007	c.7690G>T	c.(7690-7692)Gct>Tct	p.A2564S	RYR2_ENST00000360064.6_Missense_Mutation_p.A2562S|RYR2_ENST00000542537.1_Missense_Mutation_p.A2548S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2564	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A2562S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACTTACCAAAGCTCAGCGGGA	0.403																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(7690-7692)GCT>TCT		cardiac muscle ryanodine receptor							194.0	186.0	188.0					1																	237813354		1906	4130	6036	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237813354G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7690G>T	1.37:g.237813354G>T	ENSP00000355533:p.Ala2564Ser		Somatic					p.A2564S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		50	7810	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2564			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.7690G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	33	5.274685	0.95459	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93076	-3.16;-3.16;-3.16	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000006	D	0.96166	0.8750	M	0.70903	2.155	0.80722	D	1	D	0.71674	0.998	D	0.63597	0.916	D	0.95425	0.8511	10	0.48119	T	0.1	-12.851	19.9299	0.97115	0.0:0.0:1.0:0.0	.	2564	Q92736	RYR2_HUMAN	S	2564;2562;2548	ENSP00000355533:A2564S;ENSP00000353174:A2562S;ENSP00000443798:A2548S	ENSP00000353174:A2562S	A	+	1	0	RYR2	235879977	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.809000	0.99208	2.769000	0.95229	0.655000	0.94253	GCT		0.403	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		56	171	1	0	3.00063e-23	0.01441	4.88926e-23	56	171				
FMN2	56776	broad.mit.edu	37	1	240371509	240371509	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:240371509C>A	ENST00000319653.9	+	5	3627	c.3397C>A	c.(3397-3399)Ccc>Acc	p.P1133T		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1133	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1276T(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ACCCCCTCCTCCCCCTCTTCC	0.716																																							uc010pyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(3397-3399)CCC>ACC		formin 2							7.0	8.0	7.0					1																	240371509		2087	4107	6194	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240371509C>A	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3397C>A	1.37:g.240371509C>A	ENSP00000318884:p.Pro1133Thr		Somatic				FMN2_uc010pye.1_Missense_Mutation_p.P1137T	p.P1133T	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	3622	+	Ovarian(103;0.127)	all_cancers(173;0.013)	1133			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.3397C>A	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	c	4.114	0.019309	0.08006	.	.	ENSG00000155816	ENST00000319653	T	0.65364	-0.15	3.08	2.15	0.27550	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (3);	0.411905	0.19906	U	0.103419	T	0.58250	0.2109	M	0.80982	2.52	0.09310	N	0.999991	P	0.38300	0.626	B	0.37650	0.255	T	0.53940	-0.8367	9	.	.	.	.	4.5827	0.12266	0.0:0.6391:0.2279:0.133	.	1133	Q9NZ56	FMN2_HUMAN	T	1133	ENSP00000318884:P1133T	.	P	+	1	0	FMN2	238438132	0.079000	0.21365	0.003000	0.11579	0.002000	0.02628	2.323000	0.43823	0.619000	0.30197	0.471000	0.43371	CCC		0.716	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		6	15	1	0	5.18039e-06	0.00308	6.00405e-06	6	15				
FAM208B	54906	broad.mit.edu	37	10	5777379	5777379	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr10:5777379G>A	ENST00000328090.5	+	12	1942	c.1317G>A	c.(1315-1317)agG>agA	p.R439R	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	439								p.R439R(1)									AAAGGGCAAGGAAACAAGAGA	0.388																																							uc001iij.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1315-1317)AGG>AGA		hypothetical protein LOC54906							129.0	126.0	127.0					10																	5777379		1837	4089	5926	SO:0001819	synonymous_variant	54906							g.chr10:5777379G>A	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.1317G>A	10.37:g.5777379G>A			Somatic				C10orf18_uc001iik.2_Intron	p.R439R	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			12	1942	+			439					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	37	c.1317G>A	CCDS41485.1																																																																																				0.388	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		5	214	0	0	0	0.000602	0	5	214				
C10orf53	282966	broad.mit.edu	37	10	50916423	50916423	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr10:50916423T>A	ENST00000374112.3	+	3	246	c.234T>A	c.(232-234)agT>agA	p.S78R	C10orf53_ENST00000535836.1_Missense_Mutation_p.S78R	NM_182554.2	NP_872360.2	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	81								p.S78R(1)		endometrium(1)|lung(6)	7		all_neural(218;0.107)				tcaccccaagtagtgacaaga	0.483																																							uc001jid.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(232-234)AGT>AGA		chromosome 10 open reading frame 53 isoform a							96.0	84.0	88.0					10																	50916423		2203	4300	6503	SO:0001583	missense	282966							g.chr10:50916423T>A	BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374112.3:c.234T>A	10.37:g.50916423T>A	ENSP00000363226:p.Ser78Arg		Somatic					p.S78R	NM_182554	NP_872360	WXS	Illumina HiSeq	Unspecified	Q8N6V4	CJ053_HUMAN			3	294	+		all_neural(218;0.107)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NI81|A6NLE0|B9ZVK6	Missense_Mutation	SNP	ENST00000374112.3	37	c.234T>A	CCDS31202.1	.	.	.	.	.	.	.	.	.	.	T	8.703	0.910313	0.17833	.	.	ENSG00000178645	ENST00000374112;ENST00000535836	.	.	.	1.92	-3.51	0.04696	.	2.855670	0.03088	N	0.159328	T	0.23054	0.0557	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19844	-1.0293	9	0.38643	T	0.18	.	8.0849	0.30767	0.0:0.0:0.6881:0.3119	.	78	B9ZVK6	.	R	78	.	ENSP00000363226:S78R	S	+	3	2	C10orf53	50586429	0.006000	0.16342	0.002000	0.10522	0.064000	0.16182	-1.229000	0.02945	-0.800000	0.04433	0.397000	0.26171	AGT		0.483	C10orf53-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048006.1	NM_182554		31	83	0	0	0	0.010818	0	31	83				
UNC5B	219699	broad.mit.edu	37	10	73056384	73056384	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr10:73056384G>C	ENST00000335350.6	+	15	2791	c.2375G>C	c.(2374-2376)tGc>tCc	p.C792S	UNC5B_ENST00000373192.4_Missense_Mutation_p.C781S	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	792	UPA domain. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.C792S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCCCTCCACTGCACTTTCACC	0.612																																							uc001jro.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(2374-2376)TGC>TCC		unc-5 homolog B precursor							58.0	50.0	53.0					10																	73056384		2203	4300	6503	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73056384G>C	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2375G>C	10.37:g.73056384G>C	ENSP00000334329:p.Cys792Ser		Somatic				UNC5B_uc001jrp.2_Missense_Mutation_p.C781S	p.C792S	NM_170744	NP_734465	WXS	Illumina HiSeq	Unspecified	Q8IZJ1	UNC5B_HUMAN			15	2820	+			792			Cytoplasmic (Potential).		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.2375G>C	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916218	0.92249	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.57752	0.43;0.38	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.76644	0.4016	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79878	-0.1617	10	0.56958	D	0.05	-31.6229	18.7967	0.91997	0.0:0.0:1.0:0.0	.	781;792	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	S	792;781	ENSP00000334329:C792S;ENSP00000362288:C781S	ENSP00000334329:C792S	C	+	2	0	UNC5B	72726390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.444000	0.82710	0.561000	0.74099	TGC		0.612	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		3	34	0	0	0	0.001168	0	3	34				
TNKS2	80351	broad.mit.edu	37	10	93576936	93576936	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr10:93576936G>T	ENST00000371627.4	+	3	849	c.470G>T	c.(469-471)gGa>gTa	p.G157V		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	157					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.G157V(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				AATACAGATGGAAGGACAGCA	0.408																																							uc001khp.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(3)|skin(3)|ovary(1)|lung(1)	8						c.(469-471)GGA>GTA		tankyrase, TRF1-interacting ankyrin-related							97.0	78.0	84.0					10																	93576936		2203	4300	6503	SO:0001583	missense	80351				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr10:93576936G>T	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.470G>T	10.37:g.93576936G>T	ENSP00000360689:p.Gly157Val		Somatic					p.G157V	NM_025235	NP_079511	WXS	Illumina HiSeq	Unspecified	Q9H2K2	TNKS2_HUMAN			3	767	+		Colorectal(252;0.162)	157					B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	c.470G>T	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179229	0.94846	.	.	ENSG00000107854	ENST00000371627	T	0.26373	1.74	5.69	5.69	0.88448	Ankyrin repeat-containing domain (3);	0.000000	0.52532	D	0.000070	T	0.51652	0.1687	M	0.78049	2.395	0.80722	D	1	D	0.67145	0.996	P	0.59595	0.86	T	0.54583	-0.8272	10	0.87932	D	0	.	19.8154	0.96566	0.0:0.0:1.0:0.0	.	157	Q9H2K2	TNKS2_HUMAN	V	157	ENSP00000360689:G157V	ENSP00000360689:G157V	G	+	2	0	TNKS2	93566916	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.835000	0.99442	2.699000	0.92147	0.655000	0.94253	GGA		0.408	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235		6	14	1	0	2.0095e-06	0.001984	2.35861e-06	6	14				
NLRP14	338323	broad.mit.edu	37	11	7059986	7059986	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:7059986G>T	ENST00000299481.4	+	2	515	c.169G>T	c.(169-171)Gac>Tac	p.D57Y		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	57	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.D57Y(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CAGGCGGGAGGACCTGGCCAA	0.453																																							uc001mfb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(169-171)GAC>TAC		NLR family, pyrin domain containing 14							59.0	64.0	62.0					11																	7059986		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7059986G>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.169G>T	11.37:g.7059986G>T	ENSP00000299481:p.Asp57Tyr		Somatic					p.D57Y	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	2	492	+			57			DAPIN.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.169G>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.361536	0.41801	.	.	ENSG00000158077	ENST00000299481	T	0.55052	0.54	3.99	1.0	0.19881	Pyrin (2);DEATH-like (2);	0.996198	0.08133	N	0.992916	T	0.67942	0.2947	M	0.82823	2.61	0.09310	N	1	D	0.61697	0.99	D	0.64237	0.923	T	0.51132	-0.8744	10	0.56958	D	0.05	.	3.8932	0.09128	0.2232:0.202:0.5748:0.0	.	57	Q86W24	NAL14_HUMAN	Y	57	ENSP00000299481:D57Y	ENSP00000299481:D57Y	D	+	1	0	NLRP14	7016562	0.019000	0.18553	0.007000	0.13788	0.914000	0.54420	0.943000	0.29030	0.236000	0.21180	0.655000	0.94253	GAC		0.453	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		13	78	1	0	0.000219431	0.00245	0.000242161	13	78				
USH1C	10083	broad.mit.edu	37	11	17552759	17552759	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:17552759C>A	ENST00000318024.4	-	4	437	c.329G>T	c.(328-330)tGt>tTt	p.C110F	USH1C_ENST00000005226.7_Missense_Mutation_p.C110F|USH1C_ENST00000527720.1_Missense_Mutation_p.C79F|USH1C_ENST00000527020.1_Missense_Mutation_p.C110F	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	110	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.C110F(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GAAGAGCCCACAGCCAAACTC	0.657																																							uc001mnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(328-330)TGT>TTT		harmonin isoform a							54.0	54.0	54.0					11																	17552759		2200	4293	6493	SO:0001583	missense	10083				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding	g.chr11:17552759C>A	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.329G>T	11.37:g.17552759C>A	ENSP00000317018:p.Cys110Phe		Somatic				USH1C_uc001mne.2_Missense_Mutation_p.C110F|USH1C_uc009yhb.2_Missense_Mutation_p.C110F|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.C74F	p.C110F	NM_005709	NP_005700	WXS	Illumina HiSeq	Unspecified	Q9Y6N9	USH1C_HUMAN			4	438	-			110			PDZ 1.		A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	c.329G>T	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024780	0.75390	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226;ENST00000526181	T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72	5.39	5.39	0.77823	PDZ/DHR/GLGF (4);	0.090421	0.85682	D	0.000000	T	0.29716	0.0742	N	0.03224	-0.385	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71656	0.957;0.974;0.973	T	0.49753	-0.8906	10	0.62326	D	0.03	.	18.2789	0.90092	0.0:1.0:0.0:0.0	.	110;110;110	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	F	110;79;110;110;121	ENSP00000317018:C110F;ENSP00000432944:C79F;ENSP00000436934:C110F;ENSP00000005226:C110F;ENSP00000437128:C121F	ENSP00000005226:C110F	C	-	2	0	USH1C	17509335	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.035000	0.64158	2.688000	0.91661	0.561000	0.74099	TGT		0.657	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709		18	81	1	0	0.000175454	0.010504	0.000194403	18	81				
TSG101	7251	broad.mit.edu	37	11	18503191	18503192	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:18503191_18503192CC>AG	ENST00000251968.3	-	9	1483_1484	c.1068_1069GG>CT	c.(1066-1071)ctGGat>ctCTat	p.D357Y	TSG101_ENST00000357193.3_Missense_Mutation_p.D252Y|TSG101_ENST00000536719.1_Missense_Mutation_p.D357Y	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	357	SB. {ECO:0000255|PROSITE- ProRule:PRU00644}.				cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.D357Y(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						AGGAAGACATCCAGGTCTATCA	0.406																																					GBM(99;1348 1396 8611 26475 50572)	GBM(99;1348 1396 8611 26475 50572)	uc001mor.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1066-1071)CTGGAT>CTCTAT		tumor susceptibility gene 101																																				SO:0001583	missense	7251				cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding	g.chr11:18503191_18503192CC>AG	U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.1068_1069delinsAG	11.37:g.18503191_18503192delinsAG	ENSP00000251968:p.Asp357Tyr		Somatic					p.D357Y	NM_006292	NP_006283	WXS	Illumina HiSeq	Unspecified	Q99816	TS101_HUMAN			9	1194_1195	-			357			SB.		Q9BUM5	Missense_Mutation	DNP	ENST00000251968.3	37	c.1068_1069GG>CT	CCDS7842.1																																																																																				0.406	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292		25	76	0	0	0	0.004672	0	25	76				
NAV2	89797	broad.mit.edu	37	11	19890506	19890506	+	Silent	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:19890506A>T	ENST00000396087.3	+	4	573	c.474A>T	c.(472-474)gcA>gcT	p.A158A	NAV2_ENST00000349880.4_Silent_p.A158A|NAV2_ENST00000527559.2_Silent_p.A87A|NAV2_ENST00000540292.1_Silent_p.A89A|NAV2_ENST00000534229.1_3'UTR|NAV2_ENST00000360655.4_Silent_p.A94A|NAV2_ENST00000396085.1_Silent_p.A158A	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	158	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.A158A(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						ATTTCCTGGCAGCTAAGGGAA	0.433																																							uc010rdm.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)|pancreas(1)	6						c.(472-474)GCA>GCT		neuron navigator 2 isoform 2							70.0	69.0	69.0					11																	19890506		2199	4293	6492	SO:0001819	synonymous_variant	89797					nucleus	ATP binding|helicase activity	g.chr11:19890506A>T	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.474A>T	11.37:g.19890506A>T			Somatic				NAV2_uc001mpp.2_Silent_p.A94A|NAV2_uc001mpr.3_Silent_p.A158A	p.A158A	NM_145117	NP_660093	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			4	835	+			158			CH.		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	c.474A>T	CCDS58126.1																																																																																				0.433	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		16	42	0	0	0	0.014323	0	16	42				
KCNA4	3739	broad.mit.edu	37	11	30033103	30033104	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:30033103_30033104CC>AA	ENST00000328224.6	-	2	2355_2356	c.1122_1123GG>TT	c.(1120-1125)gtGGaa>gtTTaa	p.E375*	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	375					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.E375*(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CAGACTGTTTCCACGATGAAGA	0.46																																							uc001msk.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1120-1125)GTGGAA>GTTTAA		potassium voltage-gated channel, shaker-related																																				SO:0001587	stop_gained	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30033103_30033104CC>AA	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1122_1123delinsAA	11.37:g.30033103_30033104delinsAA	ENSP00000328511:p.Glu375*		Somatic					p.E375*	NM_002233	NP_002224	WXS	Illumina HiSeq	Unspecified	P22459	KCNA4_HUMAN			2	2274_2275	-			375			Helical; Name=Segment S2; (Potential).			Nonsense_Mutation	DNP	ENST00000328224.6	37	c.1122_1123GG>TT	CCDS41629.1																																																																																				0.460	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		35	113	0	0	0	0.004672	0	35	113				
RAG2	5897	broad.mit.edu	37	11	36614627	36614627	+	Missense_Mutation	SNP	G	G	T	rs150349031	byFrequency	TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:36614627G>T	ENST00000311485.3	-	2	1253	c.1092C>A	c.(1090-1092)aaC>aaA	p.N364K	C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000446510.2_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000534635.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	364					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.N364K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				ATGTTTGACTGTTTGTGAATG	0.368									Familial Hemophagocytic Lymphohistiocytosis																														uc001mwv.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|pancreas(1)	5						c.(1090-1092)AAC>AAA		recombination activating gene 2							169.0	162.0	165.0					11																	36614627		2202	4298	6500	SO:0001583	missense	5897	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding	g.chr11:36614627G>T	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1092C>A	11.37:g.36614627G>T	ENSP00000308620:p.Asn364Lys		Somatic				RAG1_uc001mwt.2_RNA|C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	p.N364K	NM_000536	NP_000527	WXS	Illumina HiSeq	Unspecified	P55895	RAG2_HUMAN			2	1280	-	all_lung(20;0.226)	all_hematologic(20;0.00756)	364					A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	37	c.1092C>A	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336864	0.41398	.	.	ENSG00000175097	ENST00000311485	D	0.89939	-2.59	5.31	-1.24	0.09435	.	0.314175	0.39083	N	0.001461	D	0.88822	0.6541	L	0.47716	1.5	0.31694	N	0.641497	D	0.60160	0.987	P	0.60286	0.872	D	0.86765	0.1969	10	0.40728	T	0.16	-3.0552	10.868	0.46866	0.5958:0.0:0.4042:0.0	.	364	P55895	RAG2_HUMAN	K	364	ENSP00000308620:N364K	ENSP00000308620:N364K	N	-	3	2	RAG2	36571203	1.000000	0.71417	0.968000	0.41197	0.912000	0.54170	1.028000	0.30128	-0.043000	0.13513	-0.157000	0.13467	AAC		0.368	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		45	157	1	0	1.22674e-20	0.00874	1.94176e-20	45	157				
PTPRJ	5795	broad.mit.edu	37	11	48146645	48146645	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:48146645G>T	ENST00000418331.2	+	6	1352	c.1000G>T	c.(1000-1002)Ggg>Tgg	p.G334W	PTPRJ_ENST00000440289.2_Missense_Mutation_p.G334W	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	334	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.G334W(4)		breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CCTGCTTGTCGGGTTAGAGCC	0.607																																							uc001ngp.3		NA																	4	Substitution - Missense(4)		lung(4)	breast(3)|kidney(3)|ovary(1)|skin(1)	8						c.(1000-1002)GGG>TGG		protein tyrosine phosphatase, receptor type, J							89.0	94.0	93.0					11																	48146645		2201	4298	6499	SO:0001583	missense	5795				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity	g.chr11:48146645G>T	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1000G>T	11.37:g.48146645G>T	ENSP00000400010:p.Gly334Trp		Somatic				PTPRJ_uc001ngo.3_Missense_Mutation_p.G334W	p.G334W	NM_002843	NP_002834	WXS	Illumina HiSeq	Unspecified	Q12913	PTPRJ_HUMAN			6	1355	+			334			Extracellular (Potential).|Fibronectin type-III 3.		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	c.1000G>T	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.927327	0.52759	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.07800	3.16;3.16	5.38	3.52	0.40303	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18551	0.0445	L	0.39898	1.24	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.06250	-1.0837	9	0.87932	D	0	.	8.3827	0.32481	0.1803:0.0:0.8197:0.0	.	334;334	Q12913;Q6P4H4	PTPRJ_HUMAN;.	W	334	ENSP00000400010:G334W;ENSP00000409733:G334W	ENSP00000278456:G334W	G	+	1	0	PTPRJ	48103221	0.514000	0.26202	0.000000	0.03702	0.002000	0.02628	2.134000	0.42102	0.650000	0.30769	0.563000	0.77884	GGG		0.607	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1			50	180	1	0	7.06795e-37	0.01441	1.24702e-36	50	180				
OR5D16	390144	broad.mit.edu	37	11	55607017	55607017	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:55607017C>A	ENST00000378396.1	+	1	790	c.790C>A	c.(790-792)Ccc>Acc	p.P264T		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P264T(2)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CTACTGTGTACCCAACTCCAA	0.522																																							uc010rio.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(790-792)CCC>ACC		olfactory receptor, family 5, subfamily D,							108.0	97.0	101.0					11																	55607017		2201	4296	6497	SO:0001583	missense	390144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55607017C>A	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.790C>A	11.37:g.55607017C>A	ENSP00000367649:p.Pro264Thr		Somatic					p.P264T	NM_001005496	NP_001005496	WXS	Illumina HiSeq	Unspecified	Q8NGK9	OR5DG_HUMAN			1	790	+		all_epithelial(135;0.208)	264			Extracellular (Potential).		Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	c.790C>A	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	13.22	2.172498	0.38315	.	.	ENSG00000205029	ENST00000378396	T	0.00274	8.35	4.43	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00815	0.0027	M	0.94021	3.485	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.39482	-0.9612	9	0.87932	D	0	-42.9354	6.3983	0.21624	0.0:0.6862:0.0:0.3138	.	264	Q8NGK9	OR5DG_HUMAN	T	264	ENSP00000367649:P264T	ENSP00000367649:P264T	P	+	1	0	OR5D16	55363593	0.000000	0.05858	0.011000	0.14972	0.667000	0.39255	-0.170000	0.09897	0.440000	0.26502	0.537000	0.68136	CCC		0.522	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		18	84	1	0	0.000295444	0.014323	0.000322196	18	84				
OR5B3	441608	broad.mit.edu	37	11	58170034	58170034	+	Silent	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:58170034C>A	ENST00000309403.2	-	1	848	c.849G>T	c.(847-849)ctG>ctT	p.L283L		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L283L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CCAGAGGGTTCAGCATGGGGA	0.428																																							uc010rkf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(847-849)CTG>CTT		olfactory receptor, family 5, subfamily B,							139.0	121.0	127.0					11																	58170034		2201	4295	6496	SO:0001819	synonymous_variant	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170034C>A	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.849G>T	11.37:g.58170034C>A			Somatic					p.L283L	NM_001005469	NP_001005469	WXS	Illumina HiSeq	Unspecified	Q8NH48	OR5B3_HUMAN			1	849	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	283			Helical; Name=7; (Potential).		Q6IEV6	Silent	SNP	ENST00000309403.2	37	c.849G>T	CCDS31549.1																																																																																				0.428	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		12	81	1	0	3.01185e-09	0.003954	3.72447e-09	12	81				
OR4D6	219983	broad.mit.edu	37	11	59225059	59225059	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:59225059T>A	ENST00000300127.2	+	1	649	c.626T>A	c.(625-627)cTc>cAc	p.L209H		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L209H(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						GTGACCCTGCTCTGGTTCCTC	0.557																																							uc010rku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(625-627)CTC>CAC		olfactory receptor, family 4, subfamily D,							165.0	139.0	148.0					11																	59225059		2201	4295	6496	SO:0001583	missense	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59225059T>A	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.626T>A	11.37:g.59225059T>A	ENSP00000300127:p.Leu209His		Somatic					p.L209H	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	626	+			209			Helical; Name=5; (Potential).		B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	c.626T>A	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	T	11.71	1.720375	0.30503	.	.	ENSG00000166884	ENST00000300127	T	0.47177	0.85	6.01	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.171641	0.27682	N	0.018295	T	0.71863	0.3390	M	0.91140	3.18	0.09310	N	1	D	0.71674	0.998	D	0.70016	0.967	T	0.67448	-0.5668	10	0.72032	D	0.01	-10.3914	10.8205	0.46601	0.0:0.0:0.2944:0.7056	.	209	Q8NGJ1	OR4D6_HUMAN	H	209	ENSP00000300127:L209H	ENSP00000300127:L209H	L	+	2	0	OR4D6	58981635	0.000000	0.05858	0.360000	0.25837	0.190000	0.23558	-0.027000	0.12371	2.299000	0.77371	0.533000	0.62120	CTC		0.557	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		38	149	0	0	0	0.00623	0	38	149				
SCGB2A2	4250	broad.mit.edu	37	11	62037700	62037700	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:62037700G>T	ENST00000227918.2	+	1	74	c.12G>T	c.(10-12)ctG>ctT	p.L4L	SCGB2A2_ENST00000525380.1_Silent_p.L4L	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	4								p.L4L(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						TGAAGTTGCTGATGGTCCTCA	0.602																																							uc001ntc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(10-12)CTG>CTT		secretoglobin, family 2A, member 2 precursor							151.0	142.0	145.0					11																	62037700		2202	4299	6501	SO:0001819	synonymous_variant	4250					extracellular region	steroid binding	g.chr11:62037700G>T	AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.12G>T	11.37:g.62037700G>T			Somatic				SCGB2A2_uc009ynx.2_Silent_p.L4L	p.L4L	NM_002411	NP_002402	WXS	Illumina HiSeq	Unspecified	Q13296	SG2A2_HUMAN			1	71	+			4					A1A522|Q86WH8	Silent	SNP	ENST00000227918.2	37	c.12G>T	CCDS8018.1																																																																																				0.602	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394860.1	NM_002411		46	214	1	0	2.12129e-23	0.01441	3.4769e-23	46	214				
EML3	256364	broad.mit.edu	37	11	62373360	62373360	+	Silent	SNP	T	T	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:62373360T>C	ENST00000394773.2	-	14	2056	c.1749A>G	c.(1747-1749)ggA>ggG	p.G583G	EML3_ENST00000494176.2_Silent_p.G555G|RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000438258.1_5'Flank|EML3_ENST00000529309.1_Silent_p.G583G|EML3_ENST00000278845.4_Silent_p.G584G|EML3_ENST00000531557.1_Silent_p.G366G	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	583						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.G583G(1)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GGGCCAGGTCTCCCCTCAGCA	0.612																																							uc001ntu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1747-1749)GGA>GGG		echinoderm microtubule associated protein like							81.0	81.0	81.0					11																	62373360		2202	4299	6501	SO:0001819	synonymous_variant	256364					cytoplasm|microtubule	protein binding	g.chr11:62373360T>C	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.1749A>G	11.37:g.62373360T>C			Somatic				EML3_uc001ntr.1_Silent_p.G555G|EML3_uc001nts.1_Silent_p.G555G|EML3_uc001ntt.1_Silent_p.G467G|EML3_uc010rly.1_Silent_p.G583G	p.G583G	NM_153265	NP_694997	WXS	Illumina HiSeq	Unspecified	Q32P44	EMAL3_HUMAN			14	2057	-			583					Q6ZQW7|Q8NA55	Silent	SNP	ENST00000394773.2	37	c.1749A>G	CCDS8023.2	.	.	.	.	.	.	.	.	.	.	T	9.810	1.182797	0.21870	.	.	ENSG00000149499	ENST00000394776	.	.	.	5.05	-2.13	0.07144	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34304	-0.9834	4	.	.	.	-8.3335	0.9072	0.01287	0.147:0.2403:0.2981:0.3146	.	.	.	.	G	578	.	.	R	-	1	2	EML3	62129936	0.271000	0.24162	0.999000	0.59377	0.977000	0.68977	-0.743000	0.04845	-0.042000	0.13535	0.459000	0.35465	AGA		0.612	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265		34	118	0	0	0	0.004289	0	34	118				
NOX4	50507	broad.mit.edu	37	11	89088203	89088203	+	Nonsense_Mutation	SNP	G	G	A	rs374112961		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:89088203G>A	ENST00000263317.4	-	13	1382	c.1144C>T	c.(1144-1146)Cga>Tga	p.R382*	NOX4_ENST00000542487.1_Nonsense_Mutation_p.R358*|NOX4_ENST00000424319.1_Nonsense_Mutation_p.R358*|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000413594.2_Nonsense_Mutation_p.R403*|NOX4_ENST00000531342.1_Nonsense_Mutation_p.R75*|NOX4_ENST00000532825.1_Nonsense_Mutation_p.R358*|NOX4_ENST00000527956.1_Nonsense_Mutation_p.R358*|NOX4_ENST00000534731.1_Nonsense_Mutation_p.R382*|NOX4_ENST00000528341.1_Nonsense_Mutation_p.R357*|NOX4_ENST00000343727.5_Nonsense_Mutation_p.R358*|NOX4_ENST00000535633.1_Nonsense_Mutation_p.R358*|NOX4_ENST00000375979.3_Nonsense_Mutation_p.R75*|NOX4_ENST00000527626.1_Nonsense_Mutation_p.R216*			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	382	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.R382*(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGTAAATCTCGAAATCGTTCT	0.328																																							uc001pct.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1144-1146)CGA>TGA		NADPH oxidase 4 isoform a		G	stop/ARG,stop/ARG,stop/ARG	0,4402		0,0,2201	50.0	49.0	49.0		1144,1072,1144	5.3	1.0	11		49	1,8597	1.2+/-3.3	0,1,4298	no	stop-gained,stop-gained,stop-gained	NOX4	NM_001143836.1,NM_001143837.1,NM_016931.3	,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,	382/539,358/555,382/579	89088203	1,12999	2201	4299	6500	SO:0001587	stop_gained	50507				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity	g.chr11:89088203G>A	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1144C>T	11.37:g.89088203G>A	ENSP00000263317:p.Arg382*		Somatic				NOX4_uc009yvr.2_Nonsense_Mutation_p.R357*|NOX4_uc001pcu.2_Nonsense_Mutation_p.R308*|NOX4_uc001pcw.2_Nonsense_Mutation_p.R75*|NOX4_uc001pcx.2_Nonsense_Mutation_p.R75*|NOX4_uc001pcv.2_Nonsense_Mutation_p.R382*|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Nonsense_Mutation_p.R216*|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Nonsense_Mutation_p.R358*|NOX4_uc009yvq.2_Nonsense_Mutation_p.R358*	p.R382*	NM_016931	NP_058627	WXS	Illumina HiSeq	Unspecified	Q9NPH5	NOX4_HUMAN			13	1383	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)	382			FAD-binding FR-type.|Extracellular (Potential).|Mediates interaction with TLR4.		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Nonsense_Mutation	SNP	ENST00000263317.4	37	c.1144C>T	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124446	0.94429	0.0	1.16E-4	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	.	.	.	5.31	5.31	0.75309	.	0.325791	0.27060	N	0.021133	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.9276	14.4891	0.67639	0.0:0.0:1.0:0.0	.	.	.	.	X	358;358;358;382;382;358;358;358;216;357;403;75;75	.	.	R	-	1	2	NOX4	88727851	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.228000	0.65310	2.479000	0.83701	0.563000	0.77884	CGA		0.328	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931		7	42	0	0	0	0.001984	0	7	42				
DYNC2H1	79659	broad.mit.edu	37	11	103029646	103029646	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr11:103029646G>A	ENST00000375735.2	+	28	4412	c.4268G>A	c.(4267-4269)cGc>cAc	p.R1423H	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R1423H|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1423	Stem. {ECO:0000250}.		R -> C (in SRTD3). {ECO:0000269|PubMed:22499340}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TAGGAAAAACGCTCAGCATTC	0.279																																							uc001pho.2		NA																	0					0						c.(4267-4269)CGC>CAC		dynein, cytoplasmic 2, heavy chain 1							35.0	32.0	33.0					11																	103029646		1787	4057	5844	SO:0001583	missense	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:103029646G>A	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4268G>A	11.37:g.103029646G>A	ENSP00000364887:p.Arg1423His		Somatic				DYNC2H1_uc001phn.1_Missense_Mutation_p.R1423H|DYNC2H1_uc009yxe.1_Intron	p.R1423H	NM_001080463	NP_001073932	WXS	Illumina HiSeq	Unspecified	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	28	4412	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	1423			Stem (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	c.4268G>A	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.967656	0.92855	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.79749	-1.3;-1.3	5.36	5.36	0.76844	Dynein heavy chain, domain-2 (1);	0.000000	0.48767	U	0.000168	D	0.94311	0.8172	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96256	0.9187	10	0.87932	D	0	.	19.4599	0.94912	0.0:0.0:1.0:0.0	.	1423;1423	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	H	1423	ENSP00000364887:R1423H;ENSP00000381167:R1423H	ENSP00000364887:R1423H	R	+	2	0	DYNC2H1	102534856	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	9.461000	0.97646	2.671000	0.90904	0.563000	0.77884	CGC		0.279	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		3	16	0	0	0	0.004672	0	3	16				
WNT5B	81029	broad.mit.edu	37	12	1741938	1741938	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:1741938C>A	ENST00000397196.2	+	3	427	c.195C>A	c.(193-195)taC>taA	p.Y65*	WNT5B_ENST00000542408.1_Nonsense_Mutation_p.Y65*|WNT5B_ENST00000310594.3_Nonsense_Mutation_p.Y65*|WNT5B_ENST00000537031.1_Nonsense_Mutation_p.Y65*	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	65					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)	p.Y65*(1)		skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			GCCAATTGTACCAGGAGCACA	0.612																																							uc009zdq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(193-195)TAC>TAA		wingless-type MMTV integration site family,							79.0	78.0	78.0					12																	1741938		2203	4300	6503	SO:0001587	stop_gained	81029				angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding	g.chr12:1741938C>A	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.195C>A	12.37:g.1741938C>A	ENSP00000380379:p.Tyr65*		Somatic				WNT5B_uc001qjj.2_Nonsense_Mutation_p.Y65*|WNT5B_uc001qjk.2_Nonsense_Mutation_p.Y65*|WNT5B_uc001qjl.2_Nonsense_Mutation_p.Y65*	p.Y65*	NM_032642	NP_116031	WXS	Illumina HiSeq	Unspecified	Q9H1J7	WNT5B_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00109)		3	437	+	Ovarian(42;0.107)		65					A8K315|D3DUP9|Q96S49|Q9BV04	Nonsense_Mutation	SNP	ENST00000397196.2	37	c.195C>A	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	C	40	8.516430	0.98845	.	.	ENSG00000111186	ENST00000539198;ENST00000545811;ENST00000537031;ENST00000310594;ENST00000397196;ENST00000543071;ENST00000542408	.	.	.	5.13	4.23	0.50019	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3823	0.38322	0.0:0.8354:0.0:0.1646	.	.	.	.	X	65	.	ENSP00000308887:Y65X	Y	+	3	2	WNT5B	1612199	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.671000	0.37513	1.264000	0.44198	0.650000	0.86243	TAC		0.612	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206747.2			40	140	1	0	1.49673e-21	0.00623	2.42453e-21	40	140				
A2ML1	144568	broad.mit.edu	37	12	8976459	8976459	+	Silent	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:8976459C>G	ENST00000299698.7	+	3	570	c.390C>G	c.(388-390)ctC>ctG	p.L130L	A2ML1-AS1_ENST00000537288.1_RNA	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.L130L(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ACAAACCTCTCTACACCCCAG	0.493																																							uc001quz.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(388-390)CTC>CTG		alpha-2-macroglobulin-like 1 precursor							77.0	79.0	78.0					12																	8976459		1909	4124	6033	SO:0001819	synonymous_variant	144568					extracellular space	endopeptidase inhibitor activity	g.chr12:8976459C>G	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.390C>G	12.37:g.8976459C>G			Somatic					p.L130L	NM_144670	NP_653271	WXS	Illumina HiSeq	Unspecified	A8K2U0	A2ML1_HUMAN			3	488	+			Error:Variant_position_missing_in_B3KVV6_after_alignment						Silent	SNP	ENST00000299698.7	37	c.390C>G	CCDS8596.2																																																																																				0.493	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670		13	76	0	0	0	0.001855	0	13	76				
ABCC9	10060	broad.mit.edu	37	12	22012531	22012531	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:22012531T>C	ENST00000261201.4	-	20	2493	c.2494A>G	c.(2494-2496)Att>Gtt	p.I832V	ABCC9_ENST00000261200.4_Missense_Mutation_p.I832V|ABCC9_ENST00000345162.2_Missense_Mutation_p.I796V|RP11-729I10.2_ENST00000539874.1_RNA	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	832	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.I832V(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AAAAAGACAATGTTGGTGTTT	0.423																																							uc001rfi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(2494-2496)ATT>GTT		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						176.0	172.0	173.0					12																	22012531		2203	4300	6503	SO:0001583	missense	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:22012531T>C	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2494A>G	12.37:g.22012531T>C	ENSP00000261201:p.Ile832Val		Somatic				ABCC9_uc001rfh.2_Missense_Mutation_p.I832V|ABCC9_uc001rfj.1_Missense_Mutation_p.I796V	p.I832V	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			20	2514	-			832			Cytoplasmic (Potential).|ABC transporter 1.		O60707	Missense_Mutation	SNP	ENST00000261201.4	37	c.2494A>G	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	T	1.414	-0.574618	0.03882	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37	4.71	3.56	0.40772	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.097833	0.64402	N	0.000002	D	0.85847	0.5792	N	0.17800	0.525	0.43435	D	0.995601	B;B	0.19200	0.001;0.034	B;B	0.21360	0.012;0.034	T	0.78221	-0.2288	10	0.29301	T	0.29	-13.0018	8.9758	0.35935	0.0:0.1576:0.0:0.8424	.	832;832	O60706;O60706-2	ABCC9_HUMAN;.	V	832;459;832;796	ENSP00000261200:I832V;ENSP00000440521:I459V;ENSP00000261201:I832V;ENSP00000261202:I796V	ENSP00000261200:I832V	I	-	1	0	ABCC9	21903798	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.105000	0.57797	0.841000	0.35020	0.383000	0.25322	ATT		0.423	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		38	120	0	0	0	0.00623	0	38	120				
SOX5	6660	broad.mit.edu	37	12	23818455	23818455	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:23818455G>A	ENST00000451604.2	-	7	955	c.854C>T	c.(853-855)cCt>cTt	p.P285L	SOX5_ENST00000545921.1_Missense_Mutation_p.P275L|SOX5_ENST00000541536.1_Missense_Mutation_p.P272L|SOX5_ENST00000537393.1_Missense_Mutation_p.P250L|SOX5_ENST00000309359.1_Missense_Mutation_p.P272L|SOX5_ENST00000381381.2_Missense_Mutation_p.P272L|SOX5_ENST00000546136.1_Missense_Mutation_p.P272L			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	285					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P285L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CCGTTGATCAGGAGGGAATAC	0.488																																							uc001rfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(1)	6						c.(853-855)CCT>CTT		SRY (sex determining region Y)-box 5 isoform a							127.0	127.0	127.0					12																	23818455		2203	4300	6503	SO:0001583	missense	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:23818455G>A	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.854C>T	12.37:g.23818455G>A	ENSP00000398273:p.Pro285Leu		Somatic				SOX5_uc001rfx.2_Missense_Mutation_p.P272L|SOX5_uc001rfy.2_Missense_Mutation_p.P272L|SOX5_uc010siv.1_Missense_Mutation_p.P272L|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.P237L	p.P285L	NM_006940	NP_008871	WXS	Illumina HiSeq	Unspecified	P35711	SOX5_HUMAN			7	956	-			285					B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	c.854C>T	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188336	0.78789	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.97505	-4.26;-4.26;-4.41;-4.27;-4.29;-4.41;-4.27	5.34	5.34	0.76211	.	0.304933	0.34386	N	0.004003	D	0.97334	0.9128	L	0.57536	1.79	0.80722	D	1	D;P;P	0.54772	0.968;0.879;0.945	P;B;P	0.53861	0.736;0.402;0.722	D	0.97578	1.0109	10	0.62326	D	0.03	.	19.227	0.93821	0.0:0.0:1.0:0.0	.	250;272;285	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	L	272;272;272;285;237;250;272;275	ENSP00000437487:P272L;ENSP00000308927:P272L;ENSP00000370788:P272L;ENSP00000398273:P285L;ENSP00000439832:P250L;ENSP00000441973:P272L;ENSP00000443520:P275L	ENSP00000308927:P272L	P	-	2	0	SOX5	23709722	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.270000	0.65547	2.767000	0.95098	0.655000	0.94253	CCT		0.488	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		28	87	0	0	0	0.013726	0	28	87				
FGD4	121512	broad.mit.edu	37	12	32735088	32735088	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:32735088C>G	ENST00000427716.2	+	4	711	c.287C>G	c.(286-288)gCa>gGa	p.A96G	FGD4_ENST00000531134.1_Missense_Mutation_p.A181G|FGD4_ENST00000534526.2_Missense_Mutation_p.A233G|FGD4_ENST00000546442.1_Missense_Mutation_p.A3G|FGD4_ENST00000525053.1_Missense_Mutation_p.A208G|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000472289.1_Missense_Mutation_p.A96G	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	96	Actin filament-binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A96G(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GTAATGGCAGCACAAAACCAG	0.473																																							uc001rkz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(286-288)GCA>GGA		FYVE, RhoGEF and PH domain containing 4							149.0	120.0	130.0					12																	32735088		2203	4300	6503	SO:0001583	missense	121512				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:32735088C>G	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.287C>G	12.37:g.32735088C>G	ENSP00000394487:p.Ala96Gly		Somatic				FGD4_uc001rlc.2_Missense_Mutation_p.A181G|FGD4_uc001rky.2_5'UTR|FGD4_uc001rla.2_5'UTR|FGD4_uc010ske.1_Missense_Mutation_p.A208G|FGD4_uc001rlb.1_RNA|FGD4_uc001rkx.3_Missense_Mutation_p.A96G	p.A96G	NM_139241	NP_640334	WXS	Illumina HiSeq	Unspecified	Q96M96	FGD4_HUMAN			4	764	+	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		96			Actin filament-binding (By similarity).		Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	37	c.287C>G	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546275	0.45383	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000472289;ENST00000427716;ENST00000546442;ENST00000525053;ENST00000395742	T;T;T;T;T	0.74106	-0.81;-0.74;-0.66;-0.55;-0.75	4.91	4.02	0.46733	.	0.326617	0.22077	N	0.064943	T	0.73621	0.3610	L	0.29908	0.895	0.52501	D	0.999951	B;B;B;D	0.57257	0.255;0.255;0.361;0.979	B;B;B;P	0.56563	0.071;0.071;0.118;0.801	T	0.75039	-0.3458	10	0.66056	D	0.02	-2.2513	11.4399	0.50090	0.0:0.9159:0.0:0.0841	.	208;181;96;96	E9PJX4;B7Z493;Q96M96;E9PQT1	.;.;FGD4_HUMAN;.	G	233;181;96;96;3;208;77	ENSP00000449273:A233G;ENSP00000431323:A181G;ENSP00000394487:A96G;ENSP00000446695:A3G;ENSP00000433666:A208G	ENSP00000379089:A96G	A	+	2	0	FGD4	32626355	0.155000	0.22806	0.009000	0.14445	0.912000	0.54170	1.724000	0.38064	1.059000	0.40554	0.467000	0.42956	GCA		0.473	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241		5	66	0	0	0	0.006214	0	5	66				
METTL7A	25840	broad.mit.edu	37	12	51319018	51319018	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:51319018C>T	ENST00000548553.1	+	2	1178	c.197C>T	c.(196-198)gCg>gTg	p.A66V	METTL7A_ENST00000332160.4_Missense_Mutation_p.A66V			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	66						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)	p.A66V(1)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						CAGGAGTTTGCGGGCCCCTCC	0.552																																							uc001rxb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(196-198)GCG>GTG		methyltransferase like 7A precursor							41.0	41.0	41.0					12																	51319018		2203	4300	6503	SO:0001583	missense	25840					endoplasmic reticulum|lipid particle|membrane	methyltransferase activity	g.chr12:51319018C>T		CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.197C>T	12.37:g.51319018C>T	ENSP00000448785:p.Ala66Val		Somatic				METTL7A_uc010smv.1_Missense_Mutation_p.A66V	p.A66V	NM_014033	NP_054752	WXS	Illumina HiSeq	Unspecified	Q9H8H3	MET7A_HUMAN			1	485	+			66					Q9H7R3|Q9UHZ7|Q9Y422	Missense_Mutation	SNP	ENST00000548553.1	37	c.197C>T	CCDS8804.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.439444	0.25900	.	.	ENSG00000185432	ENST00000548553;ENST00000550502;ENST00000332160;ENST00000433599	T;T;T	0.16597	2.33;2.33;2.33	5.0	-1.08	0.09936	.	0.852961	0.10781	N	0.634907	T	0.09598	0.0236	L	0.34521	1.04	0.09310	N	1	B;B	0.16802	0.017;0.019	B;B	0.12837	0.003;0.008	T	0.38993	-0.9635	10	0.20519	T	0.43	-1.5348	2.5233	0.04685	0.1123:0.4458:0.1094:0.3324	.	66;66	B4DDW1;Q9H8H3	.;MET7A_HUMAN	V	66	ENSP00000448785:A66V;ENSP00000450239:A66V;ENSP00000331787:A66V	ENSP00000331787:A66V	A	+	2	0	METTL7A	49605285	0.000000	0.05858	0.000000	0.03702	0.544000	0.35116	0.002000	0.13061	-0.304000	0.08843	-0.140000	0.14226	GCG		0.552	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033		4	77	0	0	0	0.009096	0	4	77				
KRT79	338785	broad.mit.edu	37	12	53215788	53215788	+	Silent	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:53215788C>A	ENST00000330553.5	-	9	1510	c.1476G>T	c.(1474-1476)ggG>ggT	p.G492G		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	492	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.G492G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCCCCCACTCCCACCCAGGG	0.612																																							uc001sbb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(1474-1476)GGG>GGT		keratin 6L							51.0	44.0	46.0					12																	53215788		2203	4300	6503	SO:0001819	synonymous_variant	338785					keratin filament	structural molecule activity	g.chr12:53215788C>A	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.1476G>T	12.37:g.53215788C>A			Somatic				KRT79_uc001sba.2_Silent_p.G263G	p.G492G	NM_175834	NP_787028	WXS	Illumina HiSeq	Unspecified	Q5XKE5	K2C79_HUMAN			9	1509	-			492			Tail.		Q6P465|Q7Z793	Silent	SNP	ENST00000330553.5	37	c.1476G>T	CCDS8839.1																																																																																				0.612	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834		17	58	1	0	3.41278e-10	0.00499	4.39693e-10	17	58				
RARG	5916	broad.mit.edu	37	12	53607014	53607014	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:53607014C>T	ENST00000425354.2	-	9	1519	c.1032G>A	c.(1030-1032)ctG>ctA	p.L344L	RARG_ENST00000543762.1_5'UTR|RARG_ENST00000327550.3_Silent_p.L272L|RARG_ENST00000394426.1_Silent_p.L344L|RARG_ENST00000338561.5_Silent_p.L333L|RARG_ENST00000543726.1_Silent_p.L322L	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	344	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.L344L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	CGGGCTCCTCCAGGTCCATGC	0.597											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001sce.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)|lung(1)	4						c.(1030-1032)CTG>CTA		retinoic acid receptor, gamma isoform 1	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)						36.0	40.0	39.0					12																	53607014		2203	4299	6502	SO:0001819	synonymous_variant	5916				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr12:53607014C>T	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.1032G>A	12.37:g.53607014C>T			Somatic	OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	993	RARG_uc001scd.2_Silent_p.L333L|RARG_uc010sob.1_Silent_p.L322L|RARG_uc001scf.2_Silent_p.L344L|RARG_uc001scg.2_Silent_p.L272L|RARG_uc010soc.1_Silent_p.L223L	p.L344L	NM_000966	NP_000957	WXS	Illumina HiSeq	Unspecified	P13631	RARG_HUMAN			9	1517	-			344			Ligand-binding.		B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Silent	SNP	ENST00000425354.2	37	c.1032G>A	CCDS8850.1																																																																																				0.597	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966		10	56	0	0	0	0.008291	0	10	56				
NTS	4922	broad.mit.edu	37	12	86268247	86268247	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:86268247G>T	ENST00000256010.6	+	1	173	c.66G>T	c.(64-66)ctG>ctT	p.L22L	NTS_ENST00000551529.1_Silent_p.L22L	NM_006183.4	NP_006174.1	P30990	NEUT_HUMAN	neurotensin	22					regulation of blood vessel size (GO:0050880)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)		p.L22L(1)		large_intestine(2)|lung(6)	8						CCTGGAGTCTGTGCTCAGGTA	0.423																																							uc001tag.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(64-66)CTG>CTT		neurotensin/neuromedin N preproprotein							120.0	114.0	116.0					12																	86268247		2203	4300	6503	SO:0001819	synonymous_variant	4922				regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity	g.chr12:86268247G>T		CCDS9029.1	12q21.31	2013-02-26			ENSG00000133636	ENSG00000133636		"""Endogenous ligands"""	8038	protein-coding gene	gene with protein product	"""neuromedin N"", ""pro-neurotensin/neuromedin"""	162650					Standard	NM_006183		Approved		uc001tag.3	P30990	OTTHUMG00000169832	ENST00000256010.6:c.66G>T	12.37:g.86268247G>T			Somatic					p.L22L	NM_006183	NP_006174	WXS	Illumina HiSeq	Unspecified	P30990	NEUT_HUMAN			1	173	+			22						Silent	SNP	ENST00000256010.6	37	c.66G>T	CCDS9029.1																																																																																				0.423	NTS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406111.2			15	50	1	0	2.32078e-09	0.003163	2.89575e-09	15	50				
MED13L	23389	broad.mit.edu	37	12	116413011	116413011	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:116413011C>A	ENST00000281928.3	-	25	5902	c.5696G>T	c.(5695-5697)gGg>gTg	p.G1899V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1899						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.G1899V(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CCCAAGTCGCCCGATTACAAC	0.443																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(5695-5697)GGG>GTG		mediator complex subunit 13-like							74.0	71.0	72.0					12																	116413011		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116413011C>A	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5696G>T	12.37:g.116413011C>A	ENSP00000281928:p.Gly1899Val		Somatic					p.G1899V	NM_015335	NP_056150	WXS	Illumina HiSeq	Unspecified	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	25	5751	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		1899					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.5696G>T	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096359	0.94197	.	.	ENSG00000123066	ENST00000281928	D	0.83506	-1.73	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.92681	0.7674	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92091	0.5680	10	0.51188	T	0.08	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	1899	Q71F56	MD13L_HUMAN	V	1899	ENSP00000281928:G1899V	ENSP00000281928:G1899V	G	-	2	0	MED13L	114897394	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.438000	0.80431	2.894000	0.99253	0.591000	0.81541	GGG		0.443	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			16	58	1	0	0.000308642	0.003163	0.00033527	16	58				
TAOK3	51347	broad.mit.edu	37	12	118650764	118650764	+	Missense_Mutation	SNP	C	C	A	rs147202627	byFrequency	TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr12:118650764C>A	ENST00000392533.3	-	11	1264	c.774G>T	c.(772-774)ttG>ttT	p.L258F	TAOK3_ENST00000419821.2_Missense_Mutation_p.L258F	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.L258F(1)		central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTATTTTCTGCAAGCAGTAAT	0.358																																							uc001twx.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|central_nervous_system(1)	6						c.(772-774)TTG>TTT		TAO kinase 3							82.0	76.0	78.0					12																	118650764		2203	4300	6503	SO:0001583	missense	51347				MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:118650764C>A	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.774G>T	12.37:g.118650764C>A	ENSP00000376317:p.Leu258Phe		Somatic				TAOK3_uc001tww.2_Missense_Mutation_p.L88F|TAOK3_uc001twy.3_Missense_Mutation_p.L258F	p.L258F	NM_016281	NP_057365	WXS	Illumina HiSeq	Unspecified	Q9H2K8	TAOK3_HUMAN			11	1069	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		258			Protein kinase.		Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	c.774G>T	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587337	0.66105	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000538601	T;T;T	0.73258	-0.73;-0.73;-0.73	5.08	4.11	0.48088	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.085602	0.49305	D	0.000148	T	0.80138	0.4568	M	0.63169	1.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81145	-0.1066	10	0.87932	D	0	.	10.9732	0.47450	0.0:0.8693:0.0:0.1307	.	258	Q9H2K8	TAOK3_HUMAN	F	258;258;156	ENSP00000416374:L258F;ENSP00000376317:L258F;ENSP00000437389:L156F	ENSP00000376317:L258F	L	-	3	2	TAOK3	117135147	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.023000	0.30065	2.621000	0.88768	0.650000	0.86243	TTG		0.358	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281		8	28	1	0	2.27111e-07	0.013537	2.71163e-07	8	28				
N4BP2L2	10443	broad.mit.edu	37	13	33092138	33092138	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr13:33092138C>G	ENST00000267068.3	-	6	1717	c.1553G>C	c.(1552-1554)aGg>aCg	p.R518T	N4BP2L2_ENST00000446957.2_Missense_Mutation_p.R518T|N4BP2L2_ENST00000504114.1_Missense_Mutation_p.R74T|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.R89T|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.R74T	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	518					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.R89T(1)|p.R518T(1)		kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATGTTTATTCCTCCTAACAAA	0.318																																							uc001uuk.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1552-1554)AGG>ACG		phosphonoformate immuno-associated protein 5							76.0	70.0	72.0					13																	33092138		2203	4300	6503	SO:0001583	missense	10443							g.chr13:33092138C>G	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.1553G>C	13.37:g.33092138C>G	ENSP00000267068:p.Arg518Thr		Somatic				N4BP2L2_uc001uuj.2_Missense_Mutation_p.R34T|N4BP2L2_uc010abe.1_Missense_Mutation_p.R89T|N4BP2L2_uc010tdz.1_Missense_Mutation_p.R74T	p.R518T	NM_014887	NP_055702	WXS	Illumina HiSeq	Unspecified	Q92802	N42L2_HUMAN		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)	6	1731	-		Lung SC(185;0.0262)	518					A3KME8	Missense_Mutation	SNP	ENST00000267068.3	37	c.1553G>C	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380636	0.61845	.	.	ENSG00000244754	ENST00000504114;ENST00000357505;ENST00000399396;ENST00000446957;ENST00000505213;ENST00000267068	T;T;T;T;T;T	0.75367	1.2;1.2;1.2;-0.93;-0.93;-0.93	5.34	5.34	0.76211	.	.	.	.	.	D	0.85758	0.5771	M	0.68317	2.08	0.39219	D	0.963465	D;D;D;D	0.89917	0.995;1.0;1.0;0.999	D;D;D;P	0.85130	0.98;0.995;0.997;0.892	D	0.87784	0.2614	9	0.87932	D	0	-5.461	19.0496	0.93038	0.0:1.0:0.0:0.0	.	74;89;518;518	B4DPY1;Q92802-3;Q92802;Q92802-2	.;.;N42L2_HUMAN;.	T	74;74;89;518;518;518	ENSP00000427477:R74T;ENSP00000350104:R74T;ENSP00000382328:R89T;ENSP00000394239:R518T;ENSP00000423362:R518T;ENSP00000267068:R518T	ENSP00000267068:R518T	R	-	2	0	N4BP2L2	31990138	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.733000	0.74796	2.510000	0.84645	0.467000	0.42956	AGG		0.318	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887		13	35	0	0	0	0.00245	0	13	35				
DACH1	1602	broad.mit.edu	37	13	72440283	72440283	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr13:72440283C>T	ENST00000359684.2	-	1	624	c.625G>A	c.(625-627)Gag>Aag	p.E209K	DACH1_ENST00000305425.4_Missense_Mutation_p.E209K|DACH1_ENST00000354591.4_Missense_Mutation_p.E209K|DACH1_ENST00000313174.7_Missense_Mutation_p.E209K			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	209	DACHbox-N.|Interaction with SIX6 and HDAC3. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.E209K(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CAGATCAGCTCGCAGCCCTCC	0.587																																							uc010thn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(619-621)GAG>AAG		dachshund homolog 1 isoform a							54.0	59.0	57.0					13																	72440283		2009	4186	6195	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72440283C>T	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.625G>A	13.37:g.72440283C>T	ENSP00000352712:p.Glu209Lys		Somatic				DACH1_uc010tho.1_Missense_Mutation_p.E207K|DACH1_uc010thp.1_Missense_Mutation_p.E207K	p.E207K	NM_080759	NP_542937	WXS	Illumina HiSeq	Unspecified	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	2	1042	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	207			Interaction with SIX6 and HDAC3 (By similarity).|DACHbox-N.		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.619G>A		.	.	.	.	.	.	.	.	.	.	C	22.6	4.305262	0.81247	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	4.14	4.14	0.48551	.	0.058519	0.64402	D	0.000003	D	0.89846	0.6833	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.75484	0.982;0.982;0.986	D	0.90265	0.4303	10	0.46703	T	0.11	-6.2902	16.0028	0.80308	0.0:1.0:0.0:0.0	.	207;207;207	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	K	209	ENSP00000304994:E209K;ENSP00000318506:E209K;ENSP00000346604:E209K;ENSP00000352712:E209K	ENSP00000304994:E209K	E	-	1	0	DACH1	71338284	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.198000	0.77823	1.836000	0.53414	0.305000	0.20034	GAG		0.587	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		20	56	0	0	0	0.00278	0	20	56				
UGGT2	55757	broad.mit.edu	37	13	96515938	96515938	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr13:96515938C>A	ENST00000376747.3	-	31	3659	c.3589G>T	c.(3589-3591)Gat>Tat	p.D1197Y		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1197					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.D1197Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						GTAAGGATATCTTCCTTAATT	0.308																																							uc001vmt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3589-3591)GAT>TAT		UDP-glucose ceramide glucosyltransferase-like 2							210.0	200.0	204.0					13																	96515938		2203	4300	6503	SO:0001583	missense	55757				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity	g.chr13:96515938C>A	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3589G>T	13.37:g.96515938C>A	ENSP00000365938:p.Asp1197Tyr		Somatic					p.D1197Y	NM_020121	NP_064506	WXS	Illumina HiSeq	Unspecified	Q9NYU1	UGGG2_HUMAN			31	3759	-			1197					A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	c.3589G>T	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.642966	0.67244	.	.	ENSG00000102595	ENST00000376747	T	0.10860	2.83	5.92	5.08	0.68730	.	0.047862	0.85682	D	0.000000	T	0.34890	0.0913	M	0.86502	2.82	0.80722	D	1	D	0.67145	0.996	P	0.61275	0.886	T	0.36187	-0.9758	10	0.87932	D	0	-18.9096	13.8812	0.63684	0.0:0.9265:0.0:0.0735	.	1197	Q9NYU1	UGGG2_HUMAN	Y	1197	ENSP00000365938:D1197Y	ENSP00000365938:D1197Y	D	-	1	0	UGGT2	95313939	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	4.433000	0.59929	1.515000	0.48885	0.650000	0.86243	GAT		0.308	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121		9	73	1	0	0.00621372	0.006214	0.00656946	9	73				
FGF14	2259	broad.mit.edu	37	13	102375188	102375188	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr13:102375188G>T	ENST00000376143.4	-	5	736	c.737C>A	c.(736-738)aCa>aAa	p.T246K	FGF14_ENST00000376131.4_Missense_Mutation_p.T251K|ITGBL1_ENST00000415285.1_Intron	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	246					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.T246K(1)|p.T251K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGGCTATGTTGTCTTACTCTT	0.498																																							uc001vpe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|large_intestine(1)	4						c.(736-738)ACA>AAA		fibroblast growth factor 14 isoform 1A							282.0	204.0	230.0					13																	102375188		2203	4300	6503	SO:0001583	missense	2259				cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding	g.chr13:102375188G>T		CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.737C>A	13.37:g.102375188G>T	ENSP00000365313:p.Thr246Lys		Somatic				FGF14_uc001vpf.2_Missense_Mutation_p.T251K|FGF14_uc001vpd.1_5'Flank	p.T246K	NM_004115	NP_004106	WXS	Illumina HiSeq	Unspecified	Q92915	FGF14_HUMAN			5	737	-	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		246					Q86YN7|Q96QX6	Missense_Mutation	SNP	ENST00000376143.4	37	c.737C>A	CCDS9501.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.915311	0.73098	.	.	ENSG00000102466	ENST00000376131;ENST00000376143	T;T	0.79247	-1.25;-1.14	5.92	5.92	0.95590	.	0.362323	0.27846	N	0.017616	T	0.78966	0.4367	L	0.29908	0.895	0.80722	D	1	P;P	0.49090	0.575;0.919	B;P	0.51453	0.406;0.67	T	0.80547	-0.1334	10	0.87932	D	0	.	20.3241	0.98686	0.0:0.0:1.0:0.0	.	251;246	Q92915-2;Q92915	.;FGF14_HUMAN	K	251;246	ENSP00000365301:T251K;ENSP00000365313:T246K	ENSP00000365301:T251K	T	-	2	0	FGF14	101173189	1.000000	0.71417	0.958000	0.39756	0.985000	0.73830	7.509000	0.81698	2.812000	0.96745	0.563000	0.77884	ACA		0.498	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045679.2			18	47	1	0	1.00905e-13	0.008871	1.40455e-13	18	47				
OR4N2	390429	broad.mit.edu	37	14	20296431	20296431	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:20296431A>T	ENST00000315947.1	+	1	824	c.824A>T	c.(823-825)cAc>cTc	p.H275L	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H275L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCTCTCTTCCACACAGTGATT	0.433																																							uc010tkv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(823-825)CAC>CTC		olfactory receptor, family 4, subfamily N,							84.0	88.0	86.0					14																	20296431		2203	4300	6503	SO:0001583	missense	390429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20296431A>T		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.824A>T	14.37:g.20296431A>T	ENSP00000319601:p.His275Leu		Somatic					p.H275L	NM_001004723	NP_001004723	WXS	Illumina HiSeq	Unspecified	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	824	+	all_cancers(95;0.00108)		275			Helical; Name=7; (Potential).		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	c.824A>T	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	16.19	3.053686	0.55218	.	.	ENSG00000176294	ENST00000315947	T	0.00027	8.93	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000136	T	0.00178	0.0005	L	0.28192	0.835	0.09310	N	1	D	0.63880	0.993	P	0.58620	0.842	T	0.65063	-0.6259	10	0.56958	D	0.05	-16.0321	12.161	0.54103	1.0:0.0:0.0:0.0	.	275	Q8NGD1	OR4N2_HUMAN	L	275	ENSP00000319601:H275L	ENSP00000319601:H275L	H	+	2	0	OR4N2	19366271	0.204000	0.23447	0.983000	0.44433	0.780000	0.44128	3.149000	0.50655	2.037000	0.60232	0.482000	0.46254	CAC		0.433	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			19	144	0	0	0	0.007413	0	19	144				
OR4K15	81127	broad.mit.edu	37	14	20443788	20443788	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:20443788G>T	ENST00000305051.5	+	1	186	c.111G>T	c.(109-111)gtG>gtT	p.V37V		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V37V(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CAGAATTTGTGTTGCTGGGAC	0.398																																							uc010tkx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(109-111)GTG>GTT		olfactory receptor, family 4, subfamily K,							117.0	125.0	123.0					14																	20443788		2203	4299	6502	SO:0001819	synonymous_variant	81127				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20443788G>T		CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.111G>T	14.37:g.20443788G>T			Somatic					p.V37V	NM_001005486	NP_001005486	WXS	Illumina HiSeq	Unspecified	Q8NH41	OR4KF_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	111	+	all_cancers(95;0.00108)		37			Extracellular (Potential).		B9EIL3|Q6IEZ4	Silent	SNP	ENST00000305051.5	37	c.111G>T	CCDS32026.1																																																																																				0.398	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409883.1			40	155	1	0	1.8453e-21	0.010771	2.97179e-21	40	155				
C14orf28	122525	broad.mit.edu	37	14	45373686	45373686	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:45373686G>A	ENST00000325192.3	+	4	978	c.703G>A	c.(703-705)Gaa>Aaa	p.E235K	C14orf28_ENST00000553841.1_3'UTR|C14orf28_ENST00000557112.1_Missense_Mutation_p.E205K|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	235								p.E235K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						TTGGAAATCTGAAGATCTGGC	0.348																																							uc001wvo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(703-705)GAA>AAA		hypothetical protein LOC122525							157.0	153.0	155.0					14																	45373686		2203	4300	6503	SO:0001583	missense	122525							g.chr14:45373686G>A	AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.703G>A	14.37:g.45373686G>A	ENSP00000326846:p.Glu235Lys		Somatic				C14orf28_uc001wvp.1_Missense_Mutation_p.E235K	p.E235K	NM_001017923	NP_001017923	WXS	Illumina HiSeq	Unspecified	Q4W4Y0	CN028_HUMAN			4	969	+			235						Missense_Mutation	SNP	ENST00000325192.3	37	c.703G>A	CCDS32069.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661817	0.67700	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.28069	1.63;1.63	5.97	5.97	0.96955	.	0.051921	0.85682	D	0.000000	T	0.20251	0.0487	N	0.08118	0	0.54753	D	0.999981	B	0.14805	0.011	B	0.13407	0.009	T	0.04693	-1.0933	10	0.45353	T	0.12	.	17.9074	0.88923	0.0:0.0:1.0:0.0	.	235	Q4W4Y0	CN028_HUMAN	K	235;205	ENSP00000326846:E235K;ENSP00000451791:E205K	ENSP00000326846:E235K	E	+	1	0	C14orf28	44443436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.922000	0.70036	2.835000	0.97688	0.591000	0.81541	GAA		0.348	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923		6	101	0	0	0	0.001168	0	6	101				
PTGDR	5729	broad.mit.edu	37	14	52735015	52735015	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:52735015G>T	ENST00000306051.2	+	1	585	c.483G>T	c.(481-483)ctG>ctT	p.L161L	PTGDR_ENST00000553372.1_Silent_p.L161L	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	161					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)	p.L161L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CCTTCTCCCTGGCTTTCTGCG	0.637																																							uc001wzq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(481-483)CTG>CTT		prostaglandin D2 receptor	Nedocromil(DB00716)						74.0	75.0	74.0					14																	52735015		2203	4300	6503	SO:0001819	synonymous_variant	5729					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding	g.chr14:52735015G>T	U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	ENST00000306051.2:c.483G>T	14.37:g.52735015G>T			Somatic					p.L161L	NM_000953	NP_000944	WXS	Illumina HiSeq	Unspecified	Q13258	PD2R_HUMAN			1	585	+	Breast(41;0.0639)|all_epithelial(31;0.0887)		161			Helical; Name=4; (Potential).		G3V5L3|Q13250|Q13251|Q1ZZ52	Silent	SNP	ENST00000306051.2	37	c.483G>T	CCDS9707.1																																																																																				0.637	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276889.1	NM_000953		43	152	1	0	2.24893e-16	0.009718	3.29605e-16	43	152				
ADAM21P1	145241	broad.mit.edu	37	14	70712902	70712902	+	RNA	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:70712902G>T	ENST00000530196.1	-	0	1616					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGGGGATCCCGTCCTGCACAT	0.448																																							uc010ttg.1		NA																	0					0						c.(964-966)GAC>GAA		SubName: Full=ADAM21-like protein;																																						145241							g.chr14:70712902G>T			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70712902G>T			Somatic					p.D322E	NR_003951		WXS	Illumina HiSeq	Unspecified					1	1617	-									Missense_Mutation	SNP	ENST00000530196.1	37	c.966C>A																																																																																					0.448	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467		14	51	1	0	1.5739e-10	0.004007	2.05646e-10	14	51				
CATSPERB	79820	broad.mit.edu	37	14	92074715	92074715	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:92074715C>A	ENST00000256343.3	-	22	2788	c.2632G>T	c.(2632-2634)Gct>Tct	p.A878S		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	878					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.A878S(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGTGGAATAGCAATTCCCATA	0.299																																							uc001xzs.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|skin(2)|ovary(1)	5						c.(2632-2634)GCT>TCT		cation channel, sperm-associated, beta							105.0	110.0	108.0					14																	92074715		2203	4300	6503	SO:0001583	missense	79820				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr14:92074715C>A	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2632G>T	14.37:g.92074715C>A	ENSP00000256343:p.Ala878Ser		Somatic				CATSPERB_uc010aub.1_Missense_Mutation_p.A400S	p.A878S	NM_024764	NP_079040	WXS	Illumina HiSeq	Unspecified	Q9H7T0	CTSRB_HUMAN			22	2772	-		all_cancers(154;0.0663)|all_epithelial(191;0.236)	878					A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	c.2632G>T	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.625092	0.66901	.	.	ENSG00000133962	ENST00000256343	T	0.55052	0.54	5.58	3.64	0.41730	.	0.227351	0.30850	N	0.008750	T	0.49253	0.1546	L	0.49126	1.545	0.25769	N	0.984859	P	0.46912	0.886	P	0.44673	0.457	T	0.43782	-0.9370	10	0.39692	T	0.17	-16.0447	12.1708	0.54157	0.3086:0.6914:0.0:0.0	.	878	Q9H7T0	CTSRB_HUMAN	S	878	ENSP00000256343:A878S	ENSP00000256343:A878S	A	-	1	0	CATSPERB	91144468	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.506000	0.35747	1.302000	0.44855	0.650000	0.86243	GCT		0.299	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764		10	50	1	0	2.80697e-09	0.010729	3.48669e-09	10	50				
UBR7	55148	broad.mit.edu	37	14	93686679	93686679	+	Nonsense_Mutation	SNP	C	C	T	rs147191980		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr14:93686679C>T	ENST00000013070.6	+	9	1281	c.1045C>T	c.(1045-1047)Cag>Tag	p.Q349*	UBR7_ENST00000416753.1_Nonsense_Mutation_p.Q273*	NM_175748.3	NP_786924.2	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin 7 (putative)	349							ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q349*(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(12)|urinary_tract(1)	19						GAAGATTGCCCAGGCCACTGA	0.418																																							uc001ybm.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1045-1047)CAG>TAG		ubiquitin protein ligase E3 component n-recognin							138.0	137.0	137.0					14																	93686679		2203	4300	6503	SO:0001587	stop_gained	55148						ubiquitin-protein ligase activity|zinc ion binding	g.chr14:93686679C>T	AK001345	CCDS9909.1	14q32.12	2008-06-23	2008-06-23	2008-06-23		ENSG00000012963		"""Ubiquitin protein ligase E3 component n-recognins"""	20344	protein-coding gene	gene with protein product		613816	"""chromosome 14 open reading frame 130"""	C14orf130		18162545	Standard	NM_175748		Approved		uc001ybm.4	Q8N806		ENST00000013070.6:c.1045C>T	14.37:g.93686679C>T	ENSP00000013070:p.Gln349*		Somatic				UBR7_uc001ybn.3_Nonsense_Mutation_p.Q273*|UBR7_uc010auq.2_Nonsense_Mutation_p.Q198*	p.Q349*	NM_175748	NP_786924	WXS	Illumina HiSeq	Unspecified	Q8N806	UBR7_HUMAN			9	1281	+			349					Q86U21|Q86UA9|Q96BY0|Q9NVV6	Nonsense_Mutation	SNP	ENST00000013070.6	37	c.1045C>T	CCDS9909.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.598253|4.598253	0.87055|0.87055	.|.	.|.	ENSG00000012963|ENSG00000012963	ENST00000555329|ENST00000013070;ENST00000535646;ENST00000416753	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.047510	.|0.85682	.|D	.|0.000000	T|.	0.52008|.	0.1708|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39563|.	-0.9608|.	3|.	.|0.06494	.|T	.|0.89	-8.4393|-8.4393	20.0544|20.0544	0.97645|0.97645	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	47|349;273;273	.|.	.|ENSP00000013070:Q349X	P|Q	+|+	2|1	0|0	UBR7|UBR7	92756432|92756432	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.708000|0.708000	0.40852|0.40852	2.162000|2.162000	0.42367|0.42367	2.746000|2.746000	0.94184|0.94184	0.591000|0.591000	0.81541|0.81541	CCA|CAG		0.418	UBR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412693.1	NM_175748		32	138	0	0	0	0.004289	0	32	138				
OR4N3P	390539	broad.mit.edu	37	15	22413749	22413749	+	IGR	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:22413749C>A								RP11-69H14.6 (29941 upstream) : RP11-2F9.4 (20140 downstream)																							CCTACAGAGGCTGCATCACTC	0.517																																							uc001yuf.2		NA																	0					0						c.(46-48)GGC>GGA		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22413749C>A																													15.37:g.22413749C>A			Somatic					p.G16G	NM_001080841	NP_001074310	WXS	Illumina HiSeq	Unspecified					1	48	+									Silent	SNP		37	c.48C>A																																																																																				0	0.517									30	289	1	0	3.03874e-20	0.003271	4.72882e-20	30	289				
NPAP1	23742	broad.mit.edu	37	15	24921511	24921511	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:24921511C>A	ENST00000329468.2	+	1	971	c.497C>A	c.(496-498)cCg>cAg	p.P166Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	166					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P166Q(1)									GATGAGGATCCGGTGCAGATC	0.632																																							uc001ywo.2		NA																	1	Substitution - Missense(1)	p.P166P(1)	lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(496-498)CCG>CAG		hypothetical protein LOC23742							42.0	37.0	39.0					15																	24921511		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921511C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.497C>A	15.37:g.24921511C>A	ENSP00000333735:p.Pro166Gln		Somatic					p.P166Q	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	971	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	166						Missense_Mutation	SNP	ENST00000329468.2	37	c.497C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	0.432	-0.903055	0.02453	.	.	ENSG00000185823	ENST00000329468	T	0.12361	2.69	1.42	-2.84	0.05751	.	5.924710	0.00397	N	0.000042	T	0.06188	0.0160	N	0.14661	0.345	0.09310	N	1	B	0.25105	0.118	B	0.24155	0.051	T	0.18241	-1.0343	10	0.05721	T	0.95	.	2.555	0.04757	0.32:0.4583:0.0:0.2217	.	166	Q9NZP6	CO002_HUMAN	Q	166	ENSP00000333735:P166Q	ENSP00000333735:P166Q	P	+	2	0	C15orf2	22472604	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-3.046000	0.00630	-0.944000	0.03686	0.430000	0.28490	CCG		0.632	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		18	68	1	0	9.16793e-09	0.00499	1.11873e-08	18	68				
GABRA5	2558	broad.mit.edu	37	15	27128544	27128544	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:27128544G>T	ENST00000335625.5	+	6	1225	c.337G>T	c.(337-339)Ggg>Tgg	p.G113W	GABRA5_ENST00000355395.5_Missense_Mutation_p.G113W|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.G113W|GABRA5_ENST00000557449.1_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	113					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G113W(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TCGGTTTAAGGGGCCCATGCA	0.542																																							uc001zbd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(337-339)GGG>TGG		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						105.0	117.0	113.0					15																	27128544		2139	4277	6416	SO:0001583	missense	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27128544G>T		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.337G>T	15.37:g.27128544G>T	ENSP00000335592:p.Gly113Trp		Somatic				GABRB3_uc001zbb.2_Intron	p.G113W	NM_000810	NP_000801	WXS	Illumina HiSeq	Unspecified	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	7	676	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	113			Extracellular (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	c.337G>T	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623198	0.87460	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599;ENST00000554083	T;T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44;-1.15	5.4	5.4	0.78164	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92593	0.7647	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94088	0.7350	10	0.87932	D	0	.	18.53	0.90987	0.0:0.0:1.0:0.0	.	113	P31644	GBRA5_HUMAN	W	113;113;81;113;113;113;81	ENSP00000335592:G113W;ENSP00000347557:G113W;ENSP00000450653:G81W;ENSP00000382953:G113W;ENSP00000450806:G113W;ENSP00000450717:G113W;ENSP00000450529:G81W	ENSP00000335592:G113W	G	+	1	0	GABRA5	24679637	1.000000	0.71417	0.978000	0.43139	0.757000	0.42996	9.597000	0.98273	2.695000	0.91970	0.561000	0.74099	GGG		0.542	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			36	84	1	0	1.57019e-19	0.007835	2.403e-19	36	84				
GABRG3	2567	broad.mit.edu	37	15	27765182	27765182	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:27765182G>A	ENST00000333743.6	+	7	1031	c.777G>A	c.(775-777)caG>caA	p.Q259Q	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	259					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.Q259Q(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCACCATTCAGACATACATTC	0.343																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(775-777)CAG>CAA		gamma-aminobutyric acid (GABA) A receptor, gamma							72.0	67.0	69.0					15																	27765182		1853	4097	5950	SO:0001819	synonymous_variant	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27765182G>A		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.777G>A	15.37:g.27765182G>A			Somatic					p.Q259Q	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	7	943	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	259			Helical; (Probable).		G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	c.777G>A	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	8.179	0.793492	0.16327	.	.	ENSG00000182256	ENST00000451330	.	.	.	5.44	0.945	0.19543	.	.	.	.	.	T	0.59088	0.2168	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52741	-0.8535	4	.	.	.	.	11.009	0.47652	0.2187:0.0:0.7813:0.0	.	.	.	.	K	22	.	.	R	+	2	0	GABRG3	25438777	1.000000	0.71417	0.981000	0.43875	0.980000	0.70556	0.711000	0.25764	0.015000	0.14971	0.650000	0.86243	AGA		0.343	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			3	8	0	0	0	0.009096	0	3	8				
HERC2	8924	broad.mit.edu	37	15	28459224	28459224	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:28459224C>A	ENST00000261609.7	-	41	6661	c.6553G>T	c.(6553-6555)Ggg>Tgg	p.G2185W		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.G2185W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAACCCACCCCTTCGGAAGGC	0.537																																							uc001zbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(6553-6555)GGG>TGG		hect domain and RLD 2							70.0	70.0	70.0					15																	28459224		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28459224C>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6553G>T	15.37:g.28459224C>A	ENSP00000261609:p.Gly2185Trp		Somatic					p.G2185W	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	41	6659	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	2185						Missense_Mutation	SNP	ENST00000261609.7	37	c.6553G>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	8.117	0.780043	0.16120	.	.	ENSG00000128731	ENST00000261609	T	0.39592	1.07	5.43	1.77	0.24775	.	0.485600	0.23440	N	0.048141	T	0.28665	0.0710	L	0.43152	1.355	0.30235	N	0.795537	P	0.47034	0.889	B	0.40101	0.319	T	0.19910	-1.0291	10	0.37606	T	0.19	.	5.011	0.14312	0.0:0.5687:0.1457:0.2855	.	2185	O95714	HERC2_HUMAN	W	2185	ENSP00000261609:G2185W	ENSP00000261609:G2185W	G	-	1	0	HERC2	26132819	1.000000	0.71417	0.232000	0.24009	0.052000	0.14988	2.967000	0.49216	0.421000	0.25980	0.484000	0.47621	GGG		0.537	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		28	71	1	0	1.80694e-10	0.009535	2.34988e-10	28	71				
MGA	23269	broad.mit.edu	37	15	42042148	42042148	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:42042148G>T	ENST00000570161.1	+	16	6343	c.6343G>T	c.(6343-6345)Gaa>Taa	p.E2115*	MGA_ENST00000219905.7_Nonsense_Mutation_p.E2115*|MGA_ENST00000566586.1_Nonsense_Mutation_p.E1906*|MGA_ENST00000545763.1_Nonsense_Mutation_p.E1906*|MGA_ENST00000389936.4_Nonsense_Mutation_p.E2076*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.E2164*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTGAAGGTGGAACAGCAGAA	0.363																																							uc010ucy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(6343-6345)GAA>TAA		MAX-interacting protein isoform 1							62.0	58.0	59.0					15																	42042148		1835	4098	5933	SO:0001587	stop_gained	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42042148G>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6343G>T	15.37:g.42042148G>T	ENSP00000457035:p.Glu2115*		Somatic				MGA_uc010ucz.1_Nonsense_Mutation_p.E1906*|MGA_uc010uda.1_Nonsense_Mutation_p.E731*|MGA_uc001zoi.2_Nonsense_Mutation_p.E329*	p.E2115*	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	17	6524	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	2076			Basic motif.		Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	c.6343G>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776882	0.70107	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	4.53	4.53	0.55603	.	0.723682	0.12381	N	0.473893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	6.2092	0.20619	0.2037:0.0:0.7963:0.0	.	.	.	.	X	2115;2076;1906	.	ENSP00000219905:E2115X	E	+	1	0	MGA	39829440	0.887000	0.30362	0.990000	0.47175	0.413000	0.31143	1.606000	0.36826	2.373000	0.80994	0.467000	0.42956	GAA		0.363	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		8	31	1	0	2.74318e-10	0.006214	3.55075e-10	8	31				
ATP8B4	79895	broad.mit.edu	37	15	50264909	50264909	+	Silent	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:50264909A>T	ENST00000284509.6	-	13	1254	c.1113T>A	c.(1111-1113)ccT>ccA	p.P371P	ATP8B4_ENST00000559829.1_Silent_p.P371P	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	371						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.P371P(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GAGCCACTGCAGGTATTGCTT	0.418																																							uc001zxu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(1111-1113)CCT>CCA		ATPase class I type 8B member 4							74.0	69.0	71.0					15																	50264909		2196	4295	6491	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50264909A>T	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1113T>A	15.37:g.50264909A>T			Somatic				ATP8B4_uc010ber.2_Silent_p.P244P|ATP8B4_uc010ufd.1_Silent_p.P244P|ATP8B4_uc010ufe.1_RNA	p.P371P	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	13	1255	-		all_lung(180;0.00183)	371			Cytoplasmic (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.1113T>A	CCDS32238.1																																																																																				0.418	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		9	30	0	0	0	0.004007	0	9	30				
CCDC33	80125	broad.mit.edu	37	15	74559018	74559018	+	Splice_Site	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:74559018G>C	ENST00000398814.3	+	4	750		c.e4-1		CCDC33_ENST00000321288.5_Splice_Site	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33									p.?(2)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TCTCTTTCCAGATGTGATCCT	0.448																																							uc002axo.2		NA																	2	Unknown(2)		lung(2)	ovary(3)|skin(2)	5						c.e4-1		coiled-coil domain containing 33 isoform 1							138.0	131.0	133.0					15																	74559018		1857	4102	5959	SO:0001630	splice_region_variant	80125						protein binding	g.chr15:74559018G>C	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.320-1G>C	15.37:g.74559018G>C			Somatic				CCDC33_uc002axp.2_5'Flank	p.D107_splice	NM_025055	NP_079331	WXS	Illumina HiSeq	Unspecified	Q8N5R6	CCD33_HUMAN			4	714	+								A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Splice_Site	SNP	ENST00000398814.3	37	c.320_splice	CCDS42058.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553110	0.27739	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.946	0.58373	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC33	72346071	1.000000	0.71417	0.349000	0.25694	0.602000	0.36980	4.830000	0.62745	2.194000	0.70268	0.462000	0.41574	.		0.448	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791	Intron	38	177	0	0	0	0.00874	0	38	177				
ADAMTS7	11173	broad.mit.edu	37	15	79088964	79088964	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:79088964C>A	ENST00000388820.4	-	4	997	c.787G>T	c.(787-789)Gtt>Ttt	p.V263F	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	263	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TAGCTCTCAACCTGCGGCTGT	0.597																																							uc002bej.3		NA																	0					0						c.(787-789)GTT>TTT		ADAM metallopeptidase with thrombospondin type 1							213.0	179.0	191.0					15																	79088964		2196	4293	6489	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79088964C>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.787G>T	15.37:g.79088964C>A	ENSP00000373472:p.Val263Phe		Somatic				ADAMTS7_uc010und.1_Missense_Mutation_p.V263F|ADAMTS7_uc002bek.1_Missense_Mutation_p.V263F	p.V263F	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			4	998	-			263			Peptidase M12B.		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.787G>T	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843853	0.51164	.	.	ENSG00000136378	ENST00000388820;ENST00000456326	T	0.69175	-0.38	5.49	4.56	0.56223	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.079324	0.49916	D	0.000137	T	0.81631	0.4863	M	0.86268	2.805	0.43678	D	0.996113	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.76575	0.983;0.988;0.984	D	0.83916	0.0298	10	0.87932	D	0	.	11.3058	0.49334	0.0:0.9121:0.0:0.0879	.	263;263;263	E7EP58;A8MQ00;Q9UKP4	.;.;ATS7_HUMAN	F	263	ENSP00000373472:V263F	ENSP00000373472:V263F	V	-	1	0	ADAMTS7	76876019	0.730000	0.28100	0.858000	0.33744	0.101000	0.19017	1.487000	0.35540	2.582000	0.87167	0.462000	0.41574	GTT		0.597	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		47	193	1	0	9.59835e-30	0.01441	1.6412e-29	47	193				
ZNF592	9640	broad.mit.edu	37	15	85327613	85327613	+	Silent	SNP	G	G	A	rs376399381		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:85327613G>A	ENST00000560079.2	+	4	1995	c.1707G>A	c.(1705-1707)gcG>gcA	p.A569A	ZNF592_ENST00000299927.3_Silent_p.A569A	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	569					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A569A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCTCTATGCGCCAAATCTCA	0.597																																							uc002bld.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)	6						c.(1705-1707)GCG>GCA		zinc finger protein 592		G		1,4405	2.1+/-5.4	0,1,2202	93.0	97.0	96.0		1707	-1.2	1.0	15		96	0,8598		0,0,4299	no	coding-synonymous	ZNF592	NM_014630.2		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		569/1268	85327613	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85327613G>A	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1707G>A	15.37:g.85327613G>A			Somatic				ZNF592_uc010upb.1_RNA	p.A569A	NM_014630	NP_055445	WXS	Illumina HiSeq	Unspecified	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		4	2043	+			569					Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	37	c.1707G>A	CCDS32317.1																																																																																				0.597	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		27	126	0	0	0	0.00632	0	27	126				
AGBL1	123624	broad.mit.edu	37	15	87217502	87217502	+	Splice_Site	SNP	A	A	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:87217502A>G	ENST00000441037.2	+	22	3014		c.e22-1		AGBL1_ENST00000421325.2_Splice_Site|AGBL1_ENST00000389298.3_Splice_Site	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.?(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TTTAACTGGCAGGGTCTACAG	0.478																																							uc002blz.1		NA																	1	Unknown(1)		lung(1)		0						c.e22-2		ATP/GTP binding protein-like 1							52.0	49.0	50.0					15																	87217502		1970	4174	6144	SO:0001630	splice_region_variant	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:87217502A>G	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2920-1A>G	15.37:g.87217502A>G			Somatic					p.G974_splice	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			22	3000	+								A1A4X5|A6NJH6|C9JHL5	Splice_Site	SNP	ENST00000441037.2	37	c.2920_splice	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.744859	0.69418	.	.	ENSG00000166748	ENST00000421325;ENST00000389298	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.967	0.58490	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGBL1	85018506	1.000000	0.71417	0.987000	0.45799	0.840000	0.47671	5.346000	0.65992	2.068000	0.61886	0.460000	0.39030	.		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	Intron	6	15	0	0	0	0.001984	0	6	15				
FES	2242	broad.mit.edu	37	15	91434895	91434895	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:91434895G>A	ENST00000328850.3	+	12	1784	c.1642G>A	c.(1642-1644)Gct>Act	p.A548T	FES_ENST00000450438.2_Missense_Mutation_p.A420T|FES_ENST00000444422.2_Missense_Mutation_p.A478T|FES_ENST00000414248.2_Missense_Mutation_p.A420T|FES_ENST00000394302.1_Missense_Mutation_p.A420T|FES_ENST00000394300.3_Missense_Mutation_p.A490T	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	548	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)	p.A548T(1)		lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CCTGCACAGGGCTGTGCCCAA	0.622																																							uc002bpv.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1642-1644)GCT>ACT		feline sarcoma oncogene isoform 1							83.0	67.0	72.0					15																	91434895		2198	4298	6496	SO:0001583	missense	2242				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr15:91434895G>A	X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.1642G>A	15.37:g.91434895G>A	ENSP00000331504:p.Ala548Thr		Somatic				FES_uc010uqj.1_Missense_Mutation_p.A420T|FES_uc010uqk.1_Missense_Mutation_p.A530T|FES_uc002bpw.2_RNA|FES_uc010bny.2_Missense_Mutation_p.A420T|FES_uc002bpx.2_Missense_Mutation_p.A478T|FES_uc002bpy.2_Missense_Mutation_p.A490T	p.A548T	NM_002005	NP_001996	WXS	Illumina HiSeq	Unspecified	P07332	FES_HUMAN	Lung(145;0.229)		12	1738	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		548			SH2.		B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	ENST00000328850.3	37	c.1642G>A	CCDS10365.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909458	0.52439	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.75938	-0.86;-0.84;-0.98;-0.83;-0.86;-0.84	5.15	4.23	0.50019	Protein kinase-like domain (1);SH2 motif (1);	0.112873	0.64402	D	0.000011	T	0.79997	0.4543	M	0.76574	2.34	0.39344	D	0.965635	B;P;D;P;B;B	0.60160	0.166;0.919;0.987;0.944;0.084;0.166	B;P;P;P;B;B	0.51135	0.028;0.66;0.499;0.472;0.075;0.062	T	0.82831	-0.0263	10	0.51188	T	0.08	-17.6572	14.7092	0.69215	0.0:0.275:0.725:0.0	.	530;420;420;490;478;548	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	T	548;420;420;478;490;420	ENSP00000331504:A548T;ENSP00000414629:A420T;ENSP00000377839:A420T;ENSP00000400868:A478T;ENSP00000377837:A490T;ENSP00000409915:A420T	ENSP00000331504:A548T	A	+	1	0	FES	89235899	0.870000	0.30015	0.048000	0.18961	0.095000	0.18619	1.559000	0.36320	1.180000	0.42898	-0.273000	0.10243	GCT		0.622	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005		4	111	0	0	0	0.009096	0	4	111				
LRRK1	79705	broad.mit.edu	37	15	101601410	101601410	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:101601410A>T	ENST00000388948.3	+	30	5073	c.4714A>T	c.(4714-4716)Atg>Ttg	p.M1572L	LRRK1_ENST00000284395.5_Missense_Mutation_p.M1569L|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.M1584L(1)|p.M1572L(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAAGGGCCTCATGGAGGTGCA	0.617																																							uc002bwr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(4714-4716)ATG>TTG		leucine-rich repeat kinase 1							82.0	95.0	91.0					15																	101601410		2109	4236	6345	SO:0001583	missense	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101601410A>T	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4714A>T	15.37:g.101601410A>T	ENSP00000373600:p.Met1572Leu		Somatic				LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	p.M1572L	NM_024652	NP_078928	WXS	Illumina HiSeq	Unspecified	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		30	5033	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		1572						Missense_Mutation	SNP	ENST00000388948.3	37	c.4714A>T	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	A	2.198	-0.383705	0.04966	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.69685	-0.42;-0.42	5.46	0.741	0.18336	.	0.735454	0.13100	N	0.413841	T	0.33177	0.0854	N	0.02539	-0.55	0.18873	N	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.24870	-1.0148	10	0.07030	T	0.85	.	8.3868	0.32505	0.5888:0.2207:0.1905:0.0	.	1572	Q38SD2	LRRK1_HUMAN	L	1572;1569;263;126	ENSP00000373600:M1572L;ENSP00000284395:M1569L	ENSP00000284395:M1569L	M	+	1	0	LRRK1	99418933	0.896000	0.30565	0.847000	0.33407	0.843000	0.47879	1.336000	0.33850	0.221000	0.20879	-0.406000	0.06334	ATG		0.617	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		12	48	0	0	0	0.013537	0	12	48				
DNM1P47	100216544	broad.mit.edu	37	15	102292829	102292829	+	RNA	SNP	C	C	G	rs543677577		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr15:102292829C>G	ENST00000561463.1	+	0	875									DNM1 pseudogene 47									p.H139Q(1)									CGAGAAGACACTCGTGGAGGC	0.597																																							uc010usj.1		NA																	1	Substitution - Missense(1)		kidney(1)		NA						c.(415-417)CAC>CAG		RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																																						0							g.chr15:102292829C>G	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292829C>G			Somatic				uc002bxo.2_5'Flank|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank	p.H139Q			WXS	Illumina HiSeq	Unspecified					4	476	+									Missense_Mutation	SNP	ENST00000561463.1	37	c.417C>G																																																																																					0.597	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		2	7	0	0	0	0.004672	0	2	7				
NARFL	64428	broad.mit.edu	37	16	781625	781625	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:781625C>A	ENST00000251588.2	-	9	990	c.974G>T	c.(973-975)cGg>cTg	p.R325L	NARFL_ENST00000568545.1_Missense_Mutation_p.R223L|NARFL_ENST00000540986.1_Missense_Mutation_p.R223L|NARFL_ENST00000562862.1_5'UTR|NARFL_ENST00000301694.5_3'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	325					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)	p.R325L(1)		autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				GGCCGCGTGCCGGAACACGTG	0.662																																							uc002cjr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(973-975)CGG>CTG		nuclear prelamin A recognition factor-like							35.0	30.0	32.0					16																	781625		2161	4267	6428	SO:0001583	missense	64428				iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding	g.chr16:781625C>A	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.974G>T	16.37:g.781625C>A	ENSP00000251588:p.Arg325Leu		Somatic				NARFL_uc002cjp.2_Missense_Mutation_p.R223L|NARFL_uc002cjq.2_Missense_Mutation_p.R223L|NARFL_uc002cjs.2_Missense_Mutation_p.R107L|NARFL_uc010uuq.1_Missense_Mutation_p.G134C	p.R325L	NM_022493	NP_071938	WXS	Illumina HiSeq	Unspecified	Q9H6Q4	NARFL_HUMAN			9	986	-		Hepatocellular(780;0.0218)	325					A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	ENST00000251588.2	37	c.974G>T	CCDS10425.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047925	0.55110	.	.	ENSG00000103245	ENST00000251588;ENST00000540986	T;T	0.46819	0.86;0.86	5.31	2.16	0.27623	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.290817	0.36002	N	0.002858	T	0.50086	0.1595	M	0.83953	2.67	0.80722	D	1	B	0.25743	0.133	B	0.28638	0.092	T	0.53975	-0.8362	10	0.72032	D	0.01	-32.5391	9.9396	0.41572	0.0:0.6936:0.0:0.3064	.	325	Q9H6Q4	NARFL_HUMAN	L	325;223	ENSP00000251588:R325L;ENSP00000444008:R223L	ENSP00000251588:R325L	R	-	2	0	NARFL	721626	0.076000	0.21285	1.000000	0.80357	0.863000	0.49368	0.364000	0.20325	0.570000	0.29347	0.511000	0.50034	CGG		0.662	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242855.1	NM_022493		3	3	1	0	0.004672	0.004672	0.00495841	3	3				
ZP2	7783	broad.mit.edu	37	16	21213575	21213575	+	Silent	SNP	G	G	A	rs182866863	byFrequency	TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:21213575G>A	ENST00000574002.1	-	12	1619	c.1137C>T	c.(1135-1137)gaC>gaT	p.D379D	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Silent_p.D379D|ZP2_ENST00000219593.4_Silent_p.D379D			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	379	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)	p.D379D(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		AGACCTCGACGTCCATAAACC	0.512													G|||	3	0.000599042	0.0	0.0	5008	,	,		20016	0.003		0.0	False		,,,				2504	0.0						uc002dii.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1135-1137)GAC>GAT		zona pellucida glycoprotein 2 preproprotein		G		0,4400		0,0,2200	89.0	81.0	84.0		1137	2.0	0.1	16		84	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	ZP2	NM_003460.1		0,4,6496	AA,AG,GG		0.0465,0.0,0.0308		379/746	21213575	4,12996	2200	4300	6500	SO:0001819	synonymous_variant	7783				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity	g.chr16:21213575G>A	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1137C>T	16.37:g.21213575G>A			Somatic				ZP2_uc010bwn.1_Silent_p.D418D	p.D379D	NM_003460	NP_003451	WXS	Illumina HiSeq	Unspecified	Q05996	ZP2_HUMAN		GBM - Glioblastoma multiforme(48;0.0573)	11	1137	-			379			Extracellular (Potential).|ZP.		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Silent	SNP	ENST00000574002.1	37	c.1137C>T	CCDS10596.1																																																																																				0.512	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			4	40	0	0	0	0.000602	0	4	40				
ZNF423	23090	broad.mit.edu	37	16	49671380	49671380	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:49671380C>G	ENST00000561648.1	-	4	1736	c.1683G>C	c.(1681-1683)gaG>gaC	p.E561D	ZNF423_ENST00000562520.1_Missense_Mutation_p.E501D|ZNF423_ENST00000563137.2_Missense_Mutation_p.E501D|ZNF423_ENST00000535559.1_Missense_Mutation_p.E444D|ZNF423_ENST00000262383.2_Missense_Mutation_p.E561D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E501D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E444D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	561					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E561D(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AGGAATAGACCTCCATGAAGG	0.577																																							uc002efs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(1681-1683)GAG>GAC		zinc finger protein 423							124.0	120.0	121.0					16																	49671380		2198	4300	6498	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49671380C>G	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1683G>C	16.37:g.49671380C>G	ENSP00000455426:p.Glu561Asp		Somatic				ZNF423_uc010vgn.1_Missense_Mutation_p.E444D	p.E561D	NM_015069	NP_055884	WXS	Illumina HiSeq	Unspecified	Q2M1K9	ZN423_HUMAN			5	1981	-		all_cancers(37;0.0155)	561					O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.1683G>C	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093916	0.36952	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.10005	2.92;2.96	4.99	1.4	0.22301	.	0.000000	0.85682	D	0.000000	T	0.16642	0.0400	L	0.29908	0.895	0.42819	D	0.993981	D	0.71674	0.998	D	0.79108	0.992	T	0.02288	-1.1182	9	.	.	.	.	8.9702	0.35901	0.0:0.588:0.0:0.412	.	561	Q2M1K9	ZN423_HUMAN	D	561;444	ENSP00000262383:E561D;ENSP00000442321:E444D	.	E	-	3	2	ZNF423	48228881	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.125000	0.31332	0.501000	0.28013	0.561000	0.74099	GAG		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		29	95	0	0	0	0.012213	0	29	95				
CDH8	1006	broad.mit.edu	37	16	61761098	61761098	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:61761098C>A	ENST00000577390.1	-	9	2390	c.1436G>T	c.(1435-1437)cGa>cTa	p.R479L	CDH8_ENST00000577730.1_Missense_Mutation_p.R479L|CDH8_ENST00000584337.1_Missense_Mutation_p.R479L|CDH8_ENST00000299345.6_Missense_Mutation_p.R479L	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	479	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.R479L(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AACAGGTACTCGTGATATCTG	0.408																																							uc002eog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(2)|breast(1)	9						c.(1435-1437)CGA>CTA		cadherin 8, type 2 preproprotein							182.0	165.0	171.0					16																	61761098		2203	4299	6502	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61761098C>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1436G>T	16.37:g.61761098C>A	ENSP00000462701:p.Arg479Leu		Somatic				CDH8_uc002eoh.2_Missense_Mutation_p.R248L	p.R479L	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	9	1688	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	479			Extracellular (Potential).|Cadherin 4.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.1436G>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	34	5.308979	0.95629	.	.	ENSG00000150394	ENST00000299345	T	0.01745	4.66	5.75	5.75	0.90469	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	L	0.58669	1.825	0.80722	D	1	D;D	0.56968	0.962;0.978	P;D	0.64321	0.879;0.924	T	0.01561	-1.1324	10	0.54805	T	0.06	.	19.9498	0.97195	0.0:1.0:0.0:0.0	.	295;479	Q3LID3;P55286	.;CADH8_HUMAN	L	479	ENSP00000299345:R479L	ENSP00000299345:R479L	R	-	2	0	CDH8	60318599	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.458000	0.66679	2.715000	0.92844	0.650000	0.86243	CGA		0.408	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		29	124	1	0	5.91797e-21	0.012213	9.47559e-21	29	124				
HAS3	3038	broad.mit.edu	37	16	69148656	69148656	+	Silent	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:69148656A>T	ENST00000306560.1	+	4	1305	c.1149A>T	c.(1147-1149)tcA>tcT	p.S383S	HAS3_ENST00000569188.1_Silent_p.S383S|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	383					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.S383S(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		CCTACGAGTCAGTGGTCACGG	0.547																																							uc010cfh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1147-1149)TCA>TCT		hyaluronan synthase 3 isoform a							152.0	131.0	138.0					16																	69148656		2198	4300	6498	SO:0001819	synonymous_variant	3038				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity	g.chr16:69148656A>T	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1149A>T	16.37:g.69148656A>T			Somatic				HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Silent_p.S383S	p.S383S	NM_005329	NP_005320	WXS	Illumina HiSeq	Unspecified	O00219	HAS3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0694)	4	1373	+		Ovarian(137;0.101)	383			Helical; Name=3; (Potential).		A8K5T5|Q8WTZ0|Q9NYP0	Silent	SNP	ENST00000306560.1	37	c.1149A>T	CCDS10871.1																																																																																				0.547	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612		58	130	0	0	0	0.01441	0	58	130				
NFAT5	10725	broad.mit.edu	37	16	69726307	69726307	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:69726307G>T	ENST00000354436.2	+	12	2843	c.2525G>T	c.(2524-2526)aGc>aTc	p.S842I	NFAT5_ENST00000567239.1_Missense_Mutation_p.S859I|NFAT5_ENST00000393742.2_Missense_Mutation_p.S766I|NFAT5_ENST00000432919.1_Missense_Mutation_p.S860I|NFAT5_ENST00000566899.1_Missense_Mutation_p.S766I|NFAT5_ENST00000349945.1_Missense_Mutation_p.S766I	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	842					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S860I(1)|p.S766I(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGTGGTGTAAGCCCTGGAATG	0.403																																							uc002exm.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2524-2526)AGC>ATC		nuclear factor of activated T-cells 5 isoform c							120.0	119.0	119.0					16																	69726307		2198	4300	6498	SO:0001583	missense	10725				excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:69726307G>T	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2525G>T	16.37:g.69726307G>T	ENSP00000346420:p.Ser842Ile		Somatic				NFAT5_uc002exi.2_Missense_Mutation_p.S766I|NFAT5_uc002exj.1_Missense_Mutation_p.S766I|NFAT5_uc002exk.1_Missense_Mutation_p.S766I|NFAT5_uc002exl.1_Missense_Mutation_p.S860I|NFAT5_uc002exn.1_Missense_Mutation_p.S859I|NFAT5_uc002exo.1_5'Flank	p.S842I	NM_006599	NP_006590	WXS	Illumina HiSeq	Unspecified	O94916	NFAT5_HUMAN			12	3733	+			842					A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	c.2525G>T	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634574	0.29068	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.49720	0.82;0.77;0.82;0.77	6.17	4.24	0.50183	.	0.199062	0.52532	D	0.000062	T	0.36991	0.0987	L	0.44542	1.39	0.32272	N	0.568767	P;P;P	0.37955	0.612;0.612;0.612	B;B;B	0.34722	0.188;0.188;0.188	T	0.51004	-0.8760	10	0.52906	T	0.07	-2.9606	8.962	0.35854	0.2911:0.0:0.7089:0.0	.	859;842;860	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	I	860;859;766;842;766	ENSP00000396538:S860I;ENSP00000338806:S766I;ENSP00000346420:S842I;ENSP00000377343:S766I	ENSP00000338806:S766I	S	+	2	0	NFAT5	68283808	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.303000	0.43646	0.945000	0.37605	0.655000	0.94253	AGC		0.403	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714		59	150	1	0	1.20869e-33	0.01441	2.09255e-33	59	150				
GAN	8139	broad.mit.edu	37	16	81410934	81410934	+	Splice_Site	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:81410934G>C	ENST00000568107.2	+	10	1774		c.e10+1			NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin						cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				CTTGATACAGGTAAGAGTGTT	0.408																																					GBM(106;1239 1507 7582 9741 33976)	GBM(106;1239 1507 7582 9741 33976)	uc002fgo.2		NA																	1	Unknown(1)		lung(1)	ovary(2)	2						c.e10+1		gigaxonin							205.0	199.0	201.0					16																	81410934		2201	4300	6501	SO:0001630	splice_region_variant	8139				cell death	cytoplasm|neurofilament	protein binding	g.chr16:81410934G>C	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1612+1G>C	16.37:g.81410934G>C			Somatic					p.G538_splice	NM_022041	NP_071324	WXS	Illumina HiSeq	Unspecified	Q9H2C0	GAN_HUMAN			10	1760	+		Colorectal(91;0.153)							Splice_Site	SNP	ENST00000568107.2	37	c.1612_splice	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706677	0.68615	.	.	ENSG00000127688	ENST00000248272	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1252	0.97977	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GAN	79968435	1.000000	0.71417	0.999000	0.59377	0.645000	0.38454	7.301000	0.78850	2.758000	0.94735	0.591000	0.81541	.		0.408	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		Intron	45	308	0	0	0	0.011902	0	45	308				
ZNF778	197320	broad.mit.edu	37	16	89294225	89294225	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr16:89294225G>T	ENST00000433976.2	+	6	1777	c.1445G>T	c.(1444-1446)tGt>tTt	p.C482F	ZNF778_ENST00000306502.6_Missense_Mutation_p.C440F|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	482					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C482F(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TGTAAGCAGTGTGGCAAAGCC	0.493																																							uc002fmv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1444-1446)TGT>TTT		zinc finger protein 778							71.0	75.0	74.0					16																	89294225		2192	4298	6490	SO:0001583	missense	197320				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:89294225G>T	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1445G>T	16.37:g.89294225G>T	ENSP00000405289:p.Cys482Phe		Somatic				ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Missense_Mutation_p.C440F|ZNF778_uc010vpg.1_Missense_Mutation_p.C245F	p.C482F	NM_182531	NP_872337	WXS	Illumina HiSeq	Unspecified	Q96MU6	ZN778_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0269)	6	1784	+			482			C2H2-type 10.		Q08AG0	Missense_Mutation	SNP	ENST00000433976.2	37	c.1445G>T	CCDS45550.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099320	0.76983	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	D;D	0.85861	-2.04;-2.04	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93491	0.7923	H	0.96430	3.82	0.33168	D	0.54793	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92557	0.6055	9	0.87932	D	0	.	8.1571	0.31176	0.0:0.0:1.0:0.0	.	440;482	Q96MU6-2;Q96MU6	.;ZN778_HUMAN	F	482;440	ENSP00000405289:C482F;ENSP00000305203:C440F	ENSP00000305203:C440F	C	+	2	0	ZNF778	87821726	1.000000	0.71417	0.869000	0.34112	0.702000	0.40608	6.677000	0.74503	0.916000	0.36871	0.545000	0.68477	TGT		0.493	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430383.1	NM_182531		12	66	1	0	9.05144e-12	0.001855	1.22904e-11	12	66				
C17orf85	55421	broad.mit.edu	37	17	3721736	3721736	+	Silent	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:3721736G>C	ENST00000389005.4	-	10	1158	c.1131C>G	c.(1129-1131)ctC>ctG	p.L377L	C17orf85_ENST00000158149.3_Silent_p.L97L	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	377							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L97L(1)|p.L377L(1)		endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		TGAGAGCCGGGAGCTCCTCGT	0.542																																							uc010ckl.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(1129-1131)CTC>CTG		ELG protein isoform a							95.0	91.0	93.0					17																	3721736		2203	4300	6503	SO:0001819	synonymous_variant	55421						nucleotide binding	g.chr17:3721736G>C		CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.1131C>G	17.37:g.3721736G>C			Somatic				C17orf85_uc002fwr.2_Silent_p.L87L|C17orf85_uc002fwq.2_Silent_p.L97L	p.L377L	NM_001114118	NP_001107590	WXS	Illumina HiSeq	Unspecified	Q53F19	CQ085_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)	10	1154	-			377					B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Silent	SNP	ENST00000389005.4	37	c.1131C>G	CCDS45578.1																																																																																				0.542	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438385.1	NM_018553		27	104	0	0	0	0.010818	0	27	104				
C17orf74	201243	broad.mit.edu	37	17	7330250	7330250	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:7330250C>T	ENST00000333870.3	+	3	1014	c.940C>T	c.(940-942)Cgg>Tgg	p.R314W	RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_3'UTR	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	314						integral component of membrane (GO:0016021)		p.R314W(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				CTGGGATCAGCGGCGTCGTGG	0.706																																							uc002ggw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(940-942)CGG>TGG		hypothetical protein LOC201243							27.0	29.0	29.0					17																	7330250		2021	4166	6187	SO:0001583	missense	201243					integral to membrane		g.chr17:7330250C>T	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.940C>T	17.37:g.7330250C>T	ENSP00000328061:p.Arg314Trp		Somatic				FGF11_uc010vtw.1_Intron	p.R314W	NM_175734	NP_783861	WXS	Illumina HiSeq	Unspecified	Q0P670	CQ074_HUMAN			3	1013	+		Prostate(122;0.157)	314						Missense_Mutation	SNP	ENST00000333870.3	37	c.940C>T	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	c	10.18	1.277994	0.23307	.	.	ENSG00000184560	ENST00000333870	T	0.36520	1.25	4.58	-0.0995	0.13624	.	0.485933	0.15514	N	0.258404	T	0.17323	0.0416	N	0.14661	0.345	0.09310	N	0.999998	B	0.17667	0.023	B	0.17433	0.018	T	0.13710	-1.0499	10	0.42905	T	0.14	-4.8172	3.9079	0.09190	0.1675:0.521:0.0:0.3115	.	314	Q0P670	CQ074_HUMAN	W	314	ENSP00000328061:R314W	ENSP00000328061:R314W	R	+	1	2	C17orf74	7270974	0.001000	0.12720	0.664000	0.29753	0.013000	0.08279	-0.474000	0.06607	0.130000	0.18549	-0.342000	0.07992	CGG		0.706	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734		11	47	0	0	0	0.003163	0	11	47				
MYH4	4622	broad.mit.edu	37	17	10355258	10355258	+	Splice_Site	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:10355258C>A	ENST00000255381.2	-	27	3848	c.3738G>T	c.(3736-3738)aaG>aaT	p.K1246N	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1246					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.K1246N(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TAATGAAGACCTTGGCTTTGG	0.388																																							uc002gmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(3736-3738)AAG>AAT		myosin, heavy polypeptide 4, skeletal muscle							122.0	102.0	108.0					17																	10355258		2203	4300	6503	SO:0001630	splice_region_variant	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10355258C>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3738+1G>T	17.37:g.10355258C>A			Somatic				uc002gml.1_Intron	p.K1246N	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			27	3849	-			1246			Potential.			Missense_Mutation	SNP	ENST00000255381.2	37	c.3738G>T	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822202	0.71028	.	.	ENSG00000141048	ENST00000255381	D	0.83591	-1.74	5.6	5.6	0.85130	Myosin tail (1);	0.000000	0.39146	U	0.001450	D	0.93530	0.7935	H	0.96333	3.805	0.58432	D	0.999999	D	0.76494	0.999	D	0.76071	0.987	D	0.94704	0.7886	9	.	.	.	.	13.2246	0.59907	0.0:0.9271:0.0:0.0729	.	1246	Q9Y623	MYH4_HUMAN	N	1246	ENSP00000255381:K1246N	.	K	-	3	2	MYH4	10295983	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.987000	0.70571	2.797000	0.96272	0.650000	0.86243	AAG		0.388	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	Missense_Mutation	37	117	1	0	6.04917e-29	0.006999	1.02172e-28	37	117				
DNAH9	1770	broad.mit.edu	37	17	11593391	11593391	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:11593391G>T	ENST00000262442.4	+	20	4320	c.4252G>T	c.(4252-4254)Gat>Tat	p.D1418Y	DNAH9_ENST00000454412.2_Missense_Mutation_p.D1418Y	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1418	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.D1418Y(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCACTATGAGGATGAGGTCCG	0.562																																							uc002gne.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(4252-4254)GAT>TAT		dynein, axonemal, heavy chain 9 isoform 2							47.0	42.0	44.0					17																	11593391		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11593391G>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4252G>T	17.37:g.11593391G>T	ENSP00000262442:p.Asp1418Tyr		Somatic				DNAH9_uc010coo.2_Missense_Mutation_p.D712Y	p.D1418Y	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	20	4320	+		Breast(5;0.0122)|all_epithelial(5;0.131)	1418			Stem (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.4252G>T	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479401	0.84747	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.63096	-0.02;-0.02	5.84	5.84	0.93424	Dynein heavy chain, domain-2 (1);	0.200598	0.42420	D	0.000718	D	0.87140	0.6103	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.90647	0.4579	10	0.87932	D	0	.	20.1379	0.98040	0.0:0.0:1.0:0.0	.	1418	Q9NYC9	DYH9_HUMAN	Y	1418	ENSP00000262442:D1418Y;ENSP00000414874:D1418Y	ENSP00000262442:D1418Y	D	+	1	0	DNAH9	11534116	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.869000	0.99810	2.779000	0.95612	0.655000	0.94253	GAT		0.562	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		11	52	1	0	5.16669e-11	0.010729	6.84771e-11	11	52				
RHBDL3	162494	broad.mit.edu	37	17	30611731	30611731	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:30611731G>A	ENST00000269051.4	+	3	203	c.189G>A	c.(187-189)ctG>ctA	p.L63L	RHBDL3_ENST00000536287.1_Intron|RHBDL3_ENST00000538145.1_Silent_p.L55L	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	63	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.L63L(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				GGAGTCTTCTGGAGAGCCACA	0.587																																							uc002hhe.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(187-189)CTG>CTA		rhomboid protease 3							77.0	72.0	74.0					17																	30611731		2203	4300	6503	SO:0001819	synonymous_variant	162494				proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity	g.chr17:30611731G>A	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.189G>A	17.37:g.30611731G>A			Somatic				RHBDL3_uc010csw.1_Silent_p.L55L|RHBDL3_uc010csx.1_Silent_p.L63L|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	p.L63L	NM_138328	NP_612201	WXS	Illumina HiSeq	Unspecified	P58872	RHBL3_HUMAN			3	203	+		Breast(31;0.116)|Ovarian(249;0.182)	63			EF-hand 1.		A6NMH1|Q495Y4|Q495Y5|Q495Y6	Silent	SNP	ENST00000269051.4	37	c.189G>A	CCDS32613.1																																																																																				0.587	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328		17	59	0	0	0	0.004007	0	17	59				
MYO19	80179	broad.mit.edu	37	17	34883509	34883509	+	Missense_Mutation	SNP	C	C	A	rs369758596		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:34883509C>A	ENST00000431794.3	-	5	695	c.173G>T	c.(172-174)cGg>cTg	p.R58L	MYO19_ENST00000268852.9_Missense_Mutation_p.R58L|MYO19_ENST00000544606.1_Intron|MYO19_ENST00000586007.1_Missense_Mutation_p.R58L	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	58	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R58L(2)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGCCATGTACCGGGCCTGCAG	0.517																																							uc010wcy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(172-174)CGG>CTG		myosin XIX isoform 2							69.0	72.0	71.0					17																	34883509		2013	4180	6193	SO:0001583	missense	80179					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr17:34883509C>A	BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.173G>T	17.37:g.34883509C>A	ENSP00000409936:p.Arg58Leu		Somatic				MYO19_uc002hmw.2_Missense_Mutation_p.R58L|MYO19_uc010cuu.2_RNA|MYO19_uc010wcz.1_RNA|MYO19_uc010wda.1_Intron|MYO19_uc002hmx.2_Missense_Mutation_p.R58L	p.R58L	NM_001163735	NP_001157207	WXS	Illumina HiSeq	Unspecified	Q96H55	MYO19_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	6	1165	-		Breast(25;0.00957)|Ovarian(249;0.17)	58			Myosin head-like.		Q59GS4|Q9H5X2	Missense_Mutation	SNP	ENST00000431794.3	37	c.173G>T	CCDS54112.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381125	0.95945	.	.	ENSG00000141140	ENST00000431794;ENST00000268852	D;D	0.98512	-4.97;-4.97	5.35	5.35	0.76521	Myosin head, motor domain (2);	0.000000	0.38492	N	0.001674	D	0.99315	0.9760	H	0.95574	3.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.999	D	0.98839	1.0754	10	0.87932	D	0	.	18.5892	0.91202	0.0:1.0:0.0:0.0	.	58;58;58	Q96H55;Q96H55-2;Q96H55-4	MYO19_HUMAN;.;.	L	58	ENSP00000409936:R58L;ENSP00000268852:R58L	ENSP00000268852:R58L	R	-	2	0	MYO19	31957622	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.254000	0.78329	2.941000	0.99782	0.655000	0.94253	CGG		0.517	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109		11	37	1	0	6.40141e-05	0.010729	7.17891e-05	11	37				
MRM1	79922	broad.mit.edu	37	17	34964761	34964761	+	Silent	SNP	A	A	G	rs367759770		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:34964761A>G	ENST00000585770.1	+	5	645	c.387A>G	c.(385-387)caA>caG	p.Q129Q	MRM1_ENST00000250156.7_Silent_p.Q324Q					mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)									p.Q324Q(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		AAGACCCCCAAGAACCCTCAG	0.567																																							uc002hne.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(970-972)CAA>CAG		mitochondrial rRNA methyltransferase 1 homolog		A		0,4406		0,0,2203	124.0	128.0	127.0		972	-1.8	0.0	17		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MRM1	NM_024864.3		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		324/354	34964761	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79922				RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity	g.chr17:34964761A>G	AK026231	CCDS32631.1	17q12	2014-05-06			ENSG00000129282	ENSG00000278619			26202	protein-coding gene	gene with protein product						24036117	Standard	NM_024864		Approved	FLJ22578	uc002hne.3	Q6IN84	OTTHUMG00000188443	ENST00000585770.1:c.387A>G	17.37:g.34964761A>G			Somatic				MRM1_uc002hnf.2_Silent_p.Q129Q	p.Q324Q	NM_024864	NP_079140	WXS	Illumina HiSeq	Unspecified	Q6IN84	MRM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)	5	1187	+		Breast(25;0.00957)|Ovarian(249;0.17)	324						Silent	SNP	ENST00000585770.1	37	c.972A>G																																																																																					0.567	MRM1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000451392.1	NM_024864		63	247	0	0	0	0.01441	0	63	247				
MLX	6945	broad.mit.edu	37	17	40720536	40720536	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:40720536A>G	ENST00000246912.4	+	3	343	c.290A>G	c.(289-291)aAt>aGt	p.N97S	MLX_ENST00000346833.4_Intron|MLX_ENST00000435881.2_Missense_Mutation_p.N43S	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	97					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.N97S(1)		kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TCCAGAGCTAATAGCATCGGT	0.547																																					GBM(121;657 1601 4665 24731 34640)	GBM(121;657 1601 4665 24731 34640)	uc002iag.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(289-291)AAT>AGT		transcription factor-like protein 4 isoform							151.0	152.0	152.0					17																	40720536		2203	4300	6503	SO:0001583	missense	6945				energy reserve metabolic process|negative regulation of transcription, DNA-dependent|positive regulation of cellular metabolic process	cytoplasm|nucleus	DNA binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr17:40720536A>G	AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.290A>G	17.37:g.40720536A>G	ENSP00000246912:p.Asn97Ser		Somatic				MLX_uc002iaf.2_Missense_Mutation_p.N43S|MLX_uc002iah.2_Intron	p.N97S	NM_170607	NP_733752	WXS	Illumina HiSeq	Unspecified	Q9UH92	MLX_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.129)	3	355	+		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)	97			Helix-loop-helix motif.		A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Missense_Mutation	SNP	ENST00000246912.4	37	c.290A>G	CCDS11430.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.000244	0.35320	.	.	ENSG00000108788	ENST00000246912;ENST00000435881	T;T	0.79749	-1.3;-0.98	5.4	5.4	0.78164	.	0.138074	0.64402	N	0.000005	T	0.57829	0.2080	N	0.04959	-0.14	0.80722	D	1	B;B	0.31599	0.33;0.017	B;B	0.24974	0.057;0.009	T	0.62859	-0.6765	10	0.02654	T	1	-19.2461	15.2516	0.73552	1.0:0.0:0.0:0.0	.	97;43	Q9UH92;Q9UH92-3	MLX_HUMAN;.	S	97;43	ENSP00000246912:N97S;ENSP00000416627:N43S	ENSP00000246912:N97S	N	+	2	0	MLX	37974062	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.003000	0.93577	2.270000	0.75569	0.459000	0.35465	AAT		0.547	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450415.1	NM_170607		68	254	0	0	0	0.01441	0	68	254				
PRKCA	5578	broad.mit.edu	37	17	64785039	64785040	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:64785039_64785040GG>TT	ENST00000413366.3	+	16	1822_1823	c.1796_1797GG>TT	c.(1795-1797)aGG>aTT	p.R599I	MIR634_ENST00000385208.1_RNA	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	599	AGC-kinase C-terminal.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.R599I(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TTCTTCCGGAGGATCGACTGGG	0.564																																							uc002jfp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(1795-1797)AGG>ATT		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)																																			SO:0001583	missense	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64785039_64785040GG>TT		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		Exception_encountered	17.37:g.64785039_64785040delinsTT	ENSP00000408695:p.Arg599Ile		Somatic					p.R599I	NM_002737	NP_002728	WXS	Illumina HiSeq	Unspecified	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		16	1840_1841	+			599			AGC-kinase C-terminal.		B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	DNP	ENST00000413366.3	37	c.1796_1797GG>TT	CCDS11664.1																																																																																				0.564	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			28	103	0	0	0	0.004672	0	28	103				
UNC13D	201294	broad.mit.edu	37	17	73836332	73836332	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:73836332G>A	ENST00000207549.4	-	10	1211	c.832C>T	c.(832-834)Ctc>Ttc	p.L278F	UNC13D_ENST00000587504.1_5'UTR|UNC13D_ENST00000412096.2_Missense_Mutation_p.L278F	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	278	Interaction with RAB27A.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)		p.L278F(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGAACTGGAGGTGGCACTGG	0.672									Familial Hemophagocytic Lymphohistiocytosis																														uc002jpp.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|skin(1)	2						c.(832-834)CTC>TTC		unc-13 homolog D							58.0	52.0	54.0					17																	73836332		2203	4300	6503	SO:0001583	missense	201294	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding	g.chr17:73836332G>A	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.832C>T	17.37:g.73836332G>A	ENSP00000207549:p.Leu278Phe		Somatic				UNC13D_uc010wsk.1_Missense_Mutation_p.L278F|UNC13D_uc002jpq.1_5'UTR|UNC13D_uc010dgq.1_Missense_Mutation_p.L75F	p.L278F	NM_199242	NP_954712	WXS	Illumina HiSeq	Unspecified	Q70J99	UN13D_HUMAN	all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)		10	1212	-			278			Interaction with RAB27A.		B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	37	c.832C>T	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400802	0.83120	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	D;D	0.85484	-1.97;-1.99	4.56	4.56	0.56223	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000008	D	0.91250	0.7242	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.92047	0.5645	10	0.87932	D	0	-23.6806	12.9705	0.58510	0.0806:0.0:0.9194:0.0	.	278;278	B4DTQ6;Q70J99	.;UN13D_HUMAN	F	278	ENSP00000207549:L278F;ENSP00000388093:L278F	ENSP00000207549:L278F	L	-	1	0	UNC13D	71347927	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.134000	0.57990	2.358000	0.79984	0.563000	0.77884	CTC		0.672	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950		8	44	0	0	0	0.013537	0	8	44				
TRIM65	201292	broad.mit.edu	37	17	73887248	73887248	+	Missense_Mutation	SNP	C	C	A	rs374478460		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr17:73887248C>A	ENST00000269383.3	-	6	1231	c.1166G>T	c.(1165-1167)cGc>cTc	p.R389L		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	389	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R389L(1)		endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTCTGACGCGCGCACCTCCCA	0.687																																							uc002jpx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1165-1167)CGC>CTC		tripartite motif-containing 65							40.0	42.0	41.0					17																	73887248		2202	4300	6502	SO:0001583	missense	201292					intracellular	zinc ion binding	g.chr17:73887248C>A	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.1166G>T	17.37:g.73887248C>A	ENSP00000269383:p.Arg389Leu		Somatic					p.R389L	NM_173547	NP_775818	WXS	Illumina HiSeq	Unspecified	Q6PJ69	TRI65_HUMAN	Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)		6	1202	-			389			B30.2/SPRY.		Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	ENST00000269383.3	37	c.1166G>T	CCDS11732.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.660|8.660	0.900357|0.900357	0.17686|0.17686	.|.	.|.	ENSG00000141569|ENSG00000141569	ENST00000543309|ENST00000269383	.|T	.|0.70045	.|-0.45	5.31|5.31	-5.4|-5.4	0.02656|0.02656	.|Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.|0.858333	.|0.10085	.|N	.|0.717947	T|T	0.55513|0.55513	0.1925|0.1925	L|L	0.50333|0.50333	1.59|1.59	0.19775|0.19775	N|N	0.999951|0.999951	.|P	.|0.34684	.|0.463	.|B	.|0.38712	.|0.28	T|T	0.54754|0.54754	-0.8246|-0.8246	5|10	.|0.59425	.|D	.|0.04	.|.	5.7375|5.7375	0.18075|0.18075	0.0948:0.2132:0.0943:0.5977|0.0948:0.2132:0.0943:0.5977	.|.	.|389	.|Q6PJ69	.|TRI65_HUMAN	S|L	241|389	.|ENSP00000269383:R389L	.|ENSP00000269383:R389L	A|R	-|-	1|2	0|0	TRIM65|TRIM65	71398843|71398843	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.020000|0.020000	0.10135|0.10135	-0.880000|-0.880000	0.04183|0.04183	-0.875000|-0.875000	0.04022|0.04022	-0.824000|-0.824000	0.03097|0.03097	GCG|CGC		0.687	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547		15	82	1	0	0.00400662	0.004007	0.0042686	15	82				
RNF165	494470	broad.mit.edu	37	18	44027602	44027602	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr18:44027602C>A	ENST00000269439.7	+	4	613	c.562C>A	c.(562-564)Cta>Ata	p.L188I	RNF165_ENST00000543885.1_5'UTR	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	188							zinc ion binding (GO:0008270)	p.L188I(1)		NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		TCAGCATTACCTAGCCACTCC	0.547																																							uc002lcb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(562-564)CTA>ATA		ring finger protein 165							233.0	196.0	208.0					18																	44027602		2203	4300	6503	SO:0001583	missense	494470						zinc ion binding	g.chr18:44027602C>A	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.562C>A	18.37:g.44027602C>A	ENSP00000269439:p.Leu188Ile		Somatic				RNF165_uc002lby.1_Missense_Mutation_p.L121I|RNF165_uc010dnn.1_5'UTR	p.L188I	NM_152470	NP_689683	WXS	Illumina HiSeq	Unspecified	Q6ZSG1	RN165_HUMAN		READ - Rectum adenocarcinoma(1;0.0873)	4	613	+			188					B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	37	c.562C>A	CCDS32823.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099975	0.37048	.	.	ENSG00000141622	ENST00000269439	T	0.19806	2.12	5.7	3.89	0.44902	.	0.081004	0.51477	D	0.000095	T	0.14356	0.0347	L	0.33485	1.01	0.80722	D	1	B	0.14012	0.009	B	0.17722	0.019	T	0.08269	-1.0730	10	0.21540	T	0.41	-2.3722	8.3225	0.32136	0.0:0.7384:0.0:0.2616	.	188	Q6ZSG1	RN165_HUMAN	I	188	ENSP00000269439:L188I	ENSP00000269439:L188I	L	+	1	2	RNF165	42281600	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.919000	0.28692	1.396000	0.46663	0.555000	0.69702	CTA		0.547	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470		42	104	1	0	2.35958e-20	0.009718	3.69268e-20	42	104				
ABCA7	10347	broad.mit.edu	37	19	1046335	1046335	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:1046335C>A	ENST00000263094.6	+	13	1783	c.1552C>A	c.(1552-1554)Ctc>Atc	p.L518I	ABCA7_ENST00000533574.1_3'UTR|ABCA7_ENST00000433129.1_Missense_Mutation_p.L518I|ABCA7_ENST00000435683.2_Missense_Mutation_p.L380I	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	518					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)	p.L518I(1)		NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCCGCGTGCTCAGCGGCGC	0.701																																							uc002lqw.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(7)|ovary(1)|central_nervous_system(1)	9						c.(1552-1554)CTC>ATC		ATP-binding cassette, sub-family A, member 7							136.0	143.0	141.0					19																	1046335		2203	4297	6500	SO:0001583	missense	10347				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity	g.chr19:1046335C>A	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1552C>A	19.37:g.1046335C>A	ENSP00000263094:p.Leu518Ile		Somatic				ABCA7_uc010dsb.1_Missense_Mutation_p.L380I	p.L518I	NM_019112	NP_061985	WXS	Illumina HiSeq	Unspecified	Q8IZY2	ABCA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	13	1783	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	518			Extracellular (By similarity).		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	c.1552C>A	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	c	15.66	2.898263	0.52227	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.95412	-3.7;-3.7	4.85	4.85	0.62838	.	.	.	.	.	D	0.95708	0.8604	L	0.57536	1.79	0.25986	N	0.982314	P;P	0.42375	0.778;0.609	P;B	0.50617	0.646;0.254	D	0.90817	0.4706	9	0.29301	T	0.29	.	15.4372	0.75155	0.0:1.0:0.0:0.0	.	380;518	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	I	518	ENSP00000263094:L518I;ENSP00000414062:L518I	ENSP00000263094:L518I	L	+	1	0	ABCA7	997335	1.000000	0.71417	0.948000	0.38648	0.959000	0.62525	3.156000	0.50708	2.237000	0.73441	0.556000	0.70494	CTC		0.701	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112		38	363	1	0	1.7489e-18	0.011902	2.61863e-18	38	363				
CELF5	60680	broad.mit.edu	37	19	3281249	3281249	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:3281249C>T	ENST00000292672.2	+	6	693	c.656C>T	c.(655-657)aCg>aTg	p.T219M	CELF5_ENST00000541430.2_Missense_Mutation_p.T219M	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	219					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.T219M(1)		kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						AAGGAGCGGACGCTCCGGCGC	0.677																																							uc002lxm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(655-657)ACG>ATG		bruno-like 5, RNA binding protein							88.0	79.0	82.0					19																	3281249		2203	4300	6503	SO:0001583	missense	60680				mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding	g.chr19:3281249C>T	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.656C>T	19.37:g.3281249C>T	ENSP00000292672:p.Thr219Met		Somatic				CELF5_uc002lxl.1_Missense_Mutation_p.T219M|CELF5_uc010dtj.1_Missense_Mutation_p.T219M|CELF5_uc010xhg.1_Missense_Mutation_p.T105M|CELF5_uc002lxn.2_RNA	p.T219M	NM_021938	NP_068757	WXS	Illumina HiSeq	Unspecified	Q8N6W0	CELF5_HUMAN			6	693	+			219					D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	c.656C>T	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.679066	0.68042	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.35973	3.36;1.62;1.28	3.91	3.91	0.45181	.	0.055959	0.64402	D	0.000001	T	0.55146	0.1902	L	0.57536	1.79	0.58432	D	0.999991	D;D;P	0.89917	0.993;1.0;0.808	P;D;B	0.83275	0.858;0.996;0.156	T	0.57631	-0.7778	10	0.49607	T	0.09	-1.5557	14.8679	0.70430	0.0:1.0:0.0:0.0	.	105;219;219	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	M	219;219;105	ENSP00000292672:T219M;ENSP00000443498:T219M;ENSP00000335182:T105M	ENSP00000292672:T219M	T	+	2	0	CELF5	3232249	1.000000	0.71417	0.857000	0.33713	0.659000	0.38960	5.955000	0.70306	1.919000	0.55581	0.462000	0.41574	ACG		0.677	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938		11	103	0	0	0	0.006122	0	11	103				
TMIGD2	126259	broad.mit.edu	37	19	4298087	4298087	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:4298087G>T	ENST00000301272.2	-	2	347	c.302C>A	c.(301-303)cCt>cAt	p.P101H	TMIGD2_ENST00000600349.1_Intron|TMIGD2_ENST00000595645.1_Missense_Mutation_p.P101H|TMIGD2_ENST00000600114.1_Intron	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	101	Ig-like.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.P101L(1)|p.P101H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCTCACAGGGTCCAGCTG	0.642																																							uc002lzx.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)		0						c.(301-303)CCT>CAT		transmembrane and immunoglobulin domain							65.0	68.0	67.0					19																	4298087		2203	4300	6503	SO:0001583	missense	126259					integral to membrane		g.chr19:4298087G>T	BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.302C>A	19.37:g.4298087G>T	ENSP00000301272:p.Pro101His		Somatic				TMIGD2_uc010dtv.1_Missense_Mutation_p.P101H	p.P101H	NM_144615	NP_653216	WXS	Illumina HiSeq	Unspecified	Q96BF3	TMIG2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)	2	348	-			101			Extracellular (Potential).|Ig-like.		Q6UW59	Missense_Mutation	SNP	ENST00000301272.2	37	c.302C>A	CCDS12126.1	.	.	.	.	.	.	.	.	.	.	G	1.722	-0.496276	0.04291	.	.	ENSG00000167664	ENST00000301272	T	0.27720	1.65	4.09	-8.19	0.01049	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10809	0.0264	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.002;0.003	T	0.16188	-1.0411	9	0.26408	T	0.33	.	4.0659	0.09859	0.1911:0.4567:0.2033:0.1489	.	101;101	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	H	101	ENSP00000301272:P101H	ENSP00000301272:P101H	P	-	2	0	TMIGD2	4249087	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-5.654000	0.00107	-3.515000	0.00149	-0.350000	0.07774	CCT		0.642	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458088.1	NM_144615		38	136	1	0	6.2361e-21	0.007835	9.92759e-21	38	136				
MUC16	94025	broad.mit.edu	37	19	9076674	9076674	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:9076674G>T	ENST00000397910.4	-	3	10975	c.10772C>A	c.(10771-10773)tCc>tAc	p.S3591Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3592	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S3591Y(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACAGTCCAGGAATCTGATGC	0.483																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(10771-10773)TCC>TAC		mucin 16							146.0	147.0	147.0					19																	9076674		2066	4202	6268	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9076674G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10772C>A	19.37:g.9076674G>T	ENSP00000381008:p.Ser3591Tyr		Somatic					p.S3591Y	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	10976	-			3592			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.10772C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	7.563	0.665097	0.14710	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.76	0.674	0.17946	.	.	.	.	.	T	0.03095	0.0091	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.56865	0.808	T	0.45011	-0.9290	8	0.87932	D	0	.	4.3374	0.11092	0.2107:0.0:0.7893:0.0	.	3591	B5ME49	.	Y	3591	ENSP00000381008:S3591Y	ENSP00000381008:S3591Y	S	-	2	0	MUC16	8937674	0.000000	0.05858	0.000000	0.03702	0.770000	0.43624	-0.621000	0.05559	0.286000	0.22352	0.313000	0.20887	TCC		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		22	135	1	0	1.85244e-09	0.00333	2.33239e-09	22	135				
MUC16	94025	broad.mit.edu	37	19	9077673	9077673	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:9077673C>A	ENST00000397910.4	-	3	9976	c.9773G>T	c.(9772-9774)aGc>aTc	p.S3258I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3259	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S3258I(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGAGAGATGCTGGTGCTGCC	0.527																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(9772-9774)AGC>ATC		mucin 16							122.0	127.0	125.0					19																	9077673		2141	4226	6367	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9077673C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9773G>T	19.37:g.9077673C>A	ENSP00000381008:p.Ser3258Ile		Somatic					p.S3258I	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	9977	-			3259			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.9773G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.984	0.365480	0.11352	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	2.04	-0.198	0.13224	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.53912	0.737	T	0.45920	-0.9228	8	0.87932	D	0	.	4.2863	0.10857	0.0:0.6279:0.0:0.3721	.	3258	B5ME49	.	I	3258	ENSP00000381008:S3258I	ENSP00000381008:S3258I	S	-	2	0	MUC16	8938673	0.000000	0.05858	0.000000	0.03702	0.337000	0.28794	-0.183000	0.09712	0.007000	0.14760	0.313000	0.20887	AGC		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		40	124	1	0	1.30998e-17	0.005524	1.93013e-17	40	124				
EMR2	30817	broad.mit.edu	37	19	14857057	14857057	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:14857057G>A	ENST00000315576.3	-	18	2621	c.2170C>T	c.(2170-2172)Ctc>Ttc	p.L724F	EMR2_ENST00000392967.2_Missense_Mutation_p.L713F|EMR2_ENST00000594294.1_Missense_Mutation_p.L675F|EMR2_ENST00000595839.1_Missense_Mutation_p.L582F|EMR2_ENST00000601345.1_Missense_Mutation_p.L713F|EMR2_ENST00000353876.1_Missense_Mutation_p.L631F|EMR2_ENST00000594076.1_Missense_Mutation_p.L631F|EMR2_ENST00000346057.1_Missense_Mutation_p.L675F|EMR2_ENST00000353005.1_Missense_Mutation_p.L582F|EMR2_ENST00000392964.3_3'UTR|EMR2_ENST00000596991.2_Missense_Mutation_p.L713F|EMR2_ENST00000392965.3_Missense_Mutation_p.L666F	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	724					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)	p.L724F(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GTGTTCCGGAGGGTGGACACT	0.478																																							uc002mzp.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|skin(1)	4						c.(2170-2172)CTC>TTC		egf-like module containing, mucin-like, hormone							182.0	186.0	185.0					19																	14857057		2203	4300	6503	SO:0001583	missense	30817				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14857057G>A	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.2170C>T	19.37:g.14857057G>A	ENSP00000319883:p.Leu724Phe		Somatic				EMR2_uc010dzs.1_Missense_Mutation_p.L183F|EMR2_uc010xnw.1_Missense_Mutation_p.L666F|EMR2_uc002mzo.1_Missense_Mutation_p.L713F|EMR2_uc002mzq.1_Missense_Mutation_p.L664F|EMR2_uc002mzr.1_Missense_Mutation_p.L675F|EMR2_uc002mzs.1_Missense_Mutation_p.L582F|EMR2_uc002mzt.1_Missense_Mutation_p.L620F|EMR2_uc002mzu.1_Missense_Mutation_p.L631F|EMR2_uc010xnx.1_RNA	p.L724F	NM_013447	NP_038475	WXS	Illumina HiSeq	Unspecified	Q9UHX3	EMR2_HUMAN			18	2626	-			724			Cytoplasmic (Potential).		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	c.2170C>T	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941776	0.34283	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12	4.74	-2.48	0.06423	GPCR, family 2-like (1);	.	.	.	.	T	0.55289	0.1911	M	0.71206	2.165	0.80722	D	1	P;B;D;B;P;P;P;P	0.76494	0.592;0.2;0.999;0.343;0.749;0.789;0.789;0.749	B;B;D;B;P;P;P;P	0.83275	0.401;0.25;0.996;0.25;0.551;0.582;0.744;0.551	T	0.59632	-0.7418	9	0.56958	D	0.05	.	7.5103	0.27569	0.0843:0.0:0.4102:0.5054	.	666;631;724;582;675;724;724;713	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	F	724;713;675;631;582;666	ENSP00000319883:L724F;ENSP00000376694:L713F;ENSP00000263380:L675F;ENSP00000319454:L631F;ENSP00000319838:L582F;ENSP00000376692:L666F	ENSP00000319883:L724F	L	-	1	0	EMR2	14718057	0.050000	0.20438	0.990000	0.47175	0.005000	0.04900	-0.077000	0.11394	0.058000	0.16222	-0.241000	0.12123	CTC		0.478	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			80	292	0	0	0	0.01441	0	80	292				
OR10H1	26539	broad.mit.edu	37	19	15918047	15918047	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:15918047C>A	ENST00000334920.2	-	1	889	c.801G>T	c.(799-801)caG>caT	p.Q267H		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q267H(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CTTCCAGAGACTGGGGACTTT	0.562																																							uc002nbq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(799-801)CAG>CAT		olfactory receptor, family 10, subfamily H,							134.0	102.0	113.0					19																	15918047		2203	4300	6503	SO:0001583	missense	26539				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15918047C>A	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.801G>T	19.37:g.15918047C>A	ENSP00000335596:p.Gln267His		Somatic					p.Q267H	NM_013940	NP_039228	WXS	Illumina HiSeq	Unspecified	Q9Y4A9	O10H1_HUMAN			1	890	-			267			Extracellular (Potential).		Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	c.801G>T	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	.	0.806	-0.753843	0.03041	.	.	ENSG00000186723	ENST00000334920	T	0.00107	8.72	5.06	-7.97	0.01139	GPCR, rhodopsin-like superfamily (1);	0.786157	0.10853	N	0.626915	T	0.00039	0.0001	N	0.01464	-0.85	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.11084	-1.0602	10	0.14656	T	0.56	.	4.6719	0.12692	0.1941:0.1465:0.5068:0.1527	.	267	Q9Y4A9	O10H1_HUMAN	H	267	ENSP00000335596:Q267H	ENSP00000335596:Q267H	Q	-	3	2	OR10H1	15779047	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.226000	0.02953	-0.739000	0.04809	-0.839000	0.03059	CAG		0.562	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			34	82	1	0	1.26612e-14	0.003271	1.81717e-14	34	82				
SLC5A5	6528	broad.mit.edu	37	19	17994525	17994525	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:17994525C>T	ENST00000222248.3	+	11	1625	c.1278C>T	c.(1276-1278)ccC>ccT	p.P426P		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	426					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.P426P(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TCAGCGGCCCCCTGCTGGGAG	0.692																																					Melanoma(65;1008 1708 7910 46650)	Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1276-1278)CCC>CCT		solute carrier family 5 (sodium iodide							39.0	44.0	42.0					19																	17994525		2200	4298	6498	SO:0001819	synonymous_variant	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:17994525C>T		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1278C>T	19.37:g.17994525C>T			Somatic					p.P426P	NM_000453	NP_000444	WXS	Illumina HiSeq	Unspecified	Q92911	SC5A5_HUMAN			11	1625	+			426			Helical; (Potential).		O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	37	c.1278C>T	CCDS12368.1																																																																																				0.692	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			17	89	0	0	0	0.008871	0	17	89				
ARRDC2	27106	broad.mit.edu	37	19	18121164	18121164	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:18121164G>C	ENST00000222250.4	+	6	1152	c.1009G>C	c.(1009-1011)Gag>Cag	p.E337Q	ARRDC2_ENST00000379656.3_Missense_Mutation_p.E332Q	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	337					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.E337Q(1)|p.E332Q(1)		endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						GGAGCGGCCTGAGGGTAAGCT	0.647																																							uc002nhv.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1009-1011)GAG>CAG		arrestin domain containing 2 isoform 1							26.0	29.0	28.0					19																	18121164		2203	4297	6500	SO:0001583	missense	27106							g.chr19:18121164G>C		CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.1009G>C	19.37:g.18121164G>C	ENSP00000222250:p.Glu337Gln		Somatic				ARRDC2_uc002nhu.2_Missense_Mutation_p.E332Q	p.E337Q	NM_015683	NP_056498	WXS	Illumina HiSeq	Unspecified	Q8TBH0	ARRD2_HUMAN			6	1152	+			337					B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	ENST00000222250.4	37	c.1009G>C	CCDS12370.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554132	0.86231	.	.	ENSG00000105643	ENST00000379656;ENST00000222250	T;T	0.06849	3.25;3.25	4.78	4.78	0.61160	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.06250	-1.0837	10	0.72032	D	0.01	-20.3615	17.1659	0.86816	0.0:0.0:1.0:0.0	.	337;332	Q8TBH0;Q8TBH0-2	ARRD2_HUMAN;.	Q	332;337	ENSP00000368977:E332Q;ENSP00000222250:E337Q	ENSP00000222250:E337Q	E	+	1	0	ARRDC2	17982164	1.000000	0.71417	0.982000	0.44146	0.614000	0.37383	9.620000	0.98373	2.397000	0.81536	0.491000	0.48974	GAG		0.647	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466845.1	NM_015683		3	57	0	0	0	0.004672	0	3	57				
CRTC1	23373	broad.mit.edu	37	19	18888001	18888001	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:18888001A>T	ENST00000321949.8	+	14	1740	c.1714A>T	c.(1714-1716)Agc>Tgc	p.S572C	CRTC1_ENST00000594658.1_Missense_Mutation_p.S531C|CRTC1_ENST00000338797.6_Missense_Mutation_p.S588C|CRTC1_ENST00000601916.1_Missense_Mutation_p.S330C	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.S572fs*4(1)|p.S572C(1)|p.S588C(1)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						GTCCCCCCCCAGCCTCTCTAA	0.627																																							uc002nkb.3		NA																CRTC1/MAML2(516)	3	Substitution - Missense(2)|Insertion - Frameshift(1)	p.S572fs*4(1)	lung(2)|breast(1)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519						c.(1714-1716)AGC>TGC		mucoepidermoid carcinoma translocated 1 isoform							38.0	44.0	42.0					19																	18888001		2203	4300	6503	SO:0001583	missense	23373				interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding	g.chr19:18888001A>T	AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1714A>T	19.37:g.18888001A>T	ENSP00000323332:p.Ser572Cys		Somatic				CRTC1_uc010ebv.2_Missense_Mutation_p.S588C|CRTC1_uc010ebw.2_Missense_Mutation_p.S408C|CRTC1_uc002nkc.3_Missense_Mutation_p.S270C	p.S572C	NM_015321	NP_056136	WXS	Illumina HiSeq	Unspecified	Q6UUV9	CRTC1_HUMAN			14	1802	+			572						Missense_Mutation	SNP	ENST00000321949.8	37	c.1714A>T	CCDS32963.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347120	0.82022	.	.	ENSG00000105662	ENST00000262813;ENST00000338797;ENST00000321949	T;T	0.14266	2.52;2.54	3.95	3.95	0.45737	Transducer of regulated CREB activity, C-terminal (1);	0.217681	0.46145	D	0.000315	T	0.26195	0.0639	L	0.39898	1.24	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.70935	0.946;0.971;0.95	T	0.01583	-1.1319	10	0.72032	D	0.01	-24.8825	12.1473	0.54029	1.0:0.0:0.0:0.0	.	543;588;572	Q6UUV9-3;Q6UUV9-2;Q6UUV9	.;.;CRTC1_HUMAN	C	543;588;572	ENSP00000345001:S588C;ENSP00000323332:S572C	ENSP00000262813:S543C	S	+	1	0	CRTC1	18749001	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.742000	0.74843	1.664000	0.50801	0.460000	0.39030	AGC		0.627	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021		21	71	0	0	0	0.00278	0	21	71				
ZNF536	9745	broad.mit.edu	37	19	31025803	31025803	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:31025803G>T	ENST00000355537.3	+	3	2367	c.2220G>T	c.(2218-2220)ctG>ctT	p.L740L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	740					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.L740L(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AACCAGCGCTGCTTCGCGACA	0.567																																							uc002nsu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(2218-2220)CTG>CTT		zinc finger protein 536							114.0	115.0	115.0					19																	31025803		2203	4300	6503	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31025803G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2220G>T	19.37:g.31025803G>T			Somatic				ZNF536_uc010edd.1_Silent_p.L740L	p.L740L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			3	2358	+	Esophageal squamous(110;0.0834)		740					A2RU18	Silent	SNP	ENST00000355537.3	37	c.2220G>T	CCDS32984.1																																																																																				0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		64	204	1	0	1.31726e-23	0.01441	2.17191e-23	64	204				
LSM14A	26065	broad.mit.edu	37	19	34706112	34706112	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:34706112G>T	ENST00000433627.5	+	5	697	c.622G>T	c.(622-624)Gct>Tct	p.A208S	LSM14A_ENST00000540746.2_Missense_Mutation_p.A167S|LSM14A_ENST00000544216.3_Missense_Mutation_p.A208S	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	208					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A208S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CCACTTACCTGCTCCAGCAGC	0.527																																							uc002nvb.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(622-624)GCT>TCT		LSM14 homolog A isoform a							83.0	78.0	79.0					19																	34706112		2203	4300	6503	SO:0001583	missense	26065				cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule		g.chr19:34706112G>T	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.622G>T	19.37:g.34706112G>T	ENSP00000413964:p.Ala208Ser		Somatic				LSM14A_uc002nva.3_Missense_Mutation_p.A208S|LSM14A_uc010xru.1_Missense_Mutation_p.A167S|LSM14A_uc002nvc.3_Missense_Mutation_p.A14S	p.A208S	NM_001114093	NP_001107565	WXS	Illumina HiSeq	Unspecified	Q8ND56	LS14A_HUMAN			5	818	+	Esophageal squamous(110;0.162)		208					B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	37	c.622G>T	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	g	12.44	1.937543	0.34189	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.32515	1.51;1.51;1.45	5.77	2.52	0.30459	.	0.268590	0.42294	D	0.000722	T	0.16041	0.0386	N	0.21282	0.65	0.48511	D	0.999665	B;B;B	0.19583	0.002;0.037;0.006	B;B;B	0.22880	0.004;0.042;0.009	T	0.06643	-1.0815	10	0.13853	T	0.58	-7.4147	5.6184	0.17444	0.271:0.0:0.5995:0.1295	.	167;208;208	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	S	208;208;167	ENSP00000446271:A208S;ENSP00000413964:A208S;ENSP00000446451:A167S	ENSP00000314768:A208S	A	+	1	0	LSM14A	39397952	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.364000	0.34171	0.906000	0.36621	0.655000	0.94253	GCT		0.527	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578		20	59	1	0	8.04996e-18	0.012319	1.19243e-17	20	59				
ZFP14	57677	broad.mit.edu	37	19	36832235	36832235	+	Missense_Mutation	SNP	C	C	G	rs555415825		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:36832235C>G	ENST00000270001.7	-	5	608	c.493G>C	c.(493-495)Gtt>Ctt	p.V165L		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V165L(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					CCATTATGAACGATCTGATAC	0.383																																							uc002odx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(493-495)GTT>CTT		zinc finger protein 14-like							165.0	159.0	161.0					19																	36832235		2203	4300	6503	SO:0001583	missense	57677				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36832235C>G	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.493G>C	19.37:g.36832235C>G	ENSP00000270001:p.Val165Leu		Somatic				ZFP14_uc010xtd.1_Missense_Mutation_p.V166L|ZFP14_uc010eex.1_Missense_Mutation_p.V165L	p.V165L	NM_020917	NP_065968	WXS	Illumina HiSeq	Unspecified	Q9HCL3	ZFP14_HUMAN			4	586	-	Esophageal squamous(110;0.162)		165					A7MD23	Missense_Mutation	SNP	ENST00000270001.7	37	c.493G>C	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	c	7.805	0.714414	0.15306	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.19250	2.16	3.51	-2.47	0.06442	.	0.771584	0.11059	N	0.604151	T	0.12305	0.0299	N	0.21324	0.655	0.46849	D	0.999224	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.09509	-1.0671	10	0.42905	T	0.14	.	8.6081	0.33786	0.0:0.3659:0.0:0.6341	.	165;165	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	L	165	ENSP00000270001:V165L	ENSP00000270001:V165L	V	-	1	0	ZFP14	41524075	0.000000	0.05858	0.767000	0.31495	0.769000	0.43574	-1.347000	0.02632	-0.354000	0.08212	0.549000	0.68633	GTT		0.383	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917		50	190	0	0	0	0.01441	0	50	190				
PSG3	5671	broad.mit.edu	37	19	43233410	43233410	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:43233410C>T	ENST00000327495.5	-	5	1292	c.1108G>A	c.(1108-1110)Ggg>Agg	p.G370R	PSG3_ENST00000595140.1_Missense_Mutation_p.G370R	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	370	Ig-like C2-type 3.			Missing (in Ref. 9). {ECO:0000305}.	defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.G370R(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TGAAACTTCCCATTAATTGTC	0.443																																							uc002oue.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1108-1110)GGG>AGG		pregnancy specific beta-1-glycoprotein 3							174.0	185.0	181.0					19																	43233410		2203	4300	6503	SO:0001583	missense	5671				defense response|female pregnancy	extracellular region		g.chr19:43233410C>T		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.1108G>A	19.37:g.43233410C>T	ENSP00000332215:p.Gly370Arg		Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.G370R|PSG3_uc010eil.2_Missense_Mutation_p.G392R	p.G370R	NM_021016	NP_066296	WXS	Illumina HiSeq	Unspecified	Q16557	PSG3_HUMAN			5	1240	-		Prostate(69;0.00682)	370	Missing (in Ref. 9).		Ig-like C2-type 3.		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	c.1108G>A	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	N	10.09	1.255675	0.22965	.	.	ENSG00000221826	ENST00000327495	T	0.52754	0.65	1.33	1.33	0.21861	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61739	0.2371	M	0.83774	2.66	0.09310	N	1	B	0.28552	0.215	P	0.48227	0.571	T	0.60979	-0.7155	9	0.48119	T	0.1	.	5.9829	0.19417	0.0:1.0:0.0:0.0	.	370	Q16557	PSG3_HUMAN	R	370	ENSP00000332215:G370R	ENSP00000332215:G370R	G	-	1	0	PSG3	47925250	0.000000	0.05858	0.007000	0.13788	0.008000	0.06430	-0.129000	0.10515	0.690000	0.31570	0.393000	0.25936	GGG		0.443	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016		80	309	0	0	0	0.01441	0	80	309				
RTN2	6253	broad.mit.edu	37	19	45992753	45992753	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:45992753C>T	ENST00000245923.4	-	6	1327	c.1092G>A	c.(1090-1092)ctG>ctA	p.L364L	RTN2_ENST00000590526.1_Silent_p.L90L|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000430715.2_Silent_p.L24L|RTN2_ENST00000344680.4_Silent_p.L291L	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	364	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.L364L(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGGAGACCATCAGGCCTGTGA	0.617																																							uc002pcb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1090-1092)CTG>CTA		reticulon 2 isoform A							109.0	61.0	77.0					19																	45992753		2202	4300	6502	SO:0001819	synonymous_variant	6253					integral to endoplasmic reticulum membrane	signal transducer activity	g.chr19:45992753C>T	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1092G>A	19.37:g.45992753C>T			Somatic				RTN2_uc002pcc.2_Silent_p.L291L|RTN2_uc002pcd.2_RNA	p.L364L	NM_005619	NP_005610	WXS	Illumina HiSeq	Unspecified	O75298	RTN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)	6	1320	-		Ovarian(192;0.051)|all_neural(266;0.112)	364			Reticulon.		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Silent	SNP	ENST00000245923.4	37	c.1092G>A	CCDS12665.1																																																																																				0.617	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		9	15	0	0	0	0.004482	0	9	15				
SIGLEC9	27180	broad.mit.edu	37	19	51628373	51628373	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:51628373C>A	ENST00000250360.3	+	1	209	c.142C>A	c.(142-144)Cat>Aat	p.H48N	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.H48N	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	48	Ig-like V-type.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.H48N(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CTACCCCTCGCATGGCTGGAT	0.582																																							uc002pvu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(142-144)CAT>AAT		sialic acid binding Ig-like lectin 9 precursor							138.0	93.0	108.0					19																	51628373		2203	4300	6503	SO:0001583	missense	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51628373C>A	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.142C>A	19.37:g.51628373C>A	ENSP00000250360:p.His48Asn		Somatic				SIGLEC9_uc010yct.1_Missense_Mutation_p.H48N	p.H48N	NM_014441	NP_055256	WXS	Illumina HiSeq	Unspecified	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	1	209	+		all_neural(266;0.0529)	48			Extracellular (Potential).|Ig-like V-type.		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	c.142C>A	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	0.323	-0.960978	0.02249	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.44083	0.93;0.93	2.74	-5.47	0.02600	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	28.649100	0.00166	N	0.000002	T	0.12433	0.0302	N	0.00926	-1.1	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.10800	-1.0614	10	0.25106	T	0.35	.	0.5225	0.00614	0.2143:0.242:0.1611:0.3826	.	48	Q9Y336	SIGL9_HUMAN	N	48	ENSP00000413861:H48N;ENSP00000250360:H48N	ENSP00000250360:H48N	H	+	1	0	SIGLEC9	56320185	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.193000	0.00276	-2.031000	0.00928	-2.053000	0.00404	CAT		0.582	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		18	59	1	0	1.9806e-07	0.014323	2.375e-07	18	59				
SIGLEC12	89858	broad.mit.edu	37	19	51994930	51994930	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:51994930C>T	ENST00000291707.3	-	8	1808	c.1753G>A	c.(1753-1755)Ggc>Agc	p.G585S	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.G467S	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	585					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G585S(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TACTCATAGCCGATGGCCTCC	0.582																																							uc002pwx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1753-1755)GGC>AGC		sialic acid binding immunoglobulin-like							121.0	105.0	110.0					19																	51994930		2203	4300	6503	SO:0001583	missense	89858				cell adhesion	integral to membrane	sugar binding	g.chr19:51994930C>T	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1753G>A	19.37:g.51994930C>T	ENSP00000291707:p.Gly585Ser		Somatic				SIGLEC12_uc002pww.1_Missense_Mutation_p.G467S|SIGLEC12_uc010eoy.1_Missense_Mutation_p.G312S	p.G585S	NM_053003	NP_443729	WXS	Illumina HiSeq	Unspecified	Q96PQ1	SIG12_HUMAN		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)	8	1809	-		all_neural(266;0.0199)	585			Cytoplasmic (Potential).		Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	c.1753G>A	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	3.064	-0.192508	0.06259	.	.	ENSG00000254521	ENST00000291707	T	0.01629	4.72	2.79	-0.738	0.11125	.	.	.	.	.	T	0.00936	0.0031	N	0.17474	0.49	0.09310	N	1	B;B	0.31599	0.059;0.33	B;B	0.23716	0.02;0.048	T	0.45366	-0.9266	9	0.06757	T	0.87	.	5.1058	0.14783	0.0:0.5372:0.0:0.4628	.	585;467	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	S	585	ENSP00000291707:G585S	ENSP00000291707:G585S	G	-	1	0	SIGLEC12	56686742	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.191000	0.01246	-0.183000	0.10585	0.558000	0.71614	GGC		0.582	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003		52	107	0	0	0	0.01441	0	52	107				
ZNF880	400713	broad.mit.edu	37	19	52876489	52876489	+	Splice_Site	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:52876489G>T	ENST00000422689.2	+	2	153	c.138G>T	c.(136-138)ctG>ctT	p.L46L	ZNF880_ENST00000344085.5_Splice_Site_p.L46L|ZNF880_ENST00000424032.2_Splice_Site_p.L46L|ZNF880_ENST00000597976.1_Splice_Site_p.L46L|ZNF880_ENST00000600321.1_Splice_Site_p.L46L	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L46L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TGGTCTTTCTGGGTGAGGATA	0.468																																							uc002pzc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(136-138)CTG>CTT		zinc finger protein LOC400713							67.0	65.0	66.0					19																	52876489		692	1591	2283	SO:0001630	splice_region_variant	400713				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:52876489G>T	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.139+1G>T	19.37:g.52876489G>T			Somatic				ZNF880_uc002pzb.3_RNA	p.L46L	NM_001145434	NP_001138906	WXS	Illumina HiSeq	Unspecified	Q6PDB4	ZN880_HUMAN			2	187	+			46			KRAB.		B4DNA6	Silent	SNP	ENST00000422689.2	37	c.138G>T	CCDS46164.1																																																																																				0.468	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	Silent	11	76	1	0	9.31168e-06	0.001855	1.06584e-05	11	76				
ZNF665	79788	broad.mit.edu	37	19	53678823	53678823	+	Intron	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:53678823C>A	ENST00000600412.1	-	2	63				ZNF665_ENST00000396424.3_Splice_Site_p.G6V			Q9H7R5	ZN665_HUMAN	zinc finger protein 665						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G6V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TGTCAACTGTCCCTAAAATGA	0.418																																							uc010eqm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(16-18)GGA>GTA		zinc finger protein 665							99.0	100.0	100.0					19																	53678823		2203	4300	6503	SO:0001627	intron_variant	79788				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53678823C>A		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.53-9223G>T	19.37:g.53678823C>A			Somatic					p.G6V	NM_024733	NP_079009	WXS	Illumina HiSeq	Unspecified	Q9H7R5	ZN665_HUMAN		GBM - Glioblastoma multiforme(134;0.0196)	3	117	-			Error:Variant_position_missing_in_Q9H7R5_after_alignment					A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37	c.17G>T		.	.	.	.	.	.	.	.	.	.	C	9.515	1.106825	0.20714	.	.	ENSG00000197497	ENST00000396424	T	0.00873	5.59	3.2	-6.24	0.02046	.	.	.	.	.	T	0.00666	0.0022	.	.	.	0.80722	D	1	B	0.20550	0.046	B	0.22601	0.04	T	0.52041	-0.8628	8	0.46703	T	0.11	.	0.2124	0.00158	0.2648:0.1602:0.262:0.313	.	6	Q9H7R5-2	.	V	6	ENSP00000379702:G6V	ENSP00000379702:G6V	G	-	2	0	ZNF665	58370635	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-4.711000	0.00195	-0.753000	0.04721	0.655000	0.94253	GGA		0.418	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733		26	121	1	0	1.39806e-14	0.008361	1.99619e-14	26	121				
CCDC106	29903	broad.mit.edu	37	19	56160839	56160839	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:56160839G>T	ENST00000586790.1	+	3	1106	c.202G>T	c.(202-204)Gct>Tct	p.A68S	CCDC106_ENST00000588740.1_Missense_Mutation_p.A68S|CCDC106_ENST00000591241.1_Missense_Mutation_p.A33S|CCDC106_ENST00000591578.1_Missense_Mutation_p.A68S|CCDC106_ENST00000308964.3_Missense_Mutation_p.A68S			Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106	68						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.A68S(1)		endometrium(2)|large_intestine(3)|lung(5)|skin(1)	11		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GCTGCACATGGCTCTGGAGAG	0.622																																							uc002qlr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)GCT>TCT		coiled-coil domain containing 106							68.0	60.0	63.0					19																	56160839		2203	4300	6503	SO:0001583	missense	29903					nucleus		g.chr19:56160839G>T	AF054984	CCDS33118.1	19q13.42	2013-09-20			ENSG00000173581	ENSG00000173581			30181	protein-coding gene	gene with protein product		613478				8619474, 9110174	Standard	XM_005258827		Approved	HSU79303	uc002qlr.3	Q9BWC9	OTTHUMG00000180907	ENST00000586790.1:c.202G>T	19.37:g.56160839G>T	ENSP00000465757:p.Ala68Ser		Somatic				CCDC106_uc002qls.2_Missense_Mutation_p.A68S	p.A68S	NM_013301	NP_037433	WXS	Illumina HiSeq	Unspecified	Q9BWC9	CC106_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)	4	937	+		Colorectal(82;0.00403)|Ovarian(87;0.133)	68			Potential.		B3KUF9|D3K183|Q99786	Missense_Mutation	SNP	ENST00000586790.1	37	c.202G>T	CCDS33118.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647043	0.29246	.	.	ENSG00000173581	ENST00000308964	.	.	.	3.5	3.5	0.40072	.	0.065963	0.64402	D	0.000008	T	0.26011	0.0634	N	0.13098	0.295	0.41553	D	0.988587	P	0.41393	0.748	B	0.32980	0.156	T	0.09930	-1.0652	9	0.19590	T	0.45	-17.3528	14.2951	0.66308	0.0:0.0:1.0:0.0	.	68	Q9BWC9	CC106_HUMAN	S	68	.	ENSP00000309681:A68S	A	+	1	0	CCDC106	60852651	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.829000	0.55760	1.981000	0.57761	0.561000	0.74099	GCT		0.622	CCDC106-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453593.1	NM_013301		17	52	1	0	9.16793e-09	0.00499	1.11873e-08	17	52				
NLRP4	147945	broad.mit.edu	37	19	56363727	56363727	+	Splice_Site	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:56363727G>T	ENST00000301295.6	+	2	702		c.e2+1		NLRP4_ENST00000346986.5_Splice_Site	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4						inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.?(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GAGAGAACAGGTGAGGGAGTC	0.438																																							uc002qmd.3		NA																	1	Unknown(1)		lung(1)	ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.e2+1		NLR family, pyrin domain containing 4							60.0	63.0	62.0					19																	56363727		2200	4299	6499	SO:0001630	splice_region_variant	147945						ATP binding	g.chr19:56363727G>T	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.280+1G>T	19.37:g.56363727G>T			Somatic					p.G94_splice	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	2	702	+		Colorectal(82;0.0002)|Ovarian(87;0.221)						Q86W87|Q96AY6	Splice_Site	SNP	ENST00000301295.6	37	c.280_splice	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704604	0.30232	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	.	.	.	3.68	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.213	0.48810	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP4	61055539	0.025000	0.19082	0.658000	0.29665	0.083000	0.17756	1.099000	0.31013	2.343000	0.79666	0.563000	0.77884	.		0.438	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	Intron	17	88	1	0	6.94344e-10	0.006122	8.78235e-10	17	88				
ZNF418	147686	broad.mit.edu	37	19	58439201	58439201	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr19:58439201C>T	ENST00000396147.1	-	4	639	c.348G>A	c.(346-348)ggG>ggA	p.G116G	ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000599852.1_Silent_p.G31G|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000425570.3_Silent_p.G137G|ZNF418_ENST00000595830.1_Silent_p.G116G	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G116G(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		ACAATTTATTCCCCCATGCCT	0.468																																							uc002qqs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(346-348)GGG>GGA		zinc finger protein 418							148.0	153.0	151.0					19																	58439201		2203	4300	6503	SO:0001819	synonymous_variant	147686				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58439201C>T	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.348G>A	19.37:g.58439201C>T			Somatic				ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Silent_p.G31G	p.G116G	NM_133460	NP_597717	WXS	Illumina HiSeq	Unspecified	Q8TF45	ZN418_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)	4	640	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	116					Q2M1S2|Q670L5|Q96N18	Silent	SNP	ENST00000396147.1	37	c.348G>A	CCDS42642.1																																																																																				0.468	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460		19	222	0	0	0	0.007413	0	19	222				
ZNF512	84450	broad.mit.edu	37	2	27844189	27844189	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:27844189G>C	ENST00000355467.4	+	14	1648	c.1565G>C	c.(1564-1566)aGa>aCa	p.R522T	ZNF512_ENST00000556601.1_Intron|ZNF512_ENST00000379717.1_Missense_Mutation_p.R521T|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000416005.2_Missense_Mutation_p.R493T|ZNF512_ENST00000413371.2_Missense_Mutation_p.R445T	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R522T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					CTGAGTCTTAGAGTAGGGAAG	0.532																																							uc002rla.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1564-1566)AGA>ACA		zinc finger protein 512							81.0	78.0	79.0					2																	27844189		2203	4300	6503	SO:0001583	missense	84450				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:27844189G>C	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.1565G>C	2.37:g.27844189G>C	ENSP00000347648:p.Arg522Thr		Somatic				ZNF512_uc010ylv.1_Missense_Mutation_p.R443T|ZNF512_uc010ylw.1_Missense_Mutation_p.R493T|ZNF512_uc002rlb.2_Missense_Mutation_p.R443T|ZNF512_uc010ylx.1_Missense_Mutation_p.R443T|ZNF512_uc002rlc.2_Missense_Mutation_p.R443T|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Missense_Mutation_p.R415T	p.R522T	NM_032434	NP_115810	WXS	Illumina HiSeq	Unspecified	Q96ME7	ZN512_HUMAN			14	1652	+	Acute lymphoblastic leukemia(172;0.155)		522					B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	ENST00000355467.4	37	c.1565G>C	CCDS1758.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749755	0.30955	.	.	ENSG00000243943	ENST00000379717;ENST00000355467;ENST00000416005;ENST00000413371	.	.	.	5.49	1.48	0.22813	.	0.257660	0.37577	N	0.002025	T	0.26448	0.0646	N	0.19112	0.55	0.58432	D	0.999995	B;B;B	0.31318	0.18;0.319;0.18	B;B;B	0.23716	0.023;0.048;0.023	T	0.03807	-1.1002	9	0.15066	T	0.55	-9.2396	4.5679	0.12196	0.2689:0.1628:0.5683:0.0	.	417;493;522	B4DES6;B4DSM5;Q96ME7	.;.;ZN512_HUMAN	T	521;522;493;445	.	ENSP00000347648:R522T	R	+	2	0	ZNF512	27697693	0.994000	0.37717	0.995000	0.50966	0.991000	0.79684	1.917000	0.39996	0.320000	0.23234	0.655000	0.94253	AGA		0.532	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215029.2	NM_032434		3	102	0	0	0	0.004672	0	3	102				
LCLAT1	253558	broad.mit.edu	37	2	30863299	30863299	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:30863299G>C	ENST00000309052.4	+	7	1268	c.1059G>C	c.(1057-1059)tgG>tgC	p.W353C	LCLAT1_ENST00000379509.3_Missense_Mutation_p.W315C|LCLAT1_ENST00000540623.1_Missense_Mutation_p.W315C|LCLAT1_ENST00000491680.2_3'UTR	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	353					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.W353C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						TACTGTATTGGACCCTGTTCA	0.403																																							uc002rnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1057-1059)TGG>TGC		lysocardiolipin acyltransferase 1 isoform 1							163.0	154.0	157.0					2																	30863299		2203	4300	6503	SO:0001583	missense	253558				multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity	g.chr2:30863299G>C	AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.1059G>C	2.37:g.30863299G>C	ENSP00000310551:p.Trp353Cys		Somatic				LCLAT1_uc010ymp.1_Missense_Mutation_p.W191C|LCLAT1_uc002rnl.2_Missense_Mutation_p.W315C|LCLAT1_uc010ymq.1_Missense_Mutation_p.W315C	p.W353C	NM_182551	NP_872357	WXS	Illumina HiSeq	Unspecified	Q6UWP7	LCLT1_HUMAN			7	1268	+			353			Helical; (Potential).		A6H8Z7|Q8N1Q7	Missense_Mutation	SNP	ENST00000309052.4	37	c.1059G>C	CCDS1772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.91|15.91	2.972994|2.972994	0.53614|0.53614	.|.	.|.	ENSG00000172954|ENSG00000172954	ENST00000444270|ENST00000379509;ENST00000309052;ENST00000540623	.|T;T;T	.|0.35421	.|1.34;1.31;1.34	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52901|0.52901	0.1763|0.1763	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.53049|0.53049	-0.8493|-0.8493	6|10	0.15499|0.72032	T|D	0.54|0.01	-11.7511|-11.7511	19.9944|19.9944	0.97379|0.97379	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|353	.|Q6UWP7	.|LCLT1_HUMAN	H|C	314|315;353;315	.|ENSP00000368823:W315C;ENSP00000310551:W353C;ENSP00000442857:W315C	ENSP00000400909:D314H|ENSP00000310551:W353C	D|W	+|+	1|3	0|0	LCLAT1|LCLAT1	30716803|30716803	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.252000|0.252000	0.25951|0.25951	9.476000|9.476000	0.97823|0.97823	2.720000|2.720000	0.93068|0.93068	0.557000|0.557000	0.71058|0.71058	GAC|TGG		0.403	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551		51	158	0	0	0	0.01441	0	51	158				
THADA	63892	broad.mit.edu	37	2	43801837	43801837	+	Missense_Mutation	SNP	G	G	A	rs574838357		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:43801837G>A	ENST00000405006.4	-	11	1718	c.1367C>T	c.(1366-1368)aCg>aTg	p.T456M	THADA_ENST00000403856.1_Missense_Mutation_p.T456M|THADA_ENST00000402360.2_Missense_Mutation_p.T456M|THADA_ENST00000404790.1_Missense_Mutation_p.T456M|THADA_ENST00000415080.2_Missense_Mutation_p.T166M|THADA_ENST00000330266.7_Missense_Mutation_p.T166M|THADA_ENST00000405975.2_Missense_Mutation_p.T456M	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	456								p.T456M(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ACCAAGGCACGTGTACTTTCC	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		21758	0.0		0.0	False		,,,				2504	0.001						uc002rsw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1366-1368)ACG>ATG		thyroid adenoma associated							132.0	127.0	129.0					2																	43801837		1909	4108	6017	SO:0001583	missense	63892						binding	g.chr2:43801837G>A	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.1367C>T	2.37:g.43801837G>A	ENSP00000385995:p.Thr456Met		Somatic				THADA_uc002rsx.3_Missense_Mutation_p.T456M|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.T166M|THADA_uc002rta.2_Missense_Mutation_p.T166M|THADA_uc002rtb.1_Missense_Mutation_p.T456M|THADA_uc002rtc.3_Missense_Mutation_p.T456M|THADA_uc002rtd.2_Missense_Mutation_p.T456M	p.T456M	NM_001083953	NP_001077422	WXS	Illumina HiSeq	Unspecified	Q6YHU6	THADA_HUMAN			11	1719	-		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)	456					A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	c.1367C>T	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	G	6.214	0.407655	0.11754	.	.	ENSG00000115970	ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T;T;T	0.65549	1.45;1.45;1.45;1.45;-0.16;-0.16;1.45	5.84	-2.61	0.06171	Armadillo-type fold (1);	0.837250	0.11048	N	0.605413	T	0.48624	0.1510	L	0.40543	1.245	0.09310	N	1	B;B;P;P;B	0.37594	0.174;0.036;0.601;0.599;0.007	B;B;B;B;B	0.32289	0.03;0.004;0.143;0.068;0.001	T	0.21143	-1.0254	10	0.41790	T	0.15	-9.3942	14.2351	0.65922	0.2598:0.0:0.7402:0.0	.	456;456;456;166;456	B5MC89;Q8IY32;Q6YHU6-5;C9JJB1;Q6YHU6	.;.;.;.;THADA_HUMAN	M	166;456;456;166;456;456;456;456	ENSP00000331105:T166M;ENSP00000386088:T456M;ENSP00000416048:T166M;ENSP00000385995:T456M;ENSP00000385441:T456M;ENSP00000384266:T456M;ENSP00000385469:T456M	ENSP00000331105:T166M	T	-	2	0	THADA	43655341	0.005000	0.15991	0.003000	0.11579	0.473000	0.32948	0.194000	0.17135	-0.958000	0.03622	-1.149000	0.01842	ACG		0.418	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		31	98	0	0	0	0.012213	0	31	98				
LRPPRC	10128	broad.mit.edu	37	2	44204416	44204416	+	Splice_Site	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:44204416C>A	ENST00000260665.7	-	4	527		c.e4-1		LRPPRC_ENST00000409659.1_Splice_Site|LRPPRC_ENST00000409946.1_Splice_Site	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing						mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.?(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TACACAGCACCTACAAATGAA	0.289																																							uc002rtr.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|skin(1)	3						c.e4-1		leucine-rich PPR motif-containing protein							69.0	70.0	69.0					2																	44204416		2202	4296	6498	SO:0001630	splice_region_variant	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44204416C>A	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.470-1G>T	2.37:g.44204416C>A			Somatic				LRPPRC_uc010yob.1_Splice_Site_p.G57_splice|LRPPRC_uc010faw.1_Splice_Site_p.G131_splice	p.G157_splice	NM_133259	NP_573566	WXS	Illumina HiSeq	Unspecified	P42704	LPPRC_HUMAN			4	528	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)						A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Splice_Site	SNP	ENST00000260665.7	37	c.470_splice	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875039	0.72180	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2133	0.93766	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRPPRC	44057920	1.000000	0.71417	0.999000	0.59377	0.788000	0.44548	7.772000	0.85439	2.613000	0.88420	0.484000	0.47621	.		0.289	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	Intron	4	20	1	0	3.59834e-05	0.001168	4.05178e-05	4	20				
LRRTM4	80059	broad.mit.edu	37	2	77746912	77746912	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:77746912G>T	ENST00000409093.1	-	3	419	c.83C>A	c.(82-84)aCg>aAg	p.T28K	LRRTM4_ENST00000409911.1_Missense_Mutation_p.T29K|LRRTM4_ENST00000409088.3_Missense_Mutation_p.T28K|LRRTM4_ENST00000409884.1_Missense_Mutation_p.T28K|LRRTM4_ENST00000409282.1_Missense_Mutation_p.T29K			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	28					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.T28M(2)|p.T28K(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CTGAGCACCCGTGAGCATAAC	0.443																																							uc002snr.2		NA																	4	Substitution - Missense(4)		lung(2)|endometrium(2)	pancreas(3)|ovary(1)	4						c.(82-84)ACG>AAG		leucine rich repeat transmembrane neuronal 4							69.0	68.0	68.0					2																	77746912		2028	4198	6226	SO:0001583	missense	80059					integral to membrane		g.chr2:77746912G>T	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.83C>A	2.37:g.77746912G>T	ENSP00000386357:p.Thr28Lys		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.T28K|LRRTM4_uc002sns.2_Missense_Mutation_p.T28K|LRRTM4_uc002snt.2_Missense_Mutation_p.T29K	p.T28K	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	498	-			28					Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.83C>A	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.517314	0.27123	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282;ENST00000456154	T;T;T;T;T	0.52754	0.65;0.67;0.67;0.78;0.79	5.96	5.96	0.96718	.	0.435314	0.26146	N	0.026067	T	0.27731	0.0682	N	0.14661	0.345	0.24037	N	0.996091	B;B;P	0.38597	0.242;0.355;0.639	B;B;B	0.28916	0.044;0.096;0.061	T	0.30060	-0.9991	10	0.48119	T	0.1	.	12.3072	0.54908	0.0774:0.0:0.9226:0.0	.	29;28;28	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	K	29;28;28;28;29;17	ENSP00000387228:T29K;ENSP00000387297:T28K;ENSP00000386357:T28K;ENSP00000386236:T28K;ENSP00000386286:T29K	ENSP00000386236:T28K	T	-	2	0	LRRTM4	77600420	0.017000	0.18338	0.998000	0.56505	0.995000	0.86356	1.961000	0.40432	2.826000	0.97356	0.655000	0.94253	ACG		0.443	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		12	31	1	0	5.16669e-11	0.010729	6.84771e-11	12	31				
RETSAT	54884	broad.mit.edu	37	2	85571154	85571154	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:85571154C>A	ENST00000295802.4	-	9	1613	c.1501G>T	c.(1501-1503)Gtc>Ttc	p.V501F	RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Missense_Mutation_p.V440F|RETSAT_ENST00000475624.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	501					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.V501F(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	AGTTTCAGGACCACTGACATA	0.537																																							uc002spd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1501-1503)GTC>TTC		all-trans-13,14-dihydroretinol saturase	Vitamin A(DB00162)						99.0	110.0	106.0					2																	85571154		2203	4300	6503	SO:0001583	missense	54884				retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity	g.chr2:85571154C>A	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1501G>T	2.37:g.85571154C>A	ENSP00000295802:p.Val501Phe		Somatic				RETSAT_uc010fge.2_Intron|RETSAT_uc010ysm.1_Missense_Mutation_p.V440F|RETSAT_uc010fgf.2_Missense_Mutation_p.V292F	p.V501F	NM_017750	NP_060220	WXS	Illumina HiSeq	Unspecified	Q6NUM9	RETST_HUMAN			9	1692	-			501					A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	c.1501G>T	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.918|6.918	0.539034|0.539034	0.13250|0.13250	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000295802;ENST00000457495|ENST00000449375	T;T|.	0.24908|.	1.83;1.84|.	4.87|4.87	-4.79|-4.79	0.03200|0.03200	.|.	0.551776|.	0.20000|.	N|.	0.101344|.	T|T	0.13756|0.13756	0.0333|0.0333	N|N	0.11698|0.11698	0.16|0.16	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.003;0.003;0.002|.	B;B;B|.	0.14578|.	0.011;0.011;0.003|.	T|T	0.24764|0.24764	-1.0151|-1.0151	10|5	0.54805|.	T|.	0.06|.	-5.1638|-5.1638	2.005|2.005	0.03475|0.03475	0.2289:0.1637:0.1128:0.4947|0.2289:0.1637:0.1128:0.4947	.|.	440;440;501|.	G5E9N3;B4DKE1;Q6NUM9|.	.;.;RETST_HUMAN|.	F|C	501;440|289	ENSP00000295802:V501F;ENSP00000405040:V440F|.	ENSP00000295802:V501F|.	V|W	-|-	1|3	0|0	RETSAT|RETSAT	85424665|85424665	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.164000|0.164000	0.22412|0.22412	0.089000|0.089000	0.15002|0.15002	-0.592000|-0.592000	0.05851|0.05851	0.561000|0.561000	0.74099|0.74099	GTC|TGG		0.537	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750		43	170	1	0	8.00217e-19	0.01441	1.21791e-18	43	170				
AMER3	205147	broad.mit.edu	37	2	131519874	131519874	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:131519874G>C	ENST00000423981.1	+	2	339	c.229G>C	c.(229-231)Gga>Cga	p.G77R	AMER3_ENST00000321420.4_Missense_Mutation_p.G77R	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	77					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.G77R(1)									CCCCAAAGGGGGACCCGCAGC	0.647																																							uc002trw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(229-231)GGA>CGA		hypothetical protein LOC205147							18.0	27.0	24.0					2																	131519874		2197	4299	6496	SO:0001583	missense	205147							g.chr2:131519874G>C	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.229G>C	2.37:g.131519874G>C	ENSP00000392700:p.Gly77Arg		Somatic				FAM123C_uc010fmv.2_Missense_Mutation_p.G77R|FAM123C_uc010fms.1_Missense_Mutation_p.G77R|FAM123C_uc010fmt.1_Missense_Mutation_p.G77R|FAM123C_uc010fmu.1_Missense_Mutation_p.G77R	p.G77R	NM_152698	NP_689911	WXS	Illumina HiSeq	Unspecified	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	419	+	Colorectal(110;0.1)		77					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.229G>C	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569154	0.45798	.	.	ENSG00000178171	ENST00000321420;ENST00000431758;ENST00000458606;ENST00000423981	T;T	0.47528	0.84;0.84	4.89	1.02	0.19986	.	0.000000	0.47455	D	0.000240	T	0.38374	0.1038	L	0.29908	0.895	0.09310	N	1	P	0.48162	0.906	P	0.49752	0.621	T	0.17961	-1.0352	10	0.40728	T	0.16	.	6.6426	0.22917	0.3965:0.0:0.6035:0.0	.	77	Q8N944	F123C_HUMAN	R	77	ENSP00000314914:G77R;ENSP00000392700:G77R	ENSP00000314914:G77R	G	+	1	0	FAM123C	131236344	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.726000	0.25984	0.213000	0.20722	-0.291000	0.09656	GGA		0.647	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		3	18	0	0	0	0.009096	0	3	18				
LCT	3938	broad.mit.edu	37	2	136566318	136566318	+	Missense_Mutation	SNP	G	G	C	rs148317168		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:136566318G>C	ENST00000264162.2	-	8	3609	c.3599C>G	c.(3598-3600)aCg>aGg	p.T1200R	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1200	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.T1200R(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GACGTCGGCCGTCGCCCTGAT	0.557																																							uc002tuu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(3598-3600)ACG>AGG		lactase-phlorizin hydrolase preproprotein							187.0	159.0	169.0					2																	136566318		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136566318G>C	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3599C>G	2.37:g.136566318G>C	ENSP00000264162:p.Thr1200Arg		Somatic					p.T1200R	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	8	3610	-			1200			3.|Extracellular (Potential).|4 X approximate repeats.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.3599C>G	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816901	0.50633	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.54071	0.59	5.76	5.76	0.90799	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.042822	0.85682	D	0.000000	T	0.71634	0.3363	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72551	-0.4259	10	0.87932	D	0	-16.322	19.9595	0.97236	0.0:0.0:1.0:0.0	.	1200	P09848	LPH_HUMAN	R	1200;632	ENSP00000264162:T1200R	ENSP00000264162:T1200R	T	-	2	0	LCT	136282788	1.000000	0.71417	0.076000	0.20297	0.080000	0.17528	9.869000	0.99810	2.706000	0.92434	0.563000	0.77884	ACG		0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		39	174	0	0	0	0.007835	0	39	174				
LRP1B	53353	broad.mit.edu	37	2	141751656	141751656	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:141751656C>G	ENST00000389484.3	-	16	3523	c.2552G>C	c.(2551-2553)cGc>cCc	p.R851P	Y_RNA_ENST00000365022.1_RNA	NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	851	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R851P(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTTTTGCAGCGAAACTCTCC	0.438										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(2551-2553)CGC>CCC		low density lipoprotein-related protein 1B							135.0	128.0	130.0					2																	141751656		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141751656C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2552G>C	2.37:g.141751656C>G	ENSP00000374135:p.Arg851Pro	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.R851P	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	16	3524	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	851			Extracellular (Potential).|LDL-receptor class A 3.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.2552G>C	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316028	0.60524	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96232	-3.95	5.76	5.76	0.90799	.	0.180787	0.39274	U	0.001417	D	0.95207	0.8446	M	0.62016	1.91	0.40314	D	0.978743	P	0.41041	0.736	P	0.46885	0.53	D	0.92909	0.6346	10	0.30854	T	0.27	.	7.5489	0.27783	0.0:0.8047:0.0:0.1953	.	851	Q9NZR2	LRP1B_HUMAN	P	851;789	ENSP00000374135:R851P	ENSP00000374135:R851P	R	-	2	0	LRP1B	141468126	0.996000	0.38824	1.000000	0.80357	0.995000	0.86356	1.526000	0.35964	2.715000	0.92844	0.563000	0.77884	CGC		0.438	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		19	90	0	0	0	0.010504	0	19	90				
ORC4	5000	broad.mit.edu	37	2	148715893	148715893	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:148715893C>A	ENST00000392857.5	-	6	468	c.361G>T	c.(361-363)Gaa>Taa	p.E121*	ORC4_ENST00000540442.1_Nonsense_Mutation_p.E47*|ORC4_ENST00000542387.1_5'UTR|ORC4_ENST00000535373.1_Nonsense_Mutation_p.E121*|ORC4_ENST00000264169.2_Nonsense_Mutation_p.E121*|ORC4_ENST00000536575.1_Nonsense_Mutation_p.E37*|ORC4_ENST00000392858.1_Nonsense_Mutation_p.E121*	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	121					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.E121*(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						ACTACATTTTCCAGATTTAAC	0.254																																							uc002twi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(361-363)GAA>TAA		origin recognition complex subunit 4							70.0	70.0	70.0					2																	148715893		2200	4298	6498	SO:0001587	stop_gained	5000				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding	g.chr2:148715893C>A	AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.361G>T	2.37:g.148715893C>A	ENSP00000376597:p.Glu121*		Somatic				ORC4L_uc002twj.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbo.1_Nonsense_Mutation_p.E47*|ORC4L_uc010zbp.1_5'UTR|ORC4L_uc010fnr.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbq.1_Nonsense_Mutation_p.E37*|ORC4L_uc002twk.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbr.1_Nonsense_Mutation_p.E121*	p.E121*	NM_181741	NP_859525	WXS	Illumina HiSeq	Unspecified	O43929	ORC4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)	6	496	-			121					B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Nonsense_Mutation	SNP	ENST00000392857.5	37	c.361G>T	CCDS2187.1	.	.	.	.	.	.	.	.	.	.	C	36	5.958139	0.97145	.	.	ENSG00000115947	ENST00000264169;ENST00000535373;ENST00000392858;ENST00000540442;ENST00000536575;ENST00000392857;ENST00000416719;ENST00000457954;ENST00000440042	.	.	.	5.34	5.34	0.76211	.	0.047429	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-12.9691	18.6323	0.91364	0.0:1.0:0.0:0.0	.	.	.	.	X	121;121;121;47;37;121;121;121;121	.	ENSP00000264169:E121X	E	-	1	0	ORC4	148432363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.369000	0.79578	2.468000	0.83385	0.585000	0.79938	GAA		0.254	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254797.3	NM_181742		6	21	1	0	8.12818e-05	0.001984	9.07866e-05	6	21				
GALNT13	114805	broad.mit.edu	37	2	154801038	154801038	+	Missense_Mutation	SNP	G	G	T	rs538808548		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:154801038G>T	ENST00000392825.3	+	3	595	c.28G>T	c.(28-30)Gtt>Ttt	p.V10F	GALNT13_ENST00000409237.1_Missense_Mutation_p.V10F	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	10					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CTGCAAGGTGGTTCTAGCCAC	0.413																																							uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(28-30)GTT>TTT		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							249.0	221.0	231.0					2																	154801038		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:154801038G>T	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.28G>T	2.37:g.154801038G>T	ENSP00000376570:p.Val10Phe		Somatic				GALNT13_uc002tyt.3_Missense_Mutation_p.V10F	p.V10F	NM_052917	NP_443149	WXS	Illumina HiSeq	Unspecified	Q8IUC8	GLT13_HUMAN			3	595	+			10			Helical; Signal-anchor for type II membrane protein; (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.28G>T	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250467	0.95305	.	.	ENSG00000144278	ENST00000392825;ENST00000434213;ENST00000409237	T;T	0.59638	0.31;0.25	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000001	T	0.74306	0.3699	M	0.73962	2.25	0.80722	D	1	P;P	0.52692	0.955;0.955	P;P	0.60345	0.873;0.835	T	0.77135	-0.2699	10	0.72032	D	0.01	.	17.7929	0.88561	0.0:0.0:1.0:0.0	.	10;10	Q08ER7;Q8IUC8	.;GLT13_HUMAN	F	10	ENSP00000376570:V10F;ENSP00000387239:V10F	ENSP00000376570:V10F	V	+	1	0	GALNT13	154509284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.930000	0.87610	2.542000	0.85734	0.585000	0.79938	GTT		0.413	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		34	121	1	0	4.44401e-20	0.010771	6.83884e-20	34	121				
CHRNA1	1134	broad.mit.edu	37	2	175624091	175624091	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:175624091G>A	ENST00000261007.5	-	3	268	c.202C>T	c.(202-204)Cag>Tag	p.Q68*	CHRNA1_ENST00000348749.5_Nonsense_Mutation_p.Q68*|CHRNA1_ENST00000409323.1_Nonsense_Mutation_p.Q68*|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Nonsense_Mutation_p.Q68*|CHRNA1_ENST00000409219.1_Nonsense_Mutation_p.Q68*	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	68					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.Q68*(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GTCACGATCTGATTTACTTCA	0.473																																							uc002ujd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(202-204)CAG>TAG		nicotinic cholinergic receptor alpha 1 isoform a							100.0	96.0	98.0					2																	175624091		2203	4300	6503	SO:0001587	stop_gained	1134				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr2:175624091G>A	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.202C>T	2.37:g.175624091G>A	ENSP00000261007:p.Gln68*		Somatic				uc002uiw.2_Intron|CHRNA1_uc002uje.2_Nonsense_Mutation_p.Q68*|CHRNA1_uc002ujf.3_Nonsense_Mutation_p.Q68*	p.Q68*	NM_001039523	NP_001034612	WXS	Illumina HiSeq	Unspecified	P02708	ACHA_HUMAN			3	280	-			68			Extracellular.		B4DRV6|D3DPE8	Nonsense_Mutation	SNP	ENST00000261007.5	37	c.202C>T	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	G	37	6.115286	0.97296	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0402	0.97587	0.0:0.0:1.0:0.0	.	.	.	.	X	68	.	ENSP00000261007:Q68X	Q	-	1	0	CHRNA1	175332337	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.803000	0.99136	2.750000	0.94351	0.563000	0.77884	CAG		0.473	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			30	126	0	0	0	0.010818	0	30	126				
TTC30B	150737	broad.mit.edu	37	2	178417000	178417000	+	Silent	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:178417000G>C	ENST00000408939.3	-	1	742	c.492C>G	c.(490-492)ctC>ctG	p.L164L		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	164					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.L164L(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			CCTCCTTGTAGAGCAAACAAC	0.582																																							uc002uln.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(490-492)CTC>CTG		tetratricopeptide repeat domain 30B							171.0	190.0	183.0					2																	178417000		2203	4300	6503	SO:0001819	synonymous_variant	150737				cell projection organization	cilium	binding	g.chr2:178417000G>C	AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.492C>G	2.37:g.178417000G>C			Somatic				TTC30B_uc010zfc.1_5'UTR	p.L164L	NM_152517	NP_689730	WXS	Illumina HiSeq	Unspecified	Q8N4P2	TT30B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)		1	525	-			164			TPR 3.		Q63HQ1|Q96NE6	Silent	SNP	ENST00000408939.3	37	c.492C>G	CCDS42784.1																																																																																				0.582	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334193.2	NM_152517		13	444	0	0	0	0.001855	0	13	444				
TTN	7273	broad.mit.edu	37	2	179650354	179650354	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:179650354C>G	ENST00000591111.1	-	15	2710	c.2486G>C	c.(2485-2487)gGa>gCa	p.G829A	TTN_ENST00000342175.6_Missense_Mutation_p.G783A|TTN_ENST00000342992.6_Missense_Mutation_p.G829A|TTN_ENST00000460472.2_Missense_Mutation_p.G783A|TTN_ENST00000360870.5_Missense_Mutation_p.G829A|TTN_ENST00000359218.5_Missense_Mutation_p.G783A|TTN_ENST00000589042.1_Missense_Mutation_p.G829A			Q8WZ42	TITIN_HUMAN	titin	33660					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G829A(3)|p.G783A(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCTCATATCCATGTTCTGT	0.413																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(2485-2487)GGA>GCA		titin isoform N2-A							110.0	109.0	109.0					2																	179650354		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179650354C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2486G>C	2.37:g.179650354C>G	ENSP00000465570:p.Gly829Ala		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.G783A|TTN_uc010zfi.1_Missense_Mutation_p.G783A|TTN_uc010zfj.1_Missense_Mutation_p.G783A|TTN_uc002unb.2_Missense_Mutation_p.G829A	p.G829A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		15	2710	-			829					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.2486G>C		.	.	.	.	.	.	.	.	.	.	C	12.09	1.834302	0.32421	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.61510	0.1;0.36;0.34;0.33;0.37	5.63	5.63	0.86233	Ribonuclease H-like (1);	.	.	.	.	T	0.47135	0.1429	N	0.24115	0.695	0.24554	N	0.994006	B;B;B;B;P	0.43287	0.144;0.144;0.144;0.144;0.802	B;B;B;B;B	0.42495	0.035;0.035;0.035;0.035;0.389	T	0.47100	-0.9143	9	0.87932	D	0	.	10.6457	0.45619	0.1221:0.5983:0.2797:0.0	.	783;783;783;829;829	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	829;783;783;783;783;829	ENSP00000343764:G829A;ENSP00000434586:G783A;ENSP00000340554:G783A;ENSP00000352154:G783A;ENSP00000354117:G829A	ENSP00000340554:G783A	G	-	2	0	TTN	179358599	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.204000	0.58460	2.798000	0.96311	0.655000	0.94253	GGA		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		19	60	0	0	0	0.008871	0	19	60				
ICA1L	130026	broad.mit.edu	37	2	203686132	203686132	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:203686132C>T	ENST00000392237.2	-	5	465	c.308G>A	c.(307-309)gGc>gAc	p.G103D	ICA1L_ENST00000425178.1_Missense_Mutation_p.G103D|ICA1L_ENST00000358299.2_Missense_Mutation_p.G103D|ICA1L_ENST00000418208.1_Intron	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	103	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.							p.G103D(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CATCATTTTGCCAGCTTGAGT	0.383																																							uc002uzh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)GGC>GAC		islet cell autoantigen 1,69kDa-like isoform 1							133.0	126.0	128.0					2																	203686132		2203	4300	6503	SO:0001583	missense	130026							g.chr2:203686132C>T	AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.308G>A	2.37:g.203686132C>T	ENSP00000376070:p.Gly103Asp		Somatic				ICA1L_uc002uzi.1_Missense_Mutation_p.G103D|ICA1L_uc002uzj.2_Missense_Mutation_p.G103D	p.G103D	NM_138468	NP_612477	WXS	Illumina HiSeq	Unspecified	Q8NDH6	ICA1L_HUMAN			5	472	-			103			AH.		B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	ENST00000392237.2	37	c.308G>A	CCDS2354.1	.	.	.	.	.	.	.	.	.	.	C	32	5.128149	0.94473	.	.	ENSG00000163596	ENST00000392237;ENST00000358299;ENST00000425178;ENST00000450143;ENST00000435143;ENST00000419460;ENST00000441547;ENST00000412210	T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	5.74	5.74	0.90152	Arfaptin-like (3);	0.054132	0.64402	D	0.000001	D	0.89044	0.6603	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89424	0.3712	10	0.56958	D	0.05	.	17.4256	0.87525	0.0:1.0:0.0:0.0	.	103	Q8NDH6	ICA1L_HUMAN	D	103	ENSP00000376070:G103D;ENSP00000351047:G103D;ENSP00000404189:G103D;ENSP00000410747:G103D;ENSP00000405592:G103D;ENSP00000410135:G103D;ENSP00000404618:G103D;ENSP00000387382:G103D	ENSP00000351047:G103D	G	-	2	0	ICA1L	203394377	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.460000	0.80816	2.716000	0.92895	0.591000	0.81541	GGC		0.383	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256330.1	NM_138468		31	110	0	0	0	0.013726	0	31	110				
CPS1	1373	broad.mit.edu	37	2	211459298	211459298	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:211459298C>T	ENST00000233072.5	+	12	1427	c.1231C>T	c.(1231-1233)Ccg>Tcg	p.P411S	CPS1_ENST00000430249.2_Missense_Mutation_p.P417S|CPS1_ENST00000451903.2_5'UTR	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	411					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.P411S(1)|p.P417S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATCAGTCTTACCGAAGCCAGC	0.363																																							uc002vee.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(1231-1233)CCG>TCG		carbamoyl-phosphate synthetase 1 isoform b							145.0	132.0	137.0					2																	211459298		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211459298C>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1231C>T	2.37:g.211459298C>T	ENSP00000233072:p.Pro411Ser		Somatic				CPS1_uc010fur.2_Missense_Mutation_p.P417S|CPS1_uc010fus.2_5'UTR	p.P411S	NM_001875	NP_001866	WXS	Illumina HiSeq	Unspecified	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	12	1363	+			411					B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.1231C>T	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442005	0.83993	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.97620	-4.46;-4.46	5.83	5.83	0.93111	Pre-ATP-grasp fold (1);	0.000000	0.85682	D	0.000000	D	0.96867	0.8977	L	0.42632	1.34	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.55713	0.782;0.782	D	0.95321	0.8420	10	0.23302	T	0.38	-2.9845	20.1099	0.97909	0.0:1.0:0.0:0.0	.	421;411	Q59HF8;P31327	.;CPSM_HUMAN	S	417;419;411;411	ENSP00000402608:P417S;ENSP00000233072:P411S	ENSP00000233072:P411S	P	+	1	0	CPS1	211167543	1.000000	0.71417	0.972000	0.41901	0.610000	0.37248	6.757000	0.74924	2.753000	0.94483	0.585000	0.79938	CCG		0.363	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			7	32	0	0	0	0.006214	0	7	32				
VIL1	7429	broad.mit.edu	37	2	219296603	219296603	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:219296603G>A	ENST00000248444.5	+	11	1214	c.1126G>A	c.(1126-1128)Gat>Aat	p.D376N	VIL1_ENST00000392114.2_Missense_Mutation_p.D65N	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	376	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.D376N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTGAAGTTCGATGCCACATC	0.557																																							uc002via.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1126-1128)GAT>AAT		villin 1							102.0	80.0	87.0					2																	219296603		2203	4300	6503	SO:0001583	missense	7429				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity	g.chr2:219296603G>A	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1126G>A	2.37:g.219296603G>A	ENSP00000248444:p.Asp376Asn		Somatic				VIL1_uc010zke.1_Missense_Mutation_p.D65N|VIL1_uc002vib.2_Missense_Mutation_p.D376N	p.D376N	NM_007127	NP_009058	WXS	Illumina HiSeq	Unspecified	P09327	VILI_HUMAN		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	11	1191	+		Renal(207;0.0474)	376			Core.		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	c.1126G>A	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577763	0.65878	.	.	ENSG00000127831	ENST00000248444;ENST00000392114	T;T	0.32023	1.47;2.39	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.43964	0.1271	M	0.85859	2.78	0.80722	D	1	D	0.67145	0.996	B	0.43478	0.421	T	0.58691	-0.7592	10	0.52906	T	0.07	-20.6861	18.0209	0.89254	0.0:0.0:1.0:0.0	.	376	P09327	VILI_HUMAN	N	376;65	ENSP00000248444:D376N;ENSP00000375962:D65N	ENSP00000248444:D376N	D	+	1	0	VIL1	219004847	1.000000	0.71417	0.990000	0.47175	0.326000	0.28443	7.773000	0.85462	2.273000	0.75805	0.462000	0.41574	GAT		0.557	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		9	30	0	0	0	0.004482	0	9	30				
NGEF	25791	broad.mit.edu	37	2	233785096	233785096	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr2:233785096G>A	ENST00000264051.3	-	5	1004	c.726C>T	c.(724-726)ctC>ctT	p.L242L	NGEF_ENST00000409079.1_Silent_p.L150L|NGEF_ENST00000373552.4_Silent_p.L150L	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	242	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L242L(2)		central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GGGGGTTACTGAGCAGGCAGA	0.617																																							uc002vts.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|central_nervous_system(3)|skin(1)	7						c.(724-726)CTC>CTT		neuronal guanine nucleotide exchange factor							64.0	68.0	67.0					2																	233785096		2203	4300	6503	SO:0001819	synonymous_variant	25791				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity	g.chr2:233785096G>A	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.726C>T	2.37:g.233785096G>A			Somatic				NGEF_uc010fyg.1_Silent_p.L150L|NGEF_uc002vtt.2_Silent_p.L150L	p.L242L	NM_019850	NP_062824	WXS	Illumina HiSeq	Unspecified	Q8N5V2	NGEF_HUMAN		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)	5	974	-		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	242			Regulatory region; modulates activity toward RHOA, RAC1 and CDC42 (By similarity).		B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	ENST00000264051.3	37	c.726C>T	CCDS2500.1																																																																																				0.617	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799		6	90	0	0	0	0.001168	0	6	90				
CYP24A1	1591	broad.mit.edu	37	20	52781004	52781004	+	Silent	SNP	G	G	T	rs368898455		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr20:52781004G>T	ENST00000216862.3	-	6	1224	c.831C>A	c.(829-831)acC>acA	p.T277T	CYP24A1_ENST00000395954.3_Silent_p.T135T|CYP24A1_ENST00000395955.3_Silent_p.T277T	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	277					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.T277T(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	ATTTGAAAATGGTGTCCCAGG	0.567																																							uc002xwv.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						c.(829-831)ACC>ACA		cytochrome P450 family 24 subfamily A	Calcidiol(DB00146)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)						216.0	183.0	194.0					20																	52781004		2203	4300	6503	SO:0001819	synonymous_variant	1591				hormone biosynthetic process|osteoblast differentiation|vitamin D catabolic process|vitamin D receptor signaling pathway|xenobiotic metabolic process	mitochondrial inner membrane	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity|electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen	g.chr20:52781004G>T	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.831C>A	20.37:g.52781004G>T			Somatic				CYP24A1_uc002xwu.1_Silent_p.T135T|CYP24A1_uc002xww.2_Silent_p.T277T	p.T277T	NM_000782	NP_000773	WXS	Illumina HiSeq	Unspecified	Q07973	CP24A_HUMAN	STAD - Stomach adenocarcinoma(23;0.206)		6	1229	-	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		277					Q15807|Q32ML3|Q5I2W7	Silent	SNP	ENST00000216862.3	37	c.831C>A	CCDS33491.1																																																																																				0.567	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2			40	131	1	0	2.05212e-20	0.005524	3.22975e-20	40	131				
TAF4	6874	broad.mit.edu	37	20	60575636	60575636	+	Silent	SNP	C	C	A	rs149271691		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr20:60575636C>A	ENST00000252996.4	-	10	2627	c.2628G>T	c.(2626-2628)gcG>gcT	p.A876A		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	876					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.A876A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TCTGCAAAGGCGCTTGGAGGA	0.458																																							uc002ybs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(2626-2628)GCG>GCT		TBP-associated factor 4							133.0	128.0	129.0					20																	60575636		2203	4300	6503	SO:0001819	synonymous_variant	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60575636C>A	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2628G>T	20.37:g.60575636C>A			Somatic					p.A876A	NM_003185	NP_003176	WXS	Illumina HiSeq	Unspecified	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		10	2628	-	Breast(26;1e-08)		876					A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	ENST00000252996.4	37	c.2628G>T	CCDS33500.1																																																																																				0.458	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		41	179	1	0	5.20006e-24	0.011902	8.62525e-24	41	179				
TMPRSS15	5651	broad.mit.edu	37	21	19713778	19713778	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr21:19713778G>T	ENST00000284885.3	-	13	1549	c.1516C>A	c.(1516-1518)Ctt>Att	p.L506I		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	506						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.L506I(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCTGGATAAAGACTCCCATTG	0.383																																							uc002ykw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(1516-1518)CTT>ATT		enterokinase precursor							168.0	159.0	162.0					21																	19713778		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19713778G>T		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1516C>A	21.37:g.19713778G>T	ENSP00000284885:p.Leu506Ile		Somatic					p.L506I	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			13	1547	-			506			Extracellular (Potential).		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.1516C>A	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889261	0.33348	.	.	ENSG00000154646	ENST00000284885	D	0.86432	-2.12	5.64	2.72	0.32119	.	0.372124	0.26390	N	0.024651	T	0.75503	0.3858	L	0.34521	1.04	0.09310	N	1	B	0.27351	0.176	B	0.21151	0.033	T	0.60234	-0.7303	9	.	.	.	.	5.5248	0.16953	0.0744:0.3522:0.4378:0.1356	.	506	P98073	ENTK_HUMAN	I	506	ENSP00000284885:L506I	.	L	-	1	0	TMPRSS15	18635649	0.015000	0.18098	0.938000	0.37757	0.955000	0.61496	0.466000	0.22019	0.732000	0.32470	0.484000	0.47621	CTT		0.383	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		22	91	1	0	9.95505e-16	0.014323	1.44374e-15	22	91				
GRIK1	2897	broad.mit.edu	37	21	31311771	31311771	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr21:31311771G>T	ENST00000399907.1	-	1	459	c.48C>A	c.(46-48)gaC>gaA	p.D16E	GRIK1_ENST00000399914.1_Missense_Mutation_p.D16E|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000535441.1_Missense_Mutation_p.D16E|GRIK1_ENST00000399913.1_Missense_Mutation_p.D16E|GRIK1_ENST00000389124.2_Missense_Mutation_p.D16E|GRIK1_ENST00000399909.1_Missense_Mutation_p.D16E|GRIK1_ENST00000309434.7_Missense_Mutation_p.D16E|GRIK1_ENST00000389125.3_Missense_Mutation_p.D16E|GRIK1_ENST00000327783.4_Missense_Mutation_p.D16E	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	16					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.D16E(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CCCAGCTGGTGTCCCTGGTCC	0.622																																							uc002yno.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|skin(1)	3						c.(46-48)GAC>GAA		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						103.0	81.0	88.0					21																	31311771		2203	4300	6503	SO:0001583	missense	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:31311771G>T		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.48C>A	21.37:g.31311771G>T	ENSP00000382791:p.Asp16Glu		Somatic				GRIK1_uc002ynn.2_Missense_Mutation_p.D16E|GRIK1_uc011acs.1_Missense_Mutation_p.D16E|GRIK1_uc011act.1_Missense_Mutation_p.D16E|GRIK1_uc010glq.1_Missense_Mutation_p.D16E|GRIK1_uc002ynr.2_Missense_Mutation_p.D16E	p.D16E	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			1	512	-			16					Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	c.48C>A	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.964265	0.34659	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.11063	2.81;2.86;2.86;2.81;2.86;2.81;2.86;2.86;2.86	3.85	2.93	0.34026	.	1.516220	0.03936	N	0.286115	T	0.07954	0.0199	N	0.14661	0.345	0.20196	N	0.999926	B;B;B;B;B	0.27732	0.004;0.118;0.118;0.118;0.187	B;B;B;B;B	0.22386	0.002;0.017;0.007;0.017;0.039	T	0.30534	-0.9975	10	0.30078	T	0.28	.	9.3734	0.38268	0.0:0.218:0.782:0.0	.	16;16;16;16;16	E7EPY9;E9PD61;B7Z3V7;P39086;P39086-2	.;.;.;GRIK1_HUMAN;.	E	16	ENSP00000327687:D16E;ENSP00000373777:D16E;ENSP00000382797:D16E;ENSP00000382798:D16E;ENSP00000446326:D16E;ENSP00000373776:D16E;ENSP00000382791:D16E;ENSP00000382793:D16E;ENSP00000311646:D16E	ENSP00000311646:D16E	D	-	3	2	GRIK1	30233642	0.971000	0.33674	1.000000	0.80357	0.996000	0.88848	1.246000	0.32803	1.136000	0.42199	0.462000	0.41574	GAC		0.622	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			10	16	1	0	0.000442599	0.006214	0.000477043	10	16				
KRTAP10-4	386672	broad.mit.edu	37	21	45993646	45993646	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr21:45993646G>A	ENST00000400374.3	+	1	41	c.11G>A	c.(10-12)tGc>tAc	p.C4Y	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	4						keratin filament (GO:0045095)		p.C4Y(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						ATGTCCGTCTGCTCCAGCGAC	0.632																																							uc002zfk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(10-12)TGC>TAC		keratin associated protein 10-4							88.0	105.0	99.0					21																	45993646		2181	4282	6463	SO:0001583	missense	386672					keratin filament		g.chr21:45993646G>A	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.11G>A	21.37:g.45993646G>A	ENSP00000383225:p.Cys4Tyr		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C4Y	NM_198687	NP_941960	WXS	Illumina HiSeq	Unspecified	P60372	KR104_HUMAN			1	41	+			4					Q08AS0	Missense_Mutation	SNP	ENST00000400374.3	37	c.11G>A	CCDS42957.1	.	.	.	.	.	.	.	.	.	.	N	12.09	1.832639	0.32421	.	.	ENSG00000215454	ENST00000400374;ENST00000334871	T	0.02863	4.13	4.56	3.66	0.41972	.	.	.	.	.	T	0.05731	0.0150	M	0.83774	2.66	0.26429	N	0.97596	B	0.30824	0.296	B	0.26094	0.066	T	0.11084	-1.0602	9	0.66056	D	0.02	.	7.8761	0.29595	0.1147:0.0:0.8853:0.0	.	4	P60372	KR104_HUMAN	Y	4;8	ENSP00000383225:C4Y	ENSP00000333987:C8Y	C	+	2	0	KRTAP10-4	44818074	0.998000	0.40836	1.000000	0.80357	0.795000	0.44927	1.622000	0.36997	2.238000	0.73509	0.484000	0.47621	TGC		0.632	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687		21	86	0	0	0	0.012319	0	21	86				
CCT8L2	150160	broad.mit.edu	37	22	17072423	17072423	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:17072423G>T	ENST00000359963.3	-	1	1277	c.1018C>A	c.(1018-1020)Cct>Act	p.P340T		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	340					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.P340T(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTCTGGGGAGGGAGCAGACGA	0.552																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1018-1020)CCT>ACT		T-complex protein 1							126.0	119.0	121.0					22																	17072423		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072423G>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1018C>A	22.37:g.17072423G>T	ENSP00000353048:p.Pro340Thr		Somatic					p.P340T	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1278	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	340					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1018C>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	g	5.817	0.335066	0.11013	.	.	ENSG00000198445	ENST00000359963	T	0.76968	-1.06	1.98	1.98	0.26296	.	0.000000	0.39210	U	0.001436	T	0.62011	0.2393	L	0.41236	1.265	0.26639	N	0.972314	B	0.22346	0.068	B	0.28385	0.089	T	0.46624	-0.9178	10	0.02654	T	1	-13.8945	7.4423	0.27190	0.0:0.0:1.0:0.0	.	340	Q96SF2	TCPQM_HUMAN	T	340	ENSP00000353048:P340T	ENSP00000353048:P340T	P	-	1	0	CCT8L2	15452423	0.789000	0.28775	0.496000	0.27539	0.174000	0.22865	1.311000	0.33562	1.115000	0.41800	0.379000	0.24179	CCT		0.552	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			17	184	1	0	6.49762e-13	0.006122	8.95443e-13	17	184				
MICAL3	57553	broad.mit.edu	37	22	18301821	18301821	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:18301821C>A	ENST00000441493.2	-	26	3958	c.3606G>T	c.(3604-3606)ttG>ttT	p.L1202F		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1202	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.L1202F(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTTTGGGGAGCAAAGGCTCAG	0.602																																							uc002zng.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3604-3606)TTG>TTT		microtubule associated monoxygenase, calponin							19.0	21.0	20.0					22																	18301821		1918	4105	6023	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18301821C>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3606G>T	22.37:g.18301821C>A	ENSP00000416015:p.Leu1202Phe		Somatic				MICAL3_uc011agl.1_Missense_Mutation_p.L1118F	p.L1202F	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	26	3959	-		all_epithelial(15;0.198)	1202			Pro-rich.		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.3606G>T	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.965|7.965	0.747783|0.747783	0.15710|0.15710	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.62364	.|0.03	4.73|4.73	1.17|1.17	0.20885|0.20885	.|.	.|.	.|.	.|.	.|.	T|T	0.39036|0.39036	0.1063|0.1063	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.17319|0.17319	-1.0373|-1.0373	5|8	.|.	.|.	.|.	.|.	3.0678|3.0678	0.06220|0.06220	0.2187:0.2458:0.4373:0.0981|0.2187:0.2458:0.4373:0.0981	.|.	.|1202	.|Q7RTP6	.|MICA3_HUMAN	F|F	184|1202	.|ENSP00000416015:L1202F	.|.	C|L	-|-	2|3	0|2	XXbac-B461K10.4|XXbac-B461K10.4	16681821|16681821	0.013000|0.013000	0.17824|0.17824	0.000000|0.000000	0.03702|0.03702	0.103000|0.103000	0.19146|0.19146	-0.301000|-0.301000	0.08232|0.08232	0.400000|0.400000	0.25396|0.25396	0.563000|0.563000	0.77884|0.77884	TGC|TTG		0.602	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			6	29	1	0	3.59834e-05	0.001168	4.05178e-05	6	29				
SNRPD3	6634	broad.mit.edu	37	22	24964111	24964111	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:24964111G>T	ENST00000215829.3	+	3	873	c.286G>T	c.(286-288)Ggc>Tgc	p.G96C	SNRPD3_ENST00000402849.1_Missense_Mutation_p.G96C	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	96	Arg/Lys-rich (basic).				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)	p.G96C(1)|p.G96S(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						CTCAGGGGCTGGCCGAGGAAA	0.458																																							uc003aam.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(1)	1						c.(286-288)GGC>TGC		small nuclear ribonucleoprotein polypeptide D3							56.0	53.0	54.0					22																	24964111		2203	4300	6503	SO:0001583	missense	6634				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding	g.chr22:24964111G>T	U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.286G>T	22.37:g.24964111G>T	ENSP00000215829:p.Gly96Cys		Somatic				SNRPD3_uc011aju.1_Missense_Mutation_p.G96C	p.G96C	NM_004175	NP_004166	WXS	Illumina HiSeq	Unspecified	P62318	SMD3_HUMAN			3	726	+			96			Arg/Lys-rich (basic).		B4DJP7|B5BU13|P43331	Missense_Mutation	SNP	ENST00000215829.3	37	c.286G>T	CCDS13828.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205849	0.79127	.	.	ENSG00000100028	ENST00000215829;ENST00000402849	T;T	0.49432	0.78;0.78	6.08	5.07	0.68467	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.58850	0.2151	M	0.70842	2.15	0.80722	D	1	P;P	0.48764	0.873;0.915	B;P	0.51999	0.431;0.687	T	0.63972	-0.6516	10	0.72032	D	0.01	.	12.7696	0.57412	0.075:0.0:0.925:0.0	.	96;96	B4DJP7;P62318	.;SMD3_HUMAN	C	96	ENSP00000215829:G96C;ENSP00000385266:G96C	ENSP00000385994:G96C	G	+	1	0	SNRPD3	23294111	1.000000	0.71417	0.912000	0.35992	0.990000	0.78478	9.195000	0.94971	1.590000	0.49995	0.655000	0.94253	GGC		0.458	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319813.1	NM_004175		16	50	1	0	2.94398e-08	0.007413	3.54558e-08	16	50				
POM121L10P	646074	broad.mit.edu	37	22	25045888	25045888	+	IGR	SNP	C	C	T	rs571236965		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:25045888C>T								GGT1 (20916 upstream) : PIWIL3 (69112 downstream)																							TGTCTTTGGCCCCACGCTGCT	0.607																																							uc011ajv.1		NA																	0					0						c.(610-612)GCC>GCT		Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).																																				SO:0001628	intergenic_variant	644165							g.chr22:25045888C>T																													22.37:g.25045888C>T			Somatic				POM121L10P_uc003aaz.3_Intron|POM121L10P_uc003abc.2_Intron	p.A204A	NR_024494		WXS	Illumina HiSeq	Unspecified					6	969	+									Silent	SNP		37	c.612C>T																																																																																				0	0.607									4	17	0	0	0	0.001168	0	4	17				
HPS4	89781	broad.mit.edu	37	22	26860631	26860631	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:26860631C>A	ENST00000398145.2	-	11	1581	c.965G>T	c.(964-966)aGg>aTg	p.R322M	HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000398141.1_Missense_Mutation_p.R335M|HPS4_ENST00000336873.5_Missense_Mutation_p.R322M|HPS4_ENST00000402105.3_Missense_Mutation_p.R317M	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	322					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)	p.R335M(1)|p.R322M(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						GTTCTCCTTCCTGCCATCTGG	0.587									Hermansky-Pudlak syndrome																														uc003acl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(964-966)AGG>ATG		light ear protein isoform a							99.0	90.0	93.0					22																	26860631		2203	4300	6503	SO:0001583	missense	89781	Hermansky-Pudlak_syndrome	Familial Cancer Database	HPS, HPS1-8	lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity	g.chr22:26860631C>A		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.965G>T	22.37:g.26860631C>A	ENSP00000381213:p.Arg322Met		Somatic				HPS4_uc003aci.2_Missense_Mutation_p.R317M|HPS4_uc003acj.2_Missense_Mutation_p.R186M|HPS4_uc003ack.2_Missense_Mutation_p.R113M|HPS4_uc003acn.2_Missense_Mutation_p.R168M|HPS4_uc010gvd.1_Missense_Mutation_p.R340M|HPS4_uc003ach.2_Missense_Mutation_p.R57M	p.R322M	NM_022081	NP_071364	WXS	Illumina HiSeq	Unspecified	Q9NQG7	HPS4_HUMAN			11	1624	-			322					B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	ENST00000398145.2	37	c.965G>T	CCDS13835.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470802	0.43942	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873;ENST00000312736;ENST00000422379	T;T;T;T;T	0.56444	1.47;1.46;1.47;1.47;0.46	4.56	-7.02	0.01589	.	1.341390	0.04797	N	0.432765	T	0.44871	0.1314	L	0.40543	1.245	0.09310	N	1	P;P;P;P;P;P	0.51791	0.876;0.924;0.924;0.876;0.948;0.924	B;P;P;B;P;P	0.47941	0.443;0.562;0.562;0.443;0.54;0.562	T	0.55685	-0.8102	10	0.66056	D	0.02	-0.0236	6.3076	0.21147	0.0:0.2252:0.2527:0.5222	.	322;322;322;322;335;317	Q6ICH6;Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;.;HPS4_HUMAN;.;.;.	M	322;335;317;322;340;340	ENSP00000381213:R322M;ENSP00000381210:R335M;ENSP00000384185:R317M;ENSP00000338457:R322M;ENSP00000415081:R340M	ENSP00000325840:R340M	R	-	2	0	HPS4	25190631	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.793000	0.01755	-1.606000	0.01591	-0.768000	0.03414	AGG		0.587	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081		21	87	1	0	2.44723e-14	0.004656	3.47632e-14	21	87				
SSTR3	6753	broad.mit.edu	37	22	37602771	37602771	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:37602771C>A	ENST00000328544.3	-	2	1605	c.1072G>T	c.(1072-1074)Ggg>Tgg	p.G358W	SSTR3_ENST00000402501.1_Missense_Mutation_p.G358W	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	358	Glu-rich (acidic).				cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.G358W(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	CTctcctccccatcctcctcc	0.716																																							uc003ara.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1072-1074)GGG>TGG		somatostatin receptor 3							32.0	31.0	31.0					22																	37602771		2203	4300	6503	SO:0001583	missense	6753				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity	g.chr22:37602771C>A		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1072G>T	22.37:g.37602771C>A	ENSP00000330138:p.Gly358Trp		Somatic				SSTR3_uc003arb.2_Missense_Mutation_p.G358W	p.G358W	NM_001051	NP_001042	WXS	Illumina HiSeq	Unspecified	P32745	SSR3_HUMAN			2	1134	-			358			Cytoplasmic (Potential).|Glu-rich (acidic).		A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	c.1072G>T	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	C	1.405	-0.577092	0.03854	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.73047	-0.71;-0.71	3.91	-1.13	0.09775	.	2.301940	0.01259	N	0.009133	T	0.54111	0.1838	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	10	0.59425	D	0.04	.	1.5187	0.02511	0.2718:0.413:0.1436:0.1716	.	358	P32745	SSR3_HUMAN	W	358	ENSP00000330138:G358W;ENSP00000384904:G358W	ENSP00000330138:G358W	G	-	1	0	SSTR3	35932717	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.017000	0.13399	-0.191000	0.10448	-0.140000	0.14226	GGG		0.716	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1			21	48	1	0	1.22574e-08	0.014323	1.48916e-08	21	48				
KCNJ4	3761	broad.mit.edu	37	22	38822911	38822911	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:38822911C>T	ENST00000303592.3	-	2	1485	c.1227G>A	c.(1225-1227)gaG>gaA	p.E409E	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	409					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)	p.E409E(1)		endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					TGCCCGCCTCCTCCTTGGAAC	0.677																																							uc003avs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1225-1227)GAG>GAA		potassium inwardly-rectifying channel J4							49.0	59.0	55.0					22																	38822911		2200	4300	6500	SO:0001819	synonymous_variant	3761				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding	g.chr22:38822911C>T	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.1227G>A	22.37:g.38822911C>T			Somatic				KCNJ4_uc003avt.1_Silent_p.E409E	p.E409E	NM_004981	NP_004972	WXS	Illumina HiSeq	Unspecified	P48050	IRK4_HUMAN			2	1324	-	Melanoma(58;0.0286)		409			Cytoplasmic (By similarity).		Q14D44	Silent	SNP	ENST00000303592.3	37	c.1227G>A	CCDS13971.1																																																																																				0.677	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981		15	89	0	0	0	0.007291	0	15	89				
CPT1B	1375	broad.mit.edu	37	22	51012810	51012810	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr22:51012810C>T	ENST00000360719.2	-	9	1061	c.924G>A	c.(922-924)caG>caA	p.Q308Q	CPT1B_ENST00000457250.1_Silent_p.Q274Q|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000440709.1_Silent_p.Q308Q|CPT1B_ENST00000405237.3_Silent_p.Q308Q|CPT1B_ENST00000434492.2_Silent_p.Q105Q|CPT1B_ENST00000312108.7_Silent_p.Q308Q|CPT1B_ENST00000395650.2_Silent_p.Q308Q	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	308					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.Q308Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TCCTCTCCATCTGGTAGGAGC	0.612																																					Esophageal Squamous(170;988 1933 25577 30295 48163)	Esophageal Squamous(170;988 1933 25577 30295 48163)	uc003bmk.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(922-924)CAG>CAA		carnitine palmitoyltransferase 1B isoform a							169.0	103.0	125.0					22																	51012810		2203	4300	6503	SO:0001819	synonymous_variant	1375				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr22:51012810C>T	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.924G>A	22.37:g.51012810C>T			Somatic				CPT1B_uc003bml.2_Silent_p.Q308Q|CPT1B_uc003bmm.2_Silent_p.Q308Q|CPT1B_uc003bmo.2_Silent_p.Q308Q|CPT1B_uc011asa.1_Silent_p.Q274Q|CPT1B_uc003bmn.2_Silent_p.Q308Q|CPT1B_uc011asb.1_Silent_p.Q308Q|CHKB-CPT1B_uc003bmp.2_Silent_p.Q105Q	p.Q308Q	NM_001145137	NP_001138609	WXS	Illumina HiSeq	Unspecified	Q92523	CPT1B_HUMAN		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)	8	1086	-		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	308			Cytoplasmic (Potential).		B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	ENST00000360719.2	37	c.924G>A	CCDS14098.1																																																																																				0.612	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246		6	33	0	0	0	0.001168	0	6	33				
CLASP2	23122	broad.mit.edu	37	3	33586292	33586292	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:33586292G>A	ENST00000468888.2	-	31	3265	c.3219C>T	c.(3217-3219)acC>acT	p.T1073T	CLASP2_ENST00000399362.4_Silent_p.T1072T|CLASP2_ENST00000461133.3_Silent_p.T832T|CLASP2_ENST00000359576.5_Silent_p.T1064T|CLASP2_ENST00000307312.7_Silent_p.T554T|CLASP2_ENST00000480013.1_Silent_p.T852T|CLASP2_ENST00000539981.1_Silent_p.T842T			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	853	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)	p.T1065T(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TAAACTCTGGGGTATTGAGTT	0.373																																							uc003cfu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3193-3195)ACC>ACT		CLIP-associating protein 2							74.0	72.0	73.0					3																	33586292		1841	4085	5926	SO:0001819	synonymous_variant	23122							g.chr3:33586292G>A	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3219C>T	3.37:g.33586292G>A			Somatic				CLASP2_uc003cfs.2_Silent_p.T272T|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Silent_p.T665T	p.T1065T	NM_015097	NP_055912	WXS	Illumina HiSeq	Unspecified	B2RTR1	B2RTR1_HUMAN			30	3549	-			1074					Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37	c.3195C>T		.	.	.	.	.	.	.	.	.	.	G	9.291	1.050697	0.19827	.	.	ENSG00000163539	ENST00000480385	.	.	.	5.62	0.0848	0.14439	.	.	.	.	.	T	0.51652	0.1687	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41858	-0.9485	4	.	.	.	-14.5065	6.323	0.21229	0.3583:0.0:0.5169:0.1248	.	.	.	.	S	129	.	.	P	-	1	0	CLASP2	33561296	0.887000	0.30362	1.000000	0.80357	0.999000	0.98932	0.035000	0.13797	0.306000	0.22856	0.650000	0.86243	CCC		0.373	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044		6	21	0	0	0	0.00308	0	6	21				
ATRIP	84126	broad.mit.edu	37	3	48501913	48501913	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:48501913G>A	ENST00000320211.3	+	8	1573	c.1460G>A	c.(1459-1461)tGc>tAc	p.C487Y	ATRIP_ENST00000346691.4_Missense_Mutation_p.C487Y|ATRIP_ENST00000412052.1_Missense_Mutation_p.C394Y|ATRIP_ENST00000357105.6_Missense_Mutation_p.C360Y	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	487					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.C487Y(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CACCTGGTGTGCCACAGCGGA	0.562								Other conserved DNA damage response genes																															uc003ctf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1459-1461)TGC>TAC	Other_conserved_DNA_damage_response_genes	ATR interacting protein isoform 1							104.0	101.0	102.0					3																	48501913		2203	4300	6503	SO:0001583	missense	84126				DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity	g.chr3:48501913G>A	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1460G>A	3.37:g.48501913G>A	ENSP00000323099:p.Cys487Tyr		Somatic				ATRIP_uc011bbj.1_Missense_Mutation_p.C360Y|ATRIP_uc003ctg.1_Missense_Mutation_p.C487Y|TREX1_uc010hjy.2_Intron	p.C487Y	NM_130384	NP_569055	WXS	Illumina HiSeq	Unspecified	Q8WXE1	ATRIP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	8	1492	+			487					A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	c.1460G>A	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458127	0.63401	.	.	ENSG00000164053	ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	T;T;T;T	0.47177	1.42;1.41;0.85;1.42	5.95	5.95	0.96441	.	0.195197	0.56097	D	0.000036	T	0.64583	0.2611	M	0.64997	1.995	0.47341	D	0.99939	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.62666	-0.6806	9	.	.	.	-10.6524	12.7851	0.57500	0.0:0.0:0.8365:0.1635	.	487;487	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	Y	487;487;360;394	ENSP00000323099:C487Y;ENSP00000302338:C487Y;ENSP00000349620:C360Y;ENSP00000400930:C394Y	.	C	+	2	0	ATRIP	48476917	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.996000	0.49449	2.824000	0.97209	0.655000	0.94253	TGC		0.562	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384		31	113	0	0	0	0.013726	0	31	113				
CELSR3	1951	broad.mit.edu	37	3	48685348	48685348	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:48685348C>T	ENST00000164024.4	-	20	7335	c.7055G>A	c.(7054-7056)cGa>cAa	p.R2352Q	CELSR3_ENST00000544264.1_Missense_Mutation_p.R2357Q	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2352					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R2352Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ATCCTGGCCTCGAAAGAGGTT	0.632																																							uc003cul.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(7054-7056)CGA>CAA		cadherin EGF LAG seven-pass G-type receptor 3							110.0	119.0	116.0					3																	48685348		2203	4300	6503	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48685348C>T	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.7055G>A	3.37:g.48685348C>T	ENSP00000164024:p.Arg2352Gln		Somatic				CELSR3_uc003cuf.1_Missense_Mutation_p.R2422Q|CELSR3_uc010hkg.2_Missense_Mutation_p.R335Q	p.R2352Q	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	20	7336	-			2352			Extracellular (Potential).		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.7055G>A	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061858	0.93846	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.71461	-0.57;-0.55	4.74	4.74	0.60224	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.80243	0.4587	M	0.64567	1.98	0.58432	D	0.999998	D;D	0.89917	0.986;1.0	P;P	0.62560	0.697;0.904	T	0.77925	-0.2405	9	0.28530	T	0.3	.	18.0916	0.89477	0.0:1.0:0.0:0.0	.	2352;2422	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	Q	2352;2357	ENSP00000164024:R2352Q;ENSP00000445694:R2357Q	ENSP00000164024:R2352Q	R	-	2	0	CELSR3	48660352	1.000000	0.71417	0.992000	0.48379	0.887000	0.51463	4.882000	0.63121	2.352000	0.79861	0.462000	0.41574	CGA		0.632	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		5	298	0	0	0	0.001984	0	5	298				
TLR9	54106	broad.mit.edu	37	3	52257313	52257313	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:52257313T>G	ENST00000360658.2	-	2	1652	c.1019A>C	c.(1018-1020)aAc>aCc	p.N340T	TLR9_ENST00000597542.1_Missense_Mutation_p.N364T|TLR9_ENST00000494383.1_Nonstop_Mutation_p.*493Y	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	340					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.N340T(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GAAGGACAGGTTAAGCTTGCG	0.557																																							uc003dda.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|skin(2)	4						c.(1018-1020)AAC>ACC		toll-like receptor 9 isoform A precursor	Chloroquine(DB00608)						121.0	124.0	123.0					3																	52257313		2203	4300	6503	SO:0001583	missense	54106				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity	g.chr3:52257313T>G	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1019A>C	3.37:g.52257313T>G	ENSP00000353874:p.Asn340Thr		Somatic				TLR9_uc003ddb.2_Missense_Mutation_p.N437T	p.N340T	NM_017442	NP_059138	WXS	Illumina HiSeq	Unspecified	Q9NR96	TLR9_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	1653	-			340			LRR 11.|Extracellular (Potential).		B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	c.1019A>C	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.52|18.52	3.642581|3.642581	0.67244|0.67244	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.60424|.	0.19|.	5.38|5.38	4.15|4.15	0.48705|0.48705	.|.	0.000000|.	0.43260|.	D|.	0.000598|.	T|.	0.58380|.	0.2118|.	L|L	0.50993|0.50993	1.605|1.605	0.36498|0.36498	D|D	0.868842|0.868842	D;P|.	0.58268|.	0.982;0.916|.	P;P|.	0.56278|.	0.795;0.672|.	T|.	0.63301|.	-0.6668|.	10|.	0.72032|.	D|.	0.01|.	.|.	9.4038|9.4038	0.38449|0.38449	0.1596:0.0:0.0:0.8404|0.1596:0.0:0.0:0.8404	.|.	437;340|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	T|Y	340|493	ENSP00000353874:N340T|.	ENSP00000353874:N340T|.	N|X	-|-	2|3	0|2	TLR9|RP11-330H6.5	52232353|52232353	0.869000|0.869000	0.29996|0.29996	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	1.852000|1.852000	0.39348|0.39348	2.038000|2.038000	0.60285|0.60285	0.533000|0.533000	0.62120|0.62120	AAC|TAA		0.557	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1			24	104	0	0	0	0.00632	0	24	104				
PROS1	5627	broad.mit.edu	37	3	93624636	93624636	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:93624636T>A	ENST00000394236.3	-	6	909	c.593A>T	c.(592-594)gAt>gTt	p.D198V	PROS1_ENST00000407433.1_Missense_Mutation_p.D67V	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	198	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.D198V(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ACCTTTACAATCTTTCTTATT	0.303																																							uc003drb.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(592-594)GAT>GTT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						62.0	62.0	62.0					3																	93624636		2203	4296	6499	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93624636T>A		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.593A>T	3.37:g.93624636T>A	ENSP00000377783:p.Asp198Val		Somatic				PROS1_uc010hoo.2_Missense_Mutation_p.D67V|PROS1_uc003dqz.3_Missense_Mutation_p.D67V	p.D198V	NM_000313	NP_000304	WXS	Illumina HiSeq	Unspecified	P07225	PROS_HUMAN			6	934	-			198			EGF-like 2; calcium-binding (Potential).		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.593A>T	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	T	9.715	1.158134	0.21454	.	.	ENSG00000184500	ENST00000394236;ENST00000407433;ENST00000348974	D;D;D	0.96365	-3.99;-3.99;-3.99	4.44	3.3	0.37823	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.526359	0.20817	N	0.085131	D	0.90239	0.6948	N	0.20845	0.615	0.58432	D	0.999993	P	0.44877	0.845	B	0.39379	0.298	D	0.87188	0.2232	10	0.59425	D	0.04	.	5.8597	0.18740	0.0:0.0857:0.168:0.7464	.	198	P07225	PROS_HUMAN	V	198;67;230	ENSP00000377783:D198V;ENSP00000385794:D67V;ENSP00000330021:D230V	ENSP00000330021:D230V	D	-	2	0	PROS1	95107326	0.995000	0.38212	0.999000	0.59377	0.498000	0.33706	1.304000	0.33482	0.771000	0.33359	0.397000	0.26171	GAT		0.303	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		22	59	0	0	0	0.010504	0	22	59				
EPHA6	285220	broad.mit.edu	37	3	96706352	96706352	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:96706352G>T	ENST00000389672.5	+	3	667	c.629G>T	c.(628-630)tGg>tTg	p.W210L	EPHA6_ENST00000470610.2_Missense_Mutation_p.W210L|EPHA6_ENST00000542517.1_Missense_Mutation_p.W116L	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	116	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.W116L(2)|p.W210L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AGCATCCCATGGGTCTTGGGG	0.398																																							uc010how.1		NA																	3	Substitution - Missense(3)		lung(3)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(628-630)TGG>TTG		EPH receptor A6 isoform a							96.0	97.0	97.0					3																	96706352		1853	4093	5946	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96706352G>T	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.629G>T	3.37:g.96706352G>T	ENSP00000374323:p.Trp210Leu		Somatic				EPHA6_uc003drp.1_Missense_Mutation_p.W210L	p.W210L	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			3	672	+			115			Ephrin-binding.|Extracellular (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	c.629G>T	CCDS46876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.10|15.10	2.733407|2.733407	0.48939|0.48939	.|.	.|.	ENSG00000080224|ENSG00000080224	ENST00000506569|ENST00000470610;ENST00000389672;ENST00000542517	.|T;T;T	.|0.08896	.|3.04;3.04;3.04	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.669254	.|0.13371	.|U	.|0.392959	T|T	0.22166|0.22166	0.0534|0.0534	L|L	0.31294|0.31294	0.92|0.92	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.02371|0.02371	-1.1169|-1.1169	5|10	.|0.40728	.|T	.|0.16	.|.	19.9351|19.9351	0.97137|0.97137	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|210;210	.|B3KS12;E7EU71	.|.;.	I|L	154|210;210;116	.|ENSP00000420598:W210L;ENSP00000374323:W210L;ENSP00000439758:W116L	.|ENSP00000374323:W210L	M|W	+|+	3|2	0|0	EPHA6|EPHA6	98189042|98189042	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.869000|9.869000	0.99810|0.99810	2.703000|2.703000	0.92315|0.92315	0.655000|0.655000	0.94253|0.94253	ATG|TGG		0.398	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		22	86	1	0	1.50039e-11	0.012319	2.02736e-11	22	86				
SENP7	57337	broad.mit.edu	37	3	101047372	101047372	+	Silent	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:101047372T>A	ENST00000394095.2	-	22	2867	c.2814A>T	c.(2812-2814)ctA>ctT	p.L938L	SENP7_ENST00000394085.3_Silent_p.L126L|SENP7_ENST00000348610.3_Silent_p.L905L|SENP7_ENST00000394091.1_Silent_p.L774L|SENP7_ENST00000358203.3_Silent_p.L774L|SENP7_ENST00000394094.2_Silent_p.L873L|SENP7_ENST00000314261.7_Silent_p.L872L	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	938	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.L872L(1)|p.L938L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TCAAGGAGTCTAGTATAAGAA	0.308																																							uc003dut.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(2)	5						c.(2812-2814)CTA>CTT		sentrin/SUMO-specific protease 7 isoform 1							96.0	110.0	105.0					3																	101047372		2203	4288	6491	SO:0001819	synonymous_variant	57337				proteolysis	nucleus	cysteine-type peptidase activity	g.chr3:101047372T>A		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2814A>T	3.37:g.101047372T>A			Somatic				SENP7_uc003duu.2_Silent_p.L873L|SENP7_uc003duv.2_Silent_p.L905L|SENP7_uc003duw.2_Silent_p.L872L|SENP7_uc003dux.2_Silent_p.L774L|SENP7_uc003dus.2_Silent_p.L126L	p.L938L	NM_020654	NP_065705	WXS	Illumina HiSeq	Unspecified	Q9BQF6	SENP7_HUMAN			22	2925	-			938			Protease.		A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Silent	SNP	ENST00000394095.2	37	c.2814A>T	CCDS2941.2																																																																																				0.308	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654		13	74	0	0	0	0.00245	0	13	74				
CASR	846	broad.mit.edu	37	3	122002643	122002643	+	Silent	SNP	C	C	T	rs199513106		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:122002643C>T	ENST00000490131.1	+	7	2214	c.1842C>T	c.(1840-1842)atC>atT	p.I614I	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Silent_p.I624I|CASR_ENST00000296154.5_Silent_p.I614I	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	614					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.I614I(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCTTTGGGATCGCACTCACCC	0.537																																							uc003eev.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7						c.(1840-1842)ATC>ATT		calcium-sensing receptor precursor	Cinacalcet(DB01012)						169.0	132.0	145.0					3																	122002643		2203	4300	6503	SO:0001819	synonymous_variant	846				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity	g.chr3:122002643C>T	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1842C>T	3.37:g.122002643C>T			Somatic				CASR_uc003eew.3_Silent_p.I624I	p.I614I	NM_000388	NP_000379	WXS	Illumina HiSeq	Unspecified	P41180	CASR_HUMAN		GBM - Glioblastoma multiforme(114;0.226)	7	2214	+			614			Helical; Name=1; (Potential).		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	37	c.1842C>T	CCDS3010.1																																																																																				0.537	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388		24	90	0	0	0	0.014323	0	24	90				
PCOLCE2	26577	broad.mit.edu	37	3	142548567	142548567	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:142548567G>A	ENST00000295992.3	-	6	1138	c.832C>T	c.(832-834)Cag>Tag	p.Q278*	PCOLCE2_ENST00000485766.1_Intron	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	278					positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.Q278*(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						GTGACAGGCTGTTCTGTAGTT	0.368																																							uc003evd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(832-834)CAG>TAG		procollagen C-endopeptidase enhancer 2							164.0	153.0	157.0					3																	142548567		2203	4300	6503	SO:0001587	stop_gained	26577					extracellular region	collagen binding|heparin binding|peptidase activator activity	g.chr3:142548567G>A	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.832C>T	3.37:g.142548567G>A	ENSP00000295992:p.Gln278*		Somatic					p.Q278*	NM_013363	NP_037495	WXS	Illumina HiSeq	Unspecified	Q9UKZ9	PCOC2_HUMAN			6	1028	-			278					B2RCH9|D3DNG4|Q9BRH3	Nonsense_Mutation	SNP	ENST00000295992.3	37	c.832C>T	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960580	0.92791	.	.	ENSG00000163710	ENST00000295992	.	.	.	5.14	-1.88	0.07713	.	0.800018	0.11730	N	0.535052	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	7.412	2.4888	0.04605	0.2074:0.3565:0.3142:0.1219	.	.	.	.	X	278	.	ENSP00000295992:Q278X	Q	-	1	0	PCOLCE2	144031257	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.741000	0.26202	-0.352000	0.08237	-0.499000	0.04595	CAG		0.368	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		33	167	0	0	0	0.012213	0	33	167				
MED12L	116931	broad.mit.edu	37	3	151127077	151127077	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:151127077C>A	ENST00000474524.1	+	38	5800	c.5762C>A	c.(5761-5763)cCc>cAc	p.P1921H	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1921	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P1921H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAAGCACGGCCCTCCCCTCAG	0.527																																							uc003eyp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(5761-5763)CCC>CAC		mediator of RNA polymerase II transcription,							74.0	75.0	75.0					3																	151127077		2203	4300	6503	SO:0001583	missense	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:151127077C>A	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5762C>A	3.37:g.151127077C>A	ENSP00000417235:p.Pro1921His		Somatic				MED12L_uc011bnz.1_Intron	p.P1921H	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		38	5800	+			1921			Gln-rich.		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	c.5762C>A	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.207824	0.79240	.	.	ENSG00000144893	ENST00000474524	T	0.58210	0.35	5.75	4.85	0.62838	Mediator complex, subunit Med12, catenin-binding (1);	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	M	0.66939	2.045	0.80722	D	1	B	0.18610	0.029	B	0.21708	0.036	T	0.51934	-0.8642	10	0.48119	T	0.1	-13.1798	13.312	0.60386	0.1571:0.8429:0.0:0.0	.	1921	Q86YW9	MD12L_HUMAN	H	1921	ENSP00000417235:P1921H	ENSP00000417235:P1921H	P	+	2	0	MED12L	152609767	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	4.480000	0.60243	2.708000	0.92522	0.650000	0.86243	CCC		0.527	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		23	131	1	0	1.64293e-13	0.00333	2.27546e-13	23	131				
MCF2L2	23101	broad.mit.edu	37	3	182897375	182897375	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:182897375C>T	ENST00000328913.3	-	29	3508	c.3211G>A	c.(3211-3213)Gag>Aag	p.E1071K	MCF2L2_ENST00000473233.1_Missense_Mutation_p.E1071K|MCF2L2_ENST00000468976.1_5'Flank	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	1071							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E1071K(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GTTTCCTCCTCATCGCGTTCT	0.562																																							uc003fli.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)	5						c.(3211-3213)GAG>AAG		Rho family guanine-nucleotide exchange factor							115.0	130.0	125.0					3																	182897375		2203	4300	6503	SO:0001583	missense	23101				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr3:182897375C>T	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.3211G>A	3.37:g.182897375C>T	ENSP00000328118:p.Glu1071Lys		Somatic					p.E1071K	NM_015078	NP_055893	WXS	Illumina HiSeq	Unspecified	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		29	3301	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		1071					O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	c.3211G>A	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	C	7.773	0.707905	0.15239	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.02158	4.42;4.6	3.02	1.13	0.20643	.	1.369320	0.05116	N	0.489816	T	0.01730	0.0055	N	0.12182	0.205	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.47446	-0.9117	10	0.48119	T	0.1	.	4.0295	0.09703	0.0:0.5634:0.2859:0.1506	.	1071	Q86YR7	MF2L2_HUMAN	K	1071	ENSP00000328118:E1071K;ENSP00000420070:E1071K	ENSP00000328118:E1071K	E	-	1	0	MCF2L2	184380069	0.000000	0.05858	0.000000	0.03702	0.285000	0.27093	0.017000	0.13399	0.026000	0.15269	0.511000	0.50034	GAG		0.562	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078		12	76	0	0	0	0.001855	0	12	76				
LMLN	89782	broad.mit.edu	37	3	197707307	197707307	+	Silent	SNP	C	C	T	rs566428236		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr3:197707307C>T	ENST00000330198.4	+	6	682	c.660C>T	c.(658-660)acC>acT	p.T220T	LMLN_ENST00000482695.1_Silent_p.T168T|LMLN_ENST00000332636.5_Silent_p.T168T|LMLN_ENST00000420910.2_Silent_p.T220T	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	220					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.T220T(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CTCTGGCCACCGAGAGATGCA	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18088	0.0		0.0	False		,,,				2504	0.0						uc011buo.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(658-660)ACC>ACT		leishmanolysin-like isoform 2							156.0	146.0	149.0					3																	197707307		2203	4300	6503	SO:0001819	synonymous_variant	89782				cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding	g.chr3:197707307C>T	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.660C>T	3.37:g.197707307C>T			Somatic				LMLN_uc003fyt.2_Silent_p.T168T|LMLN_uc010iar.2_Silent_p.T220T|LMLN_uc010ias.2_Silent_p.T168T|LMLN_uc003fyu.2_5'UTR	p.T220T	NM_033029	NP_149018	WXS	Illumina HiSeq	Unspecified	Q96KR4	LMLN_HUMAN	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)	6	682	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	220					B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Silent	SNP	ENST00000330198.4	37	c.660C>T	CCDS3332.1																																																																																				0.502	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029		32	147	0	0	0	0.011902	0	32	147				
TECRL	253017	broad.mit.edu	37	4	65274940	65274940	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr4:65274940C>A	ENST00000381210.3	-	1	240	c.130G>T	c.(130-132)Ggc>Tgc	p.G44C	TECRL_ENST00000507440.1_Missense_Mutation_p.G44C	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	44					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.G44C(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						CTTAGAGGGCCCGCTGAGAGT	0.393																																							uc003hcv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)GGC>TGC		steroid 5 alpha-reductase 2-like 2							83.0	83.0	83.0					4																	65274940		2203	4300	6503	SO:0001583	missense	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65274940C>A	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.130G>T	4.37:g.65274940C>A	ENSP00000370607:p.Gly44Cys		Somatic				TECRL_uc003hcw.2_Missense_Mutation_p.G44C	p.G44C	NM_001010874	NP_001010874	WXS	Illumina HiSeq	Unspecified	Q5HYJ1	TECRL_HUMAN			1	239	-			44						Missense_Mutation	SNP	ENST00000381210.3	37	c.130G>T	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	6.579	0.475111	0.12521	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.43688	0.94;0.94;0.94	4.99	3.19	0.36642	.	0.322217	0.30285	N	0.009977	T	0.43255	0.1239	M	0.73598	2.24	0.32388	N	0.553643	B;B	0.20052	0.041;0.008	B;B	0.23150	0.044;0.011	T	0.51687	-0.8674	10	0.45353	T	0.12	-1.9207	11.3485	0.49575	0.3306:0.6694:0.0:0.0	.	44;44	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	C	44	ENSP00000426043:G44C;ENSP00000370607:G44C;ENSP00000422497:G44C	ENSP00000370607:G44C	G	-	1	0	TECRL	64957535	0.971000	0.33674	0.903000	0.35520	0.007000	0.05969	1.228000	0.32588	0.568000	0.29311	-0.182000	0.12963	GGC		0.393	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		18	31	1	0	8.34094e-07	0.008871	9.87367e-07	18	31				
ADH7	131	broad.mit.edu	37	4	100340244	100340244	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr4:100340244C>A	ENST00000209665.4	-	7	1136	c.896G>T	c.(895-897)gGg>gTg	p.G299V	ADH7_ENST00000482593.1_Missense_Mutation_p.G230V|ADH7_ENST00000476959.1_Missense_Mutation_p.G307V|ADH7_ENST00000437033.2_Missense_Mutation_p.G287V	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	299					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)	p.G299V(1)|p.G307V(1)		breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		CACGCTGGTCCCATAGTTCAT	0.493																																							uc003huv.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(1)	3						c.(895-897)GGG>GTG		class IV alcohol dehydrogenase, mu or sigma	NADH(DB00157)						111.0	86.0	95.0					4																	100340244		2203	4300	6503	SO:0001583	missense	131				ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity	g.chr4:100340244C>A	X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.896G>T	4.37:g.100340244C>A	ENSP00000209665:p.Gly299Val		Somatic					p.G299V	NM_000673	NP_000664	WXS	Illumina HiSeq	Unspecified	P40394	ADH7_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	7	995	-			299					A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	ENST00000209665.4	37	c.896G>T	CCDS34034.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864318	0.71949	.	.	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000482593;ENST00000476959	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.53	3.68	0.42216	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.158262	0.56097	D	0.000031	D	0.88183	0.6368	H	0.98333	4.205	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.91966	0.5583	10	0.87932	D	0	-32.0048	13.5975	0.61998	0.1567:0.8433:0.0:0.0	.	299	P40394	ADH7_HUMAN	V	287;299;230;307	ENSP00000414254:G287V;ENSP00000209665:G299V;ENSP00000420613:G230V;ENSP00000420269:G307V	ENSP00000209665:G299V	G	-	2	0	ADH7	100559267	0.999000	0.42202	0.018000	0.16275	0.712000	0.41017	4.879000	0.63100	1.101000	0.41535	0.655000	0.94253	GGG		0.493	ADH7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_000673		22	23	1	0	6.44725e-10	0.014323	8.19215e-10	22	23				
SH3RF1	57630	broad.mit.edu	37	4	170017740	170017740	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr4:170017740C>G	ENST00000284637.9	-	12	2938	c.2597G>C	c.(2596-2598)tGg>tCg	p.W866S		NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	866	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.W866S(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		GCCTTTGAACCAGCCATCCTC	0.428																																							uc003isa.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(2596-2598)TGG>TCG		SH3 domain containing ring finger 1							187.0	171.0	177.0					4																	170017740		2203	4300	6503	SO:0001583	missense	57630					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding	g.chr4:170017740C>G	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2597G>C	4.37:g.170017740C>G	ENSP00000284637:p.Trp866Ser		Somatic					p.W866S	NM_020870	NP_065921	WXS	Illumina HiSeq	Unspecified	Q7Z6J0	SH3R1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)	12	2932	-		Prostate(90;0.00267)|Renal(120;0.0183)	866			SH3 4.		Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	ENST00000284637.9	37	c.2597G>C	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221512	0.79464	.	.	ENSG00000154447	ENST00000284637	T	0.75589	-0.95	5.6	5.6	0.85130	Src homology-3 domain (4);	0.127549	0.64402	D	0.000009	D	0.91529	0.7325	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93939	0.7221	10	0.87932	D	0	-13.6385	19.6253	0.95676	0.0:1.0:0.0:0.0	.	866	Q7Z6J0	SH3R1_HUMAN	S	866	ENSP00000284637:W866S	ENSP00000284637:W866S	W	-	2	0	SH3RF1	170254315	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	7.412000	0.80091	2.622000	0.88805	0.557000	0.71058	TGG		0.428	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870		11	140	0	0	0	0.010729	0	11	140				
VEGFC	7424	broad.mit.edu	37	4	177608435	177608435	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr4:177608435G>A	ENST00000280193.2	-	6	1466	c.1051C>T	c.(1051-1053)Caa>Taa	p.Q351*	VEGFC_ENST00000507638.1_5'Flank|RP11-313E19.2_ENST00000504017.1_RNA|RP11-313E19.2_ENST00000509194.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	351	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)	p.Q351*(1)		biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TTTAGGGGTTGATTTCTGGGG	0.428																																							uc003ius.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(5)	5						c.(1051-1053)CAA>TAA		vascular endothelial growth factor C							259.0	231.0	240.0					4																	177608435		1844	4097	5941	SO:0001587	stop_gained	7424				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity	g.chr4:177608435G>A	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.1051C>T	4.37:g.177608435G>A	ENSP00000280193:p.Gln351*		Somatic					p.Q351*	NM_005429	NP_005420	WXS	Illumina HiSeq	Unspecified	P49767	VEGFC_HUMAN		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)	6	1481	-		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)	351			4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.|4.		B2R9Q8	Nonsense_Mutation	SNP	ENST00000280193.2	37	c.1051C>T	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	G	40	8.311022	0.98754	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.61	4.73	0.59995	.	0.388439	0.26832	N	0.022280	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-6.4393	15.8911	0.79299	0.0:0.0:0.8641:0.1359	.	.	.	.	X	351	.	ENSP00000280193:Q351X	Q	-	1	0	VEGFC	177845429	1.000000	0.71417	0.912000	0.35992	0.857000	0.48899	7.382000	0.79729	2.629000	0.89072	0.650000	0.86243	CAA		0.428	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429		166	258	0	0	0	0.01441	0	166	258				
OTULIN	90268	broad.mit.edu	37	5	14693081	14693081	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:14693081C>T	ENST00000284274.4	+	7	1061	c.983C>T	c.(982-984)cCa>cTa	p.P328L		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		328	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.P328L(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					AAGGACTGGCCAGTGGTAACG	0.562																																							uc003jfk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(982-984)CCA>CTA		hypothetical protein LOC90268							81.0	85.0	83.0					5																	14693081		2114	4234	6348	SO:0001583	missense	90268							g.chr5:14693081C>T																												ENST00000284274.4:c.983C>T	5.37:g.14693081C>T	ENSP00000284274:p.Pro328Leu		Somatic					p.P328L	NM_138348	NP_612357	WXS	Illumina HiSeq	Unspecified	Q96BN8	F105B_HUMAN			7	1135	+	Lung NSC(4;0.00696)		328					D3DTD3|Q8NAS0|Q96IA3	Missense_Mutation	SNP	ENST00000284274.4	37	c.983C>T	CCDS43302.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504896	0.85176	.	.	ENSG00000154124	ENST00000284274	T	0.15372	2.43	5.87	5.0	0.66597	.	0.161154	0.56097	D	0.000030	T	0.37073	0.0990	M	0.74881	2.28	0.80722	D	1	D	0.61080	0.989	P	0.55455	0.776	T	0.33979	-0.9847	10	0.87932	D	0	-18.6409	16.178	0.81874	0.0:0.8667:0.1333:0.0	.	328	Q96BN8	F105B_HUMAN	L	328	ENSP00000284274:P328L	ENSP00000284274:P328L	P	+	2	0	FAM105B	14746081	1.000000	0.71417	0.928000	0.36995	0.948000	0.59901	4.547000	0.60712	1.472000	0.48140	0.655000	0.94253	CCA		0.562	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366012.1			22	55	0	0	0	0.014323	0	22	55				
HTR1A	3350	broad.mit.edu	37	5	63256504	63256504	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:63256504C>T	ENST00000323865.3	-	1	1276	c.1043G>A	c.(1042-1044)gGc>gAc	p.G348D	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	348					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.G348D(1)		cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CATGATGATGCCCAGCGTCTT	0.602																																							uc011cqt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)	4						c.(1042-1044)GGC>GAC		5-hydroxytryptamine (serotonin) receptor 1A	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						124.0	127.0	126.0					5																	63256504		2203	4300	6503	SO:0001583	missense	3350				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity	g.chr5:63256504C>T	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.1043G>A	5.37:g.63256504C>T	ENSP00000316244:p.Gly348Asp		Somatic					p.G348D	NM_000524	NP_000515	WXS	Illumina HiSeq	Unspecified	P08908	5HT1A_HUMAN		Lung(70;0.105)	1	1043	-		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)	348			Helical; Name=6; (By similarity).		Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	c.1043G>A	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546246	0.86022	.	.	ENSG00000178394	ENST00000323865	T	0.37915	1.17	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76786	0.4036	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85951	0.1464	10	0.87932	D	0	.	18.8287	0.92128	0.0:1.0:0.0:0.0	.	348	P08908	5HT1A_HUMAN	D	348	ENSP00000316244:G348D	ENSP00000316244:G348D	G	-	2	0	HTR1A	63292260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.692000	0.91855	0.655000	0.94253	GGC		0.602	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524		32	169	0	0	0	0.00623	0	32	169				
CWC27	10283	broad.mit.edu	37	5	64081315	64081315	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:64081315G>T	ENST00000381070.3	+	5	621	c.404G>T	c.(403-405)gGg>gTg	p.G135V	CWC27_ENST00000508024.1_Missense_Mutation_p.G135V	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	135	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.G135V(1)|p.?(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						TAGGTTACAGGGGATACAGTA	0.308																																							uc003jtn.1		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(1)|prostate(1)		0						c.(403-405)GGG>GTG		serologically defined colon cancer antigen 10							110.0	114.0	113.0					5																	64081315		2203	4300	6503	SO:0001583	missense	10283				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity	g.chr5:64081315G>T	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.404G>T	5.37:g.64081315G>T	ENSP00000370460:p.Gly135Val		Somatic				CWC27_uc003jtl.2_Missense_Mutation_p.G135V|CWC27_uc003jtm.2_Missense_Mutation_p.G135V|CWC27_uc010iwt.1_Missense_Mutation_p.G135V	p.G135V	NM_005869	NP_005860	WXS	Illumina HiSeq	Unspecified	Q6UX04	CWC27_HUMAN			5	623	+			135			PPIase cyclophilin-type.		O60529|O60530|Q96EM3	Missense_Mutation	SNP	ENST00000381070.3	37	c.404G>T	CCDS3982.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548986	0.86127	.	.	ENSG00000153015	ENST00000381070;ENST00000508024;ENST00000538793	T;T	0.39229	1.09;1.09	5.07	5.07	0.68467	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.81083	0.4749	H	0.99545	4.62	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89659	0.3875	10	0.87932	D	0	.	18.6436	0.91404	0.0:0.0:1.0:0.0	.	135;135;135;135	Q6UX04-2;Q6UX04;F5H636;D6REK3	.;CWC27_HUMAN;.;.	V	135	ENSP00000370460:G135V;ENSP00000426802:G135V	ENSP00000370460:G135V	G	+	2	0	CWC27	64117071	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.686000	0.91250	2.636000	0.89361	0.467000	0.42956	GGG		0.308	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869		10	72	1	0	1.56452e-12	0.007413	2.13484e-12	10	72				
F2R	2149	broad.mit.edu	37	5	76028404	76028404	+	Silent	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:76028404A>T	ENST00000319211.4	+	2	619	c.354A>T	c.(352-354)ccA>ccT	p.P118P		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	118					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.P118P(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCAGCCTCCCACTAAACATCA	0.517																																							uc003ken.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(352-354)CCA>CCT		coagulation factor II receptor precursor	Streptokinase(DB00086)						122.0	122.0	122.0					5																	76028404		2203	4300	6503	SO:0001819	synonymous_variant	2149				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity	g.chr5:76028404A>T	M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.354A>T	5.37:g.76028404A>T			Somatic					p.P118P	NM_001992	NP_001983	WXS	Illumina HiSeq	Unspecified	P25116	PAR1_HUMAN		all cancers(79;4.43e-43)	2	619	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)	118			Helical; Name=1; (Potential).		Q53XV0|Q96RF7|Q9BUN4	Silent	SNP	ENST00000319211.4	37	c.354A>T	CCDS4032.1																																																																																				0.517	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2			53	212	0	0	0	0.01441	0	53	212				
PPIP5K2	23262	broad.mit.edu	37	5	102522089	102522089	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:102522089G>T	ENST00000358359.3	+	27	3747	c.3238G>T	c.(3238-3240)Gat>Tat	p.D1080Y	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.D1080Y|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.D1080Y|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	1080					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.D1080Y(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAACCTACAGGATTATGCTCG	0.493																																							uc003kod.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3238-3240)GAT>TAT		Histidine acid phosphatase domain containing 1							153.0	131.0	139.0					5																	102522089		2203	4300	6503	SO:0001583	missense	23262				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr5:102522089G>T	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.3238G>T	5.37:g.102522089G>T	ENSP00000351126:p.Asp1080Tyr		Somatic				PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.D1080Y|PPIP5K2_uc003kof.2_Intron	p.D1080Y	NM_015216	NP_056031	WXS	Illumina HiSeq	Unspecified	O43314	VIP2_HUMAN			27	3757	+			1080					A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37	c.3238G>T		.	.	.	.	.	.	.	.	.	.	G	23.4	4.407788	0.83340	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.17528	2.27;2.27;2.27	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	T	0.44932	0.1317	M	0.75615	2.305	0.80722	D	1	D;D	0.69078	0.997;0.995	D;P	0.68192	0.956;0.905	T	0.26573	-1.0099	10	0.59425	D	0.04	-22.5168	20.0795	0.97766	0.0:0.0:1.0:0.0	.	1080;1080	O43314-2;O43314	.;VIP2_HUMAN	Y	1080;1080;1095;1080	ENSP00000313070:D1080Y;ENSP00000351126:D1080Y;ENSP00000416016:D1080Y	ENSP00000313070:D1080Y	D	+	1	0	PPIP5K2	102549988	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.747000	0.94245	0.650000	0.86243	GAT		0.493	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216		20	51	1	0	3.62473e-10	0.012319	4.64838e-10	20	51				
FNIP1	96459	broad.mit.edu	37	5	131008460	131008460	+	Silent	SNP	A	A	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:131008460A>G	ENST00000510461.1	-	14	1772	c.1677T>C	c.(1675-1677)gaT>gaC	p.D559D	FNIP1_ENST00000307968.7_Silent_p.D531D|FNIP1_ENST00000307954.8_Silent_p.D514D|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	559					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.D559D(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CGATGGCTTCATCTTCTCCAT	0.363																																							uc003kvs.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(1675-1677)GAT>GAC		folliculin interacting protein 1 isoform 1							132.0	122.0	126.0					5																	131008460		2203	4300	6503	SO:0001819	synonymous_variant	96459				regulation of protein phosphorylation	cytoplasm	protein binding	g.chr5:131008460A>G	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1677T>C	5.37:g.131008460A>G			Somatic				RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Silent_p.D531D|FNIP1_uc010jdm.1_Silent_p.D514D	p.D559D	NM_133372	NP_588613	WXS	Illumina HiSeq	Unspecified	Q8TF40	FNIP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)	14	1819	-		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	559					D6RJH5|Q86T47|Q9BUT0	Silent	SNP	ENST00000510461.1	37	c.1677T>C	CCDS34227.1																																																																																				0.363	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		11	136	0	0	0	0.00245	0	11	136				
SLC22A4	6583	broad.mit.edu	37	5	131663013	131663013	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:131663013T>C	ENST00000200652.3	+	5	1042	c.868T>C	c.(868-870)Ttt>Ctt	p.F290L	AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	290					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)	p.F290L(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	CCAGAGAAGATTTAGAGAGGC	0.363																																							uc003kwq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(868-870)TTT>CTT		solute carrier family 22 member 4	L-Carnitine(DB00583)						64.0	62.0	62.0					5																	131663013		2203	4300	6503	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131663013T>C	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.868T>C	5.37:g.131663013T>C	ENSP00000200652:p.Phe290Leu		Somatic				SLC22A4_uc010jdq.1_RNA|uc003kwr.3_Intron	p.F290L	NM_003059	NP_003050	WXS	Illumina HiSeq	Unspecified	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		5	1033	+		all_cancers(142;0.0752)|Breast(839;0.198)	290			Cytoplasmic (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.868T>C	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347214	0.24426	.	.	ENSG00000197208	ENST00000200652	T	0.71934	-0.61	5.85	3.13	0.36017	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.330286	0.35708	N	0.003033	T	0.44117	0.1278	N	0.05078	-0.115	0.33692	D	0.61346	B	0.02656	0.0	B	0.06405	0.002	T	0.45205	-0.9277	10	0.11182	T	0.66	.	10.1683	0.42893	0.1193:0.0:0.1106:0.7701	.	290	Q9H015	S22A4_HUMAN	L	290	ENSP00000200652:F290L	ENSP00000200652:F290L	F	+	1	0	SLC22A4	131690912	0.993000	0.37304	0.921000	0.36526	0.978000	0.69477	0.352000	0.20113	1.005000	0.39183	0.533000	0.62120	TTT		0.363	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		15	49	0	0	0	0.003163	0	15	49				
PCDHA3	56145	broad.mit.edu	37	5	140182645	140182645	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:140182645G>A	ENST00000522353.2	+	1	1863	c.1863G>A	c.(1861-1863)ccG>ccA	p.P621P	PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.P621P|PCDHA1_ENST00000504120.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	621	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P621P(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCATCCCGTTTCGCGTGG	0.667																																							uc003lhf.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(6)|skin(2)	8						c.(1861-1863)CCG>CCA		protocadherin alpha 3 isoform 1 precursor							76.0	76.0	76.0					5																	140182645		2203	4300	6503	SO:0001819	synonymous_variant	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140182645G>A	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1863G>A	5.37:g.140182645G>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.P621P	p.P621P	NM_018906	NP_061729	WXS	Illumina HiSeq	Unspecified	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1863	+			621			Cadherin 6.|Extracellular (Potential).		O75286	Silent	SNP	ENST00000522353.2	37	c.1863G>A	CCDS54915.1																																																																																				0.667	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		16	79	0	0	0	0.00499	0	16	79				
PCDHB4	56131	broad.mit.edu	37	5	140503215	140503215	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:140503215G>A	ENST00000194152.1	+	1	1635	c.1635G>A	c.(1633-1635)ctG>ctA	p.L545L	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	545	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L545L(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGAGGCGCTGGTGCGCGTGC	0.692																																							uc003lip.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1633-1635)CTG>CTA		protocadherin beta 4 precursor							40.0	45.0	43.0					5																	140503215		2201	4295	6496	SO:0001819	synonymous_variant	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503215G>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1635G>A	5.37:g.140503215G>A			Somatic					p.L545L	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1635	+			545			Cadherin 5.|Extracellular (Potential).		Q4V761	Silent	SNP	ENST00000194152.1	37	c.1635G>A	CCDS4246.1																																																																																				0.692	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		8	87	0	0	0	0.004482	0	8	87				
PCDHGA1	56114	broad.mit.edu	37	5	140711965	140711965	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:140711965T>A	ENST00000517417.1	+	1	1714	c.1714T>A	c.(1714-1716)Tct>Act	p.S572T	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.S572T	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	572	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S572T(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACAGATGGTTCTACCGGCGT	0.662																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(1714-1716)TCT>ACT		protocadherin gamma subfamily A, 1 isoform 1							95.0	109.0	104.0					5																	140711965		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711965T>A	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1714T>A	5.37:g.140711965T>A	ENSP00000431083:p.Ser572Thr		Somatic				PCDHGA1_uc011dan.1_Missense_Mutation_p.S572T	p.S572T	NM_018912	NP_061735	WXS	Illumina HiSeq	Unspecified	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1714	+			572			Extracellular (Potential).|Cadherin 6.		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.1714T>A	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.860029	0.32884	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.52754	0.68;0.65	4.05	4.05	0.47172	Cadherin-like (1);	0.000000	0.49305	D	0.000160	T	0.63165	0.2488	L	0.56769	1.78	0.22982	N	0.998471	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.96	T	0.56366	-0.7991	10	0.87932	D	0	.	13.1463	0.59463	0.0:0.0:0.0:1.0	.	572;572	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	T	572	ENSP00000431083:S572T;ENSP00000367345:S572T	ENSP00000367345:S572T	S	+	1	0	PCDHGA1	140692149	0.008000	0.16893	0.394000	0.26270	0.005000	0.04900	1.449000	0.35123	1.831000	0.53308	0.528000	0.53228	TCT		0.662	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		68	181	0	0	0	0.01441	0	68	181				
PCDHGB3	56102	broad.mit.edu	37	5	140778496	140778496	+	Intron	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:140778496G>T	ENST00000576222.1	+	1	2546				PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCAGCCACTGACCAAGACGA	0.478																																							uc003lkf.1		NA																	0					0						c.(802-804)GAC>TAC		protocadherin gamma subfamily B, 5 isoform 1							81.0	89.0	87.0					5																	140778496		2048	4208	6256	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140778496G>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26120G>T	5.37:g.140778496G>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.D268Y	p.D268Y	NM_018925	NP_061748	WXS	Illumina HiSeq	Unspecified	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	802	+			268			Extracellular (Potential).|Cadherin 3.		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.802G>T	CCDS58980.1																																																																																				0.478	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		40	128	1	0	3.66854e-30	0.007835	6.31172e-30	40	128				
LARP1	23367	broad.mit.edu	37	5	154181956	154181956	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:154181956C>G	ENST00000336314.4	+	11	1899	c.1875C>G	c.(1873-1875)atC>atG	p.I625M		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	702					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.I625M(1)|p.I702M(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATTCCCAGATCAAGGTGAGGC	0.502																																							uc003lvp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(2104-2106)ATC>ATG		la related protein isoform 2							33.0	36.0	35.0					5																	154181956		2190	4260	6450	SO:0001583	missense	23367						protein binding|RNA binding	g.chr5:154181956C>G	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1875C>G	5.37:g.154181956C>G	ENSP00000336721:p.Ile625Met		Somatic				LARP1_uc003lvo.2_Missense_Mutation_p.I625M|LARP1_uc010jie.1_Missense_Mutation_p.I497M	p.I702M	NM_033551	NP_291029	WXS	Illumina HiSeq	Unspecified	Q6PKG0	LARP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		11	2535	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	702					O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	c.2106C>G	CCDS4328.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.34|11.34	1.610009|1.610009	0.28712|0.28712	.|.	.|.	ENSG00000155506|ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248|ENST00000518677	T;T;T|.	0.34667|.	1.82;1.35;1.39|.	6.04|6.04	2.28|2.28	0.28536|0.28536	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.38532|.	0.1044|.	L|L	0.28192|0.28192	0.835|0.835	0.50632|0.50632	D|D	0.999887|0.999887	B;B|.	0.26002|.	0.086;0.139|.	B;B|.	0.34138|.	0.066;0.176|.	T|.	0.07501|.	-1.0769|.	10|.	0.26408|.	T|.	0.33|.	-18.237|-18.237	4.7685|4.7685	0.13144|0.13144	0.376:0.4291:0.0:0.1949|0.376:0.4291:0.0:0.1949	.|.	702;625|.	Q6PKG0;Q6PKG0-3|.	LARP1_HUMAN;.|.	M|X	625;702;497|16	ENSP00000336721:I625M;ENSP00000428589:I702M;ENSP00000429904:I497M|.	ENSP00000336721:I625M|.	I|S	+|+	3|2	3|0	LARP1|LARP1	154162149|154162149	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.898000|0.898000	0.52572|0.52572	0.638000|0.638000	0.24674|0.24674	0.138000|0.138000	0.18790|0.18790	0.561000|0.561000	0.74099|0.74099	ATC|TCA		0.502	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551		4	71	0	0	0	0.009096	0	4	71				
ZNF454	285676	broad.mit.edu	37	5	178392687	178392687	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:178392687G>T	ENST00000320129.3	+	5	1585	c.1282G>T	c.(1282-1284)Gcc>Tcc	p.A428S	ZNF454_ENST00000519564.1_Missense_Mutation_p.A428S	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A428S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		ATCAGCACTAGCCCAACATCA	0.423																																							uc003mjo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1282-1284)GCC>TCC		zinc finger protein 454							75.0	77.0	76.0					5																	178392687		2203	4300	6503	SO:0001583	missense	285676				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:178392687G>T	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1282G>T	5.37:g.178392687G>T	ENSP00000326249:p.Ala428Ser		Somatic				ZNF454_uc010jkz.1_Missense_Mutation_p.A428S	p.A428S	NM_182594	NP_872400	WXS	Illumina HiSeq	Unspecified	Q8N9F8	ZN454_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)	5	1553	+	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	428			C2H2-type 9.		Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	c.1282G>T	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	G	9.320	1.057831	0.19907	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.07444	3.19;3.19	4.25	2.45	0.29901	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.178649	0.27227	N	0.020322	T	0.04634	0.0126	N	0.17594	0.5	0.09310	N	1	B	0.26081	0.141	B	0.33254	0.16	T	0.42032	-0.9475	10	0.15499	T	0.54	-6.8509	4.0061	0.09602	0.2145:0.1992:0.5863:0.0	.	428	Q8N9F8	ZN454_HUMAN	S	428	ENSP00000326249:A428S;ENSP00000430354:A428S	ENSP00000326249:A428S	A	+	1	0	ZNF454	178325293	0.000000	0.05858	0.941000	0.38009	0.002000	0.02628	-0.086000	0.11233	1.150000	0.42419	-0.142000	0.14014	GCC		0.423	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718		16	86	1	0	2.32078e-09	0.003163	2.89575e-09	16	86				
PHACTR1	221692	broad.mit.edu	37	6	13283719	13283719	+	Silent	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:13283719C>T	ENST00000379335.3	+	3	372	c.267C>T	c.(265-267)taC>taT	p.Y89Y	PHACTR1_ENST00000457702.2_Silent_p.Y380Y|RP1-257A7.4_ENST00000399446.2_RNA|RP1-257A7.4_ENST00000606150.1_RNA|PHACTR1_ENST00000379329.1_Silent_p.Y89Y|PHACTR1_ENST00000332995.7_Silent_p.Y525Y			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	525					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)	p.Y525Y(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TCAGTGACTACGTGGAGGTGG	0.592																																							uc010jpc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1573-1575)TAC>TAT		phosphatase and actin regulator 1							117.0	132.0	127.0					6																	13283719		2075	4208	6283	SO:0001819	synonymous_variant	221692					cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity	g.chr6:13283719C>T	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379335.3:c.267C>T	6.37:g.13283719C>T			Somatic				PHACTR1_uc003nah.1_Silent_p.Y525Y|TBC1D7_uc003naj.2_Intron|TBC1D7_uc011dis.1_Intron|uc003nak.1_Intron	p.Y525Y	NM_030948	NP_112210	WXS	Illumina HiSeq	Unspecified	Q9C0D0	PHAR1_HUMAN	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)		13	1907	+	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	525					A8K1V2|Q3MJ93|Q5JSJ2	Silent	SNP	ENST00000379335.3	37	c.1575C>T		.	.	.	.	.	.	.	.	.	.	C	10.16	1.274772	0.23307	.	.	ENSG00000112137	ENST00000415087	.	.	.	5.78	-3.62	0.04543	.	.	.	.	.	T	0.49047	0.1534	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57470	-0.7806	4	.	.	.	-13.2435	13.3876	0.60805	0.0:0.385:0.0:0.615	.	.	.	.	M	360	.	.	T	+	2	0	PHACTR1	13391698	0.052000	0.20516	0.928000	0.36995	0.984000	0.73092	-0.586000	0.05787	-0.843000	0.04189	-0.794000	0.03295	ACG		0.592	PHACTR1-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000039878.1	XM_166420		27	143	0	0	0	0.008361	0	27	143				
KIF13A	63971	broad.mit.edu	37	6	17849677	17849677	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:17849677G>T	ENST00000259711.6	-	9	866	c.761C>A	c.(760-762)gCg>gAg	p.A254E	KIF13A_ENST00000378816.5_Missense_Mutation_p.A254E|KIF13A_ENST00000378826.2_Missense_Mutation_p.A254E|KIF13A_ENST00000378843.2_Missense_Mutation_p.A254E|KIF13A_ENST00000378814.5_Missense_Mutation_p.A254E	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	254	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A254E(2)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TTCGCTACCCGCCAGGTCTAC	0.458																																							uc003ncg.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|ovary(2)	4						c.(760-762)GCG>GAG		kinesin family member 13A isoform a							105.0	96.0	99.0					6																	17849677		1880	4118	5998	SO:0001583	missense	63971				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding	g.chr6:17849677G>T	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.761C>A	6.37:g.17849677G>T	ENSP00000259711:p.Ala254Glu		Somatic				KIF13A_uc003ncf.2_Missense_Mutation_p.A254E|KIF13A_uc003nch.3_Missense_Mutation_p.A254E|KIF13A_uc003nci.3_Missense_Mutation_p.A254E	p.A254E	NM_022113	NP_071396	WXS	Illumina HiSeq	Unspecified	Q9H1H9	KI13A_HUMAN	all cancers(50;0.0865)|Epithelial(50;0.0974)		9	866	-	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	254			Kinesin-motor.		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	c.761C>A	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	G	35	5.476116	0.96291	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	D;D;D;D;D	0.95656	-3.77;-3.77;-3.77;-3.77;-3.77	5.7	5.7	0.88788	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98842	0.9609	H	0.98005	4.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99470	1.0945	10	0.87932	D	0	.	19.8429	0.96697	0.0:0.0:1.0:0.0	.	254;254;254;254	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	E	254	ENSP00000368091:A254E;ENSP00000259711:A254E;ENSP00000368103:A254E;ENSP00000368120:A254E;ENSP00000368093:A254E	ENSP00000259711:A254E	A	-	2	0	KIF13A	17957656	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	9.788000	0.99064	2.685000	0.91497	0.650000	0.86243	GCG		0.458	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4			9	43	1	0	2.17888e-05	0.006214	2.47356e-05	9	43				
SLC17A2	10246	broad.mit.edu	37	6	25921560	25921560	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:25921560G>T	ENST00000265425.3	-	3	341	c.321C>A	c.(319-321)atC>atA	p.I107I	SLC17A2_ENST00000360488.3_Silent_p.I107I|SLC17A2_ENST00000377850.3_Silent_p.I107I			O00624	NPT3_HUMAN	solute carrier family 17, member 2	107					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.I107I(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						ATCCACTTGGGATCAGAGTCA	0.448																																							uc011dkb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(319-321)ATC>ATA		SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;							108.0	103.0	105.0					6																	25921560		2203	4300	6503	SO:0001819	synonymous_variant	10246				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25921560G>T	U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.321C>A	6.37:g.25921560G>T			Somatic				SLC17A2_uc011dkc.1_Silent_p.I107I|SLC17A2_uc003nfl.2_Silent_p.I107I	p.I107I			WXS	Illumina HiSeq	Unspecified	O00624	NPT3_HUMAN			3	404	-			107			Helical; (Potential).		A6NK81|A6NLD6|Q5TB84|Q76P85	Silent	SNP	ENST00000265425.3	37	c.321C>A																																																																																					0.448	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1			41	69	1	0	4.16155e-14	0.00874	5.85151e-14	41	69				
TRIM27	5987	broad.mit.edu	37	6	28872311	28872311	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:28872311C>A	ENST00000377199.3	-	8	1434	c.1078G>T	c.(1078-1080)Gtc>Ttc	p.V360F	TRIM27_ENST00000377194.3_Intron	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	360	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V360F(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GAGCCCAAGACACAGGGAAAC	0.537			T	RET	papillary thyroid																																		uc003nlr.2		NA		Dom	yes		6	6p22	5987	T	tripartite motif-containing 27			E	RET		papillary thyroid		1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1078-1080)GTC>TTC		ret finger protein							66.0	67.0	67.0					6																	28872311		1511	2709	4220	SO:0001583	missense	5987				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding	g.chr6:28872311C>A	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1078G>T	6.37:g.28872311C>A	ENSP00000366404:p.Val360Phe		Somatic				TRIM27_uc003nls.2_Intron|TRIM27_uc003nlt.1_3'UTR	p.V360F	NM_006510	NP_006501	WXS	Illumina HiSeq	Unspecified	P14373	TRI27_HUMAN			8	1437	-			360			B30.2/SPRY.		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	ENST00000377199.3	37	c.1078G>T	CCDS4654.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.816207|4.816207	0.90790|0.90790	.|.	.|.	ENSG00000204713|ENSG00000204713	ENST00000414543|ENST00000377199	T|T	0.13196|0.33216	2.61|1.42	4.98|4.98	4.98|4.98	0.66077|0.66077	.|Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.|0.000000	.|0.48767	.|D	.|0.000169	T|T	0.66992|0.66992	0.2846|0.2846	H|H	0.98005|0.98005	4.125|4.125	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.79874|0.79874	-0.1619|-0.1619	6|10	.|0.87932	.|D	.|0	.|.	16.5614|16.5614	0.84567|0.84567	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|360	.|P14373	.|TRI27_HUMAN	F|F	94|360	ENSP00000400058:C94F|ENSP00000366404:V360F	.|ENSP00000366404:V360F	C|V	-|-	2|1	0|0	TRIM27|TRIM27	28980290|28980290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	5.396000|5.396000	0.66297|0.66297	2.686000|2.686000	0.91538|0.91538	0.650000|0.650000	0.86243|0.86243	TGT|GTC		0.537	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		26	55	1	0	2.47511e-08	0.008361	2.99391e-08	26	55				
BTNL2	56244	broad.mit.edu	37	6	32370728	32370728	+	Silent	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:32370728C>A	ENST00000374993.1	-	3	692	c.693G>T	c.(691-693)tcG>tcT	p.S231S	BTNL2_ENST00000414363.1_Intron|BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000429232.2_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000454136.3_Silent_p.S231S|BTNL2_ENST00000544175.1_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	231	Ig-like V-type 2.					integral component of membrane (GO:0016021)		p.S231S(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						GGCTGATGACCGACCCCTTCT	0.582																																							uc003obg.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(691-693)TCG>TCT		butyrophilin-like 2							59.0	50.0	53.0					6																	32370728		1510	2709	4219	SO:0001819	synonymous_variant	56244					integral to membrane		g.chr6:32370728C>A	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.693G>T	6.37:g.32370728C>A			Somatic				BTNL2_uc010jty.1_Intron|BTNL2_uc010jtz.1_Intron|BTNL2_uc010jua.1_Intron	p.S231S	NM_019602	NP_062548	WXS	Illumina HiSeq	Unspecified	Q9UIR0	BTNL2_HUMAN			3	693	-			231			Ig-like V-type 2.|Extracellular (Potential).		A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Silent	SNP	ENST00000374993.1	37	c.693G>T																																																																																					0.582	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602		13	22	1	0	1.49906e-05	0.00245	1.7088e-05	13	22				
HLA-DQB2	3120	broad.mit.edu	37	6	32726670	32726670	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:32726670T>G	ENST00000437316.2	-	3	666	c.603A>C	c.(601-603)caA>caC	p.Q201H	HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.Q201H|HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.Q201H			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	205	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)	p.Q201H(1)		endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						GGTGCTCCACTTGGCAGGTGT	0.557																																							uc003oby.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(601-603)CAA>CAC		SubName: Full=Major histocompatibility complex, class II, DQ beta 2; SubName: Full=Putative uncharacterized protein ENSP00000372579;																																				SO:0001583	missense	3120				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	integral to membrane|MHC class II protein complex		g.chr6:32726670T>G	M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.603A>C	6.37:g.32726670T>G	ENSP00000396330:p.Gln201His		Somatic				HLA-DQB2_uc003obz.2_Missense_Mutation_p.Q201H	p.Q201H	NR_003937		WXS	Illumina HiSeq	Unspecified	Q5SR06	Q5SR06_HUMAN			3	686	-			201					A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	ENST00000437316.2	37	c.603A>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0|0	-2.589726|-2.589726	0.00126|0.00126	.|.	.|.	ENSG00000232629|ENSG00000232629	ENST00000427449|ENST00000437316;ENST00000435145;ENST00000411527	.|T;T;T	.|0.02974	.|4.09;4.09;4.09	3.29|3.29	-6.57|-6.57	0.01842|0.01842	.|.	.|0.675264	.|0.13136	.|N	.|0.411048	T|T	0.00271|0.00271	0.0008|0.0008	N|N	0.02420|0.02420	-0.555|-0.555	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.35351|0.35351	-0.9792|-0.9792	5|10	.|0.22706	.|T	.|0.39	.|.	2.9567|2.9567	0.05878|0.05878	0.5247:0.0905:0.1114:0.2733|0.5247:0.0905:0.1114:0.2733	.|.	.|201;201	.|A2ADX3;Q5SR06	.|.;.	T|H	200|201	.|ENSP00000396330:Q201H;ENSP00000410512:Q201H;ENSP00000390431:Q201H	.|ENSP00000390431:Q201H	K|Q	-|-	2|3	0|2	HLA-DQB2|HLA-DQB2	32834648|32834648	0.000000|0.000000	0.05858|0.05858	0.082000|0.082000	0.20525|0.20525	0.630000|0.630000	0.37929|0.37929	-4.960000|-4.960000	0.00165|0.00165	-3.644000|-3.644000	0.00127|0.00127	-1.678000|-1.678000	0.00738|0.00738	AAG|CAA		0.557	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076216.2			4	51	0	0	0	0.001168	0	4	51				
LPA	4018	broad.mit.edu	37	6	161071502	161071502	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr6:161071502T>G	ENST00000316300.5	-	2	121	c.77A>C	c.(76-78)cAg>cCg	p.Q26P	LPA_ENST00000447678.1_Missense_Mutation_p.Q26P			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2534	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.Q26P(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GTAGCAATCCTGGACCACATG	0.433																																							uc003qtl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(76-78)CAG>CCG		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						172.0	176.0	175.0					6																	161071502		2201	4299	6500	SO:0001583	missense	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161071502T>G	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.77A>C	6.37:g.161071502T>G	ENSP00000321334:p.Gln26Pro		Somatic					p.Q26P	NM_005577	NP_005568	WXS	Illumina HiSeq	Unspecified	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	3	197	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	2534			Kringle 23.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.77A>C	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	t	8.710	0.911852	0.17907	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62498	0.02;0.02	2.72	2.72	0.32119	Kringle (2);Kringle-like fold (1);	.	.	.	.	T	0.58538	0.2129	L	0.52364	1.645	0.21416	N	0.999693	P	0.46277	0.875	D	0.71656	0.974	T	0.45527	-0.9255	9	0.44086	T	0.13	.	7.2271	0.26022	0.0:0.0:0.0:1.0	.	2534	P08519	APOA_HUMAN	P	26	ENSP00000321334:Q26P;ENSP00000395608:Q26P	ENSP00000321334:Q26P	Q	-	2	0	LPA	160991492	1.000000	0.71417	0.986000	0.45419	0.187000	0.23431	3.705000	0.54823	1.249000	0.43950	0.414000	0.27820	CAG		0.433	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		35	78	0	0	0	0.003755	0	35	78				
COL28A1	340267	broad.mit.edu	37	7	7477083	7477083	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:7477083C>T	ENST00000399429.3	-	22	1873	c.1733G>A	c.(1732-1734)gGc>gAc	p.G578D		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	578	Collagen-like 5.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G578D(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GCCCATAATGCCCGGTTCACC	0.393																																							uc003src.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1732-1734)GGC>GAC		collagen, type XXVIII precursor							58.0	54.0	56.0					7																	7477083		1820	4078	5898	SO:0001583	missense	340267				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity	g.chr7:7477083C>T	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1733G>A	7.37:g.7477083C>T	ENSP00000382356:p.Gly578Asp		Somatic				COL28A1_uc011jxe.1_Missense_Mutation_p.G261D|COL28A1_uc003srd.2_Missense_Mutation_p.G133D|COL28A1_uc003sre.1_5'UTR	p.G578D	NM_001037763	NP_001032852	WXS	Illumina HiSeq	Unspecified	Q2UY09	COSA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)	22	1850	-		Ovarian(82;0.0789)	578			Collagen-like 5.		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	c.1733G>A	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384595	0.61845	.	.	ENSG00000215018	ENST00000399429;ENST00000399419	D	0.99353	-5.77	4.68	4.68	0.58851	.	0.000000	0.53938	U	0.000046	D	0.99609	0.9858	H	0.97707	4.06	0.09310	N	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.977;0.996	D	0.96561	0.9415	10	0.87932	D	0	-0.1624	13.2971	0.60303	0.0:1.0:0.0:0.0	.	578;578;578	Q2UY09-2;B5MDS6;Q2UY09	.;.;COSA1_HUMAN	D	578	ENSP00000382356:G578D	ENSP00000382347:G578D	G	-	2	0	COL28A1	7443608	0.403000	0.25319	0.069000	0.20011	0.989000	0.77384	3.239000	0.51360	2.613000	0.88420	0.655000	0.94253	GGC		0.393	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763		19	23	0	0	0	0.00333	0	19	23				
COL28A1	340267	broad.mit.edu	37	7	7477086	7477086	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:7477086G>A	ENST00000399429.3	-	22	1870	c.1730C>T	c.(1729-1731)cCg>cTg	p.P577L		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	577	Collagen-like 5.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P577L(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CATAATGCCCGGTTCACCCTT	0.388																																							uc003src.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1729-1731)CCG>CTG		collagen, type XXVIII precursor							54.0	51.0	52.0					7																	7477086		1819	4079	5898	SO:0001583	missense	340267				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity	g.chr7:7477086G>A	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1730C>T	7.37:g.7477086G>A	ENSP00000382356:p.Pro577Leu		Somatic				COL28A1_uc011jxe.1_Missense_Mutation_p.P260L|COL28A1_uc003srd.2_Missense_Mutation_p.P132L|COL28A1_uc003sre.1_5'UTR	p.P577L	NM_001037763	NP_001032852	WXS	Illumina HiSeq	Unspecified	Q2UY09	COSA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)	22	1847	-		Ovarian(82;0.0789)	577			Collagen-like 5.		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	c.1730C>T	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682994	0.47991	.	.	ENSG00000215018	ENST00000399429;ENST00000399419	D	0.93076	-3.16	4.61	1.67	0.24075	.	0.105910	0.37348	U	0.002139	D	0.91088	0.7195	M	0.81112	2.525	0.09310	N	0.999995	B;B;B	0.15930	0.012;0.004;0.015	B;B;B	0.10450	0.003;0.002;0.005	D	0.84074	0.0381	10	0.62326	D	0.03	-0.0593	5.622	0.17463	0.0938:0.0:0.5629:0.3433	.	577;577;577	Q2UY09-2;B5MDS6;Q2UY09	.;.;COSA1_HUMAN	L	577	ENSP00000382356:P577L	ENSP00000382347:P577L	P	-	2	0	COL28A1	7443611	0.311000	0.24536	0.009000	0.14445	0.973000	0.67179	0.734000	0.26101	0.243000	0.21327	0.655000	0.94253	CCG		0.388	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763		18	23	0	0	0	0.00278	0	18	23				
ABCB5	340273	broad.mit.edu	37	7	20778656	20778656	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:20778656T>A	ENST00000404938.2	+	24	3570	c.2918T>A	c.(2917-2919)gTt>gAt	p.V973D	ABCB5_ENST00000258738.6_Missense_Mutation_p.V528D	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	973	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.V528D(1)|p.V973D(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GAAACGCTCGTTTTGGCTCCT	0.423																																							uc003suw.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(1582-1584)GTT>GAT		ATP-binding cassette, sub-family B, member 5							64.0	61.0	62.0					7																	20778656		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20778656T>A	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2918T>A	7.37:g.20778656T>A	ENSP00000384881:p.Val973Asp		Somatic				ABCB5_uc010kuh.2_Missense_Mutation_p.V973D	p.V528D	NM_178559	NP_848654	WXS	Illumina HiSeq	Unspecified	Q2M3G0	ABCB5_HUMAN			15	2129	+			528			Helical; (Potential).|ABC transmembrane type-1.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.1583T>A	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.885886	0.33348	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.42131	0.98;0.98	4.99	2.57	0.30868	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.358630	0.23598	N	0.046479	T	0.20618	0.0496	N	0.08118	0	0.58432	D	0.999993	B;B	0.24317	0.043;0.101	B;B	0.24394	0.039;0.053	T	0.06499	-1.0823	10	0.87932	D	0	.	5.643	0.17575	0.0:0.3223:0.0:0.6777	.	973;528	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	D	973;528	ENSP00000384881:V973D;ENSP00000258738:V528D	ENSP00000258738:V528D	V	+	2	0	ABCB5	20745181	0.993000	0.37304	1.000000	0.80357	0.293000	0.27360	4.553000	0.60753	0.984000	0.38629	0.397000	0.26171	GTT		0.423	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		16	22	0	0	0	0.008871	0	16	22				
BMPER	168667	broad.mit.edu	37	7	34118587	34118587	+	Silent	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:34118587G>A	ENST00000297161.2	+	13	1571	c.1197G>A	c.(1195-1197)tcG>tcA	p.S399S	BMPER_ENST00000426693.1_Silent_p.S399S	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	399	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.S399S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCCCTGCCTCGCCCTTCCAGG	0.582																																							uc011kap.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1195-1197)TCG>TCA		BMP-binding endothelial regulator precursor							99.0	105.0	103.0					7																	34118587		2203	4300	6503	SO:0001819	synonymous_variant	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34118587G>A		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1197G>A	7.37:g.34118587G>A			Somatic					p.S399S	NM_133468	NP_597725	WXS	Illumina HiSeq	Unspecified	Q8N8U9	BMPER_HUMAN			12	1311	+			399			VWFD.		A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	c.1197G>A	CCDS5442.1																																																																																				0.582	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		48	292	0	0	0	0.01441	0	48	292				
URGCP	55665	broad.mit.edu	37	7	43917045	43917045	+	Missense_Mutation	SNP	G	G	A	rs530387888		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:43917045G>A	ENST00000453200.1	-	6	2510	c.2017C>T	c.(2017-2019)Cgc>Tgc	p.R673C	URGCP_ENST00000447717.3_Missense_Mutation_p.R630C|URGCP_ENST00000223341.7_Missense_Mutation_p.R630C|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.R630C|URGCP_ENST00000402306.3_Missense_Mutation_p.R664C|URGCP_ENST00000443736.1_Missense_Mutation_p.R630C|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	673					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.R673C(1)|p.R630C(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGACCCAGCGGACGGGCATG	0.647																																							uc003tiw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|liver(1)|skin(1)	4						c.(2017-2019)CGC>TGC		up-regulated gene 4 isoform 3							30.0	33.0	32.0					7																	43917045		2121	4230	6351	SO:0001583	missense	55665				cell cycle	centrosome|nucleus	GTP binding	g.chr7:43917045G>A		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2017C>T	7.37:g.43917045G>A	ENSP00000396918:p.Arg673Cys		Somatic				URGCP_uc003tiu.2_Missense_Mutation_p.R630C|URGCP_uc003tiv.2_Missense_Mutation_p.R598C|URGCP_uc003tix.2_Missense_Mutation_p.R664C|URGCP_uc003tiy.2_Missense_Mutation_p.R630C|URGCP_uc003tiz.2_Missense_Mutation_p.R630C|URGCP_uc011kbj.1_Missense_Mutation_p.R630C	p.R673C	NM_001077663	NP_001071131	WXS	Illumina HiSeq	Unspecified	Q8TCY9	URGCP_HUMAN			6	2074	-			673					E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	c.2017C>T	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492133	0.44352	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10668	2.85;2.85;2.85;2.85;2.85;2.85	5.97	5.97	0.96955	.	0.444596	0.23646	N	0.045970	T	0.13586	0.0329	M	0.64997	1.995	0.22779	N	0.998742	P;P	0.40211	0.707;0.707	B;B	0.30029	0.11;0.11	T	0.18335	-1.0340	10	0.66056	D	0.02	-23.844	17.9218	0.88969	0.0:0.0:1.0:0.0	.	664;673	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	C	630;630;664;630;673;630	ENSP00000223341:R630C;ENSP00000336872:R630C;ENSP00000384955:R664C;ENSP00000392136:R630C;ENSP00000396918:R673C;ENSP00000402803:R630C	ENSP00000223341:R630C	R	-	1	0	URGCP	43883570	0.040000	0.19996	0.957000	0.39632	0.532000	0.34746	2.305000	0.43664	2.837000	0.97791	0.655000	0.94253	CGC		0.647	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		33	63	0	0	0	0.003755	0	33	63				
EGFR	1956	broad.mit.edu	37	7	55249071	55249071	+	Missense_Mutation	SNP	C	C	T	rs121434569		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:55249071C>T	ENST00000275493.2	+	20	2546	c.2369C>T	c.(2368-2370)aCg>aTg	p.T790M	EGFR_ENST00000455089.1_Missense_Mutation_p.T745M|EGFR_ENST00000454757.2_Missense_Mutation_p.T737M|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	790	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		T -> M (found in a lung cancer sample; increased kinase activity). {ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.T790M(109)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CAGCTCATCACGCAGCTCATG	0.602	T790M(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	T790M(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		109	Substitution - Missense(109)	p.T790M(332)|p.I789_L792del(1)	lung(104)|upper_aerodigestive_tract(2)|biliary_tract(1)|soft_tissue(1)|central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	GRCh37	CM054664	EGFR	M	rs121434569	c.(2368-2370)ACG>ATG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	89.0	95.0					7																	55249071		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55249071C>T		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2369C>T	7.37:g.55249071C>T	ENSP00000275493:p.Thr790Met	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.T745M|EGFR_uc011kco.1_Missense_Mutation_p.T737M|uc003tqo.2_RNA	p.T790M	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		20	2615	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		790		T -> M (found in a lung cancer sample; increased kinase activity).	Cytoplasmic (Potential).|ATP.|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2369C>T	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055662	0.93793	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.59772	0.24;0.24;0.24	5.92	5.92	0.95590	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69931	0.3166	L	0.38733	1.17	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.986;1.0	T	0.71178	-0.4669	9	0.87932	D	0	.	18.8719	0.92319	0.0:1.0:0.0:0.0	.	745;790	Q504U8;P00533	.;EGFR_HUMAN	M	745;660;790;737	ENSP00000415559:T745M;ENSP00000275493:T790M;ENSP00000395243:T737M	ENSP00000275493:T790M	T	+	2	0	EGFR	55216565	1.000000	0.71417	0.935000	0.37517	0.948000	0.59901	4.869000	0.63028	2.795000	0.96236	0.655000	0.94253	ACG		0.602	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		109	100	0	0	0	0.01441	0	109	100				
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:55259515T>G	ENST00000275493.2	+	21	2750	c.2573T>G	c.(2572-2574)cTg>cGg	p.L858R	EGFR_ENST00000455089.1_Missense_Mutation_p.L813R|EGFR_ENST00000454757.2_Missense_Mutation_p.L805R|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	858	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> M (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.|L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity; more sensitive to gefitinib than wild-type; dbSNP:rs121434568). {ECO:0000269|PubMed:15118125, ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L858R(1489)|p.L858Q(1)|p.L858K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATTTTGGGCTGGCCAAACTG	0.537	L858R(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	L858R(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1491	Substitution - Missense(1491)	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)	lung(1475)|upper_aerodigestive_tract(5)|thyroid(4)|large_intestine(2)|peritoneum(1)|stomach(1)|thymus(1)|breast(1)|ovary(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2572-2574)CTG>CGG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	98.0	101.0					7																	55259515		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259515T>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2573T>G	7.37:g.55259515T>G	ENSP00000275493:p.Leu858Arg	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	p.L858R	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2819	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		858		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2573T>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601026	0.87055	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.91351	-2.83;-2.83;-2.83	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.137592	0.50627	D	0.000117	D	0.96340	0.8806	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.956;0.999	D	0.97213	0.9872	10	0.87932	D	0	.	14.8112	0.69996	0.0:0.0:0.0:1.0	.	813;858	Q504U8;P00533	.;EGFR_HUMAN	R	813;728;858;805	ENSP00000415559:L813R;ENSP00000275493:L858R;ENSP00000395243:L805R	ENSP00000275493:L858R	L	+	2	0	EGFR	55227009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.890000	0.87313	2.176000	0.68965	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		98	137	0	0	0	0.01441	0	98	137				
ZNF680	340252	broad.mit.edu	37	7	63982254	63982254	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:63982254G>A	ENST00000309683.6	-	4	1029	c.878C>T	c.(877-879)cCt>cTt	p.P293L	ZNF680_ENST00000476563.1_5'Flank	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P293L(1)		breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				ACATTTGTAAGGTTTGTCTCC	0.348																																							uc003tta.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(877-879)CCT>CTT		zinc finger protein 680 isoform 1							41.0	41.0	41.0					7																	63982254		2202	4300	6502	SO:0001583	missense	340252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63982254G>A	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.878C>T	7.37:g.63982254G>A	ENSP00000309330:p.Pro293Leu		Somatic				ZNF680_uc010kzr.2_Missense_Mutation_p.P220L	p.P293L	NM_178558	NP_848653	WXS	Illumina HiSeq	Unspecified	Q8NEM1	ZN680_HUMAN			4	1051	-		Lung NSC(55;0.118)|all_lung(88;0.243)	293					B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	c.878C>T	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	g	14.28	2.486932	0.44249	.	.	ENSG00000173041	ENST00000309683	T	0.27557	1.66	1.36	1.36	0.22044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39545	0.1082	L	0.51422	1.61	0.80722	D	1	D	0.69078	0.997	P	0.61940	0.896	T	0.21621	-1.0240	9	0.56958	D	0.05	.	5.9976	0.19503	0.0:0.0:1.0:0.0	.	293	Q8NEM1	ZN680_HUMAN	L	293	ENSP00000309330:P293L	ENSP00000309330:P293L	P	-	2	0	ZNF680	63619689	0.670000	0.27512	0.038000	0.18304	0.201000	0.24016	0.899000	0.28417	0.701000	0.31803	0.491000	0.48974	CCT		0.348	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344568.1	NM_178558		4	39	0	0	0	0.009096	0	4	39				
FKBP6	8468	broad.mit.edu	37	7	72744332	72744332	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:72744332G>T	ENST00000252037.4	+	4	514	c.445G>T	c.(445-447)Gac>Tac	p.D149Y	FKBP6_ENST00000413573.2_Missense_Mutation_p.D119Y|FKBP6_ENST00000431982.2_Missense_Mutation_p.D144Y|TRIM50_ENST00000493498.1_5'Flank|TRIM50_ENST00000333149.2_5'Flank	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	149					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.D149Y(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TGCTGAGTCAGACAAGTTTTG	0.493																																							uc003tya.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(445-447)GAC>TAC		FK506 binding protein 6 isoform a							92.0	84.0	87.0					7																	72744332		2203	4300	6503	SO:0001583	missense	8468				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:72744332G>T	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.445G>T	7.37:g.72744332G>T	ENSP00000252037:p.Asp149Tyr		Somatic				FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Missense_Mutation_p.D144Y|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	p.D149Y	NM_003602	NP_003593	WXS	Illumina HiSeq	Unspecified	O75344	FKBP6_HUMAN			4	577	+		Lung NSC(55;0.0908)|all_lung(88;0.198)	149					B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	ENST00000252037.4	37	c.445G>T	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349554	0.61183	.	.	ENSG00000077800	ENST00000431982;ENST00000442793;ENST00000413573;ENST00000252037	T;T;T;T	0.59906	0.56;0.4;0.23;0.55	4.93	4.04	0.47022	.	0.048143	0.85682	D	0.000000	T	0.72518	0.3470	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.986	T	0.71148	-0.4677	10	0.32370	T	0.25	-18.5395	13.3198	0.60426	0.0:0.0:0.8404:0.1596	.	144;149	O75344-2;O75344	.;FKBP6_HUMAN	Y	144;144;119;149	ENSP00000416277:D144Y;ENSP00000402360:D144Y;ENSP00000394952:D119Y;ENSP00000252037:D149Y	ENSP00000252037:D149Y	D	+	1	0	FKBP6	72382268	1.000000	0.71417	0.963000	0.40424	0.636000	0.38137	7.254000	0.78329	1.078000	0.41014	-0.291000	0.09656	GAC		0.493	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602		46	47	1	0	1.08114e-33	0.01441	1.8835e-33	46	47				
BCL7B	9275	broad.mit.edu	37	7	72952325	72952325	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:72952325G>A	ENST00000223368.2	-	5	878	c.455C>T	c.(454-456)tCg>tTg	p.S152L	BCL7B_ENST00000411832.1_Missense_Mutation_p.S95L|BCL7B_ENST00000482231.1_5'UTR	NM_001707.3	NP_001698.2	Q9BQE9	BCL7B_HUMAN	B-cell CLL/lymphoma 7B	152							actin binding (GO:0003779)	p.S152L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	9		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGCAACTTCCGAGGAGGGCAG	0.542																																							uc003tyf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(454-456)TCG>TTG		B-cell CLL/lymphoma 7B							111.0	101.0	104.0					7																	72952325		2203	4300	6503	SO:0001583	missense	9275						actin binding	g.chr7:72952325G>A	X89985	CCDS5550.1, CCDS56489.1, CCDS75613.1	7q11.23	2008-07-18			ENSG00000106635	ENSG00000106635			1005	protein-coding gene	gene with protein product		605846				8605326, 9806765	Standard	NM_001707		Approved		uc003tyf.2	Q9BQE9	OTTHUMG00000023412	ENST00000223368.2:c.455C>T	7.37:g.72952325G>A	ENSP00000223368:p.Ser152Leu		Somatic				BCL7B_uc010lbf.1_RNA|BCL7B_uc003tye.1_RNA|BCL7B_uc003tyg.1_Missense_Mutation_p.S95L	p.S152L	NM_001707	NP_001698	WXS	Illumina HiSeq	Unspecified	Q9BQE9	BCL7B_HUMAN			5	571	-		Lung NSC(55;0.0659)|all_lung(88;0.152)	152					A8K226|C9JWD3|D3DXF0|O43769|Q13845|Q6ZW75	Missense_Mutation	SNP	ENST00000223368.2	37	c.455C>T	CCDS5550.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984298	0.35036	.	.	ENSG00000106635	ENST00000223368;ENST00000411832	T	0.46819	0.86	5.71	5.71	0.89125	.	0.539636	0.19486	N	0.113113	T	0.40791	0.1131	L	0.53249	1.67	0.33665	D	0.610147	D;P	0.53462	0.96;0.921	B;B	0.37601	0.254;0.089	T	0.60439	-0.7263	10	0.48119	T	0.1	.	12.3187	0.54973	0.0:0.0:0.831:0.169	.	95;152	C9JWD3;Q9BQE9	.;BCL7B_HUMAN	L	152;95	ENSP00000223368:S152L	ENSP00000223368:S152L	S	-	2	0	BCL7B	72590261	1.000000	0.71417	0.964000	0.40570	0.341000	0.28922	4.896000	0.63222	2.704000	0.92352	0.555000	0.69702	TCG		0.542	BCL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252194.1	NM_001707		5	188	0	0	0	0.001168	0	5	188				
RUNDC3B	154661	broad.mit.edu	37	7	87436744	87436744	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:87436744C>T	ENST00000338056.3	+	10	1475	c.1064C>T	c.(1063-1065)aCc>aTc	p.T355I	RUNDC3B_ENST00000394654.3_Missense_Mutation_p.T338I|RUNDC3B_ENST00000493037.1_Intron	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	355								p.T355I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					GCCCATCTCACCAACCAGTGG	0.413																																							uc003ujb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1063-1065)ACC>ATC		RUN domain containing 3B isoform a							174.0	154.0	161.0					7																	87436744		2203	4300	6503	SO:0001583	missense	154661							g.chr7:87436744C>T		CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.1064C>T	7.37:g.87436744C>T	ENSP00000337732:p.Thr355Ile		Somatic				RUNDC3B_uc011khd.1_Missense_Mutation_p.T338I|RUNDC3B_uc011khe.1_Missense_Mutation_p.T338I|RUNDC3B_uc003ujc.2_Intron|RUNDC3B_uc003ujd.2_Intron	p.T355I	NM_138290	NP_612147	WXS	Illumina HiSeq	Unspecified	Q96NL0	RUN3B_HUMAN			10	1475	+	Esophageal squamous(14;0.00164)		355					B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	ENST00000338056.3	37	c.1064C>T	CCDS5609.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682444	0.68157	.	.	ENSG00000105784	ENST00000338056;ENST00000394654	T;T	0.39592	1.07;1.07	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.54224	0.1845	L	0.28274	0.84	0.80722	D	1	D;D;B	0.76494	0.999;0.999;0.023	D;D;B	0.78314	0.991;0.991;0.074	T	0.49854	-0.8895	10	0.39692	T	0.17	-8.8249	20.1162	0.97934	0.0:1.0:0.0:0.0	.	338;338;355	E9PBR4;B4DFD0;Q96NL0	.;.;RUN3B_HUMAN	I	355;338	ENSP00000337732:T355I;ENSP00000378149:T338I	ENSP00000337732:T355I	T	+	2	0	RUNDC3B	87274680	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.756000	0.94617	0.655000	0.94253	ACC		0.413	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253679.1	NM_138290		18	138	0	0	0	0.010504	0	18	138				
ADAM22	53616	broad.mit.edu	37	7	87780637	87780637	+	Splice_Site	SNP	T	T	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:87780637T>G	ENST00000265727.7	+	20	1760		c.e20+2		ADAM22_ENST00000398204.4_Splice_Site|ADAM22_ENST00000398209.3_Splice_Site|ADAM22_ENST00000398201.4_Splice_Site|ADAM22_ENST00000315984.7_Splice_Site			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22						adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.?(3)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GGGGGCAAAGTAAGTAAATAG	0.403																																							uc003ujn.2		NA																	3	Unknown(3)		lung(3)	ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.e20+2		ADAM metallopeptidase domain 22 isoform 1							116.0	110.0	112.0					7																	87780637		1906	4118	6024	SO:0001630	splice_region_variant	53616				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding	g.chr7:87780637T>G	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1681+2T>G	7.37:g.87780637T>G			Somatic				ADAM22_uc003ujk.1_Splice_Site_p.K561_splice|ADAM22_uc003ujl.1_Splice_Site_p.K561_splice|ADAM22_uc003ujm.2_Splice_Site_p.K561_splice|ADAM22_uc003ujo.2_Splice_Site_p.K561_splice|ADAM22_uc003ujp.1_Splice_Site_p.K613_splice	p.K561_splice	NM_021723	NP_068369	WXS	Illumina HiSeq	Unspecified	Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		20	1760	+	Esophageal squamous(14;0.00202)							O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Splice_Site	SNP	ENST00000265727.7	37	c.1681_splice	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572865	0.86542	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0792	0.64909	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM22	87618573	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.080000	0.76837	2.014000	0.59158	0.482000	0.46254	.		0.403	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	Intron	19	124	0	0	0	0.012319	0	19	124				
ZNF804B	219578	broad.mit.edu	37	7	88965549	88965549	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:88965549G>T	ENST00000333190.4	+	4	3862	c.3253G>T	c.(3253-3255)Gtg>Ttg	p.V1085L		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1085							metal ion binding (GO:0046872)	p.V1085L(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATATACTGGTGTGACTGATTC	0.348										HNSCC(36;0.09)																													uc011khi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(3253-3255)GTG>TTG		zinc finger protein 804B							55.0	54.0	54.0					7																	88965549		2202	4299	6501	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88965549G>T	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3253G>T	7.37:g.88965549G>T	ENSP00000329638:p.Val1085Leu	HNSCC(36;0.09)	Somatic					p.V1085L	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	3791	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		1085					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.3253G>T	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	G	8.820	0.937331	0.18206	.	.	ENSG00000182348	ENST00000333190	T	0.05925	3.37	4.77	-2.6	0.06190	.	0.559512	0.17214	N	0.182607	T	0.03739	0.0106	L	0.34521	1.04	0.22112	N	0.999356	P	0.37441	0.595	B	0.31016	0.123	T	0.28964	-1.0027	10	0.66056	D	0.02	-1.3463	6.0293	0.19671	0.3902:0.0:0.4945:0.1153	.	1085	A4D1E1	Z804B_HUMAN	L	1085	ENSP00000329638:V1085L	ENSP00000329638:V1085L	V	+	1	0	ZNF804B	88803485	0.989000	0.36119	0.011000	0.14972	0.666000	0.39218	0.523000	0.22925	-0.707000	0.05022	-0.890000	0.02929	GTG		0.348	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		48	65	1	0	5.57489e-27	0.01441	9.30268e-27	48	65				
CCDC132	55610	broad.mit.edu	37	7	92979331	92979331	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:92979331G>T	ENST00000305866.5	+	25	2577	c.2449G>T	c.(2449-2451)Gat>Tat	p.D817Y	CCDC132_ENST00000541136.1_3'UTR|CCDC132_ENST00000535481.1_Missense_Mutation_p.D537Y|CCDC132_ENST00000544910.1_Missense_Mutation_p.D787Y|CCDC132_ENST00000474412.1_3'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	817						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.D817Y(1)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CATATATGTAGATGCACTATT	0.378																																							uc003umo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2449-2451)GAT>TAT		coiled-coil domain containing 132 isoform a							72.0	69.0	70.0					7																	92979331		1899	4115	6014	SO:0001583	missense	55610							g.chr7:92979331G>T	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2449G>T	7.37:g.92979331G>T	ENSP00000307666:p.Asp817Tyr		Somatic				CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.D787Y|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.D537Y	p.D817Y	NM_017667	NP_060137	WXS	Illumina HiSeq	Unspecified	Q96JG6	CC132_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		25	2577	+	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		817					B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	c.2449G>T	CCDS43617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.95|14.95	2.689526|2.689526	0.48097|0.48097	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481|ENST00000443443	.|.	.|.	.|.	4.78|4.78	4.78|4.78	0.61160|0.61160	Protein of unknown function DUF2451, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82476|0.82476	0.5045|0.5045	M|M	0.85859|0.85859	2.78|2.78	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.998;0.996;0.998|.	D|D	0.84958|0.84958	0.0875|0.0875	9|5	0.87932|.	D|.	0|.	-18.953|-18.953	18.1859|18.1859	0.89792|0.89792	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	537;787;817|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	Y|I	817;787;537|41	.|.	ENSP00000307666:D817Y|.	D|R	+|+	1|2	0|0	CCDC132|CCDC132	92817267|92817267	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.018000|0.018000	0.09664|0.09664	9.734000|9.734000	0.98822|0.98822	2.369000|2.369000	0.80426|0.80426	0.585000|0.585000	0.79938|0.79938	GAT|AGA		0.378	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		10	86	1	0	0.000442599	0.006214	0.000477043	10	86				
NYAP1	222950	broad.mit.edu	37	7	100086913	100086913	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:100086913G>T	ENST00000300179.2	+	4	1728	c.1569G>T	c.(1567-1569)ggG>ggT	p.G523G	NYAP1_ENST00000423930.1_Silent_p.G523G|NYAP1_ENST00000454988.1_Silent_p.G466G	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	523					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.G523G(1)									CAGCAGCTGGGGTCCTCCACC	0.692																																							uc003uvd.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1567-1569)GGG>GGT		hypothetical protein FLJ37538							15.0	18.0	17.0					7																	100086913		2195	4289	6484	SO:0001819	synonymous_variant	222950							g.chr7:100086913G>T	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1569G>T	7.37:g.100086913G>T			Somatic				C7orf51_uc003uve.1_Silent_p.G305G	p.G523G	NM_173564	NP_775835	WXS	Illumina HiSeq	Unspecified	Q6ZVC0	CG051_HUMAN			4	1728	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		523					Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	c.1569G>T	CCDS5696.1																																																																																				0.692	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564		11	17	1	0	4.36969e-10	0.001855	5.5779e-10	11	17				
MUC17	140453	broad.mit.edu	37	7	100675478	100675478	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:100675478G>C	ENST00000306151.4	+	3	845	c.781G>C	c.(781-783)Gaa>Caa	p.E261Q		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	261	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.E261*(1)|p.E261Q(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACAACTGCTGAAGGTCCCAG	0.512																																							uc003uxp.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(781-783)GAA>CAA		mucin 17 precursor							138.0	141.0	140.0					7																	100675478		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100675478G>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.781G>C	7.37:g.100675478G>C	ENSP00000302716:p.Glu261Gln		Somatic				MUC17_uc010lho.1_RNA	p.E261Q	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	834	+	Lung NSC(181;0.136)|all_lung(186;0.182)		261			Extracellular (Potential).|59 X approximate tandem repeats.|2.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.781G>C	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	2.054	-0.416954	0.04766	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	0.792	0.792	0.18625	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	P	0.47604	0.898	B	0.31686	0.134	T	0.46119	-0.9214	9	0.15066	T	0.55	.	4.9345	0.13934	0.0:0.0:1.0:0.0	.	261	Q685J3	MUC17_HUMAN	Q	261	ENSP00000302716:E261Q	ENSP00000302716:E261Q	E	+	1	0	MUC17	100462198	0.003000	0.15002	0.017000	0.16124	0.043000	0.13939	1.476000	0.35420	0.722000	0.32252	0.186000	0.17326	GAA		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		10	278	0	0	0	0.00245	0	10	278				
MUC17	140453	broad.mit.edu	37	7	100677522	100677522	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:100677522G>C	ENST00000306151.4	+	3	2889	c.2825G>C	c.(2824-2826)aGa>aCa	p.R942T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	942	59 X approximate tandem repeats.|Ser-rich.		R -> S (in dbSNP:rs10238201).		cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.R942T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTGAGGCTAGAACACTTTCA	0.512																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(2824-2826)AGA>ACA		mucin 17 precursor							350.0	313.0	326.0					7																	100677522		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100677522G>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2825G>C	7.37:g.100677522G>C	ENSP00000302716:p.Arg942Thr		Somatic				MUC17_uc010lho.1_RNA	p.R942T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	2878	+	Lung NSC(181;0.136)|all_lung(186;0.182)		942			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|13.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.2825G>C	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	1.014	-0.687074	0.03328	.	.	ENSG00000169876	ENST00000306151	T	0.02812	4.15	0.838	-1.68	0.08212	.	.	.	.	.	T	0.01695	0.0054	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49504	-0.8933	9	0.11794	T	0.64	.	8.041	0.30521	0.0:0.367:0.633:0.0	.	942	Q685J3	MUC17_HUMAN	T	942	ENSP00000302716:R942T	ENSP00000302716:R942T	R	+	2	0	MUC17	100464242	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.137000	0.03219	-0.808000	0.04387	0.134000	0.15878	AGA		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		33	621	0	0	0	0.013726	0	33	621				
RELN	5649	broad.mit.edu	37	7	103159823	103159823	+	Silent	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:103159823G>T	ENST00000428762.1	-	49	7968	c.7809C>A	c.(7807-7809)ggC>ggA	p.G2603G	RELN_ENST00000343529.5_Silent_p.G2603G|RELN_ENST00000424685.2_Silent_p.G2603G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2603					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.G2603G(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCAGGTAATGCCTCCATTGA	0.413																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(7807-7809)GGC>GGA		reelin isoform a							154.0	129.0	137.0					7																	103159823		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103159823G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7809C>A	7.37:g.103159823G>T			Somatic				RELN_uc010liz.2_Silent_p.G2603G	p.G2603G	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	49	7969	-			2603			BNR 12.		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.7809C>A	CCDS47680.1																																																																																				0.413	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		64	81	1	0	4.46356e-37	0.01441	7.92568e-37	64	81				
RELN	5649	broad.mit.edu	37	7	103205942	103205942	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:103205942G>T	ENST00000428762.1	-	34	5152	c.4993C>A	c.(4993-4995)Cag>Aag	p.Q1665K	RELN_ENST00000343529.5_Missense_Mutation_p.Q1665K|RELN_ENST00000424685.2_Missense_Mutation_p.Q1665K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1665					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Q1665K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTTCAAACTGCAAAAAGGTA	0.433																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(4993-4995)CAG>AAG		reelin isoform a							76.0	68.0	71.0					7																	103205942		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103205942G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4993C>A	7.37:g.103205942G>T	ENSP00000392423:p.Gln1665Lys		Somatic				RELN_uc010liz.2_Missense_Mutation_p.Q1665K	p.Q1665K	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	34	5153	-			1665					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.4993C>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852149	0.91355	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.27557	1.66;1.66;1.66	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.61862	0.2381	M	0.83953	2.67	0.58432	D	0.999999	D;P	0.65815	0.995;0.891	D;P	0.66716	0.946;0.877	T	0.63193	-0.6692	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1665;1665	P78509-2;P78509	.;RELN_HUMAN	K	1665	ENSP00000392423:Q1665K;ENSP00000345694:Q1665K;ENSP00000388446:Q1665K	ENSP00000345694:Q1665K	Q	-	1	0	RELN	102993178	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.209000	0.95087	2.941000	0.99782	0.655000	0.94253	CAG		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		10	54	1	0	2.23348e-06	0.004007	2.61044e-06	10	54				
ORC5	5001	broad.mit.edu	37	7	103844634	103844634	+	Missense_Mutation	SNP	T	T	C	rs565090474		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:103844634T>C	ENST00000297431.4	-	2	263	c.121A>G	c.(121-123)Agt>Ggt	p.S41G	ORC5_ENST00000485726.1_5'UTR|ORC5_ENST00000447452.2_Missense_Mutation_p.S41G|ORC5_ENST00000545943.1_5'UTR	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	41					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.S41G(2)		kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						GTCTTTCCACTAGCAGTATGT	0.294													T|||	1	0.000199681	0.0	0.0	5008	,	,		17663	0.0		0.0	False		,,,				2504	0.001						uc003vcb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(121-123)AGT>GGT		origin recognition complex subunit 5 isoform 1							74.0	74.0	74.0					7																	103844634		2201	4299	6500	SO:0001583	missense	5001				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding	g.chr7:103844634T>C		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.121A>G	7.37:g.103844634T>C	ENSP00000297431:p.Ser41Gly		Somatic				ORC5L_uc011klp.1_5'UTR|ORC5L_uc003vcc.2_Missense_Mutation_p.S41G|ORC5L_uc003vcd.2_Missense_Mutation_p.S41G	p.S41G	NM_002553	NP_002544	WXS	Illumina HiSeq	Unspecified	O43913	ORC5_HUMAN			2	232	-			41			ATP (Potential).		A4D0P8|O60590|O95268	Missense_Mutation	SNP	ENST00000297431.4	37	c.121A>G	CCDS5734.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.499980	0.64298	.	.	ENSG00000164815	ENST00000297431;ENST00000447452	T;T	0.40476	1.03;1.03	5.56	5.56	0.83823	.	0.094658	0.64402	D	0.000001	T	0.51295	0.1666	M	0.64997	1.995	0.80722	D	1	P;P;P	0.52316	0.896;0.952;0.896	P;P;P	0.49085	0.575;0.6;0.575	T	0.57010	-0.7884	10	0.87932	D	0	.	15.7087	0.77606	0.0:0.0:0.0:1.0	.	41;41;41	A4D0P7;O43913-2;O43913	.;.;ORC5_HUMAN	G	41	ENSP00000297431:S41G;ENSP00000395747:S41G	ENSP00000297431:S41G	S	-	1	0	ORC5	103631870	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	4.319000	0.59197	2.123000	0.65237	0.482000	0.46254	AGT		0.294	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553		23	15	0	0	0	0.005443	0	23	15				
CPA2	1358	broad.mit.edu	37	7	129909536	129909536	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:129909536C>G	ENST00000222481.4	+	3	236	c.181C>G	c.(181-183)Cca>Gca	p.P61A		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	61					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P59A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					ACCCACCACCCCAGGGGAGAC	0.498																																							uc003vpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(181-183)CCA>GCA		carboxypeptidase A2 (pancreatic) precursor							129.0	121.0	124.0					7																	129909536		2203	4300	6503	SO:0001583	missense	1358				proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129909536C>G	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.181C>G	7.37:g.129909536C>G	ENSP00000222481:p.Pro61Ala		Somatic				CPA2_uc011kpc.1_Missense_Mutation_p.P61A	p.P61A	NM_001869	NP_001860	WXS	Illumina HiSeq	Unspecified	P48052	CBPA2_HUMAN			3	200	+	Melanoma(18;0.0435)		61					A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	ENST00000222481.4	37	c.181C>G	CCDS5817.2	.	.	.	.	.	.	.	.	.	.	C	4.126	0.021567	0.08006	.	.	ENSG00000158516	ENST00000222481	T	0.14391	2.51	5.47	-0.772	0.10998	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.194645	0.44688	D	0.000427	T	0.08447	0.0210	L	0.42686	1.345	0.09310	N	1	B;B	0.24368	0.102;0.017	B;B	0.28465	0.09;0.012	T	0.33266	-0.9875	10	0.15066	T	0.55	.	2.7264	0.05215	0.1133:0.3877:0.1114:0.3877	.	59;61	B4DDX9;P48052	.;CBPA2_HUMAN	A	61	ENSP00000222481:P61A	ENSP00000222481:P61A	P	+	1	0	CPA2	129696772	0.000000	0.05858	0.003000	0.11579	0.335000	0.28730	0.224000	0.17738	-0.115000	0.11915	-0.181000	0.13052	CCA		0.498	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869		67	81	0	0	0	0.01441	0	67	81				
GIMAP8	155038	broad.mit.edu	37	7	150164352	150164352	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:150164352T>C	ENST00000307271.3	+	2	1140	c.566T>C	c.(565-567)gTt>gCt	p.V189A		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	189	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.V189A(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CTTCGCAAGGTTGAGTCTTTG	0.428																																							uc003whj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(565-567)GTT>GCT		GTPase, IMAP family member 8							115.0	106.0	109.0					7																	150164352		2203	4300	6503	SO:0001583	missense	155038					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding	g.chr7:150164352T>C	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.566T>C	7.37:g.150164352T>C	ENSP00000305107:p.Val189Ala		Somatic					p.V189A	NM_175571	NP_783161	WXS	Illumina HiSeq	Unspecified	Q8ND71	GIMA8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)	2	896	+			189						Missense_Mutation	SNP	ENST00000307271.3	37	c.566T>C	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.668087	0.67814	.	.	ENSG00000171115	ENST00000307271	T	0.12255	2.7	4.16	4.16	0.48862	AIG1 (1);	0.373666	0.19446	N	0.114045	T	0.33118	0.0852	M	0.81112	2.525	0.09310	N	1	D	0.64830	0.994	P	0.62298	0.9	T	0.09058	-1.0692	10	0.49607	T	0.09	.	9.4901	0.38953	0.0:0.0:0.0:1.0	.	189	Q8ND71	GIMA8_HUMAN	A	189	ENSP00000305107:V189A	ENSP00000305107:V189A	V	+	2	0	GIMAP8	149795285	0.300000	0.24435	0.003000	0.11579	0.001000	0.01503	2.993000	0.49425	1.762000	0.52044	0.477000	0.44152	GTT		0.428	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		30	228	0	0	0	0.012213	0	30	228				
PRKAG2	51422	broad.mit.edu	37	7	151372540	151372540	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:151372540A>T	ENST00000287878.4	-	4	1154	c.650T>A	c.(649-651)cTg>cAg	p.L217Q	PRKAG2_ENST00000433631.2_Missense_Mutation_p.L93Q|PRKAG2_ENST00000461529.1_5'Flank|PRKAG2_ENST00000492843.1_Missense_Mutation_p.L93Q|PRKAG2_ENST00000392801.2_Missense_Mutation_p.L173Q	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	217					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)	p.L93Q(1)|p.L217Q(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	CGGTGATGCCAGTGGAGGCCT	0.622																																							uc003wkk.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|kidney(1)	2						c.(649-651)CTG>CAG		AMP-activated protein kinase gamma2 subunit							52.0	51.0	51.0					7																	151372540		2203	4300	6503	SO:0001583	missense	51422				ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding	g.chr7:151372540A>T	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.650T>A	7.37:g.151372540A>T	ENSP00000287878:p.Leu217Gln		Somatic				PRKAG2_uc011kvl.1_Missense_Mutation_p.L93Q|PRKAG2_uc003wkj.2_Missense_Mutation_p.L173Q|PRKAG2_uc010lqe.1_RNA|PRKAG2_uc003wkm.1_Missense_Mutation_p.L217Q	p.L217Q	NM_016203	NP_057287	WXS	Illumina HiSeq	Unspecified	Q9UGJ0	AAKG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	4	1261	-	all_neural(206;0.187)	all_hematologic(28;0.0605)	217					Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	37	c.650T>A	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.641977	0.29157	.	.	ENSG00000106617	ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801	D;D;D;D	0.88277	-1.95;-2.3;-2.3;-2.36	5.31	2.25	0.28309	.	1.831950	0.02871	N	0.131521	T	0.80732	0.4679	N	0.08118	0	0.09310	N	1	P;P;B	0.37636	0.468;0.603;0.026	B;B;B	0.42422	0.1;0.387;0.024	T	0.71961	-0.4434	10	0.17369	T	0.5	.	6.4959	0.22142	0.6524:0.0:0.3476:0.0	.	93;217;217	B7Z6X8;Q8NCK6;Q9UGJ0	.;.;AAKG2_HUMAN	Q	217;93;93;173	ENSP00000287878:L217Q;ENSP00000419577:L93Q;ENSP00000406544:L93Q;ENSP00000376549:L173Q	ENSP00000287878:L217Q	L	-	2	0	PRKAG2	151003473	0.002000	0.14202	0.004000	0.12327	0.123000	0.20343	1.287000	0.33284	0.485000	0.27652	-0.474000	0.04947	CTG		0.622	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203		34	50	0	0	0	0.005524	0	34	50				
CSMD1	64478	broad.mit.edu	37	8	2944669	2944669	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:2944669C>G	ENST00000520002.1	-	50	7982	c.7427G>C	c.(7426-7428)cGa>cCa	p.R2476P	CSMD1_ENST00000602723.1_Missense_Mutation_p.R2476P|CSMD1_ENST00000400186.3_Missense_Mutation_p.R2476P|CSMD1_ENST00000542608.1_Missense_Mutation_p.R2475P|CSMD1_ENST00000602557.1_Missense_Mutation_p.R2476P|CSMD1_ENST00000537824.1_Missense_Mutation_p.R2475P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2476	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R2204P(1)|p.R2204Q(1)|p.R2475P(1)|p.R2475Q(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGTGGGTTTCGTCTACAGGT	0.507																																							uc011kwk.1		NA																	4	Substitution - Missense(4)		lung(2)|skin(2)	breast(20)|large_intestine(5)	25						c.(7426-7428)CGA>CCA		CUB and Sushi multiple domains 1 precursor							106.0	106.0	106.0					8																	2944669		2042	4187	6229	SO:0001583	missense	64478					integral to membrane		g.chr8:2944669C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7427G>C	8.37:g.2944669C>G	ENSP00000430733:p.Arg2476Pro		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.R1805P|CSMD1_uc010lrg.2_Missense_Mutation_p.R544P	p.R2476P	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	49	7817	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2476			Sushi 14.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.7427G>C		.	.	.	.	.	.	.	.	.	.	C	11.07	1.529439	0.27387	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.81	4.93	0.64822	Complement control module (2);Sushi/SCR/CCP (3);	0.172123	0.40064	N	0.001184	T	0.38268	0.1034	L	0.40543	1.245	0.42236	D	0.991917	P;P;D	0.52996	0.896;0.944;0.957	P;P;P	0.60886	0.631;0.88;0.822	T	0.05194	-1.0900	10	0.52906	T	0.07	.	14.2967	0.66318	0.0:0.9289:0.0:0.0711	.	2476;2476;2475	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	P	2476;2476;2337;2475;2475	ENSP00000383047:R2476P;ENSP00000430733:R2476P;ENSP00000441462:R2475P;ENSP00000446243:R2475P	ENSP00000320445:R2337P	R	-	2	0	CSMD1	2932076	0.648000	0.27313	0.059000	0.19551	0.012000	0.07955	1.487000	0.35540	2.749000	0.94314	0.561000	0.74099	CGA		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		14	47	0	0	0	0.00245	0	14	47				
CSMD1	64478	broad.mit.edu	37	8	3265422	3265422	+	Splice_Site	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:3265422G>T	ENST00000520002.1	-	15	2628	c.2073C>A	c.(2071-2073)acC>acA	p.T691T	CSMD1_ENST00000602723.1_Splice_Site_p.T691T|CSMD1_ENST00000400186.3_Splice_Site_p.T691T|CSMD1_ENST00000542608.1_Splice_Site_p.T690T|CSMD1_ENST00000602557.1_Splice_Site_p.T691T|CSMD1_ENST00000539096.1_Splice_Site_p.T690T|CSMD1_ENST00000537824.1_Splice_Site_p.T690T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	691	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T419T(1)|p.T690T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGTACTTACTGGTGTAAGTGA	0.438																																							uc011kwk.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(2071-2073)ACC>ACA		CUB and Sushi multiple domains 1 precursor							61.0	58.0	59.0					8																	3265422		1980	4167	6147	SO:0001630	splice_region_variant	64478					integral to membrane		g.chr8:3265422G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2074+1C>A	8.37:g.3265422G>T			Somatic				CSMD1_uc011kwj.1_Silent_p.T83T	p.T691T	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	14	2463	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	691			Extracellular (Potential).|CUB 4.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.2073C>A		.	.	.	.	.	.	.	.	.	.	G	11.77	1.738044	0.30774	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.23	2.86	0.33363	.	.	.	.	.	T	0.52980	0.1768	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47341	-0.9125	4	.	.	.	.	5.654	0.17633	0.1541:0.0:0.2155:0.6304	.	.	.	.	N	171	.	.	H	-	1	0	CSMD1	3252829	0.999000	0.42202	0.998000	0.56505	0.935000	0.57460	0.452000	0.21795	1.116000	0.41820	0.467000	0.42956	CAC		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	Silent	4	14	1	0	2.56e-06	0.009096	2.9795e-06	4	14				
EXTL3	2137	broad.mit.edu	37	8	28600642	28600642	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:28600642A>G	ENST00000220562.4	+	6	3363	c.2461A>G	c.(2461-2463)Atc>Gtc	p.I821V	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.I437V	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	821					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.I821V(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GCCCCAGGCCATCCGGGACAT	0.493																																							uc003xgz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(2461-2463)ATC>GTC		exostoses-like 3							226.0	197.0	207.0					8																	28600642		2203	4300	6503	SO:0001583	missense	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28600642A>G	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2461A>G	8.37:g.28600642A>G	ENSP00000220562:p.Ile821Val		Somatic					p.I821V	NM_001440	NP_001431	WXS	Illumina HiSeq	Unspecified	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	6	3054	+		Ovarian(32;0.069)	821			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	c.2461A>G	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.376125	0.42105	.	.	ENSG00000012232	ENST00000523149;ENST00000220562;ENST00000521532;ENST00000517738	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	4.89	4.89	0.63831	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	L	0.39020	1.185	0.80722	D	1	D	0.69078	0.997	P	0.59487	0.858	T	0.76296	-0.3011	10	0.36615	T	0.2	-29.129	14.7101	0.69225	1.0:0.0:0.0:0.0	.	821	O43909	EXTL3_HUMAN	V	437;821;119;67	ENSP00000428691:I437V;ENSP00000220562:I821V;ENSP00000431013:I119V;ENSP00000430652:I67V	ENSP00000220562:I821V	I	+	1	0	EXTL3	28656561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.047000	0.93823	2.057000	0.61298	0.528000	0.53228	ATC		0.493	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		83	271	0	0	0	0.01441	0	83	271				
TEX15	56154	broad.mit.edu	37	8	30703484	30703484	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:30703484A>T	ENST00000256246.2	-	1	3124	c.3050T>A	c.(3049-3051)cTt>cAt	p.L1017H	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1017					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.L1017H(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTTAGTTATAAGCTGCAAAGA	0.338																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(3049-3051)CTT>CAT		testis expressed 15							105.0	118.0	114.0					8																	30703484		2203	4296	6499	SO:0001583	missense	56154							g.chr8:30703484A>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.3050T>A	8.37:g.30703484A>T	ENSP00000256246:p.Leu1017His		Somatic					p.L1017H	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	3050	-			1017						Missense_Mutation	SNP	ENST00000256246.2	37	c.3050T>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618229	0.66787	.	.	ENSG00000133863	ENST00000256246	T	0.26810	1.71	5.38	5.38	0.77491	.	0.000000	0.49916	D	0.000140	T	0.45776	0.1359	L	0.55481	1.735	0.39623	D	0.970064	D	0.89917	1.0	D	0.91635	0.999	T	0.48490	-0.9031	10	0.87932	D	0	.	12.9116	0.58182	1.0:0.0:0.0:0.0	.	1017	Q9BXT5	TEX15_HUMAN	H	1017	ENSP00000256246:L1017H	ENSP00000256246:L1017H	L	-	2	0	TEX15	30823026	1.000000	0.71417	0.975000	0.42487	0.931000	0.56810	5.281000	0.65609	2.047000	0.60756	0.383000	0.25322	CTT		0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			29	140	0	0	0	0.007291	0	29	140				
KAT6A	7994	broad.mit.edu	37	8	41791382	41791382	+	Silent	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:41791382C>A	ENST00000396930.3	-	18	4899	c.4356G>T	c.(4354-4356)gcG>gcT	p.A1452A	KAT6A_ENST00000406337.1_Silent_p.A1452A|KAT6A_ENST00000265713.2_Silent_p.A1452A	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1452					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A1452A(1)									GGGTCTGACACGCCGCAAGAG	0.532																																							uc010lxb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(4354-4356)GCG>GCT		MYST histone acetyltransferase (monocytic							125.0	110.0	115.0					8																	41791382		2203	4300	6503	SO:0001819	synonymous_variant	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41791382C>A	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4356G>T	8.37:g.41791382C>A			Somatic				MYST3_uc010lxc.2_Silent_p.A1452A|MYST3_uc003xon.3_Silent_p.A1452A	p.A1452A	NM_001099412	NP_001092882	WXS	Illumina HiSeq	Unspecified	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		18	4900	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	1452					Q76L81	Silent	SNP	ENST00000396930.3	37	c.4356G>T	CCDS6124.1																																																																																				0.532	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		25	148	1	0	3.11337e-16	0.013726	4.53897e-16	25	148				
KCNB2	9312	broad.mit.edu	37	8	73480430	73480430	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:73480430G>T	ENST00000523207.1	+	2	1049	c.461G>T	c.(460-462)cGa>cTa	p.R154L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	154					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.R154L(1)|p.R154Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GAACTGAGGCGAGAGGCAGAG	0.453																																							uc003xzb.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(460-462)CGA>CTA		potassium voltage-gated channel, Shab-related							131.0	138.0	136.0					8																	73480430		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73480430G>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.461G>T	8.37:g.73480430G>T	ENSP00000430846:p.Arg154Leu		Somatic					p.R154L	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		2	1049	+	Breast(64;0.137)		154			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.461G>T	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491273	0.84962	.	.	ENSG00000182674	ENST00000523207	D	0.97114	-4.25	6.07	5.2	0.72013	.	0.000000	0.28082	U	0.016668	D	0.97986	0.9337	M	0.82823	2.61	0.48185	D	0.999608	D	0.59357	0.985	P	0.56751	0.805	D	0.98393	1.0564	10	0.72032	D	0.01	.	15.1772	0.72924	0.068:0.0:0.932:0.0	.	154	Q92953	KCNB2_HUMAN	L	154	ENSP00000430846:R154L	ENSP00000430846:R154L	R	+	2	0	KCNB2	73642984	1.000000	0.71417	0.990000	0.47175	0.869000	0.49853	9.869000	0.99810	1.581000	0.49865	0.655000	0.94253	CGA		0.453	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		36	185	1	0	6.5261e-18	0.00874	9.71898e-18	36	185				
DCAF4L2	138009	broad.mit.edu	37	8	88885425	88885425	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:88885425C>A	ENST00000319675.3	-	1	871	c.775G>T	c.(775-777)Ggc>Tgc	p.G259C		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	259								p.G259C(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CACCCGCTGCCTTGATTTCCA	0.507																																							uc003ydz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(775-777)GGC>TGC		WD repeat domain 21C							122.0	114.0	116.0					8																	88885425		2203	4300	6503	SO:0001583	missense	138009							g.chr8:88885425C>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.775G>T	8.37:g.88885425C>A	ENSP00000316496:p.Gly259Cys		Somatic					p.G259C	NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	872	-			259						Missense_Mutation	SNP	ENST00000319675.3	37	c.775G>T	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592532	0.28357	.	.	ENSG00000176566	ENST00000319675	T	0.22945	1.93	1.92	0.948	0.19561	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.244180	0.48767	D	0.000166	T	0.19967	0.0480	L	0.55103	1.725	0.24669	N	0.993429	B	0.18166	0.026	B	0.23419	0.046	T	0.14309	-1.0477	10	0.46703	T	0.11	.	3.8168	0.08818	0.0:0.7493:0.0:0.2507	.	259	Q8NA75	DC4L2_HUMAN	C	259	ENSP00000316496:G259C	ENSP00000316496:G259C	G	-	1	0	DCAF4L2	88954541	1.000000	0.71417	0.092000	0.20876	0.287000	0.27160	2.325000	0.43840	0.750000	0.32877	0.467000	0.42956	GGC		0.507	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		24	80	1	0	5.35356e-11	0.00278	7.0616e-11	24	80				
MTERF3	51001	broad.mit.edu	37	8	97270732	97270732	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:97270732T>A	ENST00000287025.3	-	2	285	c.187A>T	c.(187-189)Act>Tct	p.T63S	MTERFD1_ENST00000522822.1_5'Flank|MTERFD1_ENST00000523821.1_Missense_Mutation_p.T63S|MTERFD1_ENST00000524341.1_5'Flank	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		63					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.T63S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					AAGGAGGAAGTCCTGTAAGTC	0.433																																							uc003yhs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(187-189)ACT>TCT		MTERF domain containing 1 precursor							129.0	127.0	128.0					8																	97270732		2203	4300	6503	SO:0001583	missense	51001				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding	g.chr8:97270732T>A																												ENST00000287025.3:c.187A>T	8.37:g.97270732T>A	ENSP00000287025:p.Thr63Ser		Somatic				MTERFD1_uc003yhr.1_5'Flank|MTERFD1_uc010mbd.1_Missense_Mutation_p.T63S	p.T63S	NM_015942	NP_057026	WXS	Illumina HiSeq	Unspecified	Q96E29	MTER1_HUMAN			2	265	-	Breast(36;5.16e-05)		63					B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	c.187A>T	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.879262	0.33162	.	.	ENSG00000156469	ENST00000523821;ENST00000287025;ENST00000517720	T;T;T	0.43294	0.95;0.95;0.95	5.78	4.6	0.57074	.	0.209202	0.39759	N	0.001279	T	0.25531	0.0621	L	0.32530	0.975	0.24003	N	0.996202	B;B	0.33318	0.408;0.097	B;B	0.21917	0.037;0.037	T	0.12889	-1.0530	10	0.14252	T	0.57	-7.4725	9.8578	0.41096	0.0:0.0796:0.0:0.9204	.	63;63	E5RIK9;Q96E29	.;MTER1_HUMAN	S	63	ENSP00000429400:T63S;ENSP00000287025:T63S;ENSP00000429526:T63S	ENSP00000287025:T63S	T	-	1	0	MTERFD1	97339908	0.581000	0.26741	0.825000	0.32803	0.503000	0.33858	0.599000	0.24089	0.973000	0.38340	0.528000	0.53228	ACT		0.433	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			23	103	0	0	0	0.00278	0	23	103				
AGO2	27161	broad.mit.edu	37	8	141595310	141595310	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr8:141595310C>G	ENST00000220592.5	-	2	235	c.123G>C	c.(121-123)caG>caC	p.Q41H	AGO2_ENST00000519980.1_Missense_Mutation_p.Q41H|AGO2_ENST00000517293.1_5'UTR	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	41					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)	p.Q41H(1)									AGAAATTGGCCTGTAATTTGA	0.498																																							uc003yvn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(121-123)CAG>CAC		argonaute 2 isoform 1							91.0	91.0	91.0					8																	141595310		2203	4300	6503	SO:0001583	missense	27161				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity	g.chr8:141595310C>G	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.123G>C	8.37:g.141595310C>G	ENSP00000220592:p.Gln41His		Somatic				EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Missense_Mutation_p.Q41H	p.Q41H	NM_012154	NP_036286	WXS	Illumina HiSeq	Unspecified	Q9UKV8	AGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.158)		2	163	-	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	41					Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	c.123G>C	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942249	0.73672	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.10288	2.89;2.89	5.09	5.09	0.68999	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.16854	0.0405	L	0.42245	1.32	0.80722	D	1	P;B	0.36065	0.535;0.159	P;B	0.46110	0.504;0.212	T	0.01198	-1.1421	10	0.66056	D	0.02	-19.4355	12.8806	0.58014	0.0:0.9218:0.0:0.0782	.	41;41	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	H	41	ENSP00000220592:Q41H;ENSP00000430176:Q41H	ENSP00000220592:Q41H	Q	-	3	2	EIF2C2	141664492	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.540000	0.45727	2.363000	0.80096	0.655000	0.94253	CAG		0.498	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			27	88	0	0	0	0.005443	0	27	88				
INSL6	11172	broad.mit.edu	37	9	5185531	5185531	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr9:5185531G>T	ENST00000381641.3	-	1	137	c.72C>A	c.(70-72)agC>agA	p.S24R		NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	24					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.S24R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		TGCTGATGTCGCTCAGTTCAC	0.587																																							uc003zix.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(70-72)AGC>AGA		insulin-like 6 precursor							47.0	43.0	45.0					9																	5185531		2203	4300	6503	SO:0001583	missense	11172					extracellular region	hormone activity	g.chr9:5185531G>T	AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.72C>A	9.37:g.5185531G>T	ENSP00000371054:p.Ser24Arg		Somatic					p.S24R	NM_007179	NP_009110	WXS	Illumina HiSeq	Unspecified	Q9Y581	INSL6_HUMAN		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)	1	88	-	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)	24					A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000381641.3	37	c.72C>A	CCDS6458.1	.	.	.	.	.	.	.	.	.	.	G	8.966	0.971865	0.18736	.	.	ENSG00000120210	ENST00000381641	T	0.48836	0.8	4.25	1.19	0.21007	Insulin-like (2);	1.333270	0.04773	N	0.428304	T	0.34308	0.0893	L	0.41710	1.295	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.13124	-1.0521	10	0.19590	T	0.45	-0.2784	1.8245	0.03118	0.1181:0.1845:0.4577:0.2397	.	24	Q9Y581	INSL6_HUMAN	R	24	ENSP00000371054:S24R	ENSP00000371054:S24R	S	-	3	2	INSL6	5175531	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.314000	0.08092	0.260000	0.21731	-0.145000	0.13849	AGC		0.587	INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051608.3	NM_007179		23	25	1	0	1.5548e-18	0.005443	2.34065e-18	23	25				
KIAA1045	23349	broad.mit.edu	37	9	34977191	34977191	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr9:34977191C>A	ENST00000242315.3	+	6	1043	c.961C>A	c.(961-963)Cac>Aac	p.H321N	KIAA1045_ENST00000544237.1_Missense_Mutation_p.H321N|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	321							metal ion binding (GO:0046872)	p.H321N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCGGGCCCAGCACTCTTGGTT	0.637																																							uc003zvq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(961-963)CAC>AAC		hypothetical protein LOC23349							62.0	68.0	66.0					9																	34977191		1999	4155	6154	SO:0001583	missense	23349						calcium ion binding	g.chr9:34977191C>A	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.961C>A	9.37:g.34977191C>A	ENSP00000242315:p.His321Asn		Somatic				KIAA1045_uc003zvr.2_Missense_Mutation_p.H321N	p.H321N	NM_015297	NP_056112	WXS	Illumina HiSeq	Unspecified	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)		6	1139	+			321					B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	c.961C>A	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729498	0.30684	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	4.72	3.81	0.43845	.	0.133751	0.51477	D	0.000084	T	0.39306	0.1073	L	0.29908	0.895	0.33176	D	0.548998	B	0.02656	0.0	B	0.08055	0.003	T	0.47649	-0.9101	9	0.38643	T	0.18	-7.3968	11.4688	0.50254	0.192:0.808:0.0:0.0	.	321	Q9UPV7	K1045_HUMAN	N	321	.	ENSP00000242315:H321N	H	+	1	0	KIAA1045	34967191	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	3.900000	0.56295	1.168000	0.42723	0.655000	0.94253	CAC		0.637	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592		35	72	1	0	4.44401e-20	0.010771	6.83884e-20	35	72				
CXorf22	170063	broad.mit.edu	37	X	35993959	35993959	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:35993959G>T	ENST00000297866.5	+	15	2708	c.2642G>T	c.(2641-2643)tGt>tTt	p.C881F		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	881								p.C881F(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CGTCAGAATTGTTGTGCTCAG	0.383																																							uc004ddj.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)	3						c.(2641-2643)TGT>TTT		hypothetical protein LOC170063							171.0	153.0	159.0					X																	35993959		2202	4300	6502	SO:0001583	missense	170063							g.chrX:35993959G>T	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2642G>T	X.37:g.35993959G>T	ENSP00000297866:p.Cys881Phe		Somatic				CXorf22_uc010ngv.2_RNA	p.C881F	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			15	2701	+			881					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.2642G>T	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.897356	0.00517	.	.	ENSG00000165164	ENST00000297866	T	0.13657	2.57	5.14	-4.8	0.03190	.	0.790877	0.12264	N	0.484488	T	0.08492	0.0211	L	0.47716	1.5	0.09310	N	1	B	0.27559	0.181	B	0.23150	0.044	T	0.41893	-0.9483	10	0.10902	T	0.67	1.5937	7.7904	0.29116	0.6341:0.0:0.2565:0.1094	.	881	Q6ZTR5	CX022_HUMAN	F	881	ENSP00000297866:C881F	ENSP00000297866:C881F	C	+	2	0	CXorf22	35903880	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.115000	0.15540	-1.193000	0.02688	-0.191000	0.12829	TGT		0.383	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		61	74	1	0	6.2918e-36	0.01441	1.10306e-35	61	74				
RBM10	8241	broad.mit.edu	37	X	47034492	47034492	+	Splice_Site	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:47034492G>T	ENST00000377604.3	+	6	1318		c.e6+1		RBM10_ENST00000329236.7_Splice_Site|RBM10_ENST00000345781.6_Splice_Site	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10						3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.?(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						AGCCAATCAGGTTGCTTTGCC	0.542																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.e6+1		RNA binding motif protein 10 isoform 1							89.0	76.0	80.0					X																	47034492		2203	4300	6503	SO:0001630	splice_region_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47034492G>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.576+1G>T	X.37:g.47034492G>T			Somatic				RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Splice_Site_p.Q115_splice|RBM10_uc004dhh.2_Splice_Site_p.Q192_splice|RBM10_uc010nhq.2_Splice_Site_p.Q115_splice|RBM10_uc004dhi.2_Splice_Site_p.Q257_splice	p.Q192_splice	NM_005676	NP_005667	WXS	Illumina HiSeq	Unspecified	P98175	RBM10_HUMAN			6	955	+								C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Splice_Site	SNP	ENST00000377604.3	37	c.576_splice	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.167019	0.57476	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9343	0.64015	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM10	46919436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.465000	0.97660	1.947000	0.56498	0.525000	0.51046	.		0.542	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	Intron	24	20	1	0	1.08312e-15	0.009535	1.56263e-15	24	20				
TSPYL2	64061	broad.mit.edu	37	X	53114870	53114870	+	Silent	SNP	A	A	C			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:53114870A>C	ENST00000375442.4	+	6	1428	c.1296A>C	c.(1294-1296)gcA>gcC	p.A432A		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	432					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)	p.A432A(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						ACTATTATGCAGTGGAAGACA	0.488																																							uc004drw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1294-1296)GCA>GCC		TSPY-like 2							120.0	100.0	107.0					X																	53114870		2203	4300	6503	SO:0001819	synonymous_variant	64061				cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding	g.chrX:53114870A>C	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1296A>C	X.37:g.53114870A>C			Somatic				TSPYL2_uc004drv.2_3'UTR|TSPYL2_uc004drx.1_Silent_p.A37A	p.A432A	NM_022117	NP_071400	WXS	Illumina HiSeq	Unspecified	Q9H2G4	TSYL2_HUMAN			6	1428	+			432					O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	37	c.1296A>C	CCDS14350.1																																																																																				0.488	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117		31	43	0	0	0	0.013726	0	31	43				
TCEAL2	140597	broad.mit.edu	37	X	101382384	101382384	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:101382384G>T	ENST00000372780.1	+	3	801	c.582G>T	c.(580-582)atG>atT	p.M194I	TCEAL2_ENST00000329035.2_Missense_Mutation_p.M194I	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.M194I(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						TTTTGTGGATGCAAAGAAATT	0.463																																							uc004eip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(580-582)ATG>ATT		transcription elongation factor A (SII)-like 2							99.0	105.0	103.0					X																	101382384		2203	4300	6503	SO:0001583	missense	140597				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:101382384G>T	AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.582G>T	X.37:g.101382384G>T	ENSP00000361866:p.Met194Ile		Somatic					p.M194I	NM_080390	NP_525129	WXS	Illumina HiSeq	Unspecified	Q9H3H9	TCAL2_HUMAN			3	801	+			194					B2R5C7	Missense_Mutation	SNP	ENST00000372780.1	37	c.582G>T	CCDS14496.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061352	0.55432	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.09817	2.94;2.94	3.35	2.47	0.30058	.	0.119549	0.39407	N	0.001369	T	0.18045	0.0433	M	0.71581	2.175	0.24601	N	0.993777	P	0.51449	0.945	P	0.51701	0.677	T	0.04041	-1.0982	10	0.48119	T	0.1	.	6.1385	0.20247	0.1475:0.0:0.8525:0.0	.	194	Q9H3H9	TCAL2_HUMAN	I	194	ENSP00000361866:M194I;ENSP00000332359:M194I	ENSP00000332359:M194I	M	+	3	0	TCEAL2	101269040	0.989000	0.36119	0.933000	0.37362	0.996000	0.88848	0.408000	0.21065	0.769000	0.33313	0.594000	0.82650	ATG		0.463	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057605.1	NM_080390		68	122	1	0	1.07941e-43	0.01441	1.95423e-43	68	122				
GLRA4	441509	broad.mit.edu	37	X	102979534	102979534	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:102979534G>T	ENST00000372617.4	-	3	625	c.205C>A	c.(205-207)Cca>Aca	p.P69T	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	69						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.P69T(2)		cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TTCACGGGTGGGCCTGAGGGT	0.582																																							uc011mse.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(205-207)CCA>ACA		glycine receptor, alpha 4 precursor							82.0	82.0	82.0					X																	102979534		2100	4221	6321	SO:0001583	missense	441509					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chrX:102979534G>T	Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.205C>A	X.37:g.102979534G>T	ENSP00000361700:p.Pro69Thr		Somatic				GLRA4_uc010nou.2_Missense_Mutation_p.P69T	p.P69T	NM_001024452	NP_001019623	WXS	Illumina HiSeq	Unspecified	Q5JXX5	GLRA4_HUMAN			3	626	-			69			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000372617.4	37	c.205C>A	CCDS43980.2	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819596	0.50633	.	.	ENSG00000188828	ENST00000372617	T	0.78816	-1.21	5.79	4.9	0.64082	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.73087	0.3542	L	0.48986	1.54	0.48696	D	0.999694	B;P	0.36712	0.099;0.566	B;B	0.38921	0.285;0.285	T	0.76484	-0.2942	10	0.87932	D	0	.	11.1918	0.48690	0.0:0.0:0.8185:0.1815	.	69;28	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	T	69	ENSP00000361700:P69T	ENSP00000361700:P69T	P	-	1	0	GLRA4	102866190	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.497000	0.73674	2.440000	0.82611	0.529000	0.55759	CCA		0.582	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057742.2	NM_001024452		7	18	1	0	0.000157383	0.00308	0.000175081	7	18				
DCAF12L2	340578	broad.mit.edu	37	X	125299021	125299021	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:125299021G>T	ENST00000360028.2	-	1	913	c.887C>A	c.(886-888)tCc>tAc	p.S296Y	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.S296Y			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	296								p.S296Y(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CAGGAGCCTGGATAGTGTGCT	0.612																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(886-888)TCC>TAC		DDB1 and CUL4 associated factor 12-like 2							89.0	93.0	92.0					X																	125299021		2203	4299	6502	SO:0001583	missense	340578							g.chrX:125299021G>T	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.887C>A	X.37:g.125299021G>T	ENSP00000353128:p.Ser296Tyr		Somatic					p.S296Y	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	914	-			296			WD 3.		B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.887C>A	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297062	0.23650	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.64991	-0.13;-0.13	3.95	3.07	0.35406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.222715	0.23137	N	0.051516	T	0.62708	0.2450	M	0.74258	2.255	0.34742	D	0.73087	P	0.42123	0.771	B	0.43575	0.424	T	0.73228	-0.4049	10	0.66056	D	0.02	.	8.3563	0.32331	0.0:0.255:0.745:0.0	.	296	Q5VW00	DC122_HUMAN	Y	296	ENSP00000441489:S296Y;ENSP00000353128:S296Y	ENSP00000353128:S296Y	S	-	2	0	DCAF12L2	125126702	1.000000	0.71417	0.998000	0.56505	0.182000	0.23217	1.738000	0.38207	1.003000	0.39130	0.544000	0.68410	TCC		0.612	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		46	82	1	0	4.48484e-38	0.01441	8.06688e-38	46	82				
DCAF12L2	340578	broad.mit.edu	37	X	125299047	125299047	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:125299047G>T	ENST00000360028.2	-	1	887	c.861C>A	c.(859-861)caC>caA	p.H287Q	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.H287Q			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	287								p.H287Q(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CTTTCCACAGGTGGAAGTAGC	0.617																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(859-861)CAC>CAA		DDB1 and CUL4 associated factor 12-like 2							74.0	78.0	77.0					X																	125299047		2203	4300	6503	SO:0001583	missense	340578							g.chrX:125299047G>T	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.861C>A	X.37:g.125299047G>T	ENSP00000353128:p.His287Gln		Somatic					p.H287Q	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	888	-			287			WD 3.		B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.861C>A	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021238	0.54576	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.63096	-0.02;-0.02	3.95	3.95	0.45737	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.38272	N	0.001753	T	0.77170	0.4091	M	0.81497	2.545	0.36958	D	0.893196	D	0.76494	0.999	D	0.83275	0.996	T	0.81833	-0.0751	10	0.54805	T	0.06	.	10.422	0.44356	0.0:0.0:1.0:0.0	.	287	Q5VW00	DC122_HUMAN	Q	287	ENSP00000441489:H287Q;ENSP00000353128:H287Q	ENSP00000353128:H287Q	H	-	3	2	DCAF12L2	125126728	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	1.369000	0.34227	2.218000	0.71995	0.544000	0.68410	CAC		0.617	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		43	82	1	0	1.0331e-37	0.01441	1.84624e-37	43	82				
PVRL4	81607	broad.mit.edu	37	1	161049685	161049685	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr1:161049685delC	ENST00000368012.3	-	2	436	c.134delG	c.(133-135)ggcfs	p.G45fs		NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	45	Ig-like V-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGCGTCCTGGCCCAGCACCAC	0.677																																					NSCLC(76;1160 1387 14476 16172 29359)	NSCLC(76;1160 1387 14476 16172 29359)	uc001fxo.2		NA																	0				ovary(2)	2						c.(133-135)GGCfs		poliovirus receptor-related 4 precursor							48.0	51.0	50.0					1																	161049685		2203	4300	6503	SO:0001589	frameshift_variant	81607				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane		g.chr1:161049685delC	AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.134delG	1.37:g.161049685delC	ENSP00000356991:p.Gly45fs		Somatic					p.G45fs	NM_030916	NP_112178	WXS	Illumina HiSeq	Unspecified	Q96NY8	PVRL4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00165)		2	433	-	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		45			Ig-like V-type 1.|Extracellular (Potential).		B4DQW3|Q96K15	Frame_Shift_Del	DEL	ENST00000368012.3	37	c.134delG	CCDS1216.1																																																																																				0.677	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916		24	124	NA	NA	NA	NA	NA	24	124	---	---	---	---
ZNF521	25925	broad.mit.edu	37	18	22902131	22902131	+	Frame_Shift_Del	DEL	C	C	-	rs7235917		TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr18:22902131delC	ENST00000361524.3	-	3	209	c.61delG	c.(61-63)gacfs	p.D21fs	ZNF521_ENST00000584787.1_5'UTR|ZNF521_ENST00000538137.2_Frame_Shift_Del_p.D21fs|ZNF521_ENST00000579111.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	21					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCAGTCTTGTCTTCAAGTTTA	0.433			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(61-63)GACfs		zinc finger protein 521							120.0	118.0	119.0					18																	22902131		2203	4300	6503	SO:0001589	frameshift_variant	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22902131delC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.61delG	18.37:g.22902131delC	ENSP00000354794:p.Asp21fs		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Frame_Shift_Del_p.D21fs|ZNF521_uc002kvl.2_5'UTR	p.D21fs	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			3	308	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		21					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Frame_Shift_Del	DEL	ENST00000361524.3	37	c.61delG	CCDS32806.1																																																																																				0.433	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		30	163	NA	NA	NA	NA	NA	30	163	---	---	---	---
GZMK	3003	broad.mit.edu	37	5	54320167	54320167	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr5:54320167delC	ENST00000231009.2	+	1	87	c.17delC	c.(16-18)tccfs	p.S6fs	CTD-2313F11.1_ENST00000371487.3_RNA|ESM1_ENST00000598310.1_5'Flank|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000607910.1_RNA|CTD-2313F11.1_ENST00000596909.2_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	6						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AAGTTTTCTTCCTTTTCTCTG	0.318																																							uc003jpl.1		NA																	0					0						c.(16-18)TCCfs		granzyme K precursor							123.0	121.0	122.0					5																	54320167		2201	4300	6501	SO:0001589	frameshift_variant	3003				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr5:54320167delC	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.17delC	5.37:g.54320167delC	ENSP00000231009:p.Ser6fs		Somatic					p.S6fs	NM_002104	NP_002095	WXS	Illumina HiSeq	Unspecified	P49863	GRAK_HUMAN			1	61	+		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)	6					B2R563	Frame_Shift_Del	DEL	ENST00000231009.2	37	c.17delC	CCDS3964.1																																																																																				0.318	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104		19	45	NA	NA	NA	NA	NA	19	45	---	---	---	---
OR2A5	393046	broad.mit.edu	37	7	143748258	143748258	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chr7:143748258delC	ENST00000408906.2	+	1	798	c.764delC	c.(763-765)gccfs	p.A255fs		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	255			A -> T (in dbSNP:rs6464574).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TTTGGCAGCGCCATTGTCATG	0.587																																							uc011ktw.1		NA																	0				ovary(3)	3						c.(763-765)GCCfs		olfactory receptor, family 2, subfamily A,							95.0	95.0	95.0					7																	143748258		2026	4187	6213	SO:0001589	frameshift_variant	393046				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143748258delC	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.764delC	7.37:g.143748258delC	ENSP00000386208:p.Ala255fs		Somatic					p.A255fs	NM_012365	NP_036497	WXS	Illumina HiSeq	Unspecified	Q96R48	OR2A5_HUMAN			1	764	+	Melanoma(164;0.0783)		255			Helical; Name=6; (Potential).		B9EGX2|O43885|O43888	Frame_Shift_Del	DEL	ENST00000408906.2	37	c.764delC	CCDS43668.1																																																																																				0.587	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1			138	152	NA	NA	NA	NA	NA	138	152	---	---	---	---
MAGEA3	4102	broad.mit.edu	37	X	151935379	151935379	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4494-01A-01D-1265-08	TCGA-49-4494-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	136bc973-1908-4767-9b22-d43d522b7c71	417cd2e0-404a-4820-be10-b02d26fe89fd	g.chrX:151935379delC	ENST00000393902.3	-	3	1355	c.788delG	c.(787-789)ggcfs	p.G263fs	MAGEA3_ENST00000370278.3_Frame_Shift_Del_p.G263fs			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	263	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					AGGATCACTGCCGGGGACCTG	0.527																																							uc004fgp.2		NA																	0					0						c.(787-789)GGCfs		melanoma antigen family A, 3							106.0	107.0	107.0					X																	151935379		2202	4294	6496	SO:0001589	frameshift_variant	4102							g.chrX:151935379delC		CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.788delG	X.37:g.151935379delC	ENSP00000377480:p.Gly263fs		Somatic					p.G263fs	NM_005362	NP_005353	WXS	Illumina HiSeq	Unspecified	P43357	MAGA3_HUMAN			3	997	-	Acute lymphoblastic leukemia(192;6.56e-05)		263			MAGE.		Q6FHI6	Frame_Shift_Del	DEL	ENST00000393902.3	37	c.788delG	CCDS14715.1																																																																																				0.527	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	NM_005362		39	92	NA	NA	NA	NA	NA	39	92	---	---	---	---
