#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CLCN6	1185	broad.mit.edu	37	1	11896114	11896114	+	Silent	SNP	G	G	A	rs368128231	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:11896114G>A	ENST00000346436.6	+	18	1936	c.1884G>A	c.(1882-1884)acG>acA	p.T628T	CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376496.3_Silent_p.T628T|CLCN6_ENST00000376487.3_Silent_p.T606T	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	628	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.T628T(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TGCGCACCACGGTCCACCATG	0.582													G|||	8	0.00159744	0.0	0.0	5008	,	,		19100	0.0		0.0	False		,,,				2504	0.0082						uc001ate.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1882-1884)ACG>ACA		chloride channel 6 isoform ClC-6a							143.0	104.0	118.0					1																	11896114		2203	4300	6503	SO:0001819	synonymous_variant	1185				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity	g.chr1:11896114G>A	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1884G>A	1.37:g.11896114G>A			Somatic				CLCN6_uc010oat.1_Silent_p.T344T|CLCN6_uc010oau.1_Silent_p.T606T	p.T628T	NM_001286	NP_001277	WXS	Illumina HiSeq	Unspecified	P51797	CLCN6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	18	1997	+	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	628			Cytoplasmic (By similarity).|CBS 1.		A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Silent	SNP	ENST00000346436.6	37	c.1884G>A	CCDS138.1																																																																																				0.582	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286		3	20	0	0	0	0.004672	0	3	20				
ERICH3	127254	broad.mit.edu	37	1	75065513	75065513	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:75065513A>G	ENST00000326665.5	-	11	1810	c.1592T>C	c.(1591-1593)tTg>tCg	p.L531S	C1orf173_ENST00000420661.2_Missense_Mutation_p.L334S|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		531	Glu-rich.							p.L531S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TTTATCATCCAAAGGTGACTG	0.388																																							uc001dgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(1591-1593)TTG>TCG		hypothetical protein LOC127254							233.0	231.0	232.0					1																	75065513		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75065513A>G																												ENST00000326665.5:c.1592T>C	1.37:g.75065513A>G	ENSP00000322609:p.Leu531Ser		Somatic				uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.L325S	p.L531S	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			11	1811	-			531			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.1592T>C	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.333203	0.00227	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.14266	2.98;2.52	6.05	4.18	0.49190	.	.	.	.	.	T	0.01320	0.0043	N	0.01874	-0.695	0.26581	N	0.973384	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.45585	-0.9251	9	0.07813	T	0.8	-4.755	11.889	0.52618	0.1415:0.0:0.8585:0.0	.	334;531	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	S	531;334	ENSP00000322609:L531S;ENSP00000398581:L334S	ENSP00000322609:L531S	L	-	2	0	C1orf173	74838101	1.000000	0.71417	0.994000	0.49952	0.002000	0.02628	2.532000	0.45659	0.882000	0.36016	-0.248000	0.11899	TTG		0.388	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			6	176	0	0	0	0.001984	0	6	176				
S1PR1	1901	broad.mit.edu	37	1	101705215	101705215	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:101705215C>A	ENST00000305352.6	+	2	1050	c.675C>A	c.(673-675)taC>taA	p.Y225*		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	225					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.Y225*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						GCAGAATCTACTCCTTGGTCA	0.567																																							uc001dud.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(1)	3						c.(673-675)TAC>TAA		sphingosine-1-phosphate receptor 1							103.0	99.0	100.0					1																	101705215		2203	4300	6503	SO:0001587	stop_gained	1901				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity	g.chr1:101705215C>A	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.675C>A	1.37:g.101705215C>A	ENSP00000305416:p.Tyr225*		Somatic				S1PR1_uc009weg.2_Nonsense_Mutation_p.Y225*	p.Y225*	NM_001400	NP_001391	WXS	Illumina HiSeq	Unspecified	P21453	S1PR1_HUMAN			2	1189	+			225			Cytoplasmic (By similarity).		D3DT66|Q9BYY4|Q9NYN8	Nonsense_Mutation	SNP	ENST00000305352.6	37	c.675C>A	CCDS777.1	.	.	.	.	.	.	.	.	.	.	C	38	6.757223	0.97817	.	.	ENSG00000170989	ENST00000305352;ENST00000424264	.	.	.	5.28	3.04	0.35103	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9805	0.58562	0.0:0.8459:0.0:0.1541	.	.	.	.	X	225	.	ENSP00000305416:Y225X	Y	+	3	2	S1PR1	101477803	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.593000	0.36686	1.227000	0.43598	0.449000	0.29647	TAC		0.567	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400		15	61	1	0	4.7546e-09	0.004007	6.85548e-09	15	61				
LCE1F	353137	broad.mit.edu	37	1	152748899	152748899	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:152748899C>A	ENST00000334371.2	+	1	52	c.52C>A	c.(52-54)Ccc>Acc	p.P18T		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	18	Pro-rich.				keratinization (GO:0031424)			p.P18T(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			caagtgcactcccaagtgccc	0.632																																							uc010pdv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(52-54)CCC>ACC		late cornified envelope 1F							59.0	59.0	59.0					1																	152748899		2203	4300	6503	SO:0001583	missense	353137				keratinization			g.chr1:152748899C>A		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.52C>A	1.37:g.152748899C>A	ENSP00000334187:p.Pro18Thr		Somatic					p.P18T	NM_178354	NP_848131	WXS	Illumina HiSeq	Unspecified	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	52	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		18			Pro-rich.			Missense_Mutation	SNP	ENST00000334371.2	37	c.52C>A	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	C	8.263	0.811515	0.16537	.	.	ENSG00000240386	ENST00000334371	T	0.06768	3.26	4.36	4.36	0.52297	.	0.000000	0.33631	U	0.004716	T	0.17280	0.0415	M	0.74647	2.275	0.23780	N	0.996865	D	0.89917	1.0	D	0.83275	0.996	T	0.00981	-1.1492	10	0.87932	D	0	.	12.5755	0.56362	0.0:1.0:0.0:0.0	.	18	Q5T754	LCE1F_HUMAN	T	18	ENSP00000334187:P18T	ENSP00000334187:P18T	P	+	1	0	LCE1F	151015523	0.572000	0.26668	0.929000	0.37066	0.434000	0.31775	0.863000	0.27913	2.405000	0.81733	0.563000	0.77884	CCC		0.632	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		17	72	1	0	8.34094e-07	0.008871	1.12421e-06	17	72				
LCE1F	353137	broad.mit.edu	37	1	152749165	152749165	+	Silent	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:152749165C>T	ENST00000334371.2	+	1	318	c.318C>T	c.(316-318)tgC>tgT	p.C106C		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	106					keratinization (GO:0031424)			p.C106C(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGCTGCTGCGGAGGGGGCA	0.627																																							uc010pdv.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(316-318)TGC>TGT		late cornified envelope 1F							35.0	40.0	38.0					1																	152749165		2201	4296	6497	SO:0001819	synonymous_variant	353137				keratinization			g.chr1:152749165C>T		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.318C>T	1.37:g.152749165C>T			Somatic					p.C106C	NM_178354	NP_848131	WXS	Illumina HiSeq	Unspecified	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	318	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		106						Silent	SNP	ENST00000334371.2	37	c.318C>T	CCDS1023.1																																																																																				0.627	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		8	40	0	0	0	0.00245	0	8	40				
HCN3	57657	broad.mit.edu	37	1	155257693	155257693	+	Silent	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:155257693G>T	ENST00000368358.3	+	8	1772	c.1764G>T	c.(1762-1764)cgG>cgT	p.R588R	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	588					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.R588R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTCGGGGTCGGGCCCCGAGCA	0.617																																							uc001fjz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(1762-1764)CGG>CGT		hyperpolarization activated cyclic							47.0	47.0	47.0					1																	155257693		2203	4300	6503	SO:0001819	synonymous_variant	57657					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr1:155257693G>T	AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1764G>T	1.37:g.155257693G>T			Somatic				RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Silent_p.R283R	p.R588R	NM_020897	NP_065948	WXS	Illumina HiSeq	Unspecified	Q9P1Z3	HCN3_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		8	1772	+	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		588			Cytoplasmic (Potential).		D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Silent	SNP	ENST00000368358.3	37	c.1764G>T	CCDS1108.1																																																																																				0.617	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1	NM_020897		10	53	1	0	0.000673444	0.008291	0.000787802	10	53				
ASH1L	55870	broad.mit.edu	37	1	155408569	155408569	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:155408569G>A	ENST00000368346.3	-	5	6016	c.5377C>T	c.(5377-5379)Cat>Tat	p.H1793Y	ASH1L_ENST00000392403.3_Missense_Mutation_p.H1793Y			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1793					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.H1793Y(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTGATATGATGGGGGGAACAG	0.443																																							uc009wqq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(5377-5379)CAT>TAT		absent, small, or homeotic 1-like							121.0	118.0	119.0					1																	155408569		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155408569G>A	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5377C>T	1.37:g.155408569G>A	ENSP00000357330:p.His1793Tyr		Somatic				ASH1L_uc001fkt.2_Missense_Mutation_p.H1793Y	p.H1793Y	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		5	5857	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		1793					Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.5377C>T		.	.	.	.	.	.	.	.	.	.	G	14.35	2.509371	0.44660	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89123	-2.47;-2.47	4.94	4.94	0.65067	.	0.062114	0.64402	D	0.000004	T	0.75803	0.3899	N	0.14661	0.345	0.80722	D	1	B;B	0.29716	0.165;0.255	B;B	0.29353	0.047;0.101	T	0.78041	-0.2359	10	0.66056	D	0.02	.	18.3157	0.90220	0.0:0.0:1.0:0.0	.	1793;1793	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	Y	1793	ENSP00000357330:H1793Y;ENSP00000376204:H1793Y	ENSP00000357330:H1793Y	H	-	1	0	ASH1L	153675193	0.390000	0.25213	0.978000	0.43139	0.100000	0.18952	3.734000	0.55037	2.735000	0.93741	0.655000	0.94253	CAT		0.443	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		13	157	0	0	0	0.001855	0	13	157				
UBQLN4	56893	broad.mit.edu	37	1	156020169	156020169	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:156020169C>T	ENST00000368309.3	-	4	746	c.654G>A	c.(652-654)atG>atA	p.M218I	UBQLN4_ENST00000472638.1_Intron	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	218					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)	p.M218I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					TGGCCATAATCATGTGACGCA	0.522																																							uc001fna.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(652-654)ATG>ATA		ataxin-1 ubiquitin-like interacting protein							177.0	154.0	162.0					1																	156020169		2203	4300	6503	SO:0001583	missense	56893					cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding	g.chr1:156020169C>T	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.654G>A	1.37:g.156020169C>T	ENSP00000357292:p.Met218Ile		Somatic				UBQLN4_uc010pgx.1_Missense_Mutation_p.M198I	p.M218I	NM_020131	NP_064516	WXS	Illumina HiSeq	Unspecified	Q9NRR5	UBQL4_HUMAN			4	678	-	Hepatocellular(266;0.133)|all_neural(408;0.195)		218					A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	ENST00000368309.3	37	c.654G>A	CCDS1127.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124270	0.56613	.	.	ENSG00000160803	ENST00000368309	T	0.28454	1.61	4.49	4.49	0.54785	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.11196	0.0273	N	0.16903	0.455	0.80722	D	1	B;B	0.24823	0.112;0.112	B;B	0.27715	0.038;0.082	T	0.06427	-1.0827	10	0.30078	T	0.28	-27.5016	15.9589	0.79910	0.0:1.0:0.0:0.0	.	198;218	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	I	218	ENSP00000357292:M218I	ENSP00000357292:M218I	M	-	3	0	UBQLN4	154286793	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.734000	0.62043	2.342000	0.79632	0.561000	0.74099	ATG		0.522	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131		47	112	0	0	0	0.00361	0	47	112				
SPTA1	6708	broad.mit.edu	37	1	158632684	158632684	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:158632684G>T	ENST00000368147.4	-	17	2452	c.2272C>A	c.(2272-2274)Cat>Aat	p.H758N		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	758					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.H758N(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GAATCAGGATGGCCTATTTCT	0.438																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2272-2274)CAT>AAT		spectrin, alpha, erythrocytic 1							83.0	80.0	81.0					1																	158632684		1879	4101	5980	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158632684G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2272C>A	1.37:g.158632684G>T	ENSP00000357129:p.His758Asn		Somatic					p.H758N	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			17	2471	-	all_hematologic(112;0.0378)		758			Spectrin 8.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2272C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508515	0.44660	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.36520	1.25;1.25	4.41	4.41	0.53225	.	0.000000	0.33057	N	0.005324	T	0.48677	0.1513	M	0.79475	2.455	0.48511	D	0.999661	D	0.56287	0.975	D	0.63877	0.919	T	0.48007	-0.9072	10	0.40728	T	0.16	.	13.8662	0.63590	0.0:0.0:1.0:0.0	.	758	P02549	SPTA1_HUMAN	N	758	ENSP00000357130:H758N;ENSP00000357129:H758N	ENSP00000357129:H758N	H	-	1	0	SPTA1	156899308	1.000000	0.71417	0.608000	0.28969	0.116000	0.19942	8.615000	0.90920	2.270000	0.75569	0.655000	0.94253	CAT		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		11	71	1	0	3.86212e-05	0.008291	4.78903e-05	11	71				
SEC16B	89866	broad.mit.edu	37	1	177930770	177930770	+	Missense_Mutation	SNP	G	G	A	rs199920429	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:177930770G>A	ENST00000308284.6	-	6	831	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	SEC16B_ENST00000464631.2_Missense_Mutation_p.R248W|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	248					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.R248W(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GGATCATCCCGCTCCGGGGCA	0.537													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18298	0.0		0.001	False		,,,				2504	0.0						uc001gli.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(742-744)CGG>TGG		leucine zipper transcription regulator 2							47.0	48.0	48.0					1																	177930770		1919	4148	6067	SO:0001583	missense	89866				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		g.chr1:177930770G>A	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.742C>T	1.37:g.177930770G>A	ENSP00000308339:p.Arg248Trp		Somatic				SEC16B_uc001glk.1_5'UTR|SEC16B_uc001glh.1_5'Flank|SEC16B_uc009wwz.1_5'UTR|SEC16B_uc001glj.1_Missense_Mutation_p.R248W|SEC16B_uc001gll.3_Missense_Mutation_p.R248W	p.R248W	NM_033127	NP_149118	WXS	Illumina HiSeq	Unspecified	Q96JE7	SC16B_HUMAN			6	832	-			248					A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	c.742C>T	CCDS44281.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	13.54	2.267931	0.40095	.	.	ENSG00000120341	ENST00000308284;ENST00000464631	T;T	0.45276	2.49;0.9	5.79	4.87	0.63330	.	1.279200	0.05006	N	0.470062	T	0.31136	0.0787	N	0.08118	0	0.27518	N	0.951491	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.30592	-0.9973	10	0.38643	T	0.18	2.3658	15.1375	0.72579	0.0:0.1404:0.8596:0.0	.	248;248;248	E9PK14;B1AM08;Q96JE7	.;.;SC16B_HUMAN	W	248	ENSP00000308339:R248W;ENSP00000431727:R248W	ENSP00000308339:R248W	R	-	1	2	AL359075.1	176197393	0.018000	0.18449	0.334000	0.25495	0.003000	0.03518	1.519000	0.35888	1.421000	0.47157	0.650000	0.86243	CGG		0.537	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		7	76	0	0	0	0.001984	0	7	76				
TDRD5	163589	broad.mit.edu	37	1	179604812	179604812	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:179604812C>A	ENST00000367614.1	+	9	1669	c.1310C>A	c.(1309-1311)aCa>aAa	p.T437K	TDRD5_ENST00000294848.8_Missense_Mutation_p.T437K|TDRD5_ENST00000444136.1_Missense_Mutation_p.T437K	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	437					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.T437K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAAGTAGAAACAAACAAATCA	0.393																																							uc001gnf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(1309-1311)ACA>AAA		tudor domain containing 5							47.0	45.0	46.0					1																	179604812		2203	4300	6503	SO:0001583	missense	163589				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding	g.chr1:179604812C>A	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1310C>A	1.37:g.179604812C>A	ENSP00000356586:p.Thr437Lys		Somatic				TDRD5_uc010pnp.1_Missense_Mutation_p.T437K|TDRD5_uc001gnh.1_5'UTR	p.T437K	NM_173533	NP_775804	WXS	Illumina HiSeq	Unspecified	Q8NAT2	TDRD5_HUMAN			9	1560	+			437					A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	c.1310C>A	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	C	7.952	0.745109	0.15710	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.12255	2.7;2.7;2.87	4.94	-0.202	0.13208	.	1.247630	0.05187	N	0.502435	T	0.08044	0.0201	N	0.19112	0.55	0.09310	N	1	B;B	0.16166	0.016;0.015	B;B	0.20384	0.029;0.009	T	0.34650	-0.9820	10	0.05833	T	0.94	-1.1887	7.5642	0.27868	0.0:0.4006:0.0:0.5994	.	437;437	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	K	437	ENSP00000356586:T437K;ENSP00000294848:T437K;ENSP00000406052:T437K	ENSP00000294848:T437K	T	+	2	0	TDRD5	177871435	0.001000	0.12720	0.001000	0.08648	0.042000	0.13812	0.552000	0.23376	-0.019000	0.14055	-0.438000	0.05819	ACA		0.393	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		8	29	1	0	5.4927e-09	0.004482	7.85879e-09	8	29				
NFASC	23114	broad.mit.edu	37	1	204937421	204937421	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:204937421G>A	ENST00000401399.1	+	8	950	c.751G>A	c.(751-753)Ggc>Agc	p.G251S	NFASC_ENST00000539706.1_Missense_Mutation_p.G262S|NFASC_ENST00000339876.6_Missense_Mutation_p.G251S|NFASC_ENST00000367172.4_Missense_Mutation_p.G251S|NFASC_ENST00000513543.1_Missense_Mutation_p.G262S|NFASC_ENST00000367170.4_Missense_Mutation_p.G251S|NFASC_ENST00000367171.4_Missense_Mutation_p.G251S|NFASC_ENST00000360049.4_Missense_Mutation_p.G262S|NFASC_ENST00000404907.1_Missense_Mutation_p.G262S|NFASC_ENST00000403080.1_Missense_Mutation_p.G251S|NFASC_ENST00000367169.4_Missense_Mutation_p.G251S|NFASC_ENST00000338586.6_Missense_Mutation_p.G251S|NFASC_ENST00000338515.6_Missense_Mutation_p.G251S|NFASC_ENST00000404076.1_Missense_Mutation_p.G245S			O94856	NFASC_HUMAN	neurofascin	251	Ig-like C2-type 3.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.G251S(2)|p.G262S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GTATCCCCAGGGCACCGCGAG	0.582																																							uc001hbj.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(751-753)GGC>AGC		neurofascin isoform 1 precursor							128.0	111.0	117.0					1																	204937421		2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204937421G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.751G>A	1.37:g.204937421G>A	ENSP00000385637:p.Gly251Ser		Somatic				NFASC_uc001hbh.2_Missense_Mutation_p.G251S|NFASC_uc010pqz.1_Missense_Mutation_p.G245S|NFASC_uc010pra.1_Missense_Mutation_p.G262S|NFASC_uc001hbi.2_Missense_Mutation_p.G262S|NFASC_uc009xbg.1_Missense_Mutation_p.G335S|NFASC_uc010prb.1_Missense_Mutation_p.G262S|NFASC_uc010prc.1_5'UTR|NFASC_uc001hbk.1_Missense_Mutation_p.G72S	p.G251S	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		9	1079	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		251			Extracellular (Potential).|Ig-like C2-type 3.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.751G>A	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659288	0.88154	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72505	-0.18;-0.24;-0.16;-0.16;-0.16;-0.16;-0.08;-0.06;-0.14;2.74;-0.66;-0.2;-0.16;-0.08;-0.06;-0.05	5.3	5.3	0.74995	.	0.000000	0.56097	D	0.000040	T	0.77452	0.4132	L	0.43152	1.355	0.80722	D	1	B;P;P;P;D;B;B	0.63880	0.232;0.698;0.843;0.531;0.993;0.248;0.061	B;B;B;B;P;B;B	0.61592	0.267;0.351;0.41;0.271;0.891;0.421;0.267	T	0.77816	-0.2447	10	0.49607	T	0.09	.	16.7273	0.85426	0.0:0.0:1.0:0.0	.	262;262;347;251;251;262;251	O94856-11;O94856-8;B4DRH7;F8W791;O94856-9;O94856-3;O94856-2	.;.;.;.;.;.;.	S	251;251;251;251;251;251;262;262;262;251;251;251;245;251;262;262;238	ENSP00000356140:G251S;ENSP00000356139:G251S;ENSP00000356138:G251S;ENSP00000342128:G251S;ENSP00000344786:G251S;ENSP00000343509:G251S;ENSP00000438614:G262S;ENSP00000353154:G262S;ENSP00000356137:G251S;ENSP00000412161:G251S;ENSP00000384875:G251S;ENSP00000385676:G245S;ENSP00000385637:G251S;ENSP00000384061:G262S;ENSP00000425908:G262S;ENSP00000415031:G238S	ENSP00000295776:G262S	G	+	1	0	NFASC	203204044	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.333000	0.72939	2.490000	0.84030	0.655000	0.94253	GGC		0.582	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		10	83	0	0	0	0.008291	0	10	83				
RYR2	6262	broad.mit.edu	37	1	237774102	237774102	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:237774102A>G	ENST00000366574.2	+	36	5041	c.4724A>G	c.(4723-4725)cAc>cGc	p.H1575R	RYR2_ENST00000542537.1_Missense_Mutation_p.H1559R|RYR2_ENST00000360064.6_Missense_Mutation_p.H1573R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1575	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.H1573R(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGAGTGAGCACAAGAACCCC	0.532																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(4723-4725)CAC>CGC		cardiac muscle ryanodine receptor							44.0	45.0	45.0					1																	237774102		1922	4103	6025	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237774102A>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4724A>G	1.37:g.237774102A>G	ENSP00000355533:p.His1575Arg		Somatic					p.H1575R	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		36	4844	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1575			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.4724A>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	4.026	0.002298	0.07819	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95980	-3.87;-3.84;-3.87	5.24	5.24	0.73138	.	0.362765	0.23386	N	0.048757	D	0.84460	0.5477	N	0.01438	-0.865	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.81355	-0.0970	10	0.02654	T	1	.	15.3062	0.73992	1.0:0.0:0.0:0.0	.	1575	Q92736	RYR2_HUMAN	R	1575;1573;1559	ENSP00000355533:H1575R;ENSP00000353174:H1573R;ENSP00000443798:H1559R	ENSP00000353174:H1573R	H	+	2	0	RYR2	235840725	1.000000	0.71417	0.986000	0.45419	0.943000	0.58893	3.069000	0.50026	2.192000	0.70111	0.533000	0.62120	CAC		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		3	14	0	0	0	0.000248	0	3	14				
PLD5	200150	broad.mit.edu	37	1	242264084	242264084	+	Splice_Site	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:242264084T>A	ENST00000536534.2	-	9	1481	c.1240A>T	c.(1240-1242)Aaa>Taa	p.K414*	PLD5_ENST00000427495.1_Splice_Site_p.K352*|PLD5_ENST00000442594.2_Splice_Site_p.K322*			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	414						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.K322*(1)|p.K414*(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCAAAAAATTTCTGTAAGAAA	0.373																																							uc001hzn.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)	6						c.(1240-1242)AAA>TAA		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							63.0	62.0	63.0					1																	242264084		2203	4300	6503	SO:0001630	splice_region_variant	200150					integral to membrane	catalytic activity	g.chr1:242264084T>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1240-1A>T	1.37:g.242264084T>A			Somatic				PLD5_uc001hzl.3_Nonsense_Mutation_p.K352*|PLD5_uc001hzm.3_Nonsense_Mutation_p.K204*|PLD5_uc001hzo.1_Nonsense_Mutation_p.K322*	p.K414*			WXS	Illumina HiSeq	Unspecified	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		9	1367	-	Melanoma(84;0.242)		414					A1KXV0|B7Z324|Q494U9|Q8NB22	Nonsense_Mutation	SNP	ENST00000536534.2	37	c.1240A>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	T	39	7.771025	0.98480	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	.	.	.	5.75	5.75	0.90469	.	0.096682	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5077	14.297	0.66321	0.0:0.0:0.0:1.0	.	.	.	.	X	352;322;414	.	ENSP00000401285:K352X	K	-	1	0	PLD5	240330707	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.475000	0.53136	2.199000	0.70637	0.528000	0.53228	AAA		0.373	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	Nonsense_Mutation	18	77	0	0	0	0.007413	0	18	77				
OR2T8	343172	broad.mit.edu	37	1	248084381	248084381	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr1:248084381C>T	ENST00000319968.4	+	1	62	c.62C>T	c.(61-63)gCc>gTc	p.A21V		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A21V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CACACCAGAGCCCACCAAGTC	0.448																																							uc010pzc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(61-63)GCC>GTC		olfactory receptor, family 2, subfamily T,							96.0	94.0	95.0					1																	248084381		2203	4300	6503	SO:0001583	missense	343172				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248084381C>T		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.62C>T	1.37:g.248084381C>T	ENSP00000326225:p.Ala21Val		Somatic					p.A21V	NM_001005522	NP_001005522	WXS	Illumina HiSeq	Unspecified	A6NH00	OR2T8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	62	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	21			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000319968.4	37	c.62C>T	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	C	5.451	0.268234	0.10349	.	.	ENSG00000177462	ENST00000319968	T	0.00444	7.4	3.65	0.295	0.15752	.	2.308900	0.02279	U	0.069239	T	0.00178	0.0005	N	0.03268	-0.37	0.09310	N	1	B	0.22346	0.068	B	0.22601	0.04	T	0.34004	-0.9846	10	0.17832	T	0.49	.	2.8412	0.05530	0.0:0.3148:0.2436:0.4416	.	21	A6NH00	OR2T8_HUMAN	V	21	ENSP00000326225:A21V	ENSP00000326225:A21V	A	+	2	0	OR2T8	246151004	0.000000	0.05858	0.014000	0.15608	0.046000	0.14306	-0.591000	0.05753	0.220000	0.20860	0.603000	0.83216	GCC		0.448	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522		11	161	0	0	0	0.000978	0	11	161				
ZWINT	11130	broad.mit.edu	37	10	58118343	58118343	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:58118343C>A	ENST00000373944.3	-	7	804	c.766G>T	c.(766-768)Ggg>Tgg	p.G256W	ZWINT_ENST00000460654.1_5'UTR|ZWINT_ENST00000318387.2_Missense_Mutation_p.G136W|ZWINT_ENST00000361148.6_Missense_Mutation_p.G209W|ZWINT_ENST00000395405.1_Missense_Mutation_p.G256W			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	256					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.G256W(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						GGGTCTCTCCCCATGGTGTCT	0.567																																							uc001jjx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(766-768)GGG>TGG		ZW10 interactor isoform a							112.0	105.0	108.0					10																	58118343		2203	4300	6503	SO:0001583	missense	11130				cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding	g.chr10:58118343C>A	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.766G>T	10.37:g.58118343C>A	ENSP00000363055:p.Gly256Trp		Somatic				ZWINT_uc001jjy.1_Missense_Mutation_p.G209W|ZWINT_uc001jka.1_Missense_Mutation_p.G256W|ZWINT_uc009xoy.1_RNA	p.G256W	NM_007057	NP_008988	WXS	Illumina HiSeq	Unspecified	O95229	ZWINT_HUMAN			7	803	-			256					A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	c.766G>T	CCDS7249.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.074|8.074	0.770828|0.770828	0.15983|0.15983	.|.	.|.	ENSG00000122952|ENSG00000122952	ENST00000373940|ENST00000373944;ENST00000395405;ENST00000318387;ENST00000361148	.|T;T;T;T	.|0.51071	.|0.72;0.72;0.72;0.72	4.16|4.16	3.25|3.25	0.37280|0.37280	.|.	.|0.698644	.|0.12485	.|N	.|0.464814	.|T	.|0.52386	.|0.1731	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|D;D	.|0.76494	.|0.999;0.997	.|D;D	.|0.77004	.|0.989;0.958	.|T	.|0.38286	.|-0.9668	.|10	.|0.87932	.|D	.|0	.|-19.7002	9.5453|9.5453	0.39277|0.39277	0.2089:0.7911:0.0:0.0|0.2089:0.7911:0.0:0.0	.|.	.|209;256	.|A6NNV6;O95229	.|.;ZWINT_HUMAN	.|W	-1|256;256;136;209	.|ENSP00000363055:G256W;ENSP00000378801:G256W;ENSP00000322850:G136W;ENSP00000354921:G209W	.|ENSP00000322850:G136W	.|G	-|-	.|1	.|0	ZWINT|ZWINT	57788349|57788349	0.000000|0.000000	0.05858|0.05858	0.019000|0.019000	0.16419|0.16419	0.019000|0.019000	0.09904|0.09904	0.183000|0.183000	0.16919|0.16919	1.328000|1.328000	0.45358|0.45358	0.563000|0.563000	0.77884|0.77884	.|GGG		0.567	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1			29	96	1	0	9.17885e-22	0.003271	1.51085e-21	29	96				
OPALIN	93377	broad.mit.edu	37	10	98105750	98105750	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:98105750A>G	ENST00000371172.3	-	6	779	c.374T>C	c.(373-375)aTg>aCg	p.M125T	OPALIN_ENST00000393870.2_Missense_Mutation_p.M114T|OPALIN_ENST00000419479.1_Missense_Mutation_p.M115T|OPALIN_ENST00000393871.1_Missense_Mutation_p.M102T|OPALIN_ENST00000536387.1_Missense_Mutation_p.M115T	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	125						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M115T(1)|p.M125T(1)		breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						CCTTCTTTCCATTTCTATAGT	0.517																																							uc001kmj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(373-375)ATG>ACG		transmembrane protein 10 isoform a							168.0	146.0	153.0					10																	98105750		2203	4300	6503	SO:0001583	missense	93377					Golgi apparatus|integral to membrane|plasma membrane		g.chr10:98105750A>G	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.374T>C	10.37:g.98105750A>G	ENSP00000360214:p.Met125Thr		Somatic				OPALIN_uc010qor.1_Missense_Mutation_p.M115T|OPALIN_uc001kmi.2_Missense_Mutation_p.M115T|OPALIN_uc001kmk.2_Missense_Mutation_p.M102T|OPALIN_uc010qos.1_RNA	p.M125T	NM_033207	NP_149984	WXS	Illumina HiSeq	Unspecified	Q96PE5	OPALI_HUMAN			6	813	-			125					A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	ENST00000371172.3	37	c.374T>C	CCDS7448.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276167	0.23307	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.12	0.291	0.15732	.	0.846034	0.10440	N	0.674364	T	0.27169	0.0666	L	0.32530	0.975	0.09310	N	1	B;B;B	0.27732	0.187;0.11;0.001	B;B;B	0.22601	0.04;0.04;0.001	T	0.24512	-1.0158	9	0.72032	D	0.01	-1.154	3.7161	0.08438	0.6011:0.1903:0.2086:0.0	.	102;125;115	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	T	125;102;115;114;115	.	ENSP00000360214:M125T	M	-	2	0	OPALIN	98095740	0.009000	0.17119	0.089000	0.20774	0.896000	0.52359	-0.209000	0.09358	-0.045000	0.13468	0.528000	0.53228	ATG		0.517	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049606.1	NM_033207		38	104	0	0	0	0.00623	0	38	104				
SORCS3	22986	broad.mit.edu	37	10	106937932	106937932	+	Splice_Site	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:106937932G>T	ENST00000369701.3	+	14	2236		c.e14+1		SORCS3_ENST00000369699.4_Intron	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3						learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.?(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		ACATCATGACGTGAGTACTTC	0.498																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	1	Unknown(1)		lung(1)	ovary(6)|skin(3)|central_nervous_system(1)	10						c.e14+1		VPS10 domain receptor protein SORCS 3 precursor							163.0	136.0	146.0					10																	106937932		2203	4300	6503	SO:0001630	splice_region_variant	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106937932G>T	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2009+1G>T	10.37:g.106937932G>T			Somatic				SORCS3_uc010qqz.1_Intron	p.T670_splice	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	14	2236	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)						Q5VXF9|Q9NQJ2	Splice_Site	SNP	ENST00000369701.3	37	c.2009_splice	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054846	0.75960	.	.	ENSG00000156395	ENST00000369701;ENST00000393176	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4894	0.90842	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SORCS3	106927922	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.987000	0.93497	2.645000	0.89757	0.585000	0.79938	.		0.498	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	Intron	3	45	1	0	0.00024832	0.000248	0.000297984	3	45				
SHOC2	8036	broad.mit.edu	37	10	112764460	112764460	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:112764460A>G	ENST00000369452.4	+	5	1414	c.1069A>G	c.(1069-1071)Atc>Gtc	p.I357V	SHOC2_ENST00000489390.1_3'UTR|SHOC2_ENST00000265277.5_Missense_Mutation_p.I311V	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	357					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)	p.I357V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		GTTTTCTACCATCTATTCCCT	0.368																																							uc001kzl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1069-1071)ATC>GTC		soc-2 suppressor of clear homolog							95.0	89.0	91.0					10																	112764460		2203	4300	6503	SO:0001583	missense	8036				fibroblast growth factor receptor signaling pathway|positive regulation of Ras protein signal transduction|Ras protein signal transduction	nucleus|protein phosphatase type 1 complex	protein phosphatase binding|protein phosphatase regulator activity	g.chr10:112764460A>G	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.1069A>G	10.37:g.112764460A>G	ENSP00000358464:p.Ile357Val		Somatic				SHOC2_uc009xxx.2_Missense_Mutation_p.I357V|SHOC2_uc010qrg.1_5'UTR|SHOC2_uc001kzn.2_Missense_Mutation_p.I311V	p.I357V	NM_007373	NP_031399	WXS	Illumina HiSeq	Unspecified	Q9UQ13	SHOC2_HUMAN		Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)	5	1418	+			357			LRR 12.		A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	37	c.1069A>G	CCDS7568.1	.	.	.	.	.	.	.	.	.	.	A	4.558	0.103639	0.08731	.	.	ENSG00000108061	ENST00000265277;ENST00000369452;ENST00000451838	T;T;T	0.79749	1.8;1.8;-1.3	5.41	5.41	0.78517	.	0.049291	0.85682	D	0.000000	T	0.68641	0.3023	N	0.16903	0.455	0.58432	D	0.999999	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.0	T	0.63686	-0.6581	10	0.34782	T	0.22	.	15.4254	0.75045	1.0:0.0:0.0:0.0	.	311;357	Q9UQ13-2;Q9UQ13	.;SHOC2_HUMAN	V	311;357;147	ENSP00000265277:I311V;ENSP00000358464:I357V;ENSP00000408275:I147V	ENSP00000265277:I311V	I	+	1	0	SHOC2	112754450	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.547000	0.82146	2.047000	0.60756	0.454000	0.30748	ATC		0.368	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373		14	65	0	0	0	0.00245	0	14	65				
ADRA2A	150	broad.mit.edu	37	10	112838174	112838174	+	Silent	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:112838174C>T	ENST00000280155.2	+	1	1385	c.420C>T	c.(418-420)tgC>tgT	p.C140C		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	125					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)	p.C125C(1)		breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGCACCTGTGCGCCATCAGCC	0.612																																					Esophageal Squamous(173;605 2658 7278 49362)	Esophageal Squamous(173;605 2658 7278 49362)	uc001kzo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(418-420)TGC>TGT		alpha-2A-adrenergic receptor	Amitriptyline(DB00321)|Amphetamine(DB00182)|Apraclonidine(DB00964)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Clonidine(DB00575)|Debrisoquin(DB04840)|Dexmedetomidine(DB00633)|Dipivefrin(DB00449)|Epinastine(DB00751)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Lofexidine(DB04948)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Norepinephrine(DB00368)|Oxymetazoline(DB00935)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Tizanidine(DB00697)|Trazodone(DB00656)|Yohimbine(DB01392)						93.0	73.0	80.0					10																	112838174		2203	4300	6503	SO:0001819	synonymous_variant	150				actin cytoskeleton organization|activation of MAPK activity by adrenergic receptor signaling pathway|activation of phospholipase C activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cellular component movement|cellular response to hormone stimulus|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|glucose homeostasis|inhibition of adenylate cyclase activity by adrenergic receptor signaling pathway|intestinal absorption|negative regulation of adrenergic receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of epinephrine secretion|negative regulation of insulin secretion involved in cellular response to glucose stimulus|negative regulation of lipid catabolic process|negative regulation of norepinephrine secretion|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cytokine production|positive regulation of membrane protein ectodomain proteolysis|positive regulation of potassium ion transport|positive regulation of wound healing|Rho protein signal transduction	basolateral plasma membrane|cytoplasm|integral to plasma membrane|receptor complex	alpha-1B adrenergic receptor binding|alpha-2C adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|heterotrimeric G-protein binding|norepinephrine binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|thioesterase binding	g.chr10:112838174C>T	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.420C>T	10.37:g.112838174C>T			Somatic					p.C140C	NM_000681	NP_000672	WXS	Illumina HiSeq	Unspecified	P08913	ADA2A_HUMAN		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	1	1385	+		Breast(234;0.0735)|Lung NSC(174;0.238)	125			Helical; Name=3; (By similarity).		B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Silent	SNP	ENST00000280155.2	37	c.420C>T	CCDS7569.2																																																																																				0.612	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681		3	32	0	0	0	0.004672	0	3	32				
AFAP1L2	84632	broad.mit.edu	37	10	116060424	116060424	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:116060424G>A	ENST00000304129.4	-	14	1597	c.1568C>T	c.(1567-1569)cCt>cTt	p.P523L	AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000545353.1_Missense_Mutation_p.P576L|AFAP1L2_ENST00000369271.3_Missense_Mutation_p.P523L			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	523					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)	p.P523L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		ATCTGCAACAGGGGTGGCTTC	0.582																																							uc001lbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1567-1569)CCT>CTT		KIAA1914 protein isoform 1							109.0	101.0	103.0					10																	116060424		2203	4300	6503	SO:0001583	missense	84632				inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding	g.chr10:116060424G>A	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.1568C>T	10.37:g.116060424G>A	ENSP00000303042:p.Pro523Leu		Somatic				AFAP1L2_uc001lbo.2_Missense_Mutation_p.P523L|AFAP1L2_uc010qse.1_Missense_Mutation_p.P576L|AFAP1L2_uc001lbp.2_Missense_Mutation_p.P551L|AFAP1L2_uc001lbr.1_Missense_Mutation_p.P523L|AFAP1L2_uc001lbm.2_Intron|AFAP1L2_uc010qsd.1_Missense_Mutation_p.P89L|AFAP1L2_uc001lbq.1_Missense_Mutation_p.P45L	p.P523L	NM_001001936	NP_001001936	WXS	Illumina HiSeq	Unspecified	Q8N4X5	AF1L2_HUMAN		Epithelial(162;0.0219)|all cancers(201;0.0561)	14	1869	-		Colorectal(252;0.175)|Breast(234;0.231)	523					A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	37	c.1568C>T	CCDS31286.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004417	0.35320	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.15017	2.48;2.48;2.46	5.76	2.82	0.32997	.	0.381511	0.29451	N	0.012101	T	0.27629	0.0679	M	0.73598	2.24	0.19945	N	0.999944	P;P;P;D;B;P;B	0.54772	0.828;0.835;0.736;0.968;0.218;0.554;0.418	B;B;B;P;B;B;B	0.51999	0.234;0.318;0.118;0.687;0.117;0.203;0.1	T	0.09422	-1.0675	10	0.52906	T	0.07	-2.8421	7.2616	0.26207	0.0763:0.0:0.4824:0.4413	.	576;89;577;45;551;523;523	F5GZE1;B7Z363;B7Z2Q0;Q8N4X5-3;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;.;.;AF1L2_HUMAN	L	523;523;550;576	ENSP00000358276:P523L;ENSP00000303042:P523L;ENSP00000444511:P576L	ENSP00000303042:P523L	P	-	2	0	AFAP1L2	116050414	0.007000	0.16637	0.004000	0.12327	0.076000	0.17211	0.615000	0.24329	0.319000	0.23209	-0.181000	0.13052	CCT		0.582	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550		8	72	0	0	0	0.008291	0	8	72				
DMBT1	1755	broad.mit.edu	37	10	124358327	124358327	+	Silent	SNP	A	A	C	rs556706179		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr10:124358327A>C	ENST00000338354.3	+	26	3100	c.2994A>C	c.(2992-2994)ggA>ggC	p.G998G	DMBT1_ENST00000344338.3_Silent_p.G988G|DMBT1_ENST00000368956.2_Silent_p.G499G|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368909.3_Silent_p.G998G|DMBT1_ENST00000330163.4_Silent_p.G499G|DMBT1_ENST00000368955.3_Silent_p.G988G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	998	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.G998G(3)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGTGAATGGAGGTGACAGGT	0.537																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(7)	7						c.(2992-2994)GGA>GGC		deleted in malignant brain tumors 1 isoform b							322.0	314.0	317.0					10																	124358327		1965	4163	6128	SO:0001819	synonymous_variant	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124358327A>C		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2994A>C	10.37:g.124358327A>C			Somatic				DMBT1_uc001lgl.1_Silent_p.G988G|DMBT1_uc001lgm.1_Silent_p.G499G|DMBT1_uc009xzz.1_Silent_p.G998G|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_5'UTR	p.G998G	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			26	3100	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	998			SRCR 8.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37	c.2994A>C																																																																																					0.537	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		32	271	0	0	0	0.002852	0	32	271				
OR2AG1	144125	broad.mit.edu	37	11	6806454	6806454	+	Silent	SNP	G	G	T	rs547097110		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:6806454G>T	ENST00000307401.4	+	1	207	c.186G>T	c.(184-186)ctG>ctT	p.L62L		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L62L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGTACCTCCTGCTTGGGCAGC	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		22042	0.0		0.0	False		,,,				2504	0.0						uc001mer.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(184-186)CTG>CTT		olfactory receptor, family 2, subfamily AG,							170.0	160.0	163.0					11																	6806454		2201	4296	6497	SO:0001819	synonymous_variant	144125				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6806454G>T	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.186G>T	11.37:g.6806454G>T			Somatic					p.L62L	NM_001004489	NP_001004489	WXS	Illumina HiSeq	Unspecified	Q9H205	O2AG1_HUMAN		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	186	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	62			Helical; Name=2; (Potential).		B9EKV7|Q6IFG7|Q96R26	Silent	SNP	ENST00000307401.4	37	c.186G>T	CCDS31414.1																																																																																				0.532	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489		27	131	1	0	1.06801e-11	0.001786	1.62828e-11	27	131				
NLRP14	338323	broad.mit.edu	37	11	7063760	7063760	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:7063760T>A	ENST00000299481.4	+	4	849	c.503T>A	c.(502-504)gTg>gAg	p.V168E		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	168					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.V168E(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTGTTCGATGTGGATGTCAAA	0.468																																							uc001mfb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(502-504)GTG>GAG		NLR family, pyrin domain containing 14							100.0	104.0	103.0					11																	7063760		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7063760T>A	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.503T>A	11.37:g.7063760T>A	ENSP00000299481:p.Val168Glu		Somatic					p.V168E	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	4	826	+			168					Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.503T>A	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780735	0.16120	.	.	ENSG00000158077	ENST00000299481	T	0.71461	-0.57	4.25	-1.02	0.10135	.	1.015620	0.07907	N	0.973692	T	0.40694	0.1127	N	0.08118	0	0.25578	N	0.986827	B	0.06786	0.001	B	0.06405	0.002	T	0.19910	-1.0291	10	0.13108	T	0.6	.	0.788	0.01052	0.3671:0.1037:0.1653:0.3639	.	168	Q86W24	NAL14_HUMAN	E	168	ENSP00000299481:V168E	ENSP00000299481:V168E	V	+	2	0	NLRP14	7020336	0.000000	0.05858	0.959000	0.39883	0.820000	0.46376	-0.103000	0.10940	-0.037000	0.13646	0.528000	0.53228	GTG		0.468	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		19	88	0	0	0	0.001523	0	19	88				
OR5M3	219482	broad.mit.edu	37	11	56237132	56237132	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:56237132G>T	ENST00000312240.2	-	1	882	c.842C>A	c.(841-843)cCc>cAc	p.P281H		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P281H(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					ATTCAACATGGGGATCACTGT	0.418																																							uc010rjk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(841-843)CCC>CAC		olfactory receptor, family 5, subfamily M,							14.0	15.0	15.0					11																	56237132		2163	4214	6377	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237132G>T	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.842C>A	11.37:g.56237132G>T	ENSP00000312208:p.Pro281His		Somatic					p.P281H	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	842	-	Esophageal squamous(21;0.00448)		281			Helical; Name=7; (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.842C>A	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936484	0.34189	.	.	ENSG00000174937	ENST00000312240	T	0.00349	7.99	5.08	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000718	T	0.01558	0.0050	H	0.99197	4.465	0.35108	D	0.765895	D	0.89917	1.0	D	0.80764	0.994	T	0.06917	-1.0800	10	0.87932	D	0	-7.8303	10.692	0.45877	0.1587:0.0:0.8413:0.0	.	281	Q8NGP4	OR5M3_HUMAN	H	281	ENSP00000312208:P281H	ENSP00000312208:P281H	P	-	2	0	OR5M3	55993708	1.000000	0.71417	0.986000	0.45419	0.038000	0.13279	5.319000	0.65835	0.542000	0.28846	-0.236000	0.12185	CCC		0.418	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		9	32	1	0	5.50884e-06	0.001368	7.2158e-06	9	32				
TENM4	26011	broad.mit.edu	37	11	78412983	78412983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:78412983G>A	ENST00000278550.7	-	28	5137	c.4675C>T	c.(4675-4677)Cga>Tga	p.R1559*		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1559					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.R1559*(4)									AACCGAATTCGGATGTTCCCA	0.488																																							uc001ozl.3		NA																	4	Substitution - Nonsense(4)		lung(2)|endometrium(2)	ovary(2)|pancreas(2)	4						c.(4675-4677)CGA>TGA		odz, odd Oz/ten-m homolog 4							93.0	100.0	98.0					11																	78412983		2117	4222	6339	SO:0001587	stop_gained	26011				signal transduction	integral to membrane		g.chr11:78412983G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4675C>T	11.37:g.78412983G>A	ENSP00000278550:p.Arg1559*		Somatic				ODZ4_uc009yvb.1_Nonsense_Mutation_p.R143*	p.R1559*	NM_001098816	NP_001092286	WXS	Illumina HiSeq	Unspecified	Q6N022	TEN4_HUMAN			28	5138	-			1559			NHL 5.|Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Nonsense_Mutation	SNP	ENST00000278550.7	37	c.4675C>T	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	49	15.459635	0.99834	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	.	.	.	5.11	4.16	0.48862	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8089	0.63250	0.0:0.0:0.7367:0.2633	.	.	.	.	X	1559;23	.	.	R	-	1	2	ODZ4	78090631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.139000	0.64801	2.649000	0.89929	0.650000	0.86243	CGA		0.488	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			4	91	0	0	0	0.000248	0	4	91				
FAT3	120114	broad.mit.edu	37	11	92086791	92086791	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:92086791G>C	ENST00000298047.6	+	1	1530	c.1513G>C	c.(1513-1515)Ggg>Cgg	p.G505R	FAT3_ENST00000409404.2_Missense_Mutation_p.G505R|FAT3_ENST00000541502.1_Missense_Mutation_p.G505R|FAT3_ENST00000525166.1_Missense_Mutation_p.G355R			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	505	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G505R(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGAGAAAATGGGTACATCAC	0.383										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(1513-1515)GGG>CGG		FAT tumor suppressor homolog 3							94.0	94.0	94.0					11																	92086791		1888	4122	6010	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92086791G>C	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1513G>C	11.37:g.92086791G>C	ENSP00000298047:p.Gly505Arg	TCGA Ovarian(4;0.039)	Somatic					p.G505R	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	1530	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	505			Cadherin 5.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.1513G>C		.	.	.	.	.	.	.	.	.	.	G	18.81	3.703476	0.68501	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.84	5.84	0.93424	.	.	.	.	.	T	0.75162	0.3812	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77528	-0.2554	9	0.52906	T	0.07	.	19.1176	0.93348	0.0:0.0:1.0:0.0	.	505	Q8TDW7-3	.	R	505;505;505;355	ENSP00000298047:G505R;ENSP00000387040:G505R;ENSP00000443786:G505R;ENSP00000432586:G355R	ENSP00000298047:G505R	G	+	1	0	FAT3	91726439	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.787000	0.99055	2.758000	0.94735	0.591000	0.81541	GGG		0.383	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		15	33	0	0	0	0.00245	0	15	33				
DYNC2H1	79659	broad.mit.edu	37	11	103006491	103006491	+	Silent	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:103006491G>T	ENST00000375735.2	+	17	2532	c.2388G>T	c.(2386-2388)cgG>cgT	p.R796R	DYNC2H1_ENST00000398093.3_Silent_p.R796R|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	796	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAGAAATCCGGGCTAAATATT	0.323																																							uc001pho.2		NA																	0					0						c.(2386-2388)CGG>CGT		dynein, cytoplasmic 2, heavy chain 1							43.0	40.0	41.0					11																	103006491		1789	4057	5846	SO:0001819	synonymous_variant	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:103006491G>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2388G>T	11.37:g.103006491G>T			Somatic				DYNC2H1_uc001phn.1_Silent_p.R796R|DYNC2H1_uc009yxe.1_Intron	p.R796R	NM_001080463	NP_001073932	WXS	Illumina HiSeq	Unspecified	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	17	2532	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	796			Stem (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	c.2388G>T	CCDS53701.1																																																																																				0.323	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		9	29	1	0	3.09899e-07	0.004482	4.26971e-07	9	29				
NCAM1	4684	broad.mit.edu	37	11	113076778	113076778	+	Silent	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:113076778C>A	ENST00000533760.1	+	5	749	c.150C>A	c.(148-150)gtC>gtA	p.V50V	NCAM1_ENST00000401611.2_Silent_p.V167V|NCAM1_ENST00000316851.7_Silent_p.V158V|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	168	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.V167V(2)|p.V158V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GATTCATAGTCCTGTCCAACA	0.502																																							uc009yyq.1		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)	1						c.(148-150)GTC>GTA		neural cell adhesion molecule 1 isoform 3							115.0	117.0	116.0					11																	113076778		1994	4156	6150	SO:0001819	synonymous_variant	4684				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane		g.chr11:113076778C>A		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.150C>A	11.37:g.113076778C>A			Somatic				NCAM1_uc001pno.2_Silent_p.V50V	p.V50V	NM_001076682	NP_001070150	WXS	Illumina HiSeq	Unspecified	P13591	NCAM1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)	5	844	+		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)	168			Ig-like C2-type 2.|Extracellular (Potential).		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37	c.150C>A																																																																																					0.502	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615		23	47	1	0	7.88262e-20	0.00333	1.28611e-19	23	47				
APOA5	116519	broad.mit.edu	37	11	116660968	116660968	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:116660968G>T	ENST00000227665.4	-	3	1011	c.977C>A	c.(976-978)cCa>cAa	p.P326Q	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Missense_Mutation_p.P326Q			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	326					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)	p.P326Q(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		TTGAAACTCTGGGGCGAAGGC	0.597																																							uc001ppr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(976-978)CCA>CAA		apolipoprotein AV precursor							99.0	92.0	94.0					11																	116660968		2201	4296	6497	SO:0001583	missense	116519				acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding	g.chr11:116660968G>T	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.977C>A	11.37:g.116660968G>T	ENSP00000227665:p.Pro326Gln		Somatic				ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Missense_Mutation_p.P326Q|APOA5_uc009yzf.2_Missense_Mutation_p.P326Q|APOA5_uc009yzg.2_Missense_Mutation_p.P352Q	p.P326Q	NM_052968	NP_443200	WXS	Illumina HiSeq	Unspecified	Q6Q788	APOA5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)	3	985	-	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)	326					B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	ENST00000227665.4	37	c.977C>A	CCDS8376.2	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439675	0.25900	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.69561	-0.41;-0.41	4.94	4.94	0.65067	Apolipoprotein/apolipophorin (1);	0.000000	0.44902	D	0.000418	T	0.74665	0.3746	M	0.72118	2.19	0.09310	N	1	D;D	0.58268	0.982;0.982	P;P	0.55824	0.785;0.785	T	0.68689	-0.5342	10	0.56958	D	0.05	-13.4182	11.4062	0.49900	0.0:0.1821:0.8179:0.0	.	323;326	B0YIW1;Q6Q788	.;APOA5_HUMAN	Q	326	ENSP00000227665:P326Q;ENSP00000445002:P326Q	ENSP00000227665:P326Q	P	-	2	0	APOA5	116166178	0.988000	0.35896	0.038000	0.18304	0.141000	0.21300	4.618000	0.61211	2.553000	0.86117	0.655000	0.94253	CCA		0.597	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106285.2			15	28	1	0	0.00074312	0.006122	0.000858512	15	28				
PVRL1	5818	broad.mit.edu	37	11	119509492	119509492	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr11:119509492C>A	ENST00000341398.2	-	7	1175	c.1176G>T	c.(1174-1176)aaG>aaT	p.K392N	RP11-196E1.3_ENST00000532153.1_RNA|RP11-196E1.3_ENST00000601999.1_RNA	NM_203285.1	NP_976030.1	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	0					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)	p.K392N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		AAGGCTCCGGCTTCTGGGAGA	0.632																																							uc001pwu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1174-1176)AAG>AAT		poliovirus receptor-related 1 isoform 2							45.0	43.0	44.0					11																	119509492		2199	4295	6494	SO:0001583	missense	5818				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity	g.chr11:119509492C>A	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000341398.2:c.1176G>T	11.37:g.119509492C>A	ENSP00000344974:p.Lys392Asn		Somatic					p.K392N	NM_203285	NP_976030	WXS	Illumina HiSeq	Unspecified	Q15223	PVRL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)	7	1348	-		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	Error:Variant_position_missing_in_Q15223_after_alignment					O75465|Q2M3D3|Q9HBE6|Q9HBW2	Missense_Mutation	SNP	ENST00000341398.2	37	c.1176G>T	CCDS8425.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765539	0.31228	.	.	ENSG00000110400	ENST00000341398	T	0.76839	-1.05	3.39	3.39	0.38822	.	.	.	.	.	T	0.69993	0.3173	L	0.54323	1.7	0.80722	D	1	B	0.26195	0.144	B	0.21546	0.035	T	0.66858	-0.5817	9	0.30078	T	0.28	.	10.5466	0.45064	0.0:1.0:0.0:0.0	.	392	Q15223-2	.	N	392	ENSP00000344974:K392N	ENSP00000344974:K392N	K	-	3	2	PVRL1	119014702	0.219000	0.23619	0.619000	0.29118	0.100000	0.18952	0.618000	0.24373	2.158000	0.67659	0.462000	0.41574	AAG		0.632	PVRL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388230.1			5	17	1	0	3.59834e-05	0.001168	4.49188e-05	5	17				
NECAP1	25977	broad.mit.edu	37	12	8244385	8244385	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr12:8244385A>G	ENST00000339754.5	+	4	400	c.322A>G	c.(322-324)Att>Gtt	p.I108V		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	108					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)		p.I108V(1)		cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		TTTCATTGGCATTGGCTTCAC	0.527																																							uc001qtx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(322-324)ATT>GTT		NECAP endocytosis associated 1							182.0	137.0	152.0					12																	8244385		2203	4300	6503	SO:0001583	missense	25977				endocytosis|protein transport	clathrin coated vesicle membrane|plasma membrane		g.chr12:8244385A>G	AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.322A>G	12.37:g.8244385A>G	ENSP00000341737:p.Ile108Val		Somatic				NECAP1_uc001qty.2_Intron	p.I108V	NM_015509	NP_056324	WXS	Illumina HiSeq	Unspecified	Q8NC96	NECP1_HUMAN		Kidney(36;0.0915)	4	400	+			108					Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Missense_Mutation	SNP	ENST00000339754.5	37	c.322A>G	CCDS8589.1	.	.	.	.	.	.	.	.	.	.	A	9.104	1.004818	0.19199	.	.	ENSG00000089818	ENST00000545179;ENST00000339754	T	0.43688	0.94	4.35	3.17	0.36434	.	0.321368	0.33712	N	0.004629	T	0.18800	0.0451	N	0.11651	0.15	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.05305	-1.0893	10	0.20046	T	0.44	.	4.4409	0.11573	0.6948:0.2033:0.1019:0.0	.	108	Q8NC96	NECP1_HUMAN	V	108	ENSP00000341737:I108V	ENSP00000341737:I108V	I	+	1	0	NECAP1	8135652	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.735000	0.55044	0.781000	0.33589	0.533000	0.62120	ATT		0.527	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509		3	35	0	0	0	0.004672	0	3	35				
GRIN2B	2904	broad.mit.edu	37	12	13768186	13768186	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr12:13768186C>A	ENST00000609686.1	-	7	1725	c.1516G>T	c.(1516-1518)Gcc>Tcc	p.A506S		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	506					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A506S(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCATGTAGGCCCTCTTCATG	0.502																																							uc001rbt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1516-1518)GCC>TCC		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						116.0	98.0	104.0					12																	13768186		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13768186C>A		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1516G>T	12.37:g.13768186C>A	ENSP00000477455:p.Ala506Ser		Somatic					p.A506S	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			7	1695	-			506			Extracellular (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.1516G>T	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	35	5.587897	0.96590	.	.	ENSG00000150086	ENST00000279593	T	0.29142	1.58	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	M	0.91920	3.255	0.80722	D	1	D	0.57571	0.98	D	0.67900	0.954	T	0.71520	-0.4568	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	506	Q13224	NMDE2_HUMAN	S	506	ENSP00000279593:A506S	ENSP00000279593:A506S	A	-	1	0	GRIN2B	13659453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.813000	0.86123	2.941000	0.99782	0.655000	0.94253	GCC		0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			7	42	1	0	8.12818e-05	0.001984	9.94633e-05	7	42				
ATF7IP	55729	broad.mit.edu	37	12	14578064	14578064	+	Silent	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr12:14578064T>C	ENST00000540793.1	+	1	1370	c.1215T>C	c.(1213-1215)gaT>gaC	p.D405D	ATF7IP_ENST00000536444.1_Silent_p.D405D|ATF7IP_ENST00000543189.1_Silent_p.D405D|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000544627.1_Silent_p.D413D|ATF7IP_ENST00000261168.4_Silent_p.D405D			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	405	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)		p.D405D(1)		cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CTTCTGCAGATCTTGTAGAAA	0.328																																							uc001rbw.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(1)|skin(1)	5						c.(1213-1215)GAT>GAC		activating transcription factor 7 interacting							57.0	60.0	59.0					12																	14578064		2203	4300	6503	SO:0001819	synonymous_variant	55729				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	g.chr12:14578064T>C	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1215T>C	12.37:g.14578064T>C			Somatic				ATF7IP_uc010shs.1_Silent_p.D405D|ATF7IP_uc001rbu.2_Silent_p.D405D|ATF7IP_uc001rbv.1_Silent_p.D405D|ATF7IP_uc001rbx.2_Silent_p.D405D|ATF7IP_uc010sht.1_Silent_p.D405D|ATF7IP_uc001rby.3_Silent_p.D405D|ATF7IP_uc001rbz.1_Silent_p.D405D|ATF7IP_uc001rca.2_Silent_p.D405D|ATF7IP_uc001rcb.2_Silent_p.D16D	p.D405D	NM_018179	NP_060649	WXS	Illumina HiSeq	Unspecified	Q6VMQ6	MCAF1_HUMAN			2	1373	+			405			Glu-rich.		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Silent	SNP	ENST00000540793.1	37	c.1215T>C	CCDS8663.1																																																																																				0.328	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		4	76	0	0	0	0.000602	0	4	76				
OVCH1	341350	broad.mit.edu	37	12	29614910	29614910	+	Silent	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr12:29614910A>T	ENST00000318184.5	-	19	2156	c.2157T>A	c.(2155-2157)atT>atA	p.I719I	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	719	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.I719I(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CATGCACTTGAATCTGCTGTA	0.433																																							uc001rix.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(2155-2157)ATT>ATA		ovochymase 1 precursor							173.0	167.0	169.0					12																	29614910		1972	4178	6150	SO:0001819	synonymous_variant	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29614910A>T	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2157T>A	12.37:g.29614910A>T			Somatic					p.I719I	NM_183378	NP_899234	WXS	Illumina HiSeq	Unspecified	Q7RTY7	OVCH1_HUMAN			19	2157	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		719			Peptidase S1 2.			Silent	SNP	ENST00000318184.5	37	c.2157T>A																																																																																					0.433	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		12	146	0	0	0	0.001855	0	12	146				
CDK17	5128	broad.mit.edu	37	12	96694092	96694092	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr12:96694092T>C	ENST00000261211.3	-	6	1193	c.590A>G	c.(589-591)aAg>aGg	p.K197R	CDK17_ENST00000542666.1_Missense_Mutation_p.K144R|CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000543119.2_Missense_Mutation_p.K197R	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.K197R(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						CTCTCCAAGCTTTTCCAATTT	0.289																																							uc001tep.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						c.(589-591)AAG>AGG		PCTAIRE protein kinase 2							71.0	79.0	76.0					12																	96694092		2202	4299	6501	SO:0001583	missense	5128						ATP binding|cyclin-dependent protein kinase activity	g.chr12:96694092T>C		CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.590A>G	12.37:g.96694092T>C	ENSP00000261211:p.Lys197Arg		Somatic				CDK17_uc009ztk.2_Missense_Mutation_p.K197R|CDK17_uc010svb.1_Missense_Mutation_p.K144R	p.K197R	NM_002595	NP_002586	WXS	Illumina HiSeq	Unspecified	Q00537	CDK17_HUMAN			6	1079	-			197			Protein kinase.		A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	c.590A>G	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.720780	0.89205	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.66995	-0.24;-0.24;-0.24	4.99	4.99	0.66335	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	L	0.61036	1.89	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.81675	-0.0825	10	0.72032	D	0.01	-14.1044	14.966	0.71193	0.0:0.0:0.0:1.0	.	197;197	A8K1U6;Q00537	.;CDK17_HUMAN	R	197;197;144	ENSP00000261211:K197R;ENSP00000444459:K197R;ENSP00000442926:K144R	ENSP00000261211:K197R	K	-	2	0	CDK17	95218223	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.021000	0.88750	1.997000	0.58415	0.477000	0.44152	AAG		0.289	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595		3	79	0	0	0	0.004672	0	3	79				
MPHOSPH8	54737	broad.mit.edu	37	13	20240685	20240685	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:20240685C>T	ENST00000361479.5	+	10	2208	c.2140C>T	c.(2140-2142)Ctt>Ttt	p.L714F	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.L714F	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	714					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)	p.L714F(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TAACAATGTGCTTGTGTACGA	0.408																																							uc001umh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2140-2142)CTT>TTT		M-phase phosphoprotein 8							167.0	135.0	146.0					13																	20240685		2203	4300	6503	SO:0001583	missense	54737				cell cycle	cytoplasm|nucleus		g.chr13:20240685C>T	AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.2140C>T	13.37:g.20240685C>T	ENSP00000355388:p.Leu714Phe		Somatic				MPHOSPH8_uc001umg.2_Missense_Mutation_p.L714F	p.L714F	NM_017520	NP_059990	WXS	Illumina HiSeq	Unspecified	Q99549	MPP8_HUMAN		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)	10	2149	+		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)	714			ANK 4.		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	37	c.2140C>T	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255476	0.39896	.	.	ENSG00000196199	ENST00000414242;ENST00000360754;ENST00000361479	T;T	0.70631	-0.5;-0.5	5.77	0.418	0.16429	Ankyrin repeat-containing domain (3);	0.281250	0.33496	N	0.004843	T	0.71204	0.3312	N	0.21282	0.65	0.33711	D	0.61579	D;D	0.69078	0.997;0.996	D;D	0.70016	0.967;0.944	T	0.77579	-0.2535	10	0.87932	D	0	.	12.9251	0.58257	0.0:0.8753:0.0:0.1247	.	714;714	Q99549;Q99549-2	MPP8_HUMAN;.	F	714;43;714	ENSP00000414663:L714F;ENSP00000355388:L714F	ENSP00000353982:L43F	L	+	1	0	MPHOSPH8	19138685	0.074000	0.21230	0.982000	0.44146	0.300000	0.27592	-0.312000	0.08113	-0.018000	0.14079	0.557000	0.71058	CTT		0.408	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	NM_017520		3	82	0	0	0	0.004672	0	3	82				
ZMYM5	9205	broad.mit.edu	37	13	20425887	20425888	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:20425887_20425888CC>AA	ENST00000337963.4	-	3	697_698	c.433_434GG>TT	c.(433-435)GGa>TTa	p.G145L	ZMYM5_ENST00000382907.4_Missense_Mutation_p.G145L|ZMYM5_ENST00000382905.4_Missense_Mutation_p.G145L	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	145						nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.G145L(2)		kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GTTTTTAGTTCCAGGAAGTCCC	0.366																																							uc010tcn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(433-435)GGA>TTA		zinc finger protein 237 isoform 3																																				SO:0001583	missense	9205					nucleus	zinc ion binding	g.chr13:20425887_20425888CC>AA	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.433_434delinsAA	13.37:g.20425887_20425888delinsAA	ENSP00000337034:p.Gly145Leu		Somatic				ZMYM5_uc001umm.1_5'UTR|ZMYM5_uc001umn.2_Missense_Mutation_p.G145L|ZMYM5_uc001umo.2_Missense_Mutation_p.G145L	p.G145L	NM_001142684	NP_001136156	WXS	Illumina HiSeq	Unspecified	Q9UJ78	ZMYM5_HUMAN		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)	3	698_699	-		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	145					B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	DNP	ENST00000337963.4	37	c.433_434GG>TT																																																																																					0.366	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242		8	117	0	0	0	0.004672	0	8	117				
XPO4	64328	broad.mit.edu	37	13	21373447	21373447	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:21373447A>T	ENST00000255305.6	-	16	2250	c.2179T>A	c.(2179-2181)Tgg>Agg	p.W727R	XPO4_ENST00000400602.2_Missense_Mutation_p.W727R			Q9C0E2	XPO4_HUMAN	exportin 4	727					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W700R(1)		breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GCTAAATTCCACCAGTTCTCA	0.378																																							uc001unq.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|kidney(1)	3						c.(2179-2181)TGG>AGG		exportin 4							132.0	130.0	131.0					13																	21373447		1858	4097	5955	SO:0001583	missense	64328				protein transport	cytoplasm|nucleus	protein binding	g.chr13:21373447A>T	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2179T>A	13.37:g.21373447A>T	ENSP00000255305:p.Trp727Arg		Somatic					p.W727R	NM_022459	NP_071904	WXS	Illumina HiSeq	Unspecified	Q9C0E2	XPO4_HUMAN		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)	16	2215	-		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)	727					Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	ENST00000255305.6	37	c.2179T>A	CCDS41872.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.033501	0.35893	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	T;T	0.55588	0.51;0.51	5.68	5.68	0.88126	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46171	0.1379	L	0.48362	1.52	0.80722	D	1	B	0.22276	0.067	B	0.19148	0.024	T	0.36768	-0.9734	10	0.16420	T	0.52	-12.1382	16.2322	0.82352	1.0:0.0:0.0:0.0	.	727	Q9C0E2	XPO4_HUMAN	R	727;597;727	ENSP00000383444:W727R;ENSP00000255305:W727R	ENSP00000255305:W727R	W	-	1	0	XPO4	20271447	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.803000	0.91915	2.288000	0.76882	0.528000	0.53228	TGG		0.378	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459		6	70	0	0	0	0.001984	0	6	70				
MTMR6	9107	broad.mit.edu	37	13	25848295	25848295	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:25848295T>C	ENST00000381801.5	-	2	816	c.55A>G	c.(55-57)Agt>Ggt	p.S19G	MTMR6_ENST00000540661.1_Missense_Mutation_p.S19G	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	19					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.S19G(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		TTGCTGGTACTGAATCGGTCA	0.348																																							uc001uqf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(55-57)AGT>GGT		myotubularin related protein 6							119.0	112.0	115.0					13																	25848295		2203	4300	6503	SO:0001583	missense	9107					cytoplasm|nuclear envelope	calcium-activated potassium channel activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr13:25848295T>C	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.55A>G	13.37:g.25848295T>C	ENSP00000371221:p.Ser19Gly		Somatic				MTMR6_uc001uqe.1_Missense_Mutation_p.S19G	p.S19G	NM_004685	NP_004676	WXS	Illumina HiSeq	Unspecified	Q9Y217	MTMR6_HUMAN		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)	2	374	-		Lung SC(185;0.0225)|Breast(139;0.0351)	19					B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	c.55A>G	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.418777	0.25552	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.94497	-3.42;-3.44	4.93	2.49	0.30216	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.90967	0.7160	M	0.64997	1.995	0.51012	D	0.9999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.83048	-0.0154	10	0.18710	T	0.47	.	9.2565	0.37586	0.0:0.1485:0.0:0.8515	.	19;19	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	G	19	ENSP00000443161:S19G;ENSP00000371221:S19G	ENSP00000371221:S19G	S	-	1	0	MTMR6	24746295	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	3.031000	0.49728	0.326000	0.23384	-0.376000	0.06991	AGT		0.348	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685		5	52	0	0	0	0.000602	0	5	52				
PAN3	255967	broad.mit.edu	37	13	28854560	28854560	+	Missense_Mutation	SNP	C	C	G	rs141442348		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:28854560C>G	ENST00000380958.3	+	16	2353	c.2201C>G	c.(2200-2202)aCt>aGt	p.T734S	PAN3_ENST00000282391.5_Missense_Mutation_p.T422S|PAN3_ENST00000399613.1_Missense_Mutation_p.T534S	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit									p.T734S(1)|p.T534S(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TATTTGTTGACTGACCAAAAC	0.383																																							uc001urz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1762-1764)ACT>AGT		PABP1-dependent poly A-specific ribonuclease		C	SER/THR	1,4405	2.1+/-5.4	0,1,2202	134.0	120.0	125.0		2201	4.9	1.0	13	dbSNP_134	125	0,8600		0,0,4300	no	missense	PAN3	NM_175854.7	58	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign	734/888	28854560	1,13005	2203	4300	6503	SO:0001583	missense	255967				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity	g.chr13:28854560C>G	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.2201C>G	13.37:g.28854560C>G	ENSP00000370345:p.Thr734Ser		Somatic				PAN3_uc001ury.2_Missense_Mutation_p.T422S|PAN3_uc001urx.2_Missense_Mutation_p.T534S	p.T588S	NM_175854	NP_787050	WXS	Illumina HiSeq	Unspecified	Q58A45	PAN3_HUMAN	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)	15	1771	+	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	734			Protein kinase.|Interaction with PAN2.			Missense_Mutation	SNP	ENST00000380958.3	37	c.1763C>G	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472787	0.43942	2.27E-4	0.0	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.40756	1.02;1.02;1.02	5.74	4.88	0.63580	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.137207	0.64402	N	0.000003	T	0.25494	0.0620	N	0.13352	0.335	0.58432	D	0.999999	B;B;B	0.32526	0.374;0.019;0.141	B;B;B	0.33254	0.16;0.019;0.041	T	0.09207	-1.0685	10	0.02654	T	1	-15.5524	16.8847	0.86072	0.0:0.8717:0.1283:0.0	.	734;422;680	Q58A45;Q58A45-2;Q58A45-3	PAN3_HUMAN;.;.	S	734;534;422	ENSP00000370345:T734S;ENSP00000382522:T534S;ENSP00000282391:T422S	ENSP00000282391:T422S	T	+	2	0	PAN3	27752560	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.995000	0.70631	1.527000	0.49086	0.561000	0.74099	ACT		0.383	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854		3	85	0	0	0	0.004672	0	3	85				
FLT1	2321	broad.mit.edu	37	13	29041231	29041231	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:29041231A>G	ENST00000282397.4	-	3	448	c.197T>C	c.(196-198)aTg>aCg	p.M66T	FLT1_ENST00000539099.1_Missense_Mutation_p.M66T|FLT1_ENST00000541932.1_Missense_Mutation_p.M66T	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	66	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.M66T(2)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTACTCACCATTTCAGGCAA	0.448																																							uc001usb.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(196-198)ATG>ACG		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						180.0	168.0	172.0					13																	29041231		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:29041231A>G	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.197T>C	13.37:g.29041231A>G	ENSP00000282397:p.Met66Thr		Somatic				FLT1_uc010aar.1_Missense_Mutation_p.M66T|FLT1_uc001usc.3_Missense_Mutation_p.M66T|FLT1_uc010tdp.1_Missense_Mutation_p.M66T|FLT1_uc001usd.2_Missense_Mutation_p.M66T	p.M66T	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	3	482	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	66			Ig-like C2-type 1.|Extracellular (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.197T>C	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.480036	0.01035	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000450836;ENST00000539099	T;T;T	0.24151	1.87;1.87;1.87	5.81	0.113	0.14631	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.343040	0.04473	N	0.376466	T	0.04724	0.0128	N	0.00099	-2.14	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.39272	-0.9622	10	0.02654	T	1	.	5.8686	0.18791	0.2994:0.2224:0.4782:0.0	.	66;66;66;66;66	P17948-4;P17948-3;B5A924;P17948-2;P17948	.;.;.;.;VGFR1_HUMAN	T	66	ENSP00000282397:M66T;ENSP00000437631:M66T;ENSP00000442630:M66T	ENSP00000282397:M66T	M	-	2	0	FLT1	27939231	0.000000	0.05858	0.000000	0.03702	0.950000	0.60333	0.158000	0.16422	-0.324000	0.08589	-0.147000	0.13772	ATG		0.448	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			20	107	0	0	0	0.00333	0	20	107				
FRY	10129	broad.mit.edu	37	13	32653165	32653165	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:32653165C>T	ENST00000380250.3	+	2	761	c.265C>T	c.(265-267)Ccc>Tcc	p.P89S		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	89						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P89S(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TATGGCAGAGCCCCTGGTGAG	0.403																																							uc001utx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(1)|skin(1)	7						c.(265-267)CCC>TCC		furry homolog							151.0	147.0	149.0					13																	32653165		1923	4132	6055	SO:0001583	missense	10129				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane		g.chr13:32653165C>T	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.265C>T	13.37:g.32653165C>T	ENSP00000369600:p.Pro89Ser		Somatic				FRY_uc010tdw.1_RNA	p.P89S	NM_023037	NP_075463	WXS	Illumina HiSeq	Unspecified	Q5TBA9	FRY_HUMAN		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)	2	761	+		Lung SC(185;0.0271)	89					Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	c.265C>T	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737004	0.89482	.	.	ENSG00000073910	ENST00000380250;ENST00000436046	T	0.25749	1.78	5.83	5.83	0.93111	.	0.115810	0.64402	D	0.000011	T	0.40522	0.1120	L	0.58354	1.805	0.80722	D	1	D	0.57257	0.979	P	0.51918	0.684	T	0.02661	-1.1127	10	0.34782	T	0.22	.	20.1338	0.98010	0.0:1.0:0.0:0.0	.	89	Q5TBA9	FRY_HUMAN	S	89;86	ENSP00000369600:P89S	ENSP00000369600:P89S	P	+	1	0	FRY	31551165	1.000000	0.71417	0.974000	0.42286	0.976000	0.68499	7.207000	0.77899	2.770000	0.95276	0.655000	0.94253	CCC		0.403	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		20	114	0	0	0	0.001523	0	20	114				
PCDH8	5100	broad.mit.edu	37	13	53422550	53422550	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:53422550C>A	ENST00000377942.3	-	1	225	c.22G>T	c.(22-24)Ggc>Tgc	p.G8C	PCDH8_ENST00000338862.4_Missense_Mutation_p.G8C	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	8					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.G8C(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CAGGGGCTGCCCCAACGCCTC	0.592																																					GBM(36;25 841 9273 49207)	GBM(36;25 841 9273 49207)	uc001vhi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(22-24)GGC>TGC		protocadherin 8 isoform 1 precursor							38.0	37.0	37.0					13																	53422550		2203	4300	6503	SO:0001583	missense	5100				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding	g.chr13:53422550C>A	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.22G>T	13.37:g.53422550C>A	ENSP00000367177:p.Gly8Cys		Somatic				PCDH8_uc001vhj.2_Missense_Mutation_p.G8C	p.G8C	NM_002590	NP_002581	WXS	Illumina HiSeq	Unspecified	O95206	PCDH8_HUMAN		GBM - Glioblastoma multiforme(99;2.19e-08)	1	225	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	8					B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	c.22G>T	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382322	0.61845	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.52983	0.66;0.64	5.43	5.43	0.79202	.	0.000000	0.45126	D	0.000398	T	0.55369	0.1916	N	0.19112	0.55	0.38154	D	0.938823	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.63651	-0.6589	10	0.87932	D	0	.	16.1748	0.81844	0.0:1.0:0.0:0.0	.	8;8	O95206-2;O95206	.;PCDH8_HUMAN	C	8	ENSP00000367177:G8C;ENSP00000341350:G8C	ENSP00000341350:G8C	G	-	1	0	PCDH8	52320551	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	3.181000	0.50903	2.554000	0.86153	0.655000	0.94253	GGC		0.592	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590		4	51	1	0	0.00024832	0.000248	0.000297984	4	51				
PCDH17	27253	broad.mit.edu	37	13	58207733	58207733	+	Silent	SNP	C	C	A	rs372289732		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:58207733C>A	ENST00000377918.3	+	1	1079	c.1053C>A	c.(1051-1053)atC>atA	p.I351I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	351	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I351I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CGCCGTCCATCGGTTTCGTCT	0.662																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(1051-1053)ATC>ATA		protocadherin 17 precursor							62.0	61.0	61.0					13																	58207733		2203	4300	6503	SO:0001819	synonymous_variant	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58207733C>A	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1053C>A	13.37:g.58207733C>A			Somatic				PCDH17_uc010aec.1_Silent_p.I351I	p.I351I	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	1945	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	351			Extracellular (Potential).|Cadherin 3.		A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	c.1053C>A	CCDS31986.1																																																																																				0.662	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		4	36	1	0	3.59834e-05	0.001168	4.49188e-05	4	36				
GPC5	2262	broad.mit.edu	37	13	92560221	92560221	+	Silent	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:92560221C>A	ENST00000377067.3	+	6	1683	c.1311C>A	c.(1309-1311)atC>atA	p.I437I		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	437					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.I437I(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GAAATGGAATCAAAGCCCAGT	0.393																																							uc010tif.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(1309-1311)ATC>ATA		glypican 5 precursor							71.0	73.0	72.0					13																	92560221		1347	2300	3647	SO:0001819	synonymous_variant	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:92560221C>A	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1311C>A	13.37:g.92560221C>A			Somatic					p.I437I	NM_004466	NP_004457	WXS	Illumina HiSeq	Unspecified	P78333	GPC5_HUMAN			6	1677	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	437					B2R726|O60436|Q9BX27	Silent	SNP	ENST00000377067.3	37	c.1311C>A	CCDS9468.1																																																																																				0.393	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		11	59	1	0	3.07112e-06	0.000978	4.10955e-06	11	59				
GPC5	2262	broad.mit.edu	37	13	93518617	93518617	+	Silent	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr13:93518617A>T	ENST00000377067.3	+	8	2016	c.1644A>T	c.(1642-1644)gcA>gcT	p.A548A		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	548					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A548A(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CAACAGGAGCAGGATGTGCAG	0.438																																							uc010tif.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(1642-1644)GCA>GCT		glypican 5 precursor							336.0	254.0	282.0					13																	93518617		2203	4300	6503	SO:0001819	synonymous_variant	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:93518617A>T	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1644A>T	13.37:g.93518617A>T			Somatic					p.A548A	NM_004466	NP_004457	WXS	Illumina HiSeq	Unspecified	P78333	GPC5_HUMAN			8	2010	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	548					B2R726|O60436|Q9BX27	Silent	SNP	ENST00000377067.3	37	c.1644A>T	CCDS9468.1																																																																																				0.438	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		11	82	0	0	0	0.008291	0	11	82				
NPAS3	64067	broad.mit.edu	37	14	34243683	34243683	+	Silent	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr14:34243683T>C	ENST00000356141.4	+	8	993	c.993T>C	c.(991-993)caT>caC	p.H331H	NPAS3_ENST00000551492.1_Silent_p.H336H|NPAS3_ENST00000346562.2_Silent_p.H299H|NPAS3_ENST00000548645.1_Silent_p.H301H|NPAS3_ENST00000357798.5_Silent_p.H318H			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	331	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.H331H(1)|p.H318H(1)|p.H299H(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TTGACTGCCATATGTTCGTCA	0.468																																							uc001wru.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)|skin(1)	2						c.(991-993)CAT>CAC		neuronal PAS domain protein 3 isoform 3							185.0	155.0	165.0					14																	34243683		2203	4300	6503	SO:0001819	synonymous_variant	64067				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr14:34243683T>C	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.993T>C	14.37:g.34243683T>C			Somatic				NPAS3_uc001wrs.2_Silent_p.H318H|NPAS3_uc001wrt.2_Silent_p.H299H|NPAS3_uc001wrv.2_Silent_p.H301H	p.H331H	NM_173159	NP_071406	WXS	Illumina HiSeq	Unspecified	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)	8	1057	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		331			PAS 2.		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	37	c.993T>C	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	T	9.566	1.119870	0.20877	.	.	ENSG00000151322	ENST00000552874	.	.	.	5.93	2.33	0.28932	.	.	.	.	.	T	0.55465	0.1922	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47420	-0.9119	4	.	.	.	.	7.5597	0.27845	0.0:0.469:0.0:0.531	.	.	.	.	T	78	.	.	I	+	2	0	NPAS3	33313434	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.339000	0.33885	0.520000	0.28426	0.533000	0.62120	ATA		0.468	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1			30	95	0	0	0	0.002445	0	30	95				
SOS2	6655	broad.mit.edu	37	14	50600930	50600930	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr14:50600930C>A	ENST00000216373.5	-	19	3260	c.2986G>T	c.(2986-2988)Gga>Tga	p.G996*	SOS2_ENST00000543680.1_Nonsense_Mutation_p.G963*	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	996	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G996*(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GATGCACTTCCCATGGGGTTA	0.313																																							uc001wxs.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(2986-2988)GGA>TGA		son of sevenless homolog 2							132.0	143.0	139.0					14																	50600930		2203	4300	6503	SO:0001587	stop_gained	6655				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr14:50600930C>A	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2986G>T	14.37:g.50600930C>A	ENSP00000216373:p.Gly996*		Somatic				SOS2_uc010tql.1_Nonsense_Mutation_p.G963*	p.G996*	NM_006939	NP_008870	WXS	Illumina HiSeq	Unspecified	Q07890	SOS2_HUMAN			19	3084	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		996			Ras-GEF.		B7ZKT6|D3DSB4|Q15503|Q17RN1	Nonsense_Mutation	SNP	ENST00000216373.5	37	c.2986G>T	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	C	40	8.357811	0.98774	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	.	.	.	5.59	5.59	0.84812	.	0.045055	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	19.9502	0.97197	0.0:1.0:0.0:0.0	.	.	.	.	X	996;963	.	ENSP00000216373:G996X	G	-	1	0	SOS2	49670680	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.445000	0.80570	2.781000	0.95711	0.555000	0.69702	GGA		0.313	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2			28	134	1	0	6.38683e-12	0.008361	9.81777e-12	28	134				
FAM181A	90050	broad.mit.edu	37	14	94394801	94394802	+	Missense_Mutation	DNP	GG	GG	TT	rs146784848		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr14:94394801_94394802GG>TT	ENST00000267594.5	+	3	663_664	c.356_357GG>TT	c.(355-357)cGG>cTT	p.R119L	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557719.1_Missense_Mutation_p.R57L|FAM181A_ENST00000556222.1_Missense_Mutation_p.R57L|FAM181A_ENST00000557000.2_Missense_Mutation_p.R57L	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	119								p.R119L(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						CGGCTCCCGCGGGGCCTTCCTG	0.658																																							uc001ybz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(355-357)CGG>CTT		hypothetical protein LOC90050																																				SO:0001583	missense	90050							g.chr14:94394801_94394802GG>TT	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	Exception_encountered	14.37:g.94394801_94394802delinsTT	ENSP00000267594:p.Arg119Leu		Somatic				C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Missense_Mutation_p.R57L|FAM181A_uc001yca.1_Missense_Mutation_p.R57L	p.R119L	NM_138344	NP_612353	WXS	Illumina HiSeq	Unspecified	Q8N9Y4	F181A_HUMAN			3	663_664	+			119					B2RD39|Q96GY1	Missense_Mutation	DNP	ENST00000267594.5	37	c.356_357GG>TT	CCDS9914.1																																																																																				0.658	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344		8	22	0	0	0	0.004672	0	8	22				
MAGEL2	54551	broad.mit.edu	37	15	23889141	23889141	+	Silent	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:23889141T>C	ENST00000532292.1	-	1	2034	c.1940A>G	c.(1939-1941)tAa>tGa	p.*647*		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)	p.*647*(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTACACCTATTAGCGGGGAGG	0.587																																							uc001ywj.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1939-1941)TAA>TGA		MAGE-like protein 2							24.0	27.0	26.0					15																	23889141		1985	4162	6147	SO:0001819	synonymous_variant	54551							g.chr15:23889141T>C	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1940A>G	15.37:g.23889141T>C			Somatic					p.*647*	NM_019066	NP_061939	WXS	Illumina HiSeq	Unspecified				all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)	1	2035	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)							Silent	SNP	ENST00000532292.1	37	c.1940A>G																																																																																					0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066		5	22	0	0	0	0.000602	0	5	22				
NPAP1	23742	broad.mit.edu	37	15	24921430	24921430	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:24921430A>T	ENST00000329468.2	+	1	890	c.416A>T	c.(415-417)aAg>aTg	p.K139M		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	139					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.K139M(1)									AAGGCCAGGAAGCCCATCCCA	0.622																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(415-417)AAG>ATG		hypothetical protein LOC23742							38.0	34.0	35.0					15																	24921430		2200	4300	6500	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921430A>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.416A>T	15.37:g.24921430A>T	ENSP00000333735:p.Lys139Met		Somatic					p.K139M	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	890	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	139						Missense_Mutation	SNP	ENST00000329468.2	37	c.416A>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	4.160	0.028154	0.08054	.	.	ENSG00000185823	ENST00000329468	T	0.08193	3.12	2.13	-4.26	0.03755	.	2.436060	0.01901	N	0.039195	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	P	0.36438	0.553	B	0.25884	0.064	T	0.30851	-0.9964	10	0.48119	T	0.1	.	10.1975	0.43062	0.724:0.0:0.276:0.0	.	139	Q9NZP6	CO002_HUMAN	M	139	ENSP00000333735:K139M	ENSP00000333735:K139M	K	+	2	0	C15orf2	22472523	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.315000	0.08081	-2.275000	0.00679	-1.509000	0.00949	AAG		0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		6	41	0	0	0	0.001168	0	6	41				
CEP152	22995	broad.mit.edu	37	15	49054774	49054774	+	Silent	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:49054774G>A	ENST00000380950.2	-	18	2563	c.2376C>T	c.(2374-2376)ggC>ggT	p.G792G	CEP152_ENST00000325747.5_Silent_p.G699G|CEP152_ENST00000399334.3_Silent_p.G792G	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	792					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.G792G(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CAGTTTGGCTGCCACAATCTA	0.388																																							uc001zwy.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)	2						c.(2374-2376)GGC>GGT		centrosomal protein 152kDa							134.0	128.0	130.0					15																	49054774		1871	4103	5974	SO:0001819	synonymous_variant	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49054774G>A	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2376C>T	15.37:g.49054774G>A			Somatic				CEP152_uc001zwz.2_Silent_p.G792G|CEP152_uc001zxa.1_Silent_p.G699G	p.G792G	NM_014985	NP_055800	WXS	Illumina HiSeq	Unspecified	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	18	2410	-		all_lung(180;0.0428)	792					E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	37	c.2376C>T	CCDS58361.1																																																																																				0.388	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		4	100	0	0	0	0.000602	0	4	100				
DMXL2	23312	broad.mit.edu	37	15	51741321	51741321	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:51741321G>A	ENST00000251076.5	-	43	9258	c.8971C>T	c.(8971-8973)Cga>Tga	p.R2991*	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Nonsense_Mutation_p.R2992*|DMXL2_ENST00000449909.3_Nonsense_Mutation_p.R2355*	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2991						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.R2991*(2)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CCAATGTTTCGAAATATGGAC	0.438																																							uc002abf.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)|skin(3)	9						c.(8971-8973)CGA>TGA		Dmx-like 2							123.0	104.0	111.0					15																	51741321		2196	4293	6489	SO:0001587	stop_gained	23312					cell junction|synaptic vesicle membrane	Rab GTPase binding	g.chr15:51741321G>A	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.8971C>T	15.37:g.51741321G>A	ENSP00000251076:p.Arg2991*		Somatic				DMXL2_uc002abd.2_Nonsense_Mutation_p.R1083*|DMXL2_uc010ufy.1_Nonsense_Mutation_p.R2992*|DMXL2_uc010bfa.2_Nonsense_Mutation_p.R2355*|DMXL2_uc002abc.2_RNA	p.R2991*	NM_015263	NP_056078	WXS	Illumina HiSeq	Unspecified	Q8TDJ6	DMXL2_HUMAN		all cancers(107;0.00494)	43	9196	-			2991					B2RTR3|B7ZMH3|F5GWF1|O94938	Nonsense_Mutation	SNP	ENST00000251076.5	37	c.8971C>T	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	46	12.693450	0.99689	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	.	.	.	5.6	-4.24	0.03777	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	23.6153	0.99984	0.0:0.0:0.8204:0.1796	.	.	.	.	X	2991;2992;2355;557	.	ENSP00000251076:R2991X	R	-	1	2	DMXL2	49528613	1.000000	0.71417	0.879000	0.34478	0.967000	0.64934	0.661000	0.25023	-0.472000	0.06881	-0.457000	0.05445	CGA		0.438	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		31	101	0	0	0	0.002836	0	31	101				
LOC645752	645752	broad.mit.edu	37	15	78207582	78207582	+	lincRNA	SNP	C	C	A	rs542968718	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:78207582C>A	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							GTGGGGTTGTCATGGGGAGAA	0.572																																							uc010bky.2		NA																	0					0						c.(1330-1332)GAC>TAC		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78207582C>A																													15.37:g.78207582C>A			Somatic				LOC645752_uc010umq.1_Missense_Mutation_p.D91Y|uc002bcw.1_5'Flank|uc002bcx.1_5'Flank	p.D444Y	NR_027024		WXS	Illumina HiSeq	Unspecified					18	2094	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.1330G>T																																																																																					0.572	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			12	45	1	0	3.27435e-08	0.00245	4.61386e-08	12	45				
ADAMTSL3	57188	broad.mit.edu	37	15	84659933	84659933	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr15:84659933G>T	ENST00000286744.5	+	23	4164	c.3940G>T	c.(3940-3942)Gga>Tga	p.G1314*	ADAMTSL3_ENST00000567476.1_Nonsense_Mutation_p.G1314*|AC027807.1_ENST00000408557.1_RNA	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1314	Ig-like C2-type 3.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G1314*(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGCAGCCCTTGGAGCAAACGT	0.498																																							uc002bjz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(3940-3942)GGA>TGA		ADAMTS-like 3 precursor							250.0	227.0	235.0					15																	84659933		2203	4300	6503	SO:0001587	stop_gained	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84659933G>T	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3940G>T	15.37:g.84659933G>T	ENSP00000286744:p.Gly1314*		Somatic				ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.G1314*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.G1314*	p.G1314*	NM_207517	NP_997400	WXS	Illumina HiSeq	Unspecified	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		23	4164	+			1314			Ig-like C2-type 3.		A1A566|A1A567|Q9ULI7	Nonsense_Mutation	SNP	ENST00000286744.5	37	c.3940G>T	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	42	9.500087	0.99189	.	.	ENSG00000156218	ENST00000286744	.	.	.	5.21	-0.702	0.11265	.	1.880200	0.03437	N	0.208702	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	21.4546	0.99954	0.0:0.1764:0.8236:0.0	.	.	.	.	X	1314	.	ENSP00000286744:G1314X	G	+	1	0	ADAMTSL3	82450937	0.002000	0.14202	0.001000	0.08648	0.813000	0.45954	0.562000	0.23531	-0.068000	0.12953	-0.311000	0.09066	GGA		0.498	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		45	187	1	0	2.77807e-22	0.003214	4.61358e-22	45	187				
MYH11	4629	broad.mit.edu	37	16	15814806	15814806	+	Missense_Mutation	SNP	C	C	T	rs138863103		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr16:15814806C>T	ENST00000300036.5	-	33	4790	c.4681G>A	c.(4681-4683)Gcc>Acc	p.A1561T	NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.A1568T|NDE1_ENST00000396354.1_Intron|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000576790.2_Missense_Mutation_p.A1561T|MYH11_ENST00000452625.2_Missense_Mutation_p.A1568T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1561					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.A1561T(1)|p.A1568T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGCAGTTTGGCGTCCTCCGTG	0.602			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(4681-4683)GCC>ACC		smooth muscle myosin heavy chain 11 isoform		C	THR/ALA,THR/ALA,,THR/ALA,,THR/ALA	0,4394		0,0,2197	110.0	101.0	104.0		4702,4702,,4681,,4681	5.0	1.0	16	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,missense,intron,missense	MYH11,NDE1	NM_001040113.1,NM_001040114.1,NM_001143979.1,NM_002474.2,NM_017668.2,NM_022844.2	58,58,,58,,58	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,,possibly-damaging,,possibly-damaging	1568/1946,1568/1980,,1561/1973,,1561/1939	15814806	1,12993	2197	4300	6497	SO:0001583	missense	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15814806C>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.4681G>A	16.37:g.15814806C>T	ENSP00000300036:p.Ala1561Thr		Somatic				MYH11_uc002ddv.2_Missense_Mutation_p.A1568T|MYH11_uc002ddw.2_Missense_Mutation_p.A1561T|MYH11_uc002ddx.2_Missense_Mutation_p.A1568T|MYH11_uc010bvg.2_Missense_Mutation_p.A1393T|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.A267T|NDE1_uc002ddz.1_5'Flank	p.A1561T	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			33	4788	-			1561			Potential.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	c.4681G>A	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	34	5.360805	0.95877	0.0	1.16E-4	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	4.97	4.97	0.65823	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.92202	0.7527	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.997;0.997;0.997	D;D;D;D;D	0.71656	0.974;0.941;0.941;0.941;0.941	D	0.93600	0.6929	10	0.66056	D	0.02	.	17.2251	0.86967	0.0:1.0:0.0:0.0	.	1568;1561;1568;1561;1568	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	T	1561;1561;1568;1568;1568	ENSP00000300036:A1561T;ENSP00000345136:A1561T;ENSP00000379616:A1568T;ENSP00000407821:A1568T	ENSP00000300036:A1561T	A	-	1	0	MYH11	15722307	1.000000	0.71417	0.960000	0.40013	0.953000	0.61014	7.818000	0.86416	2.302000	0.77476	0.561000	0.74099	GCC		0.602	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		13	81	0	0	0	0.001855	0	13	81				
XYLT1	64131	broad.mit.edu	37	16	17211812	17211812	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr16:17211812C>A	ENST00000261381.6	-	11	2332	c.2248G>T	c.(2248-2250)Gag>Tag	p.E750*		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	750					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.E750*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AATAGCCTCTCCTTGGCATCC	0.572																																							uc002dfa.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)	4						c.(2248-2250)GAG>TAG		xylosyltransferase I							74.0	65.0	68.0					16																	17211812		2197	4300	6497	SO:0001587	stop_gained	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17211812C>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2248G>T	16.37:g.17211812C>A	ENSP00000261381:p.Glu750*		Somatic					p.E750*	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			11	2333	-			750			Lumenal (Potential).		Q9H1B6	Nonsense_Mutation	SNP	ENST00000261381.6	37	c.2248G>T	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	40	8.391391	0.98791	.	.	ENSG00000103489	ENST00000261381	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-48.4144	18.0823	0.89444	0.0:1.0:0.0:0.0	.	.	.	.	X	750	.	ENSP00000261381:E750X	E	-	1	0	XYLT1	17119313	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.625000	0.83145	2.575000	0.86900	0.462000	0.41574	GAG		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		5	40	1	0	0.000602214	0.000602	0.000708936	5	40				
TNK1	8711	broad.mit.edu	37	17	7291918	7291918	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:7291918A>C	ENST00000576812.1	+	11	2055	c.1686A>C	c.(1684-1686)agA>agC	p.R562S	TNK1_ENST00000311668.2_Missense_Mutation_p.R557S|TNK1_ENST00000570896.1_Missense_Mutation_p.R557S	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1									p.R562S(1)		central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				GGCCCAAAAGAAAACCCCCAC	0.607																																							uc002ggi.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(1684-1686)AGA>AGC		tyrosine kinase, non-receptor, 1							55.0	63.0	60.0					17																	7291918		1880	4117	5997	SO:0001583	missense	8711				protein autophosphorylation	membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity	g.chr17:7291918A>C	U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.1686A>C	17.37:g.7291918A>C	ENSP00000459799:p.Arg562Ser		Somatic				TNK1_uc002ggj.3_Missense_Mutation_p.R557S|TNK1_uc010cmf.2_RNA|TNK1_uc002ggk.3_Intron	p.R562S	NM_003985	NP_003976	WXS	Illumina HiSeq	Unspecified	Q13470	TNK1_HUMAN			11	1846	+		Prostate(122;0.157)	562			Pro-rich.			Missense_Mutation	SNP	ENST00000576812.1	37	c.1686A>C	CCDS58510.1	.	.	.	.	.	.	.	.	.	.	A	18.78	3.696727	0.68386	.	.	ENSG00000174292	ENST00000311668	T	0.76186	-1.0	4.74	3.65	0.41850	.	0.000000	0.51477	D	0.000082	T	0.67325	0.2881	N	0.08118	0	0.26670	N	0.97176	D;D	0.61080	0.989;0.981	D;D	0.75020	0.985;0.966	T	0.56914	-0.7900	10	0.45353	T	0.12	.	4.877	0.13662	0.7142:0.1891:0.0967:0.0	.	557;562	Q13470-2;Q13470	.;TNK1_HUMAN	S	557	ENSP00000312309:R557S	ENSP00000312309:R557S	R	+	3	2	TNK1	7232642	1.000000	0.71417	0.972000	0.41901	0.989000	0.77384	1.032000	0.30178	0.964000	0.38108	0.533000	0.62120	AGA		0.607	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440832.2	NM_003985		7	24	0	0	0	0.001984	0	7	24				
EVI2A	2123	broad.mit.edu	37	17	29645432	29645432	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:29645432T>G	ENST00000462804.2	-	2	999	c.600A>C	c.(598-600)aaA>aaC	p.K200N	NF1_ENST00000581113.2_3'UTR|EVI2A_ENST00000247270.3_Missense_Mutation_p.K223N|CTD-2370N5.3_ENST00000578584.1_Missense_Mutation_p.T140P|NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron|EVI2A_ENST00000461237.1_Missense_Mutation_p.K200N	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	200					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)|p.K223N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		CTGTGAGCTGTTTTGTTCTTT	0.453																																							uc002hgm.2		NA																	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)		soft_tissue(7)|lung(2)|autonomic_ganglia(2)|central_nervous_system(1)	ovary(1)|breast(1)	2						c.(598-600)AAA>AAC		ecotropic viral integration site 2A isoform 2							97.0	83.0	88.0					17																	29645432		2203	4300	6503	SO:0001583	missense	2123					integral to membrane	transmembrane receptor activity	g.chr17:29645432T>G	M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.600A>C	17.37:g.29645432T>G	ENSP00000420557:p.Lys200Asn		Somatic				NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2A_uc002hgl.2_Missense_Mutation_p.K223N	p.K200N	NM_014210	NP_055025	WXS	Illumina HiSeq	Unspecified	P22794	EVI2A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)	2	815	-		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)	200			Cytoplasmic (Potential).		B2R5X2|B4DHX8	Missense_Mutation	SNP	ENST00000462804.2	37	c.600A>C	CCDS42293.1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.660863	0.47572	.	.	ENSG00000126860	ENST00000394755;ENST00000462804;ENST00000461237;ENST00000247270	.	.	.	5.57	-0.65	0.11457	.	0.426123	0.24172	N	0.040886	T	0.52008	0.1708	M	0.62723	1.935	0.80722	D	1	P;D	0.53462	0.922;0.96	P;P	0.50537	0.502;0.643	T	0.51888	-0.8648	9	0.72032	D	0.01	.	6.9001	0.24277	0.0:0.3803:0.1257:0.494	.	200;223	P22794;P22794-2	EVI2A_HUMAN;.	N	200;196;200;223	.	ENSP00000247270:K223N	K	-	3	2	EVI2A	26669558	0.988000	0.35896	0.986000	0.45419	0.987000	0.75469	-0.018000	0.12568	-0.140000	0.11394	-0.250000	0.11733	AAA		0.453	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354491.3	NM_014210		6	44	0	0	0	0.004482	0	6	44				
SLFN13	146857	broad.mit.edu	37	17	33769261	33769261	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:33769261C>A	ENST00000285013.6	-	5	1518	c.1243G>T	c.(1243-1245)Gag>Tag	p.E415*	SLFN13_ENST00000360502.2_Nonsense_Mutation_p.E97*|SLFN13_ENST00000533791.1_Nonsense_Mutation_p.E415*|SLFN13_ENST00000534689.1_Nonsense_Mutation_p.E97*|SLFN13_ENST00000526861.1_Nonsense_Mutation_p.E415*|SLFN13_ENST00000542635.1_Nonsense_Mutation_p.E415*	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	415						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.E415*(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AAAGACAGCTCCTTCCAGAGG	0.428																																							uc002hjk.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1243-1245)GAG>TAG		schlafen family member 13							63.0	60.0	61.0					17																	33769261		2203	4300	6503	SO:0001587	stop_gained	146857					intracellular	ATP binding	g.chr17:33769261C>A	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1243G>T	17.37:g.33769261C>A	ENSP00000285013:p.Glu415*		Somatic				SLFN13_uc010wch.1_Nonsense_Mutation_p.E415*|SLFN13_uc002hjl.2_Nonsense_Mutation_p.E415*|SLFN13_uc010ctt.2_Nonsense_Mutation_p.E97*|SLFN13_uc002hjm.2_Nonsense_Mutation_p.E84*	p.E415*	NM_144682	NP_653283	WXS	Illumina HiSeq	Unspecified	Q68D06	SLN13_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	3	1573	-			415					E1P645|Q658M1|Q6ZS51|Q96A81	Nonsense_Mutation	SNP	ENST00000285013.6	37	c.1243G>T	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	c	32	5.163151	0.94727	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	.	.	.	3.07	3.07	0.35406	.	0.142304	0.32258	N	0.006350	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	9.7067	0.40220	0.0:1.0:0.0:0.0	.	.	.	.	X	415;97;415;415;97;84	.	ENSP00000285013:E415X	E	-	1	0	SLFN13	30793374	0.023000	0.18921	0.018000	0.16275	0.058000	0.15608	0.585000	0.23879	1.701000	0.51217	0.407000	0.27541	GAG		0.428	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682		6	61	1	0	3.59834e-05	0.001168	4.49188e-05	6	61				
GDPD1	284161	broad.mit.edu	37	17	57311875	57311875	+	Silent	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:57311875T>C	ENST00000284116.4	+	2	302	c.165T>C	c.(163-165)aaT>aaC	p.N55N	GDPD1_ENST00000581276.1_Silent_p.N55N|GDPD1_ENST00000581140.1_Silent_p.N55N	NM_182569.3	NP_872375.2	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain containing 1	55	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)	p.N55N(2)		endometrium(1)|kidney(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					ATTTGGAGAATACAATGGCAG	0.289																																							uc002ixk.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(163-165)AAT>AAC		glycerophosphodiester phosphodiesterase domain							56.0	60.0	59.0					17																	57311875		2203	4298	6501	SO:0001819	synonymous_variant	284161				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding	g.chr17:57311875T>C	AK094770	CCDS11616.1, CCDS58583.1, CCDS58584.1	17q23.2	2011-01-25				ENSG00000153982			20883	protein-coding gene	gene with protein product						14612981	Standard	NM_182569		Approved	FLJ37451, GDE4	uc002ixk.2	Q8N9F7		ENST00000284116.4:c.165T>C	17.37:g.57311875T>C			Somatic				GDPD1_uc002ixj.2_Silent_p.N55N	p.N55N	NM_182569	NP_872375	WXS	Illumina HiSeq	Unspecified	Q8N9F7	GDPD1_HUMAN			2	302	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		55			Cytoplasmic (Potential).|GDPD.		A8W735|Q56VR1|Q8N4E3	Silent	SNP	ENST00000284116.4	37	c.165T>C	CCDS11616.1																																																																																				0.289	GDPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446024.1	NM_182569		5	65	0	0	0	0.001168	0	5	65				
RGS9	8787	broad.mit.edu	37	17	63133675	63133675	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:63133675A>G	ENST00000262406.9	+	1	84	c.17A>G	c.(16-18)cAa>cGa	p.Q6R	RGS9_ENST00000449996.3_Missense_Mutation_p.Q6R|RGS9_ENST00000443584.3_Missense_Mutation_p.Q6R	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	6					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.Q6R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						ATCCGACACCAAGGCCAGCAG	0.622																																							uc002jfe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(16-18)CAA>CGA		regulator of G-protein signaling 9 isoform 1							52.0	57.0	55.0					17																	63133675		1959	4133	6092	SO:0001583	missense	8787				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr17:63133675A>G	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.17A>G	17.37:g.63133675A>G	ENSP00000262406:p.Gln6Arg		Somatic				RGS9_uc010dem.2_Missense_Mutation_p.Q6R|RGS9_uc002jfd.2_Missense_Mutation_p.Q6R|RGS9_uc002jff.2_RNA	p.Q6R	NM_003835	NP_003826	WXS	Illumina HiSeq	Unspecified	O75916	RGS9_HUMAN			1	127	+			6					A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	c.17A>G	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.897558	0.33535	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T;T	0.30448	1.54;1.53;1.53	4.01	4.01	0.46588	.	0.114155	0.64402	D	0.000010	T	0.38772	0.1053	L	0.33485	1.01	0.27679	N	0.946503	D;P;P	0.54601	0.967;0.539;0.669	D;B;B	0.65140	0.932;0.057;0.122	T	0.09930	-1.0652	10	0.54805	T	0.06	.	9.481	0.38900	1.0:0.0:0.0:0.0	.	6;6;6	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	R	6	ENSP00000262406:Q6R;ENSP00000396329:Q6R;ENSP00000405814:Q6R	ENSP00000262406:Q6R	Q	+	2	0	RGS9	60564137	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.313000	0.59160	1.808000	0.52836	0.260000	0.18958	CAA		0.622	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835		8	54	0	0	0	0.008291	0	8	54				
ANKRD30B	374860	broad.mit.edu	37	18	14851640	14851640	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr18:14851640G>T	ENST00000358984.4	+	36	3520	c.3340G>T	c.(3340-3342)Gag>Tag	p.E1114*		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1114								p.E1114*(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TAAATACTTTGAGGACATTAA	0.348																																							uc010dlo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3340-3342)GAG>TAG		ankyrin repeat domain 30B							27.0	25.0	25.0					18																	14851640		692	1589	2281	SO:0001587	stop_gained	374860							g.chr18:14851640G>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3340G>T	18.37:g.14851640G>T	ENSP00000351875:p.Glu1114*		Somatic				ANKRD30B_uc010xal.1_Nonsense_Mutation_p.E256*	p.E1114*	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			36	3520	+			1199			Potential.		B4DGP1|F8WAG3|Q4G175	Nonsense_Mutation	SNP	ENST00000358984.4	37	c.3340G>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	G	38	6.847382	0.97881	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	.	.	.	1.39	1.39	0.22231	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	8.7313	0.34501	0.0:0.0:1.0:0.0	.	.	.	.	X	1114;508;534	.	ENSP00000277669:E534X	E	+	1	0	ANKRD30B	14841640	1.000000	0.71417	0.676000	0.29932	0.552000	0.35366	4.135000	0.57997	1.076000	0.40961	0.173000	0.16961	GAG		0.348	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		7	24	1	0	2.17888e-05	0.006214	2.79497e-05	7	24				
RTTN	25914	broad.mit.edu	37	18	67727182	67727182	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr18:67727182G>A	ENST00000255674.6	-	36	5130	c.4844C>T	c.(4843-4845)tCa>tTa	p.S1615L	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1615					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.S1615L(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GCACATTGCTGAAAGAAGAGA	0.468																																							uc002lkp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8						c.(4843-4845)TCA>TTA		rotatin							117.0	119.0	118.0					18																	67727182		1942	4141	6083	SO:0001583	missense	25914						binding	g.chr18:67727182G>A	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4844C>T	18.37:g.67727182G>A	ENSP00000255674:p.Ser1615Leu		Somatic				RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.S703L|RTTN_uc010dqp.2_5'UTR	p.S1615L	NM_173630	NP_775901	WXS	Illumina HiSeq	Unspecified	Q86VV8	RTTN_HUMAN			36	4912	-		Esophageal squamous(42;0.129)	1615					Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	c.4844C>T	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032653	0.54790	.	.	ENSG00000176225	ENST00000255674	T	0.54071	0.59	5.92	5.92	0.95590	Armadillo-like helical (1);	0.266842	0.38272	N	0.001748	T	0.45875	0.1364	L	0.50333	1.59	0.80722	D	1	B	0.33379	0.41	B	0.29524	0.103	T	0.35025	-0.9805	10	0.13470	T	0.59	.	17.2511	0.87042	0.0:0.0:1.0:0.0	.	1615	Q86VV8	RTTN_HUMAN	L	1615	ENSP00000255674:S1615L	ENSP00000255674:S1615L	S	-	2	0	RTTN	65878162	0.996000	0.38824	0.039000	0.18376	0.108000	0.19459	5.526000	0.67116	2.822000	0.97130	0.650000	0.86243	TCA		0.468	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		22	36	0	0	0	0.001882	0	22	36				
SALL3	27164	broad.mit.edu	37	18	76754914	76754914	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr18:76754914C>A	ENST00000537592.2	+	2	2923	c.2923C>A	c.(2923-2925)Ccc>Acc	p.P975T	SALL3_ENST00000575389.2_Intron|SALL3_ENST00000536229.3_Intron	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	975					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P975T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGGTAAGTGTCCCAGCACTGT	0.657																																							uc002lmt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(2923-2925)CCC>ACC		sal-like 3							46.0	42.0	44.0					18																	76754914		2201	4300	6501	SO:0001583	missense	27164				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:76754914C>A	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2923C>A	18.37:g.76754914C>A	ENSP00000441823:p.Pro975Thr		Somatic				SALL3_uc010dra.2_Intron	p.P975T	NM_171999	NP_741996	WXS	Illumina HiSeq	Unspecified	Q9BXA9	SALL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	2	2923	+		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)	975					Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	c.2923C>A	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	C	0.896	-0.723875	0.03158	.	.	ENSG00000256463	ENST00000537592	T	0.16897	2.31	5.28	-5.06	0.02946	.	16.987600	0.00424	N	0.000078	T	0.14227	0.0344	L	0.39898	1.24	0.43214	D	0.995089	B	0.15141	0.012	B	0.12156	0.007	T	0.24905	-1.0147	10	0.62326	D	0.03	-2.3025	6.1177	0.20136	0.2034:0.5819:0.1189:0.0957	.	975	Q9BXA9	SALL3_HUMAN	T	975	ENSP00000441823:P975T	ENSP00000299466:P975T	P	+	1	0	SALL3	74855902	0.337000	0.24766	0.071000	0.20095	0.104000	0.19210	0.217000	0.17603	-0.663000	0.05331	-0.291000	0.09656	CCC		0.657	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		10	12	1	0	7.48243e-07	0.006214	1.01586e-06	10	12				
PALM	5064	broad.mit.edu	37	19	746366	746366	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:746366C>A	ENST00000338448.5	+	9	762	c.716C>A	c.(715-717)gCg>gAg	p.A239E	PALM_ENST00000593172.1_3'UTR|PALM_ENST00000264560.7_Missense_Mutation_p.A195E	NM_002579.2	NP_002570.2	O75781	PALM_HUMAN	paralemmin	239					cellular component movement (GO:0006928)|cellular response to electrical stimulus (GO:0071257)|cytoskeleton organization (GO:0007010)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of filopodium assembly (GO:0051491)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)|synapse maturation (GO:0060074)	apicolateral plasma membrane (GO:0016327)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasmic membrane-bounded vesicle (GO:0016023)|dendrite membrane (GO:0032590)|dendritic spine membrane (GO:0032591)|filopodium membrane (GO:0031527)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A239E(1)		endometrium(2)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		ATCCACAAAGCGGACGAGGTC	0.697																																							uc002lpm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(715-717)GCG>GAG		paralemmin isoform 1							41.0	42.0	42.0					19																	746366		2203	4300	6503	SO:0001583	missense	5064				cellular component movement|negative regulation of adenylate cyclase activity|negative regulation of dopamine receptor signaling pathway|positive regulation of filopodium assembly|regulation of cell shape	cytoplasmic membrane-bounded vesicle|filopodium membrane|integral to plasma membrane		g.chr19:746366C>A	Y16270	CCDS32857.1, CCDS32858.1	19p13.3	2008-07-17				ENSG00000099864			8594	protein-coding gene	gene with protein product		608134				9615234, 9813098	Standard	XM_005259565		Approved	KIAA0270	uc002lpm.1	O75781		ENST00000338448.5:c.716C>A	19.37:g.746366C>A	ENSP00000341911:p.Ala239Glu		Somatic				PALM_uc002lpn.1_Missense_Mutation_p.A195E|PALM_uc010xfu.1_Missense_Mutation_p.A104E	p.A239E	NM_002579	NP_002570	WXS	Illumina HiSeq	Unspecified	O75781	PALM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)	9	910	+		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	239					O43359|O95673|Q92559|Q9UPJ4|Q9UQS2|Q9UQS3	Missense_Mutation	SNP	ENST00000338448.5	37	c.716C>A	CCDS32857.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693767	0.88735	.	.	ENSG00000099864	ENST00000338448;ENST00000264560;ENST00000538247	T;T	0.30714	1.52;1.52	4.71	4.71	0.59529	.	0.221592	0.45867	D	0.000339	T	0.60856	0.2301	M	0.85630	2.765	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.69243	-0.5196	10	0.87932	D	0	-20.1003	16.6372	0.85062	0.0:1.0:0.0:0.0	.	195;239	O75781-2;O75781	.;PALM_HUMAN	E	239;195;104	ENSP00000341911:A239E;ENSP00000264560:A195E	ENSP00000264560:A195E	A	+	2	0	PALM	697366	1.000000	0.71417	0.711000	0.30485	0.702000	0.40608	6.901000	0.75693	2.157000	0.67596	0.462000	0.41574	GCG		0.697	PALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457592.1	NM_002579		15	36	1	0	1.5739e-10	0.004007	2.32337e-10	15	36				
COL5A3	50509	broad.mit.edu	37	19	10102467	10102467	+	Silent	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:10102467G>A	ENST00000264828.3	-	23	2029	c.1944C>T	c.(1942-1944)tcC>tcT	p.S648S		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	648	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.S648S(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TTCAAACCTGGGACCCATGGT	0.557																																							uc002mmq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(1942-1944)TCC>TCT		collagen, type V, alpha 3 preproprotein							89.0	86.0	87.0					19																	10102467		2203	4300	6503	SO:0001819	synonymous_variant	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10102467G>A	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1944C>T	19.37:g.10102467G>A			Somatic					p.S648S	NM_015719	NP_056534	WXS	Illumina HiSeq	Unspecified	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		23	2030	-			648			Triple-helical region.		Q9NZQ6	Silent	SNP	ENST00000264828.3	37	c.1944C>T	CCDS12222.1																																																																																				0.557	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		6	106	0	0	0	0.004482	0	6	106				
KEAP1	9817	broad.mit.edu	37	19	10600347	10600347	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:10600347A>T	ENST00000171111.5	-	4	2055	c.1508T>A	c.(1507-1509)aTg>aAg	p.M503K	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.M503K|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	503					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.M503K(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GATGGTGTTCATTGCTGTGAT	0.597																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1507-1509)ATG>AAG		kelch-like ECH-associated protein 1							96.0	78.0	84.0					19																	10600347		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600347A>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1508T>A	19.37:g.10600347A>T	ENSP00000171111:p.Met503Lys		Somatic				KEAP1_uc002mop.1_Missense_Mutation_p.M221K|KEAP1_uc002mor.1_Missense_Mutation_p.M503K	p.M503K	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1664	-			503			Kelch 4.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1508T>A	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647209	0.87958	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.84070	-1.8;-1.8	5.67	5.67	0.87782	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.93979	0.8072	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95634	0.8692	10	0.87932	D	0	.	13.9128	0.63878	1.0:0.0:0.0:0.0	.	503	Q14145	KEAP1_HUMAN	K	503	ENSP00000171111:M503K;ENSP00000377245:M503K	ENSP00000171111:M503K	M	-	2	0	KEAP1	10461347	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.627000	0.74258	2.174000	0.68829	0.456000	0.33151	ATG		0.597	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		22	49	0	0	0	0.00333	0	22	49				
KRI1	65095	broad.mit.edu	37	19	10668512	10668512	+	Silent	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:10668512C>A	ENST00000312962.6	-	15	1456	c.1437G>T	c.(1435-1437)acG>acT	p.T479T	KRI1_ENST00000361821.5_Silent_p.T475T	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	473						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.T479T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TCTTCTTGCCCGTCAAGGGGG	0.677																																							uc002moy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1435-1437)ACG>ACT		KRI1 homolog							34.0	35.0	35.0					19																	10668512		2203	4300	6503	SO:0001819	synonymous_variant	65095							g.chr19:10668512C>A		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.1437G>T	19.37:g.10668512C>A			Somatic				KRI1_uc002mow.1_Silent_p.T98T|KRI1_uc002mox.1_Silent_p.T475T	p.T479T	NM_023008	NP_075384	WXS	Illumina HiSeq	Unspecified	Q8N9T8	KRI1_HUMAN	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		15	1446	-			479					Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Silent	SNP	ENST00000312962.6	37	c.1437G>T	CCDS12242.1																																																																																				0.677	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	NM_023008		5	27	1	0	2.7689e-08	0.001984	3.93141e-08	5	27				
EMR2	30817	broad.mit.edu	37	19	14854511	14854511	+	Silent	SNP	G	G	T	rs201317256		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:14854511G>T	ENST00000315576.3	-	19	2720	c.2269C>A	c.(2269-2271)Cgg>Agg	p.R757R	EMR2_ENST00000596991.2_Silent_p.R746R|EMR2_ENST00000595839.1_Silent_p.R615R|EMR2_ENST00000594076.1_Silent_p.R664R|EMR2_ENST00000392967.2_Silent_p.R746R|EMR2_ENST00000353005.1_Silent_p.R615R|EMR2_ENST00000594294.1_Silent_p.R708R|EMR2_ENST00000601345.1_Silent_p.R746R|EMR2_ENST00000392965.3_Silent_p.R699R|EMR2_ENST00000353876.1_Silent_p.R664R|EMR2_ENST00000346057.1_Silent_p.R708R	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	757					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)	p.R757R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GCCATGACCCGGGCAGCCGGA	0.577																																							uc002mzp.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)|skin(1)	4						c.(2269-2271)CGG>AGG		egf-like module containing, mucin-like, hormone							143.0	128.0	133.0					19																	14854511		2203	4300	6503	SO:0001819	synonymous_variant	30817				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14854511G>T	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.2269C>A	19.37:g.14854511G>T			Somatic				EMR2_uc010dzs.1_Silent_p.R216R|EMR2_uc010xnw.1_Silent_p.R699R|EMR2_uc002mzo.1_Silent_p.R746R|EMR2_uc002mzq.1_Silent_p.R697R|EMR2_uc002mzr.1_Silent_p.R708R|EMR2_uc002mzs.1_Silent_p.R615R|EMR2_uc002mzt.1_Silent_p.R653R|EMR2_uc002mzu.1_Silent_p.R664R|EMR2_uc010xnx.1_RNA	p.R757R	NM_013447	NP_038475	WXS	Illumina HiSeq	Unspecified	Q9UHX3	EMR2_HUMAN			19	2725	-			757			Extracellular (Potential).		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Silent	SNP	ENST00000315576.3	37	c.2269C>A	CCDS32935.1																																																																																				0.577	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			44	67	1	0	5.48756e-27	0.002852	9.19537e-27	44	67				
NLRP13	126204	broad.mit.edu	37	19	56424482	56424482	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr19:56424482A>T	ENST00000342929.3	-	5	700	c.701T>A	c.(700-702)gTg>gAg	p.V234E	NLRP13_ENST00000588751.1_Missense_Mutation_p.V234E	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	234	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)	p.V234E(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TGCCCTCCCCACCAAGACTAT	0.502																																							uc010ygg.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(1)|lung(1)	9						c.(700-702)GTG>GAG		NACHT, leucine rich repeat and PYD containing							113.0	116.0	115.0					19																	56424482		2203	4300	6503	SO:0001583	missense	126204						ATP binding	g.chr19:56424482A>T	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.701T>A	19.37:g.56424482A>T	ENSP00000343891:p.Val234Glu		Somatic					p.V234E	NM_176810	NP_789780	WXS	Illumina HiSeq	Unspecified	Q86W25	NAL13_HUMAN		GBM - Glioblastoma multiforme(193;0.0642)	5	726	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	234			NACHT.		Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	c.701T>A	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-2.016293	0.00418	.	.	ENSG00000173572	ENST00000342929	D	0.82433	-1.61	2.81	0.531	0.17108	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.50240	0.1604	N	0.00760	-1.21	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.44498	-0.9324	9	0.14656	T	0.56	.	3.5205	0.07740	0.2277:0.0:0.222:0.5503	.	234	Q86W25	NAL13_HUMAN	E	234	ENSP00000343891:V234E	ENSP00000343891:V234E	V	-	2	0	NLRP13	61116294	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.004000	0.13106	-0.072000	0.12864	-1.629000	0.00783	GTG		0.502	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		55	106	0	0	0	0.00361	0	55	106				
GREB1	9687	broad.mit.edu	37	2	11740993	11740993	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:11740993T>C	ENST00000381486.2	+	16	2701	c.2401T>C	c.(2401-2403)Tgc>Cgc	p.C801R	GREB1_ENST00000234142.5_Missense_Mutation_p.C801R	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	801						integral component of membrane (GO:0016021)		p.C801R(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ATTGCTCAACTGCAGGGAGGT	0.527																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2401-2403)TGC>CGC		growth regulation by estrogen in breast cancer 1							199.0	210.0	206.0					2																	11740993		2086	4218	6304	SO:0001583	missense	9687					integral to membrane		g.chr2:11740993T>C		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2401T>C	2.37:g.11740993T>C	ENSP00000370896:p.Cys801Arg		Somatic				GREB1_uc002rbo.1_Missense_Mutation_p.C435R	p.C801R	NM_014668	NP_055483	WXS	Illumina HiSeq	Unspecified	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	16	2701	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		801					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.2401T>C	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.553934	0.86231	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.50001	0.76;0.76;0.76	5.84	5.84	0.93424	.	0.062950	0.64402	D	0.000002	T	0.66896	0.2836	M	0.71036	2.16	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.66497	0.931;0.944	T	0.68405	-0.5417	10	0.51188	T	0.08	-30.4997	16.2108	0.82158	0.0:0.0:0.0:1.0	.	435;801	C9JIG0;Q4ZG55	.;GREB1_HUMAN	R	801;801;435	ENSP00000370896:C801R;ENSP00000234142:C801R;ENSP00000403886:C435R	ENSP00000234142:C801R	C	+	1	0	GREB1	11658444	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.195000	0.72088	2.232000	0.73038	0.533000	0.62120	TGC		0.527	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		43	182	0	0	0	0.00361	0	43	182				
GALNT14	79623	broad.mit.edu	37	2	31147016	31147016	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:31147016G>T	ENST00000349752.5	-	13	1988	c.1349C>A	c.(1348-1350)gCc>gAc	p.A450D	GALNT14_ENST00000406653.1_Missense_Mutation_p.A430D|GALNT14_ENST00000324589.5_Missense_Mutation_p.A455D|GALNT14_ENST00000356174.3_Missense_Mutation_p.A417D|GALNT14_ENST00000420311.2_Missense_Mutation_p.A415D|GALNT14_ENST00000486564.1_Intron	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	450	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A450D(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TTTGACCTTGGCACAGGGGCT	0.517																																							uc002rnr.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|skin(1)	3						c.(1348-1350)GCC>GAC		N-acetylgalactosaminyltransferase 14							317.0	289.0	299.0					2																	31147016		2203	4300	6503	SO:0001583	missense	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31147016G>T	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1349C>A	2.37:g.31147016G>T	ENSP00000288988:p.Ala450Asp		Somatic				GALNT14_uc002rnq.2_Missense_Mutation_p.A430D|GALNT14_uc002rns.2_Missense_Mutation_p.A455D|GALNT14_uc010ymr.1_Missense_Mutation_p.A415D|GALNT14_uc010ezo.1_Missense_Mutation_p.A417D	p.A450D	NM_024572	NP_078848	WXS	Illumina HiSeq	Unspecified	Q96FL9	GLT14_HUMAN			13	1968	-	Acute lymphoblastic leukemia(172;0.155)		450			Lumenal (Potential).|Ricin B-type lectin.		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	c.1349C>A	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	G	8.953	0.968618	0.18659	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	4.63	-0.694	0.11294	Ricin B-related lectin (1);Ricin B lectin (3);	0.890728	0.09631	N	0.776311	T	0.13415	0.0325	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.28584	0.017;0.078;0.216;0.04;0.096	B;B;B;B;B	0.31191	0.062;0.033;0.125;0.063;0.09	T	0.31475	-0.9942	10	0.29301	T	0.29	.	1.1588	0.01801	0.3643:0.2645:0.2425:0.1287	.	415;417;455;450;430	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	D	450;455;430;417;415	ENSP00000288988:A450D;ENSP00000314500:A455D;ENSP00000385435:A430D;ENSP00000348497:A417D;ENSP00000415514:A415D	ENSP00000314500:A455D	A	-	2	0	GALNT14	31000520	0.144000	0.22641	0.733000	0.30861	0.404000	0.30871	0.367000	0.20382	-0.411000	0.07530	-0.471000	0.05019	GCC		0.517	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		54	189	1	0	9.79885e-19	0.00361	1.55777e-18	54	189				
TEKT4	150483	broad.mit.edu	37	2	95537412	95537412	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:95537412G>A	ENST00000295201.4	+	1	225	c.88G>A	c.(88-90)Gcc>Acc	p.A30T	AC097374.2_ENST00000568768.1_RNA|TEKT4_ENST00000427593.2_Missense_Mutation_p.A30T	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	30					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.A30T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CTCCGGCCTGGCCACCGCCAG	0.672																																							uc002stw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(88-90)GCC>ACC		tektin 4							25.0	29.0	28.0					2																	95537412		2152	4179	6331	SO:0001583	missense	150483				cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		g.chr2:95537412G>A	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.88G>A	2.37:g.95537412G>A	ENSP00000295201:p.Ala30Thr		Somatic				uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	p.A30T	NM_144705	NP_653306	WXS	Illumina HiSeq	Unspecified	Q8WW24	TEKT4_HUMAN			1	181	+			30						Missense_Mutation	SNP	ENST00000295201.4	37	c.88G>A	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	14.01	2.408925	0.42715	.	.	ENSG00000163060	ENST00000295201;ENST00000427593	T;T	0.16597	3.68;2.33	1.85	1.85	0.25348	.	0.060841	0.64402	D	0.000003	T	0.08179	0.0204	N	0.08118	0	0.46396	D	0.999021	P	0.50617	0.937	B	0.42138	0.377	T	0.27872	-1.0061	10	0.34782	T	0.22	-15.6133	9.3018	0.37851	0.0:0.0:1.0:0.0	.	30	Q8WW24	TEKT4_HUMAN	T	30	ENSP00000295201:A30T;ENSP00000407596:A30T	ENSP00000295201:A30T	A	+	1	0	TEKT4	94901139	0.996000	0.38824	0.797000	0.32132	0.056000	0.15407	2.519000	0.45546	1.021000	0.39600	0.460000	0.39030	GCC		0.672	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705		4	27	0	0	0	0.000248	0	4	27				
IL1RL1	9173	broad.mit.edu	37	2	102956626	102956627	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:102956626_102956627CA>AG	ENST00000233954.1	+	4	612_613	c.341_342CA>AG	c.(340-342)cCA>cAG	p.P114Q	IL1RL1_ENST00000311734.2_Missense_Mutation_p.P114Q|IL1RL1_ENST00000393393.3_Missense_Mutation_p.P114Q|IL1RL1_ENST00000473175.1_3'UTR|IL1RL1_ENST00000409584.1_Missense_Mutation_p.P114Q|IL1RL1_ENST00000404917.2_5'UTR	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	114	Ig-like C2-type 2.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)	p.P114Q(2)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TGCAATGTTCCAGATTATTTGA	0.347																																							uc002tbu.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(340-342)CCA>CAG		interleukin 1 receptor-like 1 isoform 1																																				SO:0001583	missense	9173				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity	g.chr2:102956626_102956627CA>AG	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	Exception_encountered	2.37:g.102956626_102956627delinsAG	ENSP00000233954:p.Pro114Gln		Somatic				IL1RL1_uc010ywa.1_5'UTR|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Missense_Mutation_p.P114Q	p.P114Q	NM_016232	NP_057316	WXS	Illumina HiSeq	Unspecified	Q01638	ILRL1_HUMAN			4	612_613	+			114			Ig-like C2-type 2.|Extracellular (Potential).		A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	DNP	ENST00000233954.1	37	c.341_342CA>AG	CCDS2057.1																																																																																				0.347	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232		16	50	0	0	0	0.004672	0	16	50				
NIFK	84365	broad.mit.edu	37	2	122488515	122488515	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:122488515C>G	ENST00000285814.4	-	4	590	c.518G>C	c.(517-519)aGg>aCg	p.R173T	AC018737.1_ENST00000419902.1_RNA	NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		173					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R173T(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						TAATTTCTTCCTGAGTAATCT	0.393																																							uc002tnk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(517-519)AGG>ACG		MKI67 interacting nucleolar phosphoprotein							116.0	117.0	116.0					2																	122488515		2202	4300	6502	SO:0001583	missense	84365				protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr2:122488515C>G																												ENST00000285814.4:c.518G>C	2.37:g.122488515C>G	ENSP00000285814:p.Arg173Thr		Somatic				MKI67IP_uc010fls.2_Missense_Mutation_p.R173T	p.R173T	NM_032390	NP_115766	WXS	Illumina HiSeq	Unspecified	Q9BYG3	MK67I_HUMAN			4	595	-			173					A8K788|Q8TB66|Q96ED4	Missense_Mutation	SNP	ENST00000285814.4	37	c.518G>C	CCDS2135.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514913	0.64634	.	.	ENSG00000155438	ENST00000285814;ENST00000409201;ENST00000423105;ENST00000447132;ENST00000451734	T;T;T	0.54279	2.19;0.58;1.45	5.65	5.65	0.86999	.	0.046520	0.85682	D	0.000000	T	0.59376	0.2189	M	0.68317	2.08	0.53688	D	0.99997	P;P	0.48834	0.916;0.483	P;B	0.47376	0.545;0.122	T	0.62969	-0.6741	10	0.56958	D	0.05	-11.081	15.2323	0.73401	0.0:1.0:0.0:0.0	.	173;173	B4DSM4;Q9BYG3	.;MK67I_HUMAN	T	173;173;2;68;141	ENSP00000285814:R173T;ENSP00000406227:R68T;ENSP00000398116:R141T	ENSP00000285814:R173T	R	-	2	0	MKI67IP	122204985	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	5.870000	0.69620	2.668000	0.90789	0.655000	0.94253	AGG		0.393	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254239.2			12	116	0	0	0	0.001855	0	12	116				
TUBA3E	112714	broad.mit.edu	37	2	130953906	130953906	+	Silent	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:130953906G>T	ENST00000312988.7	-	2	142	c.42C>A	c.(40-42)gtC>gtA	p.V14V		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	14					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.V14V(1)		endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TGCCGATCTGGACACCCGCCT	0.502																																							uc002tqv.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(40-42)GTC>GTA		tubulin, alpha 3e							99.0	92.0	95.0					2																	130953906		2203	4298	6501	SO:0001819	synonymous_variant	112714				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr2:130953906G>T	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.42C>A	2.37:g.130953906G>T			Somatic					p.V14V	NM_207312	NP_997195	WXS	Illumina HiSeq	Unspecified	Q6PEY2	TBA3E_HUMAN			2	143	-	Colorectal(110;0.1)		14						Silent	SNP	ENST00000312988.7	37	c.42C>A	CCDS2158.1																																																																																				0.502	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312		15	68	1	0	1.1804e-14	0.003954	1.86062e-14	15	68				
CCDC74A	90557	broad.mit.edu	37	2	132288316	132288316	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:132288316G>T	ENST00000295171.6	+	3	598	c.460G>T	c.(460-462)Ggc>Tgc	p.G154C	CCDC74A_ENST00000467992.2_Missense_Mutation_p.G256C|CCDC74A_ENST00000409856.3_Intron	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	154								p.G154C(1)		endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GCGTCTTGCGGGCGGTAGCGC	0.632																																							uc002tta.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(460-462)GGC>TGC		coiled-coil domain containing 74A							101.0	95.0	97.0					2																	132288316		2202	4300	6502	SO:0001583	missense	90557							g.chr2:132288316G>T		CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.460G>T	2.37:g.132288316G>T	ENSP00000295171:p.Gly154Cys		Somatic				CCDC74A_uc002ttb.2_Intron	p.G154C	NM_138770	NP_620125	WXS	Illumina HiSeq	Unspecified	Q96AQ1	CC74A_HUMAN			3	512	+			154					Q6P4I5	Missense_Mutation	SNP	ENST00000295171.6	37	c.460G>T	CCDS2167.1	.	.	.	.	.	.	.	.	.	.	.	10.90	1.482337	0.26598	.	.	ENSG00000163040	ENST00000295171;ENST00000467992	T;T	0.55052	1.52;0.54	1.88	-3.75	0.04372	.	.	.	.	.	T	0.38904	0.1058	L	0.46157	1.445	0.09310	N	1	B	0.20671	0.047	B	0.08055	0.003	T	0.12993	-1.0526	9	0.56958	D	0.05	.	5.6832	0.17788	0.0:0.2903:0.5039:0.2058	.	154	Q96AQ1	CC74A_HUMAN	C	154;256	ENSP00000295171:G154C;ENSP00000444610:G256C	ENSP00000295171:G154C	G	+	1	0	CCDC74A	132004786	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.270000	0.08584	-2.021000	0.00939	0.194000	0.17425	GGC		0.632	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770		6	77	1	0	3.59834e-05	0.001168	4.49188e-05	6	77				
NCKAP5	344148	broad.mit.edu	37	2	133486442	133486443	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:133486442_133486443CC>AT	ENST00000409261.1	-	18	5899_5900	c.5526_5527GG>AT	c.(5524-5529)atGGca>atATca	p.1842_1843MA>IS	NCKAP5_ENST00000317721.6_Missense_Mutation_p.1842_1843MA>IS|NCKAP5_ENST00000409213.1_Missense_Mutation_p.523_524MA>IS|NCKAP5_ENST00000405974.3_Missense_Mutation_p.523_524MA>IS	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1842								p.M362I(1)|p.M1842I(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCTGGCTTGCCATTGGGTCTT	0.554																																							uc002ttp.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(5524-5529)ATGGCA>ATATCA		Nck-associated protein 5 isoform 1																																				SO:0001583	missense	344148						protein binding	g.chr2:133486442_133486443CC>AT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5526_5527delinsAT	2.37:g.133486442_133486443delinsAT	ENSP00000387128:p.M1842_A1843delinsIS		Somatic				NCKAP5_uc002ttq.2_Missense_Mutation_p.523_524MA>IS	p.1842_1843MA>IS	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			18	5900_5901	-			1842_1843					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	DNP	ENST00000409261.1	37	c.5526_5527GG>AT	CCDS46418.1																																																																																				0.554	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		27	119	0	0	0	0.004672	0	27	119				
LRP1B	53353	broad.mit.edu	37	2	141625676	141625676	+	Silent	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:141625676T>A	ENST00000389484.3	-	26	5297	c.4326A>T	c.(4324-4326)acA>acT	p.T1442T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1442					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.T1442T(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCTGGCGTCTGTCCACACTA	0.363										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4324-4326)ACA>ACT		low density lipoprotein-related protein 1B							93.0	88.0	90.0					2																	141625676		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141625676T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4326A>T	2.37:g.141625676T>A		TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Silent_p.T624T	p.T1442T	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	26	5298	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1442			Extracellular (Potential).|LDL-receptor class B 12.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.4326A>T	CCDS2182.1																																																																																				0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		26	96	0	0	0	0.005443	0	26	96				
HOXD8	3234	broad.mit.edu	37	2	176995521	176995521	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:176995521C>A	ENST00000313173.4	+	1	1054	c.427C>A	c.(427-429)Cag>Aag	p.Q143K	HOXD8_ENST00000429017.1_Intron|HOXD8_ENST00000548663.1_Intron|HOXD8_ENST00000544999.1_Missense_Mutation_p.Q143K|HOXD8_ENST00000450510.2_Missense_Mutation_p.Q143K|HOXD-AS2_ENST00000440016.2_RNA	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	143					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q143K(1)		central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		CGATAACTTACAGAGACAGCC	0.582																																							uc002uko.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(427-429)CAG>AAG		homeobox D8							73.0	84.0	80.0					2																	176995521		2197	4294	6491	SO:0001583	missense	3234				anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176995521C>A		CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.427C>A	2.37:g.176995521C>A	ENSP00000315949:p.Gln143Lys		Somatic				uc002ukl.1_5'Flank|uc002ukm.1_5'Flank|HOXD8_uc002ukn.2_Intron|HOXD8_uc002ukp.2_Missense_Mutation_p.Q143K	p.Q143K	NM_019558	NP_062458	WXS	Illumina HiSeq	Unspecified	P13378	HXD8_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)	1	1045	+			143					F8WBG7|Q5BL00|Q8IXZ1	Missense_Mutation	SNP	ENST00000313173.4	37	c.427C>A	CCDS2268.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.189011	0.57909	.	.	ENSG00000175879	ENST00000313173;ENST00000544999;ENST00000450510	T;T;T	0.39787	1.06;1.06;1.06	4.51	4.51	0.55191	.	0.107189	0.40222	N	0.001151	T	0.37404	0.1002	L	0.49126	1.545	0.46096	D	0.998867	B;B	0.33212	0.402;0.402	B;B	0.33799	0.074;0.17	T	0.19877	-1.0292	10	0.08837	T	0.75	.	17.6075	0.88042	0.0:1.0:0.0:0.0	.	143;143	Q8IXZ1;P13378	.;HXD8_HUMAN	K	143	ENSP00000315949:Q143K;ENSP00000437431:Q143K;ENSP00000409026:Q143K	ENSP00000315949:Q143K	Q	+	1	0	HOXD8	176703767	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.735000	0.68587	2.200000	0.70718	0.643000	0.83706	CAG		0.582	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255694.1			21	97	1	0	4.26978e-12	0.00333	6.61815e-12	21	97				
TTN	7273	broad.mit.edu	37	2	179398651	179398651	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:179398651C>T	ENST00000591111.1	-	308	97992	c.97768G>A	c.(97768-97770)Gaa>Aaa	p.E32590K	TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E25291K|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E31663K|TTN_ENST00000342175.6_Missense_Mutation_p.E25358K|TTN-AS1_ENST00000587568.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E34231K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E25166K|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000585625.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32590					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E25166K(1)|p.E31661K(1)|p.E31663K(1)|p.E25291K(1)|p.E25358K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATAGACTTCTCTCACACCT	0.408																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(94987-94989)GAA>AAA		titin isoform N2-A							102.0	93.0	96.0					2																	179398651		1906	4121	6027	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179398651C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97768G>A	2.37:g.179398651C>T	ENSP00000465570:p.Glu32590Lys		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E25358K|TTN_uc010zfi.1_Missense_Mutation_p.E25291K|TTN_uc010zfj.1_Missense_Mutation_p.E25166K	p.E31663K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	95211	-			32590					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.94987G>A		.	.	.	.	.	.	.	.	.	.	C	13.63	2.293485	0.40594	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62232	0.04;0.26;0.24;0.23	5.6	5.6	0.85130	Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.47210	0.1433	N	0.08118	0	0.37318	D	0.90944	P;P;P;P	0.49090	0.919;0.919;0.919;0.919	B;B;B;B	0.41202	0.282;0.282;0.282;0.35	T	0.62402	-0.6862	9	0.87932	D	0	.	19.2083	0.93744	0.0:1.0:0.0:0.0	.	25166;25291;25358;32590	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	31663;25166;25358;25291;25163	ENSP00000343764:E31663K;ENSP00000434586:E25166K;ENSP00000340554:E25358K;ENSP00000352154:E25291K	ENSP00000340554:E25358K	E	-	1	0	TTN	179106897	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.583000	0.60964	2.641000	0.89580	0.491000	0.48974	GAA		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	46	0	0	0	0.00308	0	7	46				
ZNF804A	91752	broad.mit.edu	37	2	185731221	185731221	+	Nonsense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:185731221T>A	ENST00000302277.6	+	2	831	c.237T>A	c.(235-237)taT>taA	p.Y79*		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	79							metal ion binding (GO:0046872)	p.Y79*(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTAATTCATATGACCATGCTC	0.353																																							uc002uph.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(235-237)TAT>TAA		zinc finger protein 804A							70.0	70.0	70.0					2																	185731221		2203	4300	6503	SO:0001587	stop_gained	91752					intracellular	zinc ion binding	g.chr2:185731221T>A	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.237T>A	2.37:g.185731221T>A	ENSP00000303252:p.Tyr79*		Somatic					p.Y79*	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			2	831	+			79			C2H2-type.		A7E253|Q6ZN26	Nonsense_Mutation	SNP	ENST00000302277.6	37	c.237T>A	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	42	9.168432	0.99087	.	.	ENSG00000170396	ENST00000302277	.	.	.	5.57	4.41	0.53225	.	0.092634	0.42294	D	0.000732	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9066	9.8667	0.41148	0.0:0.1447:0.0:0.8553	.	.	.	.	X	79	.	ENSP00000303252:Y79X	Y	+	3	2	ZNF804A	185439466	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	0.761000	0.26489	1.029000	0.39812	0.482000	0.46254	TAT		0.353	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		4	63	0	0	0	0.000248	0	4	63				
COL3A1	1281	broad.mit.edu	37	2	189849926	189849926	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:189849926A>T	ENST00000304636.3	+	3	456	c.286A>T	c.(286-288)Act>Tct	p.T96S	COL3A1_ENST00000317840.5_Missense_Mutation_p.T96S	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	96					aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.T96S(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TTATTAGCCTACTCGCCCTCC	0.338																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(286-288)ACT>TCT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						108.0	107.0	107.0					2																	189849926		2203	4299	6502	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189849926A>T	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.286A>T	2.37:g.189849926A>T	ENSP00000304408:p.Thr96Ser		Somatic					p.T96S	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		3	403	+			96					D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.286A>T	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059427	0.55325	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.90004	-2.44;-2.6	5.28	0.0541	0.14309	.	0.485063	0.16970	N	0.192158	T	0.72614	0.3482	N	0.08118	0	0.18873	N	0.999988	B	0.02656	0.0	B	0.08055	0.003	T	0.54833	-0.8234	10	0.06099	T	0.92	.	12.2863	0.54793	0.3228:0.5954:0.0:0.0818	.	96	P02461	CO3A1_HUMAN	S	96	ENSP00000304408:T96S;ENSP00000315243:T96S	ENSP00000304408:T96S	T	+	1	0	COL3A1	189558171	0.000000	0.05858	0.557000	0.28306	0.797000	0.45037	-0.146000	0.10250	0.121000	0.18284	0.260000	0.18958	ACT		0.338	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		20	66	0	0	0	0.008871	0	20	66				
IRS1	3667	broad.mit.edu	37	2	227660594	227660594	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:227660594C>A	ENST00000305123.5	-	1	3881	c.2861G>T	c.(2860-2862)tGg>tTg	p.W954L	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	954					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.W954L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCTCTCCTGCCAGGCTGCCCT	0.672																																							uc002voh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12						c.(2860-2862)TGG>TTG		insulin receptor substrate 1							46.0	52.0	50.0					2																	227660594		2203	4300	6503	SO:0001583	missense	3667				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr2:227660594C>A		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2861G>T	2.37:g.227660594C>A	ENSP00000304895:p.Trp954Leu		Somatic					p.W954L	NM_005544	NP_005535	WXS	Illumina HiSeq	Unspecified	P35568	IRS1_HUMAN		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)	1	2913	-		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)	954						Missense_Mutation	SNP	ENST00000305123.5	37	c.2861G>T	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	3.702	-0.061252	0.07317	.	.	ENSG00000169047	ENST00000305123	T	0.54866	0.55	5.31	5.31	0.75309	.	0.152498	0.31335	N	0.007834	T	0.36193	0.0958	N	0.19112	0.55	0.32302	N	0.564926	B	0.12013	0.005	B	0.09377	0.004	T	0.26538	-1.0100	10	0.09590	T	0.72	-12.3052	16.0085	0.80380	0.0:1.0:0.0:0.0	.	954	P35568	IRS1_HUMAN	L	954	ENSP00000304895:W954L	ENSP00000304895:W954L	W	-	2	0	IRS1	227368838	.	.	1.000000	0.80357	0.681000	0.39784	.	.	2.762000	0.94881	0.655000	0.94253	TGG		0.672	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		14	79	1	0	3.52763e-06	0.00499	4.65347e-06	14	79				
CASS4	57091	broad.mit.edu	37	20	55012296	55012297	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr20:55012296_55012297TG>CT	ENST00000360314.3	+	3	338_339	c.113_114TG>CT	c.(112-114)cTG>cCT	p.L38P	CASS4_ENST00000371336.3_Missense_Mutation_p.L38P|CASS4_ENST00000434344.1_Missense_Mutation_p.L38P	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	38	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.L38P(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GGGGACATCCTGACCATTCTGG	0.594																																							uc002xxp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(112-114)CTG>CCT		HEF-like protein isoform a																																				SO:0001583	missense	57091				cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity	g.chr20:55012296_55012297TG>CT	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	Exception_encountered	20.37:g.55012296_55012297delinsCT	ENSP00000353462:p.Leu38Pro		Somatic				CASS4_uc002xxq.3_Missense_Mutation_p.L38P|CASS4_uc002xxr.2_Missense_Mutation_p.L38P|CASS4_uc010zze.1_Missense_Mutation_p.L38P|CASS4_uc010gio.2_Missense_Mutation_p.L38P	p.L38P	NM_001164116	NP_001157588	WXS	Illumina HiSeq	Unspecified	Q9NQ75	CASS4_HUMAN			3	338_339	+			38			SH3.		E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	DNP	ENST00000360314.3	37	c.113_114TG>CT	CCDS33492.1																																																																																				0.594	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		8	71	0	0	0	0.004672	0	8	71				
CRYZL1	9946	broad.mit.edu	37	21	34974653	34974653	+	Splice_Site	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr21:34974653T>A	ENST00000381554.3	-	8	551		c.e8-2		AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000445393.1_Splice_Site|CRYZL1_ENST00000290244.5_Splice_Site|CRYZL1_ENST00000361534.2_Splice_Site|CRYZL1_ENST00000381540.3_Splice_Site	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1						quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)	p.?(1)		lung(1)|prostate(1)|urinary_tract(1)	3						ACCAAATGCCTGTGTAGAAAA	0.338																																							uc011adw.1		NA																	1	Unknown(1)		lung(1)		0						c.e8-1		crystallin, zeta-like 1							113.0	106.0	108.0					21																	34974653		2203	4300	6503	SO:0001630	splice_region_variant	9946				quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding	g.chr21:34974653T>A	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.466-2A>T	21.37:g.34974653T>A			Somatic				DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Splice_Site_p.A180_splice|CRYZL1_uc002yss.1_Splice_Site|CRYZL1_uc002yst.1_Splice_Site	p.A156_splice	NM_145858	NP_665857	WXS	Illumina HiSeq	Unspecified	O95825	QORL1_HUMAN			8	646	-								B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Splice_Site	SNP	ENST00000381554.3	37	c.466_splice	CCDS13633.2	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569739	0.65765	.	.	ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000440526;ENST00000414079;ENST00000426935;ENST00000431177;ENST00000417979	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3681	0.60696	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRYZL1	33896523	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.425000	0.66470	1.859000	0.53934	0.533000	0.62120	.		0.338	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858	Intron	12	45	0	0	0	0.001368	0	12	45				
TATDN2	9797	broad.mit.edu	37	3	10320619	10320619	+	Silent	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:10320619G>A	ENST00000287652.4	+	7	3247	c.2196G>A	c.(2194-2196)acG>acA	p.T732T	TATDN2_ENST00000448281.2_Silent_p.T732T|RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000496355.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	732					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.T732T(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CCTTGCATACGGTCCGAGAGA	0.537																																							uc003bvg.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)	2						c.(2194-2196)ACG>ACA		TatD DNase domain containing 2							67.0	59.0	62.0					3																	10320619		2203	4300	6503	SO:0001819	synonymous_variant	9797					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr3:10320619G>A	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.2196G>A	3.37:g.10320619G>A			Somatic				TATDN2_uc003bvf.2_Silent_p.T732T|TATDN2_uc011atr.1_Silent_p.T732T|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA|TATDN2_uc011atu.1_5'Flank|TATDN2_uc011atv.1_5'Flank|GHRLOS_uc011atw.1_5'Flank|GHRLOS_uc011atx.1_5'Flank|GHRLOS_uc011aty.1_5'Flank|GHRLOS_uc011atz.1_5'Flank|GHRLOS_uc011aua.1_5'Flank|GHRLOS_uc010hdl.2_5'Flank|GHRLOS_uc011aub.1_5'Flank|GHRLOS_uc010hdm.2_5'Flank|GHRLOS_uc011auc.1_5'Flank|GHRLOS_uc011aud.1_5'Flank|GHRLOS_uc011aue.1_5'Flank|GHRLOS_uc011auf.1_5'Flank|GHRLOS_uc011aug.1_5'Flank	p.T732T	NM_014760	NP_055575	WXS	Illumina HiSeq	Unspecified	Q93075	TATD2_HUMAN			7	2777	+			732					Q3MIL9|Q5BKU0	Silent	SNP	ENST00000287652.4	37	c.2196G>A	CCDS33698.1																																																																																				0.537	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203		5	32	0	0	0	0.000602	0	5	32				
BAP1	8314	broad.mit.edu	37	3	52437180	52437181	+	Missense_Mutation	DNP	AG	AG	TA			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:52437180_52437181AG>TA	ENST00000460680.1	-	14	2334_2335	c.1863_1864CT>TA	c.(1861-1866)ccCTtg>ccTAtg	p.L622M	BAP1_ENST00000296288.5_Missense_Mutation_p.L604M	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L622M(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCCCCACTCAAGGGCTCGCCAG	0.604			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	GBM(101;493 1458 7992 21037 25532)	uc003ddx.2		NA		Rec	yes		3	3p21.31-p21.2	8314	N|Mis|F|S|O	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)			E			uveal melanoma|breast|NSCLC		1	Substitution - Missense(1)		lung(1)	pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65						c.(1861-1866)CCCTTG>CCTATG		BRCA1 associated protein-1																																				SO:0001583	missense	8314				monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr3:52437180_52437181AG>TA	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1863_1864delinsTA	3.37:g.52437180_52437181delinsTA	ENSP00000417132:p.Leu622Met		Somatic				BAP1_uc003ddw.2_Intron|BAP1_uc010hmg.2_RNA|BAP1_uc010hmh.2_Intron	p.L622M	NM_004656	NP_004647	WXS	Illumina HiSeq	Unspecified	Q92560	BAP1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	14	1978_1979	-			622			Interaction with BRCA1.		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	DNP	ENST00000460680.1	37	c.1863_1864CT>TA	CCDS2853.1																																																																																				0.604	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			4	38	0	0	0	0.004672	0	4	38				
ADAMTS9	56999	broad.mit.edu	37	3	64589670	64589670	+	Silent	SNP	C	C	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:64589670C>G	ENST00000498707.1	-	25	4017	c.3675G>C	c.(3673-3675)ctG>ctC	p.L1225L	ADAMTS9_ENST00000295903.4_Silent_p.L1197L	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1225	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L1225L(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTGGTCTAGGCAGGGTAGCAC	0.542																																							uc003dmg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|urinary_tract(1)|skin(1)	4						c.(3673-3675)CTG>CTC		ADAM metallopeptidase with thrombospondin type 1							122.0	116.0	118.0					3																	64589670		2203	4300	6503	SO:0001819	synonymous_variant	56999				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr3:64589670C>G	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3675G>C	3.37:g.64589670C>G			Somatic				ADAMTS9_uc011bfo.1_Silent_p.L1197L|ADAMTS9_uc003dmh.1_Silent_p.L1054L|ADAMTS9_uc011bfp.1_Silent_p.L136L	p.L1225L	NM_182920	NP_891550	WXS	Illumina HiSeq	Unspecified	Q9P2N4	ATS9_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)	25	3707	-		Lung NSC(201;0.00682)	1225			TSP type-1 7.		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	c.3675G>C	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	2.723	-0.266122	0.05754	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.22	-2.97	0.05530	.	.	.	.	.	T	0.37732	0.1014	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	T	0.33599	-0.9862	4	.	.	.	.	0.7883	0.01053	0.2091:0.2874:0.2548:0.2487	.	.	.	.	S	281	.	.	C	-	2	0	ADAMTS9	64564710	0.007000	0.16637	0.005000	0.12908	0.530000	0.34684	-1.125000	0.03257	-0.403000	0.07622	-0.781000	0.03364	TGC		0.542	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			21	44	0	0	0	0.008871	0	21	44				
OR5H6	79295	broad.mit.edu	37	3	97983253	97983253	+	Missense_Mutation	SNP	C	C	A	rs36040433	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:97983253C>A	ENST00000383696.2	+	1	166	c.125C>A	c.(124-126)cCg>cAg	p.P42Q	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P42Q(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TGTAAAATACCGCTCTTCCTG	0.418																																							uc003dsi.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)	3						c.(124-126)CCG>CAG		olfactory receptor, family 5, subfamily H,							196.0	202.0	200.0					3																	97983253		2203	4299	6502	SO:0001583	missense	79295				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97983253C>A	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.125C>A	3.37:g.97983253C>A	ENSP00000373196:p.Pro42Gln		Somatic					p.P42Q	NM_001005479	NP_001005479	WXS	Illumina HiSeq	Unspecified	Q8NGV6	OR5H6_HUMAN			1	125	+			42			Helical; Name=1; (Potential).		Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	c.125C>A	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	8.241	0.806791	0.16467	.	.	ENSG00000230301	ENST00000383696	T	0.00428	7.44	1.97	1.03	0.20045	.	0.351137	0.20863	N	0.084304	T	0.00724	0.0024	M	0.70787	2.145	0.09310	N	1	D	0.61697	0.99	D	0.64687	0.928	T	0.49725	-0.8909	10	0.49607	T	0.09	.	6.0767	0.19919	0.0:0.811:0.0:0.1889	.	42	Q8NGV6	OR5H6_HUMAN	Q	42	ENSP00000373196:P42Q	ENSP00000373196:P42Q	P	+	2	0	OR5H6	99465943	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-0.216000	0.09266	1.092000	0.41356	0.194000	0.17425	CCG		0.418	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2			42	155	1	0	1.48734e-19	0.003214	2.40561e-19	42	155				
SEC22A	26984	broad.mit.edu	37	3	122942517	122942517	+	Nonsense_Mutation	SNP	T	T	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:122942517T>G	ENST00000309934.4	+	2	1190	c.294T>G	c.(292-294)taT>taG	p.Y98*	SEC22A_ENST00000481965.2_Intron|SEC22A_ENST00000477063.1_3'UTR|SEC22A_ENST00000492595.1_Nonsense_Mutation_p.Y98*	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	98	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.Y98*(1)		NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		TTACTACTTATAACATGATGA	0.388																																							uc003ege.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(292-294)TAT>TAG		SEC22 vesicle trafficking protein homolog A							182.0	179.0	180.0					3																	122942517		2203	4300	6503	SO:0001587	stop_gained	26984				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity	g.chr3:122942517T>G	AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.294T>G	3.37:g.122942517T>G	ENSP00000310521:p.Tyr98*		Somatic				SEC22A_uc003egf.2_Nonsense_Mutation_p.Y98*	p.Y98*	NM_012430	NP_036562	WXS	Illumina HiSeq	Unspecified	Q96IW7	SC22A_HUMAN		GBM - Glioblastoma multiforme(114;0.0548)	3	373	+			98			Cytoplasmic (Potential).|Longin.		B2RE26|Q9Y682	Nonsense_Mutation	SNP	ENST00000309934.4	37	c.294T>G	CCDS3021.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.842184	0.71488	.	.	ENSG00000121542	ENST00000492595;ENST00000473494;ENST00000466519;ENST00000480631;ENST00000491366;ENST00000487572;ENST00000309934	.	.	.	4.8	-0.227	0.13102	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5605	8.5432	0.33406	0.0:0.6334:0.0:0.3666	.	.	.	.	X	98	.	ENSP00000310521:Y98X	Y	+	3	2	SEC22A	124425207	0.996000	0.38824	0.999000	0.59377	0.999000	0.98932	0.358000	0.20216	0.047000	0.15862	0.528000	0.53228	TAT		0.388	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355770.2	NM_012430		50	135	0	0	0	0.00361	0	50	135				
LRRC15	131578	broad.mit.edu	37	3	194081021	194081021	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr3:194081021T>A	ENST00000347624.3	-	2	837	c.752A>T	c.(751-753)tAc>tTc	p.Y251F	LRRC15_ENST00000428839.1_Missense_Mutation_p.Y257F|LRRC15_ENST00000439944.2_Missense_Mutation_p.Y257F	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	251					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.Y251F(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GTTGGACAGGTAGAGTCTCTG	0.552																																							uc003ftu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(751-753)TAC>TTC		leucine rich repeat containing 15 isoform b							158.0	171.0	167.0					3																	194081021		2203	4300	6503	SO:0001583	missense	131578					integral to membrane		g.chr3:194081021T>A	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.752A>T	3.37:g.194081021T>A	ENSP00000306276:p.Tyr251Phe		Somatic				LRRC15_uc003ftt.2_Missense_Mutation_p.Y257F	p.Y251F	NM_130830	NP_570843	WXS	Illumina HiSeq	Unspecified	Q8TF66	LRC15_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)	2	838	-	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		251			LRR 9.|Extracellular (Potential).		Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	c.752A>T	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559582	0.27827	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.10288	2.89;2.89;2.89	5.15	5.15	0.70609	.	0.099262	0.44483	D	0.000448	T	0.09512	0.0234	L	0.42529	1.33	0.37027	D	0.89649	B;B	0.30563	0.263;0.285	B;B	0.33392	0.163;0.122	T	0.15263	-1.0443	10	0.10111	T	0.7	.	9.386	0.38342	0.2748:0.0:0.0:0.7251	.	251;257	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	F	251;257;257	ENSP00000306276:Y251F;ENSP00000389128:Y257F;ENSP00000413707:Y257F	ENSP00000306276:Y251F	Y	-	2	0	LRRC15	195562316	1.000000	0.71417	0.948000	0.38648	0.863000	0.49368	1.827000	0.39102	2.074000	0.62210	0.533000	0.62120	TAC		0.552	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			16	41	0	0	0	0.00499	0	16	41				
KIAA0232	9778	broad.mit.edu	37	4	6860175	6860175	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:6860175G>T	ENST00000307659.5	+	6	915	c.460G>T	c.(460-462)Gag>Tag	p.E154*	KIAA0232_ENST00000425103.1_Nonsense_Mutation_p.E154*	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	154							ATP binding (GO:0005524)	p.E154*(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						CAAAAAGTTAGAGGGGTCTCC	0.328																																							uc003gjr.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(460-462)GAG>TAG		hypothetical protein LOC9778							40.0	38.0	39.0					4																	6860175		1807	4073	5880	SO:0001587	stop_gained	9778						ATP binding	g.chr4:6860175G>T	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.460G>T	4.37:g.6860175G>T	ENSP00000303928:p.Glu154*		Somatic				KIAA0232_uc003gjq.3_Nonsense_Mutation_p.E154*	p.E154*	NM_014743	NP_055558	WXS	Illumina HiSeq	Unspecified	Q92628	K0232_HUMAN			6	923	+			154					A7E2D2	Nonsense_Mutation	SNP	ENST00000307659.5	37	c.460G>T	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	G	42	9.236567	0.99110	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.56	5.56	0.83823	.	0.046784	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-31.4264	19.5353	0.95251	0.0:0.0:1.0:0.0	.	.	.	.	X	154	.	ENSP00000303928:E154X	E	+	1	0	KIAA0232	6911076	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.782000	0.75073	2.618000	0.88619	0.650000	0.86243	GAG		0.328	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743		4	30	1	0	0.00116845	0.001168	0.00134155	4	30				
KIT	3815	broad.mit.edu	37	4	55569902	55569902	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:55569902G>C	ENST00000288135.5	+	5	866	c.769G>C	c.(769-771)Gag>Cag	p.E257Q		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	257	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E257Q(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TAAACTACAGGAGAAATATAA	0.343		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														uc010igr.2		1	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	Mis|O	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	Piebald trait	"""L, M, O, E"""		GIST|epithelioma	GIST|AML|TGCT|mastocytosis|mucosal melanoma		1	Substitution - Missense(1)		lung(1)	soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118						c.(769-771)GAG>CAG		v-kit Hardy-Zuckerman 4 feline sarcoma viral	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)						67.0	69.0	68.0					4																	55569902		2203	4300	6503	SO:0001583	missense	3815	Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	g.chr4:55569902G>C	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.769G>C	4.37:g.55569902G>C	ENSP00000288135:p.Glu257Gln		Somatic				KIT_uc010igs.2_Missense_Mutation_p.E257Q	p.E257Q	NM_000222	NP_000213	WXS	Illumina HiSeq	Unspecified	P10721	KIT_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	5	856	+	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		257			Extracellular (Potential).|Ig-like C2-type 3.		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	c.769G>C	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.339107	0.01287	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	D;D	0.83992	-1.79;-1.79	5.77	-0.776	0.10984	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.776670	0.02950	N	0.141616	T	0.65059	0.2655	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.0;0.012	B;B	0.25405	0.001;0.06	T	0.53429	-0.8440	10	0.13853	T	0.58	.	3.4813	0.07603	0.1982:0.299:0.4012:0.1017	.	257;257	P10721-2;P10721	.;KIT_HUMAN	Q	257	ENSP00000288135:E257Q;ENSP00000390987:E257Q	ENSP00000288135:E257Q	E	+	1	0	KIT	55264659	0.657000	0.27393	0.035000	0.18076	0.073000	0.16967	1.055000	0.30467	-0.104000	0.12154	-0.172000	0.13284	GAG		0.343	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			5	46	0	0	0	0.000602	0	5	46				
WDFY3	23001	broad.mit.edu	37	4	85662997	85662997	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:85662997G>A	ENST00000295888.4	-	38	6558	c.6151C>T	c.(6151-6153)Cgt>Tgt	p.R2051C	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2051C	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2051					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R2051C(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCCACCACACGCTGTGTGAAA	0.383																																							uc003hpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(6151-6153)CGT>TGT		WD repeat and FYVE domain containing 3 isoform							94.0	96.0	95.0					4																	85662997		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85662997G>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6151C>T	4.37:g.85662997G>A	ENSP00000295888:p.Arg2051Cys		Somatic					p.R2051C	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	38	6559	-		Hepatocellular(203;0.114)	2051					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.6151C>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026965	0.75390	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.71103	-0.52;-0.54	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.82287	0.5004	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82997	-0.0179	10	0.59425	D	0.04	.	14.5338	0.67944	0.0:0.0:0.8535:0.1465	.	2051	Q8IZQ1	WDFY3_HUMAN	C	2051	ENSP00000318466:R2051C;ENSP00000295888:R2051C	ENSP00000295888:R2051C	R	-	1	0	WDFY3	85882021	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.566000	0.60843	2.660000	0.90430	0.655000	0.94253	CGT		0.383	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		9	90	0	0	0	0.008291	0	9	90				
CCSER1	401145	broad.mit.edu	37	4	91760173	91760173	+	Intron	SNP	C	C	A	rs531761554		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:91760173C>A	ENST00000509176.1	+	8	2382				CCSER1_ENST00000333691.8_Intron	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1																		TCAGCCATATCGGGTTTGTCA	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		15747	0.001		0.0	False		,,,				2504	0.0						uc003hsy.2		NA																	0					0						c.(16-18)GAT>TAT		thymosin-like 3							143.0	165.0	157.0					4																	91760173		1511	2708	4219	SO:0001627	intron_variant	7117							g.chr4:91760173C>A		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2094+23177C>A	4.37:g.91760173C>A			Somatic				FAM190A_uc003hsv.3_Intron|FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsx.2_Intron	p.D6Y	NM_183049	NP_898870	WXS	Illumina HiSeq	Unspecified				Epithelial(2;5.28e-11)|OV - Ovarian serous cystadenocarcinoma(123;8.9e-10)|all cancers(2;3.21e-09)|STAD - Stomach adenocarcinoma(1;0.0201)	1	97	-		all_cancers(2;6.48e-24)|all_epithelial(2;3.86e-25)|Colorectal(2;8.52e-12)|all_lung(2;3.73e-07)|Lung NSC(2;7.99e-07)|Renal(2;0.0243)|Hepatocellular(203;0.0411)						Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	c.16G>T	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	c	12.57	1.978651	0.34942	.	.	ENSG00000187653	ENST00000402089;ENST00000507623;ENST00000380638	.	.	.	2.29	2.29	0.28610	.	0.212699	0.29165	U	0.012957	T	0.52141	0.1716	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.19946	0.027	T	0.56577	-0.7956	8	0.72032	D	0.01	-3.7736	10.304	0.43670	0.0:1.0:0.0:0.0	.	6	A8MW06	TMSL3_HUMAN	Y	6;31;6	.	ENSP00000370012:D6Y	D	-	1	0	TMSL3	91979196	0.996000	0.38824	1.000000	0.80357	0.848000	0.48234	1.625000	0.37029	1.290000	0.44636	0.281000	0.19383	GAT		0.517	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		20	138	1	0	4.96729e-08	0.008871	6.94674e-08	20	138				
DCLK2	166614	broad.mit.edu	37	4	151169531	151169531	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:151169531G>T	ENST00000296550.7	+	14	2704	c.1950G>T	c.(1948-1950)tgG>tgT	p.W650C	DCLK2_ENST00000302176.8_Missense_Mutation_p.W667C|DCLK2_ENST00000506325.1_Missense_Mutation_p.W649C	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	650	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.W650C(1)|p.W667C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GTCACCCCTGGGTGTCAGTAA	0.478																																					GBM(195;186 2215 13375 16801 37459)	GBM(195;186 2215 13375 16801 37459)	uc003ilm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1948-1950)TGG>TGT		doublecortin-like kinase 2 isoform a							97.0	94.0	95.0					4																	151169531		2203	4300	6503	SO:0001583	missense	166614				intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity	g.chr4:151169531G>T	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1950G>T	4.37:g.151169531G>T	ENSP00000296550:p.Trp650Cys		Somatic				DCLK2_uc003iln.3_Missense_Mutation_p.W649C|DCLK2_uc003ilo.3_Missense_Mutation_p.W667C|DCLK2_uc003ilp.3_RNA	p.W650C	NM_001040260	NP_001035350	WXS	Illumina HiSeq	Unspecified	Q8N568	DCLK2_HUMAN			14	2050	+	all_hematologic(180;0.151)		650			Protein kinase.		C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	ENST00000296550.7	37	c.1950G>T	CCDS34076.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624823	0.87560	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.69561	-0.41;-0.41;-0.41	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89143	0.6631	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.91376	0.5123	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	667;649;650	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	C	650;649;667	ENSP00000296550:W650C;ENSP00000427235:W649C;ENSP00000303887:W667C	ENSP00000296550:W650C	W	+	3	0	DCLK2	151388981	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.202000	0.95026	2.941000	0.99782	0.655000	0.94253	TGG		0.478	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	NM_001040260		3	36	1	0	0.00024832	0.000248	0.000297984	3	36				
FGB	2244	broad.mit.edu	37	4	155490722	155490722	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:155490722G>C	ENST00000302068.4	+	7	1078	c.1015G>C	c.(1015-1017)Gaa>Caa	p.E339Q	FGB_ENST00000502545.1_Intron|FGB_ENST00000509493.1_Missense_Mutation_p.E120Q	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	339	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.E339Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GGGACCCACAGAACTTTTGAT	0.363																																					NSCLC(106;1133 1613 21870 46110 52656)	NSCLC(106;1133 1613 21870 46110 52656)	uc003ioa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1015-1017)GAA>CAA		fibrinogen, beta chain preproprotein	Sucralfate(DB00364)						85.0	88.0	87.0					4																	155490722		2203	4300	6503	SO:0001583	missense	2244				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155490722G>C		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1015G>C	4.37:g.155490722G>C	ENSP00000306099:p.Glu339Gln		Somatic				FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Missense_Mutation_p.E277Q|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Missense_Mutation_p.E120Q	p.E339Q	NM_005141	NP_005132	WXS	Illumina HiSeq	Unspecified	P02675	FIBB_HUMAN			7	1054	+	all_hematologic(180;0.215)	Renal(120;0.0458)	339			Fibrinogen C-terminal.		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	ENST00000302068.4	37	c.1015G>C	CCDS3786.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699985	0.48307	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	D;D	0.82893	-1.66;-1.66	5.53	4.67	0.58626	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.136497	0.64402	D	0.000004	D	0.82962	0.5151	L	0.57130	1.785	0.58432	D	0.999996	P;P	0.51791	0.948;0.653	P;P	0.51487	0.671;0.662	T	0.79441	-0.1802	10	0.15952	T	0.53	.	11.6317	0.51178	0.1521:0.0:0.8479:0.0	.	322;339	B4E1D3;P02675	.;FIBB_HUMAN	Q	339;322;120	ENSP00000306099:E339Q;ENSP00000426757:E120Q	ENSP00000306099:E339Q	E	+	1	0	FGB	155710172	1.000000	0.71417	0.958000	0.39756	0.983000	0.72400	6.401000	0.73256	1.426000	0.47256	0.655000	0.94253	GAA		0.363	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		14	77	0	0	0	0.00499	0	14	77				
MARCH1	55016	broad.mit.edu	37	4	164506998	164506998	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:164506998G>A	ENST00000503008.1	-	6	1302	c.326C>T	c.(325-327)tCc>tTc	p.S109F	MARCH1_ENST00000274056.7_Missense_Mutation_p.S109F|MARCH1_ENST00000514618.1_Missense_Mutation_p.S365F|MARCH1_ENST00000339875.5_Missense_Mutation_p.S92F	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	109					antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S109F(1)|p.S92F(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GTGGAGGCAGGACTGGTGGAC	0.542																																							uc003iqs.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)	2						c.(325-327)TCC>TTC		membrane-associated RING-CH protein I							104.0	94.0	98.0					4																	164506998		2203	4300	6503	SO:0001583	missense	55016				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr4:164506998G>A	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.326C>T	4.37:g.164506998G>A	ENSP00000427223:p.Ser109Phe		Somatic				MARCH1_uc003iqr.1_Missense_Mutation_p.S92F	p.S109F	NM_017923	NP_060393	WXS	Illumina HiSeq	Unspecified	Q8TCQ1	MARH1_HUMAN			6	1303	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	109			RING-CH-type.		D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	c.326C>T	CCDS54814.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961526	0.53400	.	.	ENSG00000145416	ENST00000274056;ENST00000503008;ENST00000514618;ENST00000339875;ENST00000507270	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.27	5.27	0.74061	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.258814	0.32836	N	0.005597	T	0.61515	0.2353	M	0.90870	3.155	0.35050	D	0.760549	B;B	0.11235	0.0;0.004	B;B	0.15052	0.008;0.012	T	0.70813	-0.4770	10	0.72032	D	0.01	-9.1211	19.259	0.93959	0.0:0.0:1.0:0.0	.	109;92	Q8TCQ1;Q8TCQ1-2	MARH1_HUMAN;.	F	109;109;365;92;109	ENSP00000274056:S109F;ENSP00000427223:S109F;ENSP00000421322:S365F;ENSP00000345676:S92F;ENSP00000426731:S109F	ENSP00000274056:S109F	S	-	2	0	MARCH1	164726448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.828000	0.55753	2.628000	0.89032	0.585000	0.79938	TCC		0.542	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		9	58	0	0	0	0.006214	0	9	58				
WDR17	116966	broad.mit.edu	37	4	177069485	177069485	+	Splice_Site	SNP	T	T	C	rs200212356		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:177069485T>C	ENST00000280190.4	+	14	2124	c.1968T>C	c.(1966-1968)taT>taC	p.Y656Y	WDR17_ENST00000507824.2_Splice_Site_p.Y639Y|WDR17_ENST00000508596.1_Splice_Site_p.Y632Y|WDR17_ENST00000393643.2_Splice_Site_p.Y632Y			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	656								p.Y656Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CAGATGTATATGGTAGAGTGT	0.358													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17460	0.0		0.0	False		,,,				2504	0.0						uc003iuj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6						c.(1966-1968)TAT>TAC		WD repeat domain 17 isoform 1							79.0	78.0	78.0					4																	177069485		2203	4300	6503	SO:0001630	splice_region_variant	116966							g.chr4:177069485T>C	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1969+1T>C	4.37:g.177069485T>C			Somatic				WDR17_uc003iuk.2_Silent_p.Y632Y|WDR17_uc003ium.3_Silent_p.Y632Y|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	p.Y656Y	NM_170710	NP_733828	WXS	Illumina HiSeq	Unspecified	Q8IZU2	WDR17_HUMAN		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)	14	2124	+		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	656			WD 12.		E7EQX0|Q0QD35	Silent	SNP	ENST00000280190.4	37	c.1968T>C	CCDS3825.1																																																																																				0.358	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		Silent	12	47	0	0	0	0.001855	0	12	47				
NEIL3	55247	broad.mit.edu	37	4	178257420	178257420	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr4:178257420G>T	ENST00000264596.3	+	4	690	c.572G>T	c.(571-573)gGg>gTg	p.G191V		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	191					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)	p.G191V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		CCTGGAGTAGGGAACATCATC	0.378								Base excision repair (BER), DNA glycosylases																															uc003iut.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|central_nervous_system(1)	4						c.(571-573)GGG>GTG	BER_DNA_glycosylases	nei endonuclease VIII-like 3							150.0	152.0	152.0					4																	178257420		2203	4300	6503	SO:0001583	missense	55247				base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding	g.chr4:178257420G>T	AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.572G>T	4.37:g.178257420G>T	ENSP00000264596:p.Gly191Val		Somatic				NEIL3_uc010irs.2_Missense_Mutation_p.G94V	p.G191V	NM_018248	NP_060718	WXS	Illumina HiSeq	Unspecified	Q8TAT5	NEIL3_HUMAN		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)	4	689	+		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)	191					Q2PPJ3|Q8NG51|Q9NV95	Missense_Mutation	SNP	ENST00000264596.3	37	c.572G>T	CCDS3828.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869820	0.72065	.	.	ENSG00000109674	ENST00000264596	T	0.68765	-0.35	4.93	4.93	0.64822	DNA glycosylase/AP lyase, H2TH DNA-binding (1);Ribosomal protein S13-like, H2TH (1);	0.000000	0.85682	D	0.000000	D	0.88503	0.6454	H	0.97540	4.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92340	0.5881	10	0.87932	D	0	-16.7766	17.6857	0.88255	0.0:0.0:1.0:0.0	.	191	Q8TAT5	NEIL3_HUMAN	V	191	ENSP00000264596:G191V	ENSP00000264596:G191V	G	+	2	0	NEIL3	178494414	1.000000	0.71417	0.967000	0.41034	0.992000	0.81027	8.941000	0.92964	2.713000	0.92767	0.655000	0.94253	GGG		0.378	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248		15	103	1	0	3.52763e-06	0.00499	4.65347e-06	15	103				
SEMA5A	9037	broad.mit.edu	37	5	9154736	9154736	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:9154736C>T	ENST00000382496.5	-	12	2010	c.1345G>A	c.(1345-1347)Gag>Aag	p.E449K		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	449	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.E449K(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GGGAAGAGCTCAATCTCTTCC	0.542																																							uc003jek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1345-1347)GAG>AAG		semaphorin 5A precursor							99.0	97.0	98.0					5																	9154736		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9154736C>T	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1345G>A	5.37:g.9154736C>T	ENSP00000371936:p.Glu449Lys		Somatic					p.E449K	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			12	2057	-			449			Sema.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.1345G>A	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384372	0.42308	.	.	ENSG00000112902	ENST00000382496	T	0.10960	2.82	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.10294	0.0252	L	0.39020	1.185	0.58432	D	0.999995	B	0.06786	0.001	B	0.12837	0.008	T	0.08953	-1.0697	10	0.37606	T	0.19	.	12.5334	0.56128	0.0:0.8322:0.1677:0.0	.	449	Q13591	SEM5A_HUMAN	K	449	ENSP00000371936:E449K	ENSP00000371936:E449K	E	-	1	0	SEMA5A	9207736	1.000000	0.71417	0.998000	0.56505	0.789000	0.44602	4.361000	0.59461	2.584000	0.87258	0.591000	0.81541	GAG		0.542	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			8	114	0	0	0	0.004482	0	8	114				
MYO10	4651	broad.mit.edu	37	5	16680116	16680116	+	Silent	SNP	G	G	A	rs375311233		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:16680116G>A	ENST00000513610.1	-	33	4936	c.4482C>T	c.(4480-4482)aaC>aaT	p.N1494N	MYO10_ENST00000274203.9_Silent_p.N851N|MYO10_ENST00000505695.1_Silent_p.N833N|MYO10_ENST00000427430.2_Silent_p.N851N|MYO10_ENST00000515803.1_Silent_p.N833N	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1494	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.N1494N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TGTCAGTCACGTTTTGAATGG	0.567																																							uc003jft.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4480-4482)AAC>AAT		myosin X		G		0,4046		0,0,2023	92.0	91.0	91.0		4482	-9.1	0.1	5		91	1,8369		0,1,4184	no	coding-synonymous	MYO10	NM_012334.2		0,1,6207	AA,AG,GG		0.0119,0.0,0.0081		1494/2059	16680116	1,12415	2023	4185	6208	SO:0001819	synonymous_variant	4651				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity	g.chr5:16680116G>A	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4482C>T	5.37:g.16680116G>A			Somatic				MYO10_uc011cnb.1_Silent_p.N123N|MYO10_uc011cnc.1_Silent_p.N373N|MYO10_uc011cnd.1_Silent_p.N851N|MYO10_uc011cne.1_Silent_p.N851N|MYO10_uc010itx.2_Silent_p.N1116N	p.N1494N	NM_012334	NP_036466	WXS	Illumina HiSeq	Unspecified	Q9HD67	MYO10_HUMAN			33	4950	-			1494			PH 2.		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	c.4482C>T	CCDS54834.1																																																																																				0.567	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334		3	29	0	0	0	0.004672	0	3	29				
CDH9	1007	broad.mit.edu	37	5	26881622	26881622	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:26881622C>A	ENST00000231021.4	-	12	2165	c.1993G>T	c.(1993-1995)Ggg>Tgg	p.G665W		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	665					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G665W(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TCTTCTTCCCCGCCGCCTTCA	0.428																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1993-1995)GGG>TGG		cadherin 9, type 2 preproprotein							171.0	172.0	172.0					5																	26881622		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881622C>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1993G>T	5.37:g.26881622C>A	ENSP00000231021:p.Gly665Trp		Somatic				CDH9_uc011cnv.1_Missense_Mutation_p.G258W	p.G665W	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			12	2162	-			665			Cytoplasmic (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.1993G>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287407	0.59976	.	.	ENSG00000113100	ENST00000231021	D	0.98717	-5.09	4.96	4.96	0.65561	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	H	0.97611	4.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98096	1.0412	9	.	.	.	.	17.1426	0.86758	0.0:1.0:0.0:0.0	.	258;665	B4DFP0;Q9ULB4	.;CADH9_HUMAN	W	665	ENSP00000231021:G665W	.	G	-	1	0	CDH9	26917379	1.000000	0.71417	0.934000	0.37439	0.523000	0.34469	7.744000	0.85034	2.447000	0.82792	0.557000	0.71058	GGG		0.428	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		19	166	1	0	7.21436e-19	0.008871	1.15679e-18	19	166				
PDE4D	5144	broad.mit.edu	37	5	58271618	58271618	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:58271618G>A	ENST00000340635.6	-	14	2054	c.1879C>T	c.(1879-1881)Cct>Tct	p.P627S	PDE4D_ENST00000405755.2_Missense_Mutation_p.P505S|PDE4D_ENST00000358923.6_Missense_Mutation_p.P325S|PDE4D_ENST00000507116.1_Missense_Mutation_p.P563S|PDE4D_ENST00000546160.1_Missense_Mutation_p.P566S|PDE4D_ENST00000360047.5_Missense_Mutation_p.P491S|PDE4D_ENST00000317118.8_Missense_Mutation_p.P336S|PDE4D_ENST00000503258.1_Missense_Mutation_p.P497S|PDE4D_ENST00000502484.2_Missense_Mutation_p.P566S	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	627					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.P491S(2)|p.P505S(1)|p.P566S(1)|p.P627S(1)|p.P497S(1)|p.P563S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	AGCTGGAGAGGCTTTGTTGGG	0.483																																							uc003jsa.2		NA																	7	Substitution - Missense(7)		lung(7)	breast(1)|central_nervous_system(1)	2						c.(1879-1881)CCT>TCT		phosphodiesterase 4D isoform 1	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)						91.0	96.0	94.0					5																	58271618		2191	4293	6484	SO:0001583	missense	5144				signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr5:58271618G>A		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.1879C>T	5.37:g.58271618G>A	ENSP00000345502:p.Pro627Ser		Somatic				PDE4D_uc003jrx.2_Missense_Mutation_p.P491S|PDE4D_uc003jry.2_Missense_Mutation_p.P325S|PDE4D_uc003jrz.2_Missense_Mutation_p.P563S|PDE4D_uc003jsb.2_Missense_Mutation_p.P566S|PDE4D_uc003jrt.2_Missense_Mutation_p.P325S|PDE4D_uc003jru.2_Missense_Mutation_p.P403S|PDE4D_uc003jrv.2_Missense_Mutation_p.P497S|PDE4D_uc003jrw.2_Missense_Mutation_p.P505S|PDE4D_uc003jrs.2_Missense_Mutation_p.P336S	p.P627S	NM_001104631	NP_001098101	WXS	Illumina HiSeq	Unspecified	Q08499	PDE4D_HUMAN		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	14	2051	-		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)	627					O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	37	c.1879C>T	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676197	0.67928	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000358923;ENST00000317118;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000505453	T;T;T;T;T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	4.3	4.3	0.51218	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;P;B	0.89917	0.996;0.997;0.996;1.0;1.0;0.996;0.674;0.4	D;D;D;D;D;D;B;B	0.91635	0.974;0.99;0.974;0.999;0.999;0.974;0.296;0.137	T	0.78404	-0.2217	10	0.28530	T	0.3	.	17.3054	0.87192	0.0:0.0:1.0:0.0	.	566;627;563;490;505;497;402;336	Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10;Q08499-4;Q08499-8	.;PDE4D_HUMAN;.;.;.;.;.;.	S	627;496;491;563;325;336;497;505;566;566;325	ENSP00000345502:P627S;ENSP00000353152:P491S;ENSP00000424852:P563S;ENSP00000351800:P325S;ENSP00000321739:P336S;ENSP00000425605:P497S;ENSP00000384806:P505S;ENSP00000423094:P566S;ENSP00000442734:P566S;ENSP00000421013:P325S	ENSP00000321739:P336S	P	-	1	0	PDE4D	58307375	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.601000	0.98297	2.380000	0.81148	0.655000	0.94253	CCT		0.483	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3			5	26	0	0	0	0.001168	0	5	26				
PCDHA5	56143	broad.mit.edu	37	5	140203159	140203159	+	Missense_Mutation	SNP	C	C	T	rs529947743		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:140203159C>T	ENST00000529859.1	+	1	1799	c.1799C>T	c.(1798-1800)tCg>tTg	p.S600L	PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.S600L|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.S600L|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	600	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S600L(7)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCCTGATTCGGGCTACAAC	0.672													.|||	1	0.000199681	0.0	0.0	5008	,	,		17028	0.0		0.0	False		,,,				2504	0.001						uc003lhl.2		NA																	7	Substitution - Missense(7)		skin(4)|lung(2)|upper_aerodigestive_tract(1)	ovary(1)|breast(1)|skin(1)	3						c.(1798-1800)TCG>TTG		protocadherin alpha 5 isoform 1 precursor							73.0	78.0	76.0					5																	140203159		2203	4300	6503	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140203159C>T	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1799C>T	5.37:g.140203159C>T	ENSP00000436557:p.Ser600Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.S600L|PCDHA5_uc003lhj.1_Missense_Mutation_p.S600L	p.S600L	NM_018908	NP_061731	WXS	Illumina HiSeq	Unspecified	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1799	+			600			Extracellular (Potential).|Cadherin 6.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.1799C>T	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278804	0.40294	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.49432	0.78;0.78;0.78	3.87	3.87	0.44632	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70219	0.3199	M	0.80616	2.505	0.23669	N	0.997151	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.70935	0.966;0.971;0.97	T	0.63972	-0.6516	9	0.87932	D	0	.	16.2362	0.82377	0.0:1.0:0.0:0.0	.	600;600;600	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	L	600	ENSP00000433416:S600L;ENSP00000436557:S600L;ENSP00000367366:S600L	ENSP00000367366:S600L	S	+	2	0	PCDHA5	140183343	0.005000	0.15991	0.629000	0.29254	0.230000	0.25150	2.078000	0.41567	1.887000	0.54652	0.306000	0.20318	TCG		0.672	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		10	54	0	0	0	0.001368	0	10	54				
PCDHB6	56130	broad.mit.edu	37	5	140531256	140531256	+	Missense_Mutation	SNP	C	C	A	rs147347959	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:140531256C>A	ENST00000231136.1	+	1	1418	c.1418C>A	c.(1417-1419)gCc>gAc	p.A473D	PCDHB6_ENST00000543635.1_Missense_Mutation_p.A337D	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	473	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A473D(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCGTCAGCGCCACAGACAGA	0.642																																							uc003lir.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1417-1419)GCC>GAC		protocadherin beta 6 precursor							97.0	106.0	103.0					5																	140531256		2203	4300	6503	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531256C>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1418C>A	5.37:g.140531256C>A	ENSP00000231136:p.Ala473Asp		Somatic				PCDHB6_uc011dah.1_Missense_Mutation_p.A337D	p.A473D	NM_018939	NP_061762	WXS	Illumina HiSeq	Unspecified	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1418	+			473			Cadherin 5.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.1418C>A	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489966	0.84962	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.61980	0.06;0.06	4.18	4.18	0.49190	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.88047	0.6332	H	0.99156	4.45	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	D	0.93675	0.6993	9	0.87932	D	0	.	16.9318	0.86192	0.0:1.0:0.0:0.0	.	473	Q9Y5E3	PCDB6_HUMAN	D	337;473;258	ENSP00000438466:A337D;ENSP00000231136:A473D	ENSP00000231136:A473D	A	+	2	0	PCDHB6	140511440	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.933000	0.70130	2.046000	0.60703	0.485000	0.47835	GCC		0.642	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		7	86	1	0	0.00621372	0.006214	0.0070905	7	86				
PCDHGA8	9708	broad.mit.edu	37	5	140772816	140772816	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:140772816G>A	ENST00000398604.2	+	1	436	c.436G>A	c.(436-438)Gcg>Acg	p.A146T	PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	146	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A146T(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACGAAATCGCGGTTCCTGG	0.443																																							uc003lkd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)GCG>ACG		protocadherin gamma subfamily A, 8 isoform 1							51.0	56.0	54.0					5																	140772816		1933	4151	6084	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140772816G>A	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.436G>A	5.37:g.140772816G>A	ENSP00000381605:p.Ala146Thr		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A146T	p.A146T	NM_032088	NP_114477	WXS	Illumina HiSeq	Unspecified	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1334	+			146			Extracellular (Potential).|Cadherin 2.		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.436G>A	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	6.133	0.392706	0.11638	.	.	ENSG00000253767	ENST00000398604	T	0.55413	0.52	5.41	2.63	0.31362	Cadherin (3);Cadherin-like (1);	0.699665	0.10826	U	0.629889	T	0.32255	0.0823	N	0.20807	0.61	0.23287	N	0.99798	B;B	0.17852	0.014;0.024	B;B	0.17979	0.02;0.016	T	0.24905	-1.0147	10	0.20519	T	0.43	.	4.0745	0.09897	0.3461:0.0:0.5014:0.1526	.	146;146	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	T	146	ENSP00000381605:A146T	ENSP00000381605:A146T	A	+	1	0	PCDHGA8	140753000	0.005000	0.15991	0.889000	0.34880	0.695000	0.40330	0.445000	0.21677	0.258000	0.21686	0.655000	0.94253	GCG		0.443	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		23	49	0	0	0	0.002299	0	23	49				
PPARGC1B	133522	broad.mit.edu	37	5	149221870	149221870	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:149221870C>T	ENST00000309241.5	+	10	2778	c.2746C>T	c.(2746-2748)Cga>Tga	p.R916*	PPARGC1B_ENST00000394320.3_Nonsense_Mutation_p.R916*|PPARGC1B_ENST00000360453.4_Nonsense_Mutation_p.R877*|PPARGC1B_ENST00000403750.1_Nonsense_Mutation_p.R852*	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	916	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.R916*(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CATGAGCTCCCGAGAGCTGAA	0.532																																							uc003lrc.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(2746-2748)CGA>TGA		peroxisome proliferator-activated receptor							132.0	114.0	120.0					5																	149221870		2203	4300	6503	SO:0001587	stop_gained	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149221870C>T	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2746C>T	5.37:g.149221870C>T	ENSP00000312649:p.Arg916*		Somatic				PPARGC1B_uc003lrb.1_Nonsense_Mutation_p.R916*|PPARGC1B_uc003lrd.2_Nonsense_Mutation_p.R877*|PPARGC1B_uc003lrf.2_Nonsense_Mutation_p.R895*|PPARGC1B_uc003lre.1_Nonsense_Mutation_p.R895*	p.R916*	NM_133263	NP_573570	WXS	Illumina HiSeq	Unspecified	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		10	2788	+			916			RRM.		A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Nonsense_Mutation	SNP	ENST00000309241.5	37	c.2746C>T	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.211921|7.211921	0.98139|0.98139	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|.	.|.	.|.	4.79|4.79	-0.43|-0.43	0.12299|0.12299	.|.	.|0.249710	.|0.32819	.|N	.|0.005613	T|.	0.35189|.	0.0923|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39272|.	-0.9622|.	3|.	.|0.07030	.|T	.|0.85	-12.5147|-12.5147	14.231|14.231	0.65892|0.65892	0.7726:0.2274:0.0:0.0|0.7726:0.2274:0.0:0.0	.|.	.|.	.|.	.|.	L|X	602|877;916;916;852	.|.	.|ENSP00000312649:R916X	P|R	+|+	2|1	0|2	PPARGC1B|PPARGC1B	149202063|149202063	0.104000|0.104000	0.21937|0.21937	0.034000|0.034000	0.17996|0.17996	0.983000|0.983000	0.72400|0.72400	2.737000|2.737000	0.47393|0.47393	0.104000|0.104000	0.17725|0.17725	0.462000|0.462000	0.41574|0.41574	CCG|CGA		0.532	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		8	53	0	0	0	0.008291	0	8	53				
NMUR2	56923	broad.mit.edu	37	5	151784153	151784153	+	Silent	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr5:151784153G>A	ENST00000255262.3	-	1	687	c.522C>T	c.(520-522)tcC>tcT	p.S174S	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	174					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.S174S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AGAAGAGCACGGAGAAGCCCC	0.637																																							uc003luv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8						c.(520-522)TCC>TCT		neuromedin U receptor 2							77.0	82.0	80.0					5																	151784153		2203	4300	6503	SO:0001819	synonymous_variant	56923				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	g.chr5:151784153G>A	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.522C>T	5.37:g.151784153G>A			Somatic					p.S174S	NM_020167	NP_064552	WXS	Illumina HiSeq	Unspecified	Q9GZQ4	NMUR2_HUMAN	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)		1	688	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	174			Helical; Name=4; (Potential).		Q7LC54|Q96AM5|Q9NRA6	Silent	SNP	ENST00000255262.3	37	c.522C>T	CCDS4321.1																																																																																				0.637	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		11	75	0	0	0	0.001855	0	11	75				
VARS	7407	broad.mit.edu	37	6	31751989	31751989	+	Splice_Site	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:31751989A>G	ENST00000375663.3	-	13	2112		c.e13+1		VARS_ENST00000444930.2_Splice_Site|VARS_ENST00000482996.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase						gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.?(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	ACAGTCCCCCACCTGGTATCT	0.572																																							uc003nxe.2		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.e13+1		valyl-tRNA synthetase	L-Valine(DB00161)						195.0	188.0	191.0					6																	31751989		2203	4300	6503	SO:0001630	splice_region_variant	7407				translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity	g.chr6:31751989A>G	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1671+1T>C	6.37:g.31751989A>G			Somatic				VARS_uc011doi.1_Splice_Site	p.Q557_splice	NM_006295	NP_006286	WXS	Illumina HiSeq	Unspecified	P26640	SYVC_HUMAN			13	2094	-								B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Splice_Site	SNP	ENST00000375663.3	37	c.1671_splice	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.687948	0.68271	.	.	ENSG00000204394	ENST00000375663;ENST00000444930	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9753	0.64268	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VARS	31859968	1.000000	0.71417	0.931000	0.37212	0.954000	0.61252	6.845000	0.75394	2.186000	0.69663	0.533000	0.62120	.		0.572	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	Intron	9	164	0	0	0	0.006214	0	9	164				
GCM1	8521	broad.mit.edu	37	6	52993300	52993301	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:52993300_52993301GG>CT	ENST00000259803.7	-	6	1225_1226	c.1014_1015CC>AG	c.(1012-1017)taCCag>taAGag	p.338_339YQ>*E	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	338					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Y338_Q339>*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					GGAAGCTGCTGGTAAAAGGGTT	0.46																																							uc003pbp.2		NA																	1	Complex - deletion inframe(1)		lung(1)	central_nervous_system(1)	1						c.(1012-1017)TACCAG>TAAGAG		glial cells missing homolog a																																				SO:0001587	stop_gained	8521					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:52993300_52993301GG>CT	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.1014_1015delinsCT	6.37:g.52993300_52993301delinsCT	ENSP00000259803:p.Y338_Q339delins*E		Somatic					p.338_339YQ>*E	NM_003643	NP_003634	WXS	Illumina HiSeq	Unspecified	Q9NP62	GCM1_HUMAN			6	1223_1224	-	Lung NSC(77;0.0755)		338_339					Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Nonsense_Mutation	DNP	ENST00000259803.7	37	c.1014_1015CC>AG	CCDS4950.1																																																																																				0.460	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			17	57	0	0	0	0.004672	0	17	57				
FAM83B	222584	broad.mit.edu	37	6	54735136	54735136	+	Missense_Mutation	SNP	C	C	T	rs368238775		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:54735136C>T	ENST00000306858.7	+	2	208	c.92C>T	c.(91-93)gCc>gTc	p.A31V		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	31								p.A31V(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TATCGAGTAGCCATTGATATT	0.388																																							uc003pck.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(91-93)GCC>GTC		hypothetical protein LOC222584		C	VAL/ALA	1,4405		0,1,2202	133.0	125.0	128.0		92	5.2	0.8	6		128	0,8600		0,0,4300	no	missense	FAM83B	NM_001010872.1	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	31/1012	54735136	1,13005	2203	4300	6503	SO:0001583	missense	222584							g.chr6:54735136C>T	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.92C>T	6.37:g.54735136C>T	ENSP00000304078:p.Ala31Val		Somatic					p.A31V	NM_001010872	NP_001010872	WXS	Illumina HiSeq	Unspecified	Q5T0W9	FA83B_HUMAN			2	208	+	Lung NSC(77;0.0178)|Renal(3;0.122)		31					Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	c.92C>T	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	C	33	5.240083	0.95240	2.27E-4	0.0	ENSG00000168143	ENST00000306858	T	0.31769	1.48	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.58821	0.2149	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67352	-0.5692	10	0.87932	D	0	-21.3782	19.1761	0.93603	0.0:1.0:0.0:0.0	.	31	Q5T0W9	FA83B_HUMAN	V	31	ENSP00000304078:A31V	ENSP00000304078:A31V	A	+	2	0	FAM83B	54843095	1.000000	0.71417	0.849000	0.33467	0.981000	0.71138	7.556000	0.82233	2.602000	0.87976	0.467000	0.42956	GCC		0.388	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		25	106	0	0	0	0.00333	0	25	106				
LAMA2	3908	broad.mit.edu	37	6	129465145	129465145	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:129465145A>G	ENST00000421865.2	+	5	788	c.739A>G	c.(739-741)Agg>Ggg	p.R247G		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	247	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.R247G(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAGATTTCAGAGGATCCGCAC	0.433																																							uc003qbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(739-741)AGG>GGG		laminin alpha 2 subunit isoform a precursor							119.0	111.0	114.0					6																	129465145		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129465145A>G	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.739A>G	6.37:g.129465145A>G	ENSP00000400365:p.Arg247Gly		Somatic				LAMA2_uc003qbo.2_Missense_Mutation_p.R247G	p.R247G	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	5	844	+			247			Laminin N-terminal.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.739A>G	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675569	0.67928	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.80393	-1.37	5.43	4.25	0.50352	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	M	0.71871	2.18	0.47308	D	0.999387	P;P	0.44281	0.698;0.831	P;P	0.54759	0.696;0.76	D	0.83652	0.0156	10	0.87932	D	0	.	11.7661	0.51930	0.7214:0.2786:0.0:0.0	.	247;247	A6NF00;P24043	.;LAMA2_HUMAN	G	247	ENSP00000400365:R247G	ENSP00000346769:R247G	R	+	1	2	LAMA2	129506838	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.475000	0.35409	0.967000	0.38186	0.383000	0.25322	AGG		0.433	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			15	97	0	0	0	0.003163	0	15	97				
MOXD1	26002	broad.mit.edu	37	6	132693821	132693821	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:132693821G>T	ENST00000367963.3	-	4	707	c.589C>A	c.(589-591)Cca>Aca	p.P197T	MOXD1_ENST00000336749.3_Missense_Mutation_p.P129T	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	197						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)	p.P197T(1)|p.P129T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		TCTTTGTTTGGGATGGGGACC	0.363																																							uc003qdf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(589-591)CCA>ACA		monooxygenase, DBH-like 1 isoform 2							85.0	83.0	84.0					6																	132693821		2203	4300	6503	SO:0001583	missense	26002				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity	g.chr6:132693821G>T	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.589C>A	6.37:g.132693821G>T	ENSP00000356940:p.Pro197Thr		Somatic				MOXD1_uc003qde.2_Missense_Mutation_p.P129T	p.P197T	NM_015529	NP_056344	WXS	Illumina HiSeq	Unspecified	Q6UVY6	MOXD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)	4	688	-	Breast(56;0.0495)		197			Lumenal (Potential).		Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	ENST00000367963.3	37	c.589C>A	CCDS5152.2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175040	0.78564	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.56611	0.45;0.45	5.46	5.46	0.80206	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.061910	0.64402	D	0.000004	T	0.73659	0.3615	M	0.91510	3.215	0.80722	D	1	P;P	0.51791	0.948;0.617	P;B	0.60286	0.872;0.242	T	0.80020	-0.1557	10	0.87932	D	0	-9.3393	19.3128	0.94198	0.0:0.0:1.0:0.0	.	197;129	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	T	197;129	ENSP00000356940:P197T;ENSP00000336998:P129T	ENSP00000336998:P129T	P	-	1	0	MOXD1	132735514	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.728000	0.84847	2.567000	0.86603	0.650000	0.86243	CCA		0.363	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529		5	79	1	0	1.23904e-05	0.000602	1.60043e-05	5	79				
MAP3K5	4217	broad.mit.edu	37	6	137041635	137041635	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:137041635T>A	ENST00000359015.4	-	2	901	c.541A>T	c.(541-543)Atc>Ttc	p.I181F		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	181					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.I181F(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TAGAGGATGATGTTGTTGGCC	0.468																																							uc003qhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(541-543)ATC>TTC		mitogen-activated protein kinase kinase kinase							225.0	186.0	199.0					6																	137041635		2203	4300	6503	SO:0001583	missense	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:137041635T>A	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.541A>T	6.37:g.137041635T>A	ENSP00000351908:p.Ile181Phe		Somatic				MAP3K5_uc011edk.1_Missense_Mutation_p.I26F|MAP3K5_uc010kgw.1_Missense_Mutation_p.I181F	p.I181F	NM_005923	NP_005914	WXS	Illumina HiSeq	Unspecified	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	2	902	-	Colorectal(23;0.24)		181					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.541A>T	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	T	31	5.085816	0.94100	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.15603	2.41	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.34337	0.0894	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.87578	0.985;0.998;0.996	T	0.13602	-1.0503	10	0.87932	D	0	.	16.3871	0.83514	0.0:0.0:0.0:1.0	.	261;26;181	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	F	181;261	ENSP00000351908:I181F	ENSP00000351908:I181F	I	-	1	0	MAP3K5	137083328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.981000	0.56902	2.270000	0.75569	0.482000	0.46254	ATC		0.468	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			13	47	0	0	0	0.00245	0	13	47				
MAP3K5	4217	broad.mit.edu	37	6	137041644	137041644	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr6:137041644C>A	ENST00000359015.4	-	2	892	c.532G>T	c.(532-534)Gcc>Tcc	p.A178S		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	178					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.A178S(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		ATGTTGTTGGCCATGCTGAAA	0.458																																							uc003qhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(532-534)GCC>TCC		mitogen-activated protein kinase kinase kinase							225.0	185.0	198.0					6																	137041644		2203	4300	6503	SO:0001583	missense	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:137041644C>A	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.532G>T	6.37:g.137041644C>A	ENSP00000351908:p.Ala178Ser		Somatic				MAP3K5_uc011edk.1_Missense_Mutation_p.A23S|MAP3K5_uc010kgw.1_Missense_Mutation_p.A178S	p.A178S	NM_005923	NP_005914	WXS	Illumina HiSeq	Unspecified	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	2	893	-	Colorectal(23;0.24)		178					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.532G>T	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319214	0.95682	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.09163	3.01	5.93	5.93	0.95920	.	0.048952	0.85682	D	0.000000	T	0.16769	0.0403	L	0.50919	1.6	0.80722	D	1	P;D;D	0.67145	0.932;0.996;0.969	P;D;P	0.63488	0.685;0.915;0.793	T	0.03374	-1.1043	10	0.15499	T	0.54	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	258;23;178	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	S	178;258	ENSP00000351908:A178S	ENSP00000351908:A178S	A	-	1	0	MAP3K5	137083337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.757000	0.68766	2.814000	0.96858	0.591000	0.81541	GCC		0.458	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			14	44	1	0	4.3838e-07	0.001855	5.99549e-07	14	44				
CREB5	9586	broad.mit.edu	37	7	28610075	28610075	+	Missense_Mutation	SNP	C	C	A	rs199608009		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:28610075C>A	ENST00000357727.2	+	5	774	c.384C>A	c.(382-384)aaC>aaA	p.N128K	CREB5_ENST00000396300.2_Missense_Mutation_p.N121K|CREB5_ENST00000409603.1_Missense_Mutation_p.N95K|CREB5_ENST00000396299.2_Missense_Mutation_p.N95K	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	128					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N128K(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						ATGACACCAACGTTGTGATTC	0.592																																							uc003szq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(382-384)AAC>AAA		cAMP responsive element binding protein 5							112.0	98.0	103.0					7																	28610075		2203	4300	6503	SO:0001583	missense	9586				positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:28610075C>A	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.384C>A	7.37:g.28610075C>A	ENSP00000350359:p.Asn128Lys		Somatic				CREB5_uc003szo.2_Missense_Mutation_p.N95K|CREB5_uc003szr.2_Missense_Mutation_p.N121K	p.N128K	NM_182898	NP_878901	WXS	Illumina HiSeq	Unspecified	Q02930	CREB5_HUMAN			5	774	+			128					A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	c.384C>A	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426258	0.43020	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.46	-0.687	0.11320	.	0.117408	0.85682	D	0.000000	T	0.43010	0.1228	N	0.24115	0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09885	-1.0654	10	0.32370	T	0.25	-9.4627	11.347	0.49567	0.0:0.5548:0.0:0.4452	.	128	Q02930	CREB5_HUMAN	K	95;128;121;95	ENSP00000379593:N95K;ENSP00000350359:N128K;ENSP00000379594:N121K;ENSP00000387197:N95K	ENSP00000350359:N128K	N	+	3	2	CREB5	28576600	0.988000	0.35896	0.980000	0.43619	0.997000	0.91878	0.293000	0.19029	-0.465000	0.06953	0.655000	0.94253	AAC		0.592	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904		15	71	1	0	1.01871e-10	0.008871	1.52807e-10	15	71				
NOD1	10392	broad.mit.edu	37	7	30492655	30492655	+	Splice_Site	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:30492655C>T	ENST00000222823.4	-	6	903	c.378G>A	c.(376-378)gtG>gtA	p.V126V	NOD1_ENST00000423334.2_Splice_Site_p.V126V	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	126					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.V126V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						TATACCTGCTCACTGGAGGGA	0.582																																							uc003tav.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(376-378)GTG>GTA		nucleotide-binding oligomerization domain							39.0	38.0	38.0					7																	30492655		2203	4300	6503	SO:0001630	splice_region_variant	10392				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity	g.chr7:30492655C>T	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.377-1G>A	7.37:g.30492655C>T			Somatic				NOD1_uc010kvs.2_Silent_p.V126V	p.V126V	NM_006092	NP_006083	WXS	Illumina HiSeq	Unspecified	Q9Y239	NOD1_HUMAN			6	901	-			126					B4DTU3|Q549U4|Q8IWF5	Silent	SNP	ENST00000222823.4	37	c.378G>A	CCDS5427.1																																																																																				0.582	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		Silent	11	52	0	0	0	0.00245	0	11	52				
PSPH	5723	broad.mit.edu	37	7	56087408	56087408	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:56087408C>G	ENST00000395471.3	-	5	965	c.160G>C	c.(160-162)Ggg>Cgg	p.G54R	PSPH_ENST00000275605.3_Missense_Mutation_p.G54R|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	54					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.G54R(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GGCACTGCCCCGCCCATGGCT	0.617																																							uc003trg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(160-162)GGG>CGG		phosphoserine phosphatase							51.0	37.0	42.0					7																	56087408		2203	4300	6503	SO:0001583	missense	5723				L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity	g.chr7:56087408C>G	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.160G>C	7.37:g.56087408C>G	ENSP00000378854:p.Gly54Arg		Somatic				PSPH_uc003trh.2_Missense_Mutation_p.G54R|PSPH_uc003tri.2_Missense_Mutation_p.G54R|PSPH_uc003trj.2_Missense_Mutation_p.G83R	p.G54R	NM_004577	NP_004568	WXS	Illumina HiSeq	Unspecified	P78330	SERB_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	523	-	Breast(14;0.214)		54					B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	c.160G>C	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631639	0.67015	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.91740	-2.9;-2.9;-2.9	4.5	3.63	0.41609	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Phosphoserine phosphatase, domain 2 (1);	0.050580	0.85682	D	0.000000	D	0.97614	0.9218	H	0.99090	4.425	0.80722	D	1	D;D	0.59357	0.985;0.97	D;D	0.74348	0.983;0.983	D	0.97755	1.0217	10	0.87932	D	0	-24.1446	11.95	0.52950	0.0:0.9155:0.0:0.0845	.	54;54	Q53EY1;P78330	.;SERB_HUMAN	R	54	ENSP00000275605:G54R;ENSP00000378854:G54R;ENSP00000398653:G54R	ENSP00000275605:G54R	G	-	1	0	PSPH	56054902	1.000000	0.71417	0.948000	0.38648	0.689000	0.40095	5.546000	0.67243	1.130000	0.42092	-0.191000	0.12829	GGG		0.617	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577		3	27	0	0	0	0.000248	0	3	27				
DTX2	113878	broad.mit.edu	37	7	76121568	76121568	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:76121568C>A	ENST00000324432.5	+	6	1517	c.1007C>A	c.(1006-1008)gCa>gAa	p.A336E	DTX2_ENST00000307569.8_Missense_Mutation_p.A336E|DTX2_ENST00000446820.2_Missense_Mutation_p.A336E|DTX2_ENST00000446600.1_Missense_Mutation_p.A245E|DTX2_ENST00000430490.2_Missense_Mutation_p.A336E|DTX2_ENST00000413936.2_Missense_Mutation_p.A336E	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	336					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A336E(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CAGGCGCTCGCAGGTAGGTGC	0.647																																							uc003uff.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1006-1008)GCA>GAA		deltex 2 isoform a							13.0	17.0	16.0					7																	76121568		1330	3302	4632	SO:0001583	missense	113878				Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding	g.chr7:76121568C>A		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1007C>A	7.37:g.76121568C>A	ENSP00000322885:p.Ala336Glu		Somatic				DTX2_uc011kgk.1_Missense_Mutation_p.A245E|DTX2_uc003ufg.3_Missense_Mutation_p.A336E|DTX2_uc003ufh.3_Missense_Mutation_p.A336E|DTX2_uc003ufj.3_Missense_Mutation_p.A336E|DTX2_uc003ufk.3_Missense_Mutation_p.A14E	p.A336E	NM_020892	NP_065943	WXS	Illumina HiSeq	Unspecified	Q86UW9	DTX2_HUMAN			6	1563	+			336					Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	ENST00000324432.5	37	c.1007C>A	CCDS5587.1	.	.	.	.	.	.	.	.	.	.	.	19.33	3.807018	0.70797	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	T;T;T;T;T;T	0.20881	2.04;2.67;2.05;2.04;2.04;2.67	4.05	4.05	0.47172	.	0.145107	0.43747	D	0.000525	T	0.41650	0.1168	M	0.72118	2.19	0.80722	D	1	D;D;P	0.76494	0.99;0.999;0.865	P;D;P	0.71656	0.899;0.974;0.493	T	0.21724	-1.0237	10	0.23891	T	0.37	-3.9396	13.7026	0.62618	0.0:1.0:0.0:0.0	.	245;336;336	F5GX89;Q86UW9-2;Q86UW9	.;.;DTX2_HUMAN	E	336;336;245;245;336;336;336	ENSP00000322885:A336E;ENSP00000305242:A336E;ENSP00000397648:A245E;ENSP00000390218:A336E;ENSP00000411986:A336E;ENSP00000392545:A336E	ENSP00000305242:A336E	A	+	2	0	AC005522.1	75959504	1.000000	0.71417	0.998000	0.56505	0.716000	0.41182	4.853000	0.62911	1.987000	0.57996	0.462000	0.41574	GCA		0.647	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			14	31	1	0	1.15088e-07	0.004007	1.59749e-07	14	31				
HGF	3082	broad.mit.edu	37	7	81386504	81386504	+	Splice_Site	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:81386504C>T	ENST00000222390.5	-	4	709		c.e4+1		HGF_ENST00000453411.1_Splice_Site|HGF_ENST00000444829.2_Splice_Site|HGF_ENST00000453018.1_Silent_p.R58R|HGF_ENST00000457544.2_Splice_Site|HGF_ENST00000354224.6_Splice_Site|HGF_ENST00000423064.2_Splice_Site	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)						activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.?(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						ACTGTTCTTACCTGTGTTCGT	0.388																																							uc003uhl.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.e4+1		hepatocyte growth factor isoform 1							158.0	145.0	150.0					7																	81386504		2203	4300	6503	SO:0001630	splice_region_variant	3082				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity	g.chr7:81386504C>T		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.482+1G>A	7.37:g.81386504C>T			Somatic				HGF_uc003uhm.2_Splice_Site_p.S161_splice|HGF_uc003uhn.1_Splice_Site_p.S161_splice|HGF_uc003uho.1_Splice_Site_p.S161_splice|HGF_uc003uhp.2_Splice_Site_p.S161_splice	p.S161_splice	NM_000601	NP_000592	WXS	Illumina HiSeq	Unspecified	P14210	HGF_HUMAN			4	647	-								A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Splice_Site	SNP	ENST00000222390.5	37	c.482_splice	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270701	0.80469	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769;ENST00000423064;ENST00000354224	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4119	0.90554	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HGF	81224440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.530000	0.73816	2.346000	0.79739	0.655000	0.94253	.		0.388	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	Intron	15	42	0	0	0	0.004007	0	15	42				
TAF6	6878	broad.mit.edu	37	7	99705129	99705129	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:99705129G>C	ENST00000344095.4	-	15	2299	c.1774C>G	c.(1774-1776)Ccc>Gcc	p.P592A	TAF6_ENST00000418432.2_Missense_Mutation_p.P516A|TAF6_ENST00000437822.2_Missense_Mutation_p.P629A|TAF6_ENST00000453269.2_Missense_Mutation_p.P592A|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000472509.1_Missense_Mutation_p.P649A|TAF6_ENST00000452041.1_Missense_Mutation_p.P592A	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	592					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P592A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGCTGGGGGGTGCGGTGGTG	0.667																																							uc003uti.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1774-1776)CCC>GCC		TBP-associated factor 6 isoform alpha							98.0	100.0	99.0					7																	99705129		2203	4300	6503	SO:0001583	missense	6878				negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:99705129G>C		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1774C>G	7.37:g.99705129G>C	ENSP00000344537:p.Pro592Ala		Somatic				AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_Missense_Mutation_p.P514A|TAF6_uc003uth.2_Missense_Mutation_p.P649A|TAF6_uc003utk.2_Missense_Mutation_p.P592A|TAF6_uc011kji.1_Missense_Mutation_p.P629A|TAF6_uc003utj.2_Missense_Mutation_p.P582A|TAF6_uc003utl.2_Missense_Mutation_p.P582A|TAF6_uc003utm.2_Missense_Mutation_p.P592A	p.P592A	NM_139315	NP_647476	WXS	Illumina HiSeq	Unspecified	P49848	TAF6_HUMAN			15	1855	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		592					A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	37	c.1774C>G	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	G	6.858	0.527559	0.13127	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822	T;T;T;T;T	0.41065	1.03;1.01;1.03;1.03;1.02	6.04	5.16	0.70880	.	0.403326	0.27807	N	0.017763	T	0.23572	0.0570	N	0.14661	0.345	0.21950	N	0.999456	B;B;B;B;B	0.10296	0.002;0.003;0.002;0.002;0.002	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.05818	-1.0862	10	0.30854	T	0.27	-22.2524	7.8719	0.29571	0.0828:0.1632:0.754:0.0	.	629;582;582;592;516	B4DT11;P49848-2;A4D299;P49848;B3KUR4	.;.;.;TAF6_HUMAN;.	A	592;649;592;592;516;629	ENSP00000389575:P592A;ENSP00000419760:P649A;ENSP00000416396:P592A;ENSP00000344537:P592A;ENSP00000399982:P629A	ENSP00000344537:P592A	P	-	1	0	TAF6	99543065	1.000000	0.71417	0.920000	0.36463	0.394000	0.30568	4.111000	0.57838	2.871000	0.98454	0.639000	0.83563	CCC		0.667	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		22	104	0	0	0	0.00632	0	22	104				
MOGAT3	346606	broad.mit.edu	37	7	100839574	100839574	+	Silent	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:100839574G>T	ENST00000223114.4	-	6	931	c.765C>A	c.(763-765)acC>acA	p.T255T	MOGAT3_ENST00000379423.3_Intron|MOGAT3_ENST00000440203.2_Silent_p.T255T	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	255					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.T255T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GCTTCTTGAAGGTGAGCTGGC	0.582																																							uc003uyc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(763-765)ACC>ACA		monoacylglycerol O-acyltransferase 3							43.0	47.0	46.0					7																	100839574		2203	4300	6503	SO:0001819	synonymous_variant	346606				glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity	g.chr7:100839574G>T	AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.765C>A	7.37:g.100839574G>T			Somatic				MOGAT3_uc010lhr.2_Intron	p.T255T	NM_178176	NP_835470	WXS	Illumina HiSeq	Unspecified	Q86VF5	MOGT3_HUMAN			6	932	-	Lung NSC(181;0.168)|all_lung(186;0.215)		255					Q496A6|Q496A7|Q496A8|Q9UDW7	Silent	SNP	ENST00000223114.4	37	c.765C>A	CCDS5714.1																																																																																				0.582	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		4	21	1	0	0.000602214	0.000602	0.000708936	4	21				
NRCAM	4897	broad.mit.edu	37	7	107823140	107823140	+	Splice_Site	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:107823140G>C	ENST00000425651.2	-	20	2528	c.2529C>G	c.(2527-2529)gaC>gaG	p.D843E	NRCAM_ENST00000379028.3_Splice_Site_p.D843E|NRCAM_ENST00000379024.4_Splice_Site_p.D824E|NRCAM_ENST00000351718.4_Splice_Site_p.D827E|NRCAM_ENST00000413765.2_Splice_Site_p.D824E|NRCAM_ENST00000379022.4_Splice_Site_p.D843E	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	843	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.D827E(1)|p.D843E(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATCACTTACGGTCTTCTCCAG	0.522																																							uc003vfb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)	5						c.(2527-2529)GAC>GAG		neuronal cell adhesion molecule isoform A							74.0	70.0	71.0					7																	107823140		2203	4300	6503	SO:0001630	splice_region_variant	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107823140G>C		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2530+1C>G	7.37:g.107823140G>C			Somatic				NRCAM_uc003vfc.2_Missense_Mutation_p.D827E|NRCAM_uc011kmk.1_Missense_Mutation_p.D838E|NRCAM_uc003vfd.2_Missense_Mutation_p.D819E|NRCAM_uc003vfe.2_Missense_Mutation_p.D819E	p.D843E	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			23	3000	-			843			Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	c.2529C>G	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543486	0.86022	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	T;T;T;T;T;T	0.61040	0.14;0.43;0.18;0.21;0.14;0.18	6.05	6.05	0.98169	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.041854	0.85682	D	0.000000	T	0.75946	0.3919	M	0.68952	2.095	0.80722	D	1	D;P;D;D;D	0.67145	0.996;0.951;0.995;0.989;0.996	D;P;D;D;D	0.75020	0.985;0.81;0.909;0.933;0.942	T	0.72883	-0.4157	10	0.45353	T	0.12	.	20.6087	0.99469	0.0:0.0:1.0:0.0	.	843;824;824;827;843	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	E	843;843;824;843;827;824;843;843	ENSP00000368314:D843E;ENSP00000407858:D824E;ENSP00000325269:D827E;ENSP00000368310:D824E;ENSP00000401244:D843E;ENSP00000368308:D843E	ENSP00000325269:D827E	D	-	3	2	NRCAM	107610376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.503000	0.53340	2.866000	0.98385	0.650000	0.86243	GAC		0.522	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	Missense_Mutation	10	23	0	0	0	0.006214	0	10	23				
TAS2R16	50833	broad.mit.edu	37	7	122635164	122635164	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:122635164C>G	ENST00000249284.2	-	1	590	c.525G>C	c.(523-525)caG>caC	p.Q175H		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	175					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.Q175H(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGAACTGATACTGATGAAAAT	0.418																																							uc003vkl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(523-525)CAG>CAC		taste receptor T2R16							161.0	145.0	150.0					7																	122635164		2203	4300	6503	SO:0001583	missense	50833				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding	g.chr7:122635164C>G	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.525G>C	7.37:g.122635164C>G	ENSP00000249284:p.Gln175His		Somatic					p.Q175H	NM_016945	NP_058641	WXS	Illumina HiSeq	Unspecified	Q9NYV7	T2R16_HUMAN			1	591	-			175			Extracellular (Potential).		A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	c.525G>C	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	C	1.506	-0.550762	0.03996	.	.	ENSG00000128519	ENST00000249284	T	0.37058	1.22	4.21	-5.95	0.02241	.	3.318570	0.01160	N	0.006633	T	0.17323	0.0416	N	0.22421	0.69	0.09310	N	1	P	0.35468	0.503	B	0.33254	0.16	T	0.14117	-1.0484	10	0.16420	T	0.52	.	0.1856	0.00128	0.2418:0.1891:0.2385:0.3306	.	175	Q9NYV7	T2R16_HUMAN	H	175	ENSP00000249284:Q175H	ENSP00000249284:Q175H	Q	-	3	2	TAS2R16	122422400	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.420000	0.01032	-1.632000	0.01541	-1.045000	0.02358	CAG		0.418	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945		31	88	0	0	0	0.002096	0	31	88				
KIAA1549	57670	broad.mit.edu	37	7	138603645	138603645	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:138603645C>G	ENST00000422774.1	-	2	775	c.727G>C	c.(727-729)Gtt>Ctt	p.V243L	KIAA1549_ENST00000242365.4_Missense_Mutation_p.V193L|KIAA1549_ENST00000440172.1_Missense_Mutation_p.V243L			Q9HCM3	K1549_HUMAN	KIAA1549	243						integral component of membrane (GO:0016021)		p.V193L(1)|p.V243L(1)	KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GGAGTTGGAACGATGCCCTCA	0.522			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	NSCLC(119;1534 1718 44213 46230 50068)	uc011kql.1		NA		Dom	yes		7	7q34	57670	O	KIAA1549			O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(229)	2	Substitution - Missense(2)		lung(2)	central_nervous_system(229)|pancreas(1)	230						c.(727-729)GTT>CTT		hypothetical protein LOC57670 isoform 1							115.0	118.0	117.0					7																	138603645		2059	4189	6248	SO:0001583	missense	57670					integral to membrane		g.chr7:138603645C>G		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.727G>C	7.37:g.138603645C>G	ENSP00000416040:p.Val243Leu		Somatic				KIAA1549_uc003vuk.3_Missense_Mutation_p.V193L|KIAA1549_uc011kqj.1_Missense_Mutation_p.V243L	p.V243L	NM_020910	NP_065961	WXS	Illumina HiSeq	Unspecified	Q9HCM3	K1549_HUMAN			2	776	-			243					B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	c.727G>C	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.250743	0.22880	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.28666	1.6;1.6;1.6	4.68	-9.37	0.00626	.	1.563430	0.03911	N	0.281965	T	0.11537	0.0281	N	0.04508	-0.205	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.08055	0.002;0.003	T	0.16958	-1.0385	10	0.16896	T	0.51	.	8.8726	0.35325	0.0:0.4723:0.2977:0.2301	.	243;243	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	L	243;193;243	ENSP00000406661:V243L;ENSP00000242365:V193L;ENSP00000416040:V243L	ENSP00000242365:V193L	V	-	1	0	KIAA1549	138254185	0.000000	0.05858	0.000000	0.03702	0.586000	0.36452	-0.783000	0.04638	-2.135000	0.00811	-0.367000	0.07326	GTT		0.522	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			17	64	0	0	0	0.00499	0	17	64				
KMT2C	58508	broad.mit.edu	37	7	151945190	151945190	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:151945190T>A	ENST00000262189.6	-	14	2547	c.2329A>T	c.(2329-2331)Agc>Tgc	p.S777C	KMT2C_ENST00000355193.2_Missense_Mutation_p.S777C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	777					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S777C(2)									TCTGCCTTGCTTATGTCTGCT	0.423																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2329-2331)AGC>TGC		myeloid/lymphoid or mixed-lineage leukemia 3							230.0	204.0	213.0					7																	151945190		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151945190T>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2329A>T	7.37:g.151945190T>A	ENSP00000262189:p.Ser777Cys		Somatic					p.S777C	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	14	2548	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	777					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2329A>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	9.745	1.165912	0.21538	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.84442	-1.85;-1.85	5.68	2.04	0.26737	.	0.152963	0.33712	N	0.004631	T	0.74574	0.3734	N	0.19112	0.55	0.28561	N	0.911108	D	0.57257	0.979	P	0.46362	0.514	T	0.69822	-0.5041	10	0.72032	D	0.01	.	6.0078	0.19557	0.1219:0.1332:0.0:0.7449	.	777	Q8NEZ4	MLL3_HUMAN	C	777	ENSP00000262189:S777C;ENSP00000347325:S777C	ENSP00000262189:S777C	S	-	1	0	MLL3	151576123	0.058000	0.20735	0.099000	0.21106	0.065000	0.16274	1.463000	0.35277	0.106000	0.17784	-0.309000	0.09137	AGC		0.423	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			37	191	0	0	0	0.004289	0	37	191				
MFHAS1	9258	broad.mit.edu	37	8	8748245	8748245	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:8748245G>C	ENST00000276282.6	-	1	2910	c.2324C>G	c.(2323-2325)cCc>cGc	p.P775R		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	775								p.P775R(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		TTCCTGGCTGGGGGTGGACCG	0.617																																					Melanoma(103;1201 2045 17515 28966)	Melanoma(103;1201 2045 17515 28966)	uc003wsj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2323-2325)CCC>CGC		malignant fibrous histiocytoma amplified							47.0	47.0	47.0					8																	8748245		2203	4300	6503	SO:0001583	missense	9258							g.chr8:8748245G>C	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2324C>G	8.37:g.8748245G>C	ENSP00000276282:p.Pro775Arg		Somatic					p.P775R	NM_004225	NP_004216	WXS	Illumina HiSeq	Unspecified	Q9Y4C4	MFHA1_HUMAN		COAD - Colon adenocarcinoma(149;0.124)	1	2887	-		Hepatocellular(245;0.217)	775					Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	c.2324C>G	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	5.608	0.296930	0.10622	.	.	ENSG00000147324	ENST00000276282	T	0.33865	1.39	3.64	-0.274	0.12910	.	0.352427	0.25692	N	0.028924	T	0.16642	0.0400	L	0.27053	0.805	0.09310	N	1	B	0.16802	0.019	B	0.12156	0.007	T	0.23084	-1.0198	10	0.08381	T	0.77	.	4.0277	0.09695	0.1961:0.0:0.294:0.5099	.	775	Q9Y4C4	MFHA1_HUMAN	R	775	ENSP00000276282:P775R	ENSP00000276282:P775R	P	-	2	0	MFHAS1	8785655	0.082000	0.21442	0.000000	0.03702	0.003000	0.03518	0.634000	0.24614	-0.074000	0.12820	0.655000	0.94253	CCC		0.617	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225		5	61	0	0	0	0.001168	0	5	61				
PRSS55	203074	broad.mit.edu	37	8	10396270	10396270	+	Silent	SNP	G	G	C	rs186026568	byFrequency	TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:10396270G>C	ENST00000328655.3	+	5	1066	c.1026G>C	c.(1024-1026)ctG>ctC	p.L342L	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Intron	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	342						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						TCTGTCCCCTGTCCCATGTGT	0.527																																							uc003wta.2		NA																	0				ovary(1)	1						c.(1024-1026)CTG>CTC		hypothetical protein LOC203074 precursor							92.0	104.0	100.0					8																	10396270		2203	4300	6503	SO:0001819	synonymous_variant	203074				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr8:10396270G>C	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.1026G>C	8.37:g.10396270G>C			Somatic				uc010lru.2_Intron|PRSS55_uc003wtb.2_Intron	p.L342L	NM_198464	NP_940866	WXS	Illumina HiSeq	Unspecified	Q6UWB4	PRS55_HUMAN			5	1041	+			342			Helical; (Potential).		E5RJX5	Silent	SNP	ENST00000328655.3	37	c.1026G>C	CCDS5976.1																																																																																				0.527	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464		51	152	0	0	0	0.00361	0	51	152				
EXTL3	2137	broad.mit.edu	37	8	28574048	28574048	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:28574048C>T	ENST00000220562.4	+	3	1374	c.472C>T	c.(472-474)Cga>Tga	p.R158*	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	158					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.R158*(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CCTGCCCATCCGACTGCTCCC	0.602																																							uc003xgz.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)	2						c.(472-474)CGA>TGA		exostoses-like 3							55.0	52.0	53.0					8																	28574048		2203	4300	6503	SO:0001587	stop_gained	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28574048C>T	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.472C>T	8.37:g.28574048C>T	ENSP00000220562:p.Arg158*		Somatic					p.R158*	NM_001440	NP_001431	WXS	Illumina HiSeq	Unspecified	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	3	1065	+		Ovarian(32;0.069)	158			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Nonsense_Mutation	SNP	ENST00000220562.4	37	c.472C>T	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	C	44	10.706828	0.99454	.	.	ENSG00000012232	ENST00000220562	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.7793	18.403	0.90523	0.0:1.0:0.0:0.0	.	.	.	.	X	158	.	.	R	+	1	2	EXTL3	28629967	1.000000	0.71417	0.997000	0.53966	0.779000	0.44077	2.976000	0.49289	2.348000	0.79779	0.485000	0.47835	CGA		0.602	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		3	45	0	0	0	0.004672	0	3	45				
MCM4	4173	broad.mit.edu	37	8	48883365	48883365	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:48883365G>T	ENST00000262105.2	+	11	1938	c.1729G>T	c.(1729-1731)Gac>Tac	p.D577Y	MCM4_ENST00000523944.1_Missense_Mutation_p.D577Y	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	577	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.D577Y(1)		biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CGATGAGTTCGACAAGATGAA	0.498																																							uc003xqk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1729-1731)GAC>TAC		minichromosome maintenance complex component 4							86.0	73.0	77.0					8																	48883365		2203	4300	6503	SO:0001583	missense	4173				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr8:48883365G>T		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1729G>T	8.37:g.48883365G>T	ENSP00000262105:p.Asp577Tyr		Somatic				MCM4_uc003xql.1_Missense_Mutation_p.D577Y|MCM4_uc011ldi.1_Missense_Mutation_p.D564Y	p.D577Y	NM_182746	NP_877423	WXS	Illumina HiSeq	Unspecified	P33991	MCM4_HUMAN			12	1824	+		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)	577			MCM.		Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	37	c.1729G>T	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655539	0.88056	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229	T;T	0.14266	2.52;2.52	6.03	5.12	0.69794	Mini-chromosome maintenance, conserved site (1);ATPase, AAA+ type, core (1);	0.081294	0.85682	D	0.000000	T	0.59169	0.2174	H	0.99582	4.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77603	-0.2526	10	0.87932	D	0	-34.2131	16.7665	0.85525	0.0:0.0:0.8706:0.1294	.	577;577	B3KMX0;P33991	.;MCM4_HUMAN	Y	577;577;564;537	ENSP00000430194:D577Y;ENSP00000262105:D577Y	ENSP00000262105:D577Y	D	+	1	0	MCM4	49045918	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.977000	0.88081	2.861000	0.98227	0.655000	0.94253	GAC		0.498	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914		13	44	1	0	2.32078e-09	0.003163	3.37239e-09	13	44				
RP1	6101	broad.mit.edu	37	8	55540191	55540191	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:55540191G>A	ENST00000220676.1	+	4	3897	c.3749G>A	c.(3748-3750)tGt>tAt	p.C1250Y		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1250					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.C1250Y(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCTGAAGTCTGTGTTTTGGAA	0.438																																					Colon(91;1014 1389 7634 14542 40420)	Colon(91;1014 1389 7634 14542 40420)	uc003xsd.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(4)|pancreas(1)	12						c.(3748-3750)TGT>TAT		retinitis pigmentosa RP1 protein							142.0	135.0	137.0					8																	55540191		2203	4300	6503	SO:0001583	missense	6101				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	g.chr8:55540191G>A	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3749G>A	8.37:g.55540191G>A	ENSP00000220676:p.Cys1250Tyr		Somatic				RP1_uc011ldy.1_Intron	p.C1250Y	NM_006269	NP_006260	WXS	Illumina HiSeq	Unspecified	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)		4	3897	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	1250						Missense_Mutation	SNP	ENST00000220676.1	37	c.3749G>A	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.519925	0.44866	.	.	ENSG00000104237	ENST00000220676	T	0.21543	2.0	4.76	2.94	0.34122	.	0.622969	0.15008	N	0.285753	T	0.13756	0.0333	L	0.27053	0.805	0.09310	N	0.999997	B	0.25312	0.123	B	0.21917	0.037	T	0.21109	-1.0255	10	0.87932	D	0	.	6.1616	0.20368	0.0987:0.0:0.715:0.1863	.	1250	P56715	RP1_HUMAN	Y	1250	ENSP00000220676:C1250Y	ENSP00000220676:C1250Y	C	+	2	0	RP1	55702744	0.311000	0.24536	0.035000	0.18076	0.878000	0.50629	0.750000	0.26334	0.662000	0.31006	0.655000	0.94253	TGT		0.438	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		14	159	0	0	0	0.003163	0	14	159				
TGS1	96764	broad.mit.edu	37	8	56695311	56695311	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:56695311C>T	ENST00000260129.5	+	2	583	c.106C>T	c.(106-108)Cga>Tga	p.R36*		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	36					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)	p.R36*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			TCGCAGGGATCGAAAATTGTA	0.318																																					Esophageal Squamous(34;275 823 4842 34837 48447)	Esophageal Squamous(34;275 823 4842 34837 48447)	uc003xsj.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(106-108)CGA>TGA		trimethylguanosine synthase homolog							72.0	79.0	77.0					8																	56695311		2203	4298	6501	SO:0001587	stop_gained	96764				cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity	g.chr8:56695311C>T	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.106C>T	8.37:g.56695311C>T	ENSP00000260129:p.Arg36*		Somatic				TGS1_uc010lyh.2_Intron	p.R36*	NM_024831	NP_079107	WXS	Illumina HiSeq	Unspecified	Q96RS0	TGS1_HUMAN	Epithelial(17;0.00027)|all cancers(17;0.00251)		2	493	+		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	36					A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Nonsense_Mutation	SNP	ENST00000260129.5	37	c.106C>T	CCDS34894.1	.	.	.	.	.	.	.	.	.	.	C	40	8.255243	0.98729	.	.	ENSG00000137574	ENST00000260129	.	.	.	5.16	5.16	0.70880	.	0.194769	0.33875	N	0.004467	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.8235	17.1982	0.86899	0.0:1.0:0.0:0.0	.	.	.	.	X	36	.	ENSP00000260129:R36X	R	+	1	2	TGS1	56857865	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.697000	0.54764	2.559000	0.86315	0.563000	0.77884	CGA		0.318	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1	NM_024831		25	78	0	0	0	0.007291	0	25	78				
CSMD3	114788	broad.mit.edu	37	8	113569029	113569029	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr8:113569029C>A	ENST00000297405.5	-	25	4441	c.4197G>T	c.(4195-4197)gaG>gaT	p.E1399D	CSMD3_ENST00000352409.3_Missense_Mutation_p.E1399D|CSMD3_ENST00000343508.3_Missense_Mutation_p.E1359D|CSMD3_ENST00000455883.2_Missense_Mutation_p.E1295D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1399	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E1399D(1)|p.E1359D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGCCCTTCTCTCCCCTGTCA	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4195-4197)GAG>GAT		CUB and Sushi multiple domains 3 isoform 1							110.0	99.0	103.0					8																	113569029		2203	4299	6502	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113569029C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4197G>T	8.37:g.113569029C>A	ENSP00000297405:p.Glu1399Asp	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.E671D|CSMD3_uc003ynt.2_Missense_Mutation_p.E1359D|CSMD3_uc011lhx.1_Missense_Mutation_p.E1295D	p.E1399D	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			25	4356	-			1399			Extracellular (Potential).|Sushi 7.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4197G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	9.622	1.134181	0.21123	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.11	1.79	0.24919	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.15955	0.0384	N	0.05592	-0.015	0.26204	N	0.979396	P;P;P	0.48834	0.712;0.756;0.916	B;B;P	0.52217	0.279;0.401;0.693	T	0.14980	-1.0453	10	0.14656	T	0.56	.	7.5225	0.27637	0.0:0.5931:0.0:0.4069	.	1295;1399;1359	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	D	1359;1399;739;1295;1399	ENSP00000345799:E1359D;ENSP00000297405:E1399D;ENSP00000341558:E739D;ENSP00000412263:E1295D;ENSP00000343124:E1399D	ENSP00000297405:E1399D	E	-	3	2	CSMD3	113638205	0.926000	0.31397	1.000000	0.80357	0.968000	0.65278	0.017000	0.13399	0.618000	0.30179	-0.150000	0.13652	GAG		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		13	68	1	0	2.68362e-12	0.001368	4.19457e-12	13	68				
IFNA4	3441	broad.mit.edu	37	9	21187398	21187398	+	Missense_Mutation	SNP	C	C	T	rs145690832		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr9:21187398C>T	ENST00000421715.1	-	1	200	c.133G>A	c.(133-135)Gga>Aga	p.G45R		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	45					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.G45R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAGATTCTTCCCATTTGTGCC	0.527																																					NSCLC(154;890 1986 23660 27800 51138)	NSCLC(154;890 1986 23660 27800 51138)	uc003zon.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(133-135)GGA>AGA		interferon, alpha 4 precursor																																				SO:0001583	missense	3441				blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21187398C>T		CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.133G>A	9.37:g.21187398C>T	ENSP00000412897:p.Gly45Arg		Somatic					p.G45R	NM_021068	NP_066546	WXS	Illumina HiSeq	Unspecified	P05014	IFNA4_HUMAN		GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)	1	201	-			45					P13358|Q14CS4|Q5VV15	Missense_Mutation	SNP	ENST00000421715.1	37	c.133G>A	CCDS6498.1	.	.	.	.	.	.	.	.	.	.	-	0.019	-1.461313	0.01062	.	.	ENSG00000236637	ENST00000421715	T	0.02916	4.11	2.96	0.0887	0.14455	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.450770	0.23056	N	0.052435	T	0.00580	0.0019	N	0.00134	-2.025	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45977	-0.9224	10	0.02654	T	1	.	5.6712	0.17723	0.0:0.2607:0.0:0.7393	.	45	P05014	IFNA4_HUMAN	R	45	ENSP00000412897:G45R	ENSP00000412897:G45R	G	-	1	0	IFNA4	21177398	0.003000	0.15002	0.781000	0.31783	0.051000	0.14879	-0.482000	0.06544	-0.029000	0.13827	-0.674000	0.03794	GGA		0.527	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051889.1	NM_021068		24	89	0	0	0	0.003954	0	24	89				
NOL6	65083	broad.mit.edu	37	9	33469596	33469596	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr9:33469596A>C	ENST00000379471.2	-	5	715	c.628T>G	c.(628-630)Ttg>Gtg	p.L210V	NOL6_ENST00000464829.1_5'UTR|NOL6_ENST00000455041.2_Missense_Mutation_p.L150V			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	210					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L210V(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		TGGTGAGCCAAGTGGGCCAGG	0.617																																							uc003zsz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(628-630)TTG>GTG		nucleolar protein family 6 alpha isoform							116.0	127.0	123.0					9																	33469596		2203	4300	6503	SO:0001583	missense	65083				rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding	g.chr9:33469596A>C	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.628T>G	9.37:g.33469596A>C	ENSP00000368784:p.Leu210Val		Somatic				SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zta.2_Missense_Mutation_p.L210V|NOL6_uc010mjv.2_Missense_Mutation_p.L210V|NOL6_uc011lob.1_Missense_Mutation_p.L150V|NOL6_uc003ztb.1_Missense_Mutation_p.L210V	p.L210V	NM_022917	NP_075068	WXS	Illumina HiSeq	Unspecified	Q9H6R4	NOL6_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)	5	729	-			210					Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37	c.628T>G		.	.	.	.	.	.	.	.	.	.	A	11.07	1.529539	0.27387	.	.	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.59	1.77	0.24775	.	0.386402	0.27567	N	0.018793	T	0.21307	0.0513	N	0.11789	0.175	0.44055	D	0.996795	B;B;B;B;B	0.18863	0.016;0.013;0.013;0.031;0.007	B;B;B;B;B	0.21708	0.036;0.021;0.021;0.034;0.026	T	0.05954	-1.0854	10	0.23891	T	0.37	.	0.1471	0.00089	0.281:0.2619:0.1981:0.259	.	150;210;210;210;210	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	V	210;210;210;210;150	ENSP00000313978:L210V;ENSP00000297990:L210V;ENSP00000368784:L210V;ENSP00000395915:L150V	ENSP00000297990:L210V	L	-	1	2	NOL6	33459596	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.787000	0.26858	0.367000	0.24454	0.459000	0.35465	TTG		0.617	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917		4	129	0	0	0	0.000602	0	4	129				
PAPPA	5069	broad.mit.edu	37	9	118982243	118982243	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr9:118982243C>A	ENST00000328252.3	+	5	2315	c.1946C>A	c.(1945-1947)cCc>cAc	p.P649H	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	649					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P649H(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCCTTCACGCCCAATCAAGTC	0.587																																							uc004bjn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|pancreas(1)	9						c.(1945-1947)CCC>CAC		pregnancy-associated plasma protein A							107.0	102.0	104.0					9																	118982243		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:118982243C>A		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1946C>A	9.37:g.118982243C>A	ENSP00000330658:p.Pro649His		Somatic				PAPPA_uc011lxp.1_Missense_Mutation_p.P344H|PAPPA_uc011lxq.1_Intron	p.P649H	NM_002581	NP_002572	WXS	Illumina HiSeq	Unspecified	Q13219	PAPP1_HUMAN			5	2327	+			649					B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.1946C>A	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537256	0.85812	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02472	4.28	5.99	5.99	0.97316	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.050966	0.85682	D	0.000000	T	0.20820	0.0501	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.982	T	0.00141	-1.1998	10	0.87932	D	0	-23.595	20.4777	0.99188	0.0:1.0:0.0:0.0	.	93;649	E7EMD3;Q13219	.;PAPP1_HUMAN	H	649;93	ENSP00000330658:P649H	ENSP00000330658:P649H	P	+	2	0	PAPPA	118022064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.597000	0.67577	2.840000	0.97914	0.655000	0.94253	CCC		0.587	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		24	80	1	0	5.35356e-11	0.00278	8.09562e-11	24	80				
ENTPD2	954	broad.mit.edu	37	9	139944797	139944797	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr9:139944797C>T	ENST00000355097.2	-	6	1015	c.968G>A	c.(967-969)tGc>tAc	p.C323Y	RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank|ENTPD2_ENST00000312665.5_Missense_Mutation_p.C323Y	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	323					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.C323Y(1)		endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGAGAAGGGGCAGGAGGAGAA	0.607											OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004ckw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(967-969)TGC>TAC		ectonucleoside triphosphate diphosphohydrolase 2							63.0	72.0	69.0					9																	139944797		2203	4300	6503	SO:0001583	missense	954					integral to membrane	ATP binding	g.chr9:139944797C>T	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.968G>A	9.37:g.139944797C>T	ENSP00000347213:p.Cys323Tyr		Somatic	OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1652	ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Missense_Mutation_p.C323Y	p.C323Y	NM_203468	NP_982293	WXS	Illumina HiSeq	Unspecified	Q9Y5L3	ENTP2_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)	6	1024	-	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	323			Extracellular (Potential).		O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	37	c.968G>A	CCDS7026.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619325	0.66787	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.21543	2.0;2.0	5.04	4.07	0.47477	.	0.135516	0.64402	D	0.000001	T	0.57710	0.2072	H	0.96633	3.855	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.69789	-0.5050	10	0.87932	D	0	-33.991	10.7105	0.45980	0.1449:0.7145:0.1406:0.0	.	323;323	Q9Y5L3-2;Q9Y5L3	.;ENTP2_HUMAN	Y	323	ENSP00000347213:C323Y;ENSP00000312494:C323Y	ENSP00000312494:C323Y	C	-	2	0	ENTPD2	139064618	0.995000	0.38212	0.989000	0.46669	0.677000	0.39632	3.646000	0.54396	2.317000	0.78254	0.561000	0.74099	TGC		0.607	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055169.1	NM_203468		5	106	0	0	0	0.000602	0	5	106				
MXRA5	25878	broad.mit.edu	37	X	3238914	3238914	+	Silent	SNP	T	T	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:3238914T>C	ENST00000217939.6	-	5	4966	c.4812A>G	c.(4810-4812)caA>caG	p.Q1604Q		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1604						extracellular vesicular exosome (GO:0070062)		p.Q1604Q(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTCTGGTTAGTTGATGAGAAG	0.483																																							uc004crg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(4810-4812)CAA>CAG		adlican precursor							174.0	152.0	160.0					X																	3238914		2203	4300	6503	SO:0001819	synonymous_variant	25878					extracellular region		g.chrX:3238914T>C	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4812A>G	X.37:g.3238914T>C			Somatic					p.Q1604Q	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	4969	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1604					Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	c.4812A>G	CCDS14124.1																																																																																				0.483	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		19	99	0	0	0	0.007413	0	19	99				
STS	412	broad.mit.edu	37	X	7267979	7267979	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:7267979G>T	ENST00000217961.4	+	10	1649	c.1429G>T	c.(1429-1431)Ggt>Tgt	p.G477C		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	477					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)	p.G477C(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CAACCCCGTGGGTTCCAACGG	0.478									Ichthyosis																														uc004cry.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1429-1431)GGT>TGT		steryl-sulfatase precursor	Estrone(DB00655)						116.0	106.0	109.0					X																	7267979		2203	4299	6502	SO:0001583	missense	412	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity	g.chrX:7267979G>T	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1429G>T	X.37:g.7267979G>T	ENSP00000217961:p.Gly477Cys		Somatic					p.G477C	NM_000351	NP_000342	WXS	Illumina HiSeq	Unspecified	P08842	STS_HUMAN			10	1674	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	477			Lumenal.		B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	c.1429G>T	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753580	0.31046	.	.	ENSG00000101846	ENST00000217961	D	0.90955	-2.76	4.22	4.22	0.49857	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.294027	0.37053	N	0.002261	D	0.96691	0.8920	H	0.96518	3.835	0.19575	N	0.999969	D	0.89917	1.0	D	0.87578	0.998	D	0.91430	0.5165	10	0.66056	D	0.02	.	14.597	0.68415	0.0:0.0:1.0:0.0	.	477	P08842	STS_HUMAN	C	477	ENSP00000217961:G477C	ENSP00000217961:G477C	G	+	1	0	STS	7277979	0.486000	0.25980	0.119000	0.21687	0.011000	0.07611	3.064000	0.49986	1.716000	0.51395	0.594000	0.82650	GGT		0.478	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351		21	104	1	0	1.96292e-10	0.001523	2.87483e-10	21	104				
FRMPD4	9758	broad.mit.edu	37	X	12632918	12632918	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:12632918C>A	ENST00000380682.1	+	4	846	c.340C>A	c.(340-342)Ctg>Atg	p.L114M	7SK_ENST00000606842.1_RNA	NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	114	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.L104M(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TGAAGGCAAGCTGATCCCGGG	0.512																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(340-342)CTG>ATG		FERM and PDZ domain containing 4							115.0	109.0	111.0					X																	12632918		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12632918C>A	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.340C>A	X.37:g.12632918C>A	ENSP00000370057:p.Leu114Met		Somatic				FRMPD4_uc011mij.1_Missense_Mutation_p.L106M	p.L114M	NM_014728	NP_055543	WXS	Illumina HiSeq	Unspecified	Q14CM0	FRPD4_HUMAN			4	846	+			114			PDZ.		A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.340C>A	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607510	0.46527	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.50001	0.76	5.4	4.54	0.55810	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000007	T	0.71542	0.3352	M	0.91768	3.24	0.41696	D	0.989377	D;D	0.71674	0.998;0.995	D;D	0.70016	0.961;0.967	T	0.76266	-0.3022	10	0.87932	D	0	.	9.622	0.39727	0.0:0.837:0.0:0.163	.	106;114	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	M	114;105;103	ENSP00000370057:L114M	ENSP00000304583:L103M	L	+	1	2	FRMPD4	12542839	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	4.519000	0.60517	1.063000	0.40649	0.594000	0.82650	CTG		0.512	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		15	92	1	0	0.000308642	0.003163	0.000367996	15	92				
SCML2	10389	broad.mit.edu	37	X	18264732	18264732	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:18264732T>A	ENST00000251900.4	-	13	1946	c.1787A>T	c.(1786-1788)cAt>cTt	p.H596L	SCML2_ENST00000398048.3_Missense_Mutation_p.H332L	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	596					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H596L(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TTTAACTTCATGGGGACTGCT	0.413																																					Esophageal Squamous(100;1252 1965 19021 35517)	Esophageal Squamous(100;1252 1965 19021 35517)	uc004cyl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1786-1788)CAT>CTT		sex comb on midleg-like 2							122.0	104.0	110.0					X																	18264732		2203	4300	6503	SO:0001583	missense	10389				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:18264732T>A	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1787A>T	X.37:g.18264732T>A	ENSP00000251900:p.His596Leu		Somatic				SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.H596L|SCML2_uc011miz.1_Missense_Mutation_p.H530L|SCML2_uc010nfc.2_Missense_Mutation_p.H332L	p.H596L	NM_006089	NP_006080	WXS	Illumina HiSeq	Unspecified	Q9UQR0	SCML2_HUMAN			13	1944	-	Hepatocellular(33;0.183)		596					Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	c.1787A>T	CCDS14185.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.62|15.62	2.886753|2.886753	0.51908|0.51908	.|.	.|.	ENSG00000102098|ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000|ENST00000420857	T;T|.	0.42131|.	2.28;0.98|.	5.51|5.51	-5.39|-5.39	0.02664|0.02664	.|.	4.843870|.	0.00447|.	N|.	0.000082|.	T|T	0.16342|0.16342	0.0393|0.0393	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.09022|.	0.001;0.001;0.002;0.0|.	B;B;B;B|.	0.06405|.	0.001;0.002;0.001;0.001|.	T|T	0.24764|0.24764	-1.0151|-1.0151	10|5	0.27785|.	T|.	0.31|.	.|.	0.1686|0.1686	0.00111|0.00111	0.2332:0.2066:0.2365:0.3238|0.2332:0.2066:0.2365:0.3238	.|.	564;111;332;596|.	B4DZR9;Q5JXE7;B4DRC2;Q9UQR0|.	.;.;.;SCML2_HUMAN|.	L|L	596;332;564|112	ENSP00000251900:H596L;ENSP00000381126:H332L|.	ENSP00000251900:H596L|.	H|M	-|-	2|1	0|0	SCML2|SCML2	18174653|18174653	0.564000|0.564000	0.26602|0.26602	0.000000|0.000000	0.03702|0.03702	0.069000|0.069000	0.16628|0.16628	0.536000|0.536000	0.23129|0.23129	-1.242000|-1.242000	0.02523|0.02523	0.486000|0.486000	0.48141|0.48141	CAT|ATG		0.413	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089		19	93	0	0	0	0.007413	0	19	93				
CXorf22	170063	broad.mit.edu	37	X	35971801	35971801	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:35971801G>A	ENST00000297866.5	+	7	1205	c.1139G>A	c.(1138-1140)gGa>gAa	p.G380E		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	380								p.G380E(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGTAAAGATGGATTTTTGAGA	0.318																																							uc004ddj.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|ovary(1)	3						c.(1138-1140)GGA>GAA		hypothetical protein LOC170063							80.0	74.0	76.0					X																	35971801		2202	4298	6500	SO:0001583	missense	170063							g.chrX:35971801G>A	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1139G>A	X.37:g.35971801G>A	ENSP00000297866:p.Gly380Glu		Somatic				CXorf22_uc010ngv.2_RNA	p.G380E	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			7	1198	+			380					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.1139G>A	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260438	0.23051	.	.	ENSG00000165164	ENST00000297866	T	0.53857	0.6	5.69	4.78	0.61160	.	0.313351	0.35067	N	0.003461	T	0.62804	0.2458	M	0.73598	2.24	0.09310	N	1	D	0.69078	0.997	P	0.61940	0.896	T	0.55829	-0.8079	10	0.08837	T	0.75	-33.3985	10.011	0.41986	0.0884:0.1534:0.7583:0.0	.	380	Q6ZTR5	CX022_HUMAN	E	380	ENSP00000297866:G380E	ENSP00000297866:G380E	G	+	2	0	CXorf22	35881722	1.000000	0.71417	0.668000	0.29813	0.041000	0.13682	1.448000	0.35112	2.383000	0.81215	0.544000	0.68410	GGA		0.318	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		11	62	0	0	0	0.000978	0	11	62				
IRS4	8471	broad.mit.edu	37	X	107977758	107977758	+	Missense_Mutation	SNP	C	C	A	rs367909187		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:107977758C>A	ENST00000372129.2	-	1	1893	c.1817G>T	c.(1816-1818)cGt>cTt	p.R606L	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	606					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.R606L(1)|p.R606H(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGATTTTCCACGTTCACCATC	0.542																																							uc004eoc.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1816-1818)CGT>CTT		insulin receptor substrate 4		C	LEU/ARG	1,3834		0,1,1631,571	211.0	208.0	209.0		1817	0.8	0.5	X		209	0,6728		0,0,2428,1872	no	missense	IRS4	NM_003604.2	102	0,1,4059,2443	AA,AC,CC,C		0.0,0.0261,0.0095	benign	606/1258	107977758	1,10562	2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977758C>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1817G>T	X.37:g.107977758C>A	ENSP00000361202:p.Arg606Leu		Somatic					p.R606L	NM_003604	NP_003595	WXS	Illumina HiSeq	Unspecified	O14654	IRS4_HUMAN			1	1850	-			606						Missense_Mutation	SNP	ENST00000372129.2	37	c.1817G>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.991088	0.35131	2.61E-4	0.0	ENSG00000133124	ENST00000372129	T	0.32753	1.44	4.77	0.795	0.18643	.	0.905593	0.09488	N	0.795383	T	0.24624	0.0597	L	0.57536	1.79	0.18873	N	0.999984	B	0.31318	0.319	B	0.23716	0.048	T	0.19289	-1.0310	10	0.31617	T	0.26	-1.5361	5.441	0.16509	0.0:0.3596:0.3205:0.3199	.	606	O14654	IRS4_HUMAN	L	606	ENSP00000361202:R606L	ENSP00000361202:R606L	R	-	2	0	IRS4	107864414	0.054000	0.20591	0.536000	0.28039	0.842000	0.47809	0.233000	0.17911	0.109000	0.17891	0.513000	0.50165	CGT		0.542	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		35	154	1	0	1.04352e-10	0.003755	1.55275e-10	35	154				
STK26	51765	broad.mit.edu	37	X	131197485	131197485	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:131197485G>T	ENST00000354719.6	+	4	514	c.298G>T	c.(298-300)Gaa>Taa	p.E100*	MST4_ENST00000496850.1_Nonsense_Mutation_p.E100*|MST4_ENST00000394334.2_Nonsense_Mutation_p.E100*|MST4_ENST00000481105.1_Nonsense_Mutation_p.E122*|MST4_ENST00000394335.2_Nonsense_Mutation_p.E23*														p.E100*(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					GATAATAATGGAATACCTGGG	0.323																																							uc004ewk.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9						c.(298-300)GAA>TAA		serine/threonine protein kinase MST4 isoform 1							107.0	106.0	106.0					X																	131197485		2203	4300	6503	SO:0001587	stop_gained	51765				cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:131197485G>T																												ENST00000354719.6:c.298G>T	X.37:g.131197485G>T	ENSP00000346755:p.Glu100*		Somatic				MST4_uc004ewl.1_Nonsense_Mutation_p.E23*|MST4_uc011mux.1_Nonsense_Mutation_p.E122*|MST4_uc010nrj.1_Nonsense_Mutation_p.E100*|MST4_uc004ewm.1_Nonsense_Mutation_p.E100*	p.E100*	NM_016542	NP_057626	WXS	Illumina HiSeq	Unspecified	Q9P289	MST4_HUMAN			4	599	+	Acute lymphoblastic leukemia(192;0.000127)		100			Protein kinase.			Nonsense_Mutation	SNP	ENST00000354719.6	37	c.298G>T		.	.	.	.	.	.	.	.	.	.	G	38	7.178029	0.98114	.	.	ENSG00000134602	ENST00000394334;ENST00000481105;ENST00000354719;ENST00000394335;ENST00000496850	.	.	.	4.96	4.96	0.65561	.	0.091279	0.46442	D	0.000294	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.585	0.87979	0.0:0.0:1.0:0.0	.	.	.	.	X	100;122;100;23;100	.	ENSP00000346755:E100X	E	+	1	0	AL109749.1	131025166	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.809000	0.99208	2.169000	0.68431	0.544000	0.68410	GAA		0.323	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2			16	109	1	0	0.00074312	0.006122	0.000858512	16	109				
RENBP	5973	broad.mit.edu	37	X	153209788	153209788	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chrX:153209788A>C	ENST00000393700.3	-	2	190	c.110T>G	c.(109-111)aTg>aGg	p.M37R	RENBP_ENST00000412763.1_Missense_Mutation_p.M37R|RENBP_ENST00000369997.3_Missense_Mutation_p.M37R|RENBP_ENST00000462086.1_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	37					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)	p.M27R(1)|p.M37R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	GGAGTGCTCCATCCAGAAAGC	0.622																																							uc004fjo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(109-111)ATG>AGG		renin binding protein	N-Acetyl-D-glucosamine(DB00141)						116.0	108.0	110.0					X																	153209788		2203	4300	6503	SO:0001583	missense	5973				mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity	g.chrX:153209788A>C		CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.110T>G	X.37:g.153209788A>C	ENSP00000377303:p.Met37Arg		Somatic				RENBP_uc011mzh.1_Missense_Mutation_p.M37R|RENBP_uc011mzi.1_5'Flank	p.M37R	NM_002910	NP_002901	WXS	Illumina HiSeq	Unspecified	P51606	RENBP_HUMAN			2	280	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		37					B4DNZ3|Q96BI6	Missense_Mutation	SNP	ENST00000393700.3	37	c.110T>G	CCDS14738.2	.	.	.	.	.	.	.	.	.	.	A	15.80	2.941387	0.53079	.	.	ENSG00000102032	ENST00000393700;ENST00000412763;ENST00000369997	T;T;T	0.29655	1.59;1.56;1.59	4.29	0.515	0.17013	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.386624	0.27397	N	0.019558	T	0.21267	0.0512	L	0.53249	1.67	0.30890	N	0.730439	P;P	0.47106	0.89;0.716	B;B	0.38020	0.263;0.192	T	0.24225	-1.0166	10	0.72032	D	0.01	-3.4968	3.9275	0.09270	0.494:0.1859:0.3201:0.0	.	37;37	P51606-2;P51606	.;RENBP_HUMAN	R	37	ENSP00000377303:M37R;ENSP00000387811:M37R;ENSP00000359014:M37R	ENSP00000359014:M37R	M	-	2	0	RENBP	152862982	0.000000	0.05858	0.938000	0.37757	0.690000	0.40134	0.145000	0.16157	0.105000	0.17753	-0.700000	0.03674	ATG		0.622	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3	NM_002910		14	83	0	0	0	0.003163	0	14	83				
KLHL28	54813	broad.mit.edu	37	14	45414728	45414728	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr14:45414728delC	ENST00000396128.4	-	2	523	c.404delG	c.(403-405)ggtfs	p.G135fs	KLHL28_ENST00000355081.2_Frame_Shift_Del_p.G149fs	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	135										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AATACAATTACCAGGATCAAG	0.408																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(403-405)GGTfs		BTB (POZ) domain containing 5							60.0	60.0	60.0					14																	45414728		2203	4300	6503	SO:0001589	frameshift_variant	54813							g.chr14:45414728delC	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.404delG	14.37:g.45414728delC	ENSP00000379434:p.Gly135fs		Somatic				KLHL28_uc001wvr.2_Frame_Shift_Del_p.G135fs|KLHL28_uc001wvt.3_Frame_Shift_Del_p.G135fs	p.G135fs	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	650	-			135					Q0VAL5	Frame_Shift_Del	DEL	ENST00000396128.4	37	c.404delG	CCDS9680.1																																																																																				0.408	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			9	62	NA	NA	NA	NA	NA	9	62	---	---	---	---
HOXB8	3218	broad.mit.edu	37	17	46690610	46690611	+	Frame_Shift_Ins	INS	-	-	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr17:46690610_46690611insA	ENST00000239144.4	-	2	919_920	c.685_686insT	c.(685-687)ccafs	p.P229fs	HOXB7_ENST00000567101.2_Intron|HOXB8_ENST00000576562.1_Frame_Shift_Ins_p.P228fs|HOXB7_ENST00000239165.7_5'Flank	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	229					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						CGCCGCCTCTGGGGCCCGCTCC	0.644																																							uc002inw.2		NA																	0					0						c.(685-687)CCAfs		homeobox B8																																				SO:0001589	frameshift_variant	3218					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46690610_46690611insA		CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.685_686insT	17.37:g.46690610_46690611insA	ENSP00000239144:p.Pro229fs		Somatic				HOXB7_uc002inv.2_5'Flank	p.P229fs	NM_024016	NP_076921	WXS	Illumina HiSeq	Unspecified	P17481	HXB8_HUMAN			2	920_921	-			229					Q9H1I2	Frame_Shift_Ins	INS	ENST00000239144.4	37	c.685_686insT	CCDS11533.1																																																																																				0.644	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3			23	120	NA	NA	NA	NA	NA	23	120	---	---	---	---
ACTR2	10097	broad.mit.edu	37	2	65473856	65473859	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	AGAG	AGAG	-	-	AGAG	AGAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr2:65473856_65473859delAGAG	ENST00000260641.5	+	3	515_518	c.358_361delAGAG	c.(358-363)agagagfs	p.RE120fs	ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Frame_Shift_Del_p.RE125fs|ACTR2_ENST00000542850.1_Frame_Shift_Del_p.RE65fs	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	120					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						AACCAAAAACAGAGAGAAGATTGT	0.338																																							uc002sdq.2		NA																	0					0						c.(358-363)AGAGAGfs		actin-related protein 2 isoform b																																				SO:0001589	frameshift_variant	10097				cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding	g.chr2:65473856_65473859delAGAG	AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.358_361delAGAG	2.37:g.65473856_65473859delAGAG	ENSP00000260641:p.Arg120fs		Somatic				ACTR2_uc010yqf.1_Frame_Shift_Del_p.R65fs|ACTR2_uc002sdp.2_Frame_Shift_Del_p.R125fs|ACTR2_uc010yqg.1_Frame_Shift_Del_p.R68fs	p.R120fs	NM_005722	NP_005713	WXS	Illumina HiSeq	Unspecified	P61160	ARP2_HUMAN			3	573_576	+			120_121					B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Frame_Shift_Del	DEL	ENST00000260641.5	37	c.358_361delAGAG	CCDS1881.1																																																																																				0.338	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1	NM_001005386		9	130	NA	NA	NA	NA	NA	9	130	---	---	---	---
SIK1	150094	broad.mit.edu	37	21	44841183	44841184	+	Frame_Shift_Ins	INS	-	-	G	rs373343445		TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr21:44841183_44841184insG	ENST00000270162.6	-	6	695_696	c.563_564insC	c.(562-564)ccgfs	p.P188fs		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	188	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GGGCGGCATACGGGGGGCTCCC	0.589																																							uc002zdf.2		NA																	0				lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						c.(562-564)CCGfs		salt-inducible kinase 1																																				SO:0001589	frameshift_variant	150094				anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr21:44841183_44841184insG	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.564dupC	21.37:g.44841189_44841189dupG	ENSP00000270162:p.Pro188fs		Somatic					p.P188fs	NM_173354	NP_775490	WXS	Illumina HiSeq	Unspecified	P57059	SIK1_HUMAN			6	690_691	-			188			Protein kinase.		A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Frame_Shift_Ins	INS	ENST00000270162.6	37	c.563_564insC	CCDS33575.1																																																																																				0.589	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354		16	92	NA	NA	NA	NA	NA	16	92	---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20198725	20198726	+	Frame_Shift_Ins	INS	-	-	A			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:20198725_20198726insA	ENST00000400331.5	-	5	1566_1567	c.1258_1259insT	c.(1258-1260)tggfs	p.W420fs	MACC1_ENST00000589011.1_Frame_Shift_Ins_p.W420fs|MACC1_ENST00000332878.4_Frame_Shift_Ins_p.W420fs	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	420					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						CTGCTTCCCCCAGAGCTGAAAC	0.356																																							uc003sus.3		NA																	0				ovary(2)|skin(1)	3						c.(1258-1260)TGGfs		putative binding protein 7a5																																				SO:0001589	frameshift_variant	346389				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity	g.chr7:20198725_20198726insA		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1259dupT	7.37:g.20198726_20198726dupA	ENSP00000383185:p.Trp420fs		Somatic				MACC1_uc010kug.2_Frame_Shift_Ins_p.W420fs	p.W420fs	NM_182762	NP_877439	WXS	Illumina HiSeq	Unspecified	Q6ZN28	MACC1_HUMAN			5	1567_1568	-			420					A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Frame_Shift_Ins	INS	ENST00000400331.5	37	c.1258_1259insT	CCDS5369.1																																																																																				0.356	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762		8	52	NA	NA	NA	NA	NA	8	52	---	---	---	---
PIK3CG	5294	broad.mit.edu	37	7	106509606	106509606	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4506-01A-01D-1265-08	TCGA-49-4506-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d707f8ad-5ea5-493a-a745-9b5dba64f213	b8fa1b54-140b-4a50-bc72-604fe25b0f32	g.chr7:106509606delC	ENST00000359195.3	+	2	1910	c.1600delC	c.(1600-1602)cccfs	p.P534fs	PIK3CG_ENST00000440650.2_Frame_Shift_Del_p.P534fs|PIK3CG_ENST00000496166.1_Frame_Shift_Del_p.P534fs	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	534					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TAAGCATCAGCCCACCCCTGA	0.537																																							uc003vdv.3		NA																	0				lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						c.(1600-1602)CCCfs		phosphoinositide-3-kinase, catalytic, gamma							111.0	106.0	108.0					7																	106509606		2203	4300	6503	SO:0001589	frameshift_variant	5294				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	g.chr7:106509606delC		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1600delC	7.37:g.106509606delC	ENSP00000352121:p.Pro534fs		Somatic				PIK3CG_uc003vdu.2_Frame_Shift_Del_p.P534fs|PIK3CG_uc003vdw.2_Frame_Shift_Del_p.P534fs	p.P534fs	NM_002649	NP_002640	WXS	Illumina HiSeq	Unspecified	P48736	PK3CG_HUMAN			2	1685	+			534					A4D0Q6|Q8IV23|Q9BZC8	Frame_Shift_Del	DEL	ENST00000359195.3	37	c.1600delC	CCDS5739.1																																																																																				0.537	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			19	68	NA	NA	NA	NA	NA	19	68	---	---	---	---
