#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF19	645414	broad.mit.edu	37	1	13695841	13695841	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:13695841C>T	ENST00000376101.2	-	3	916	c.917G>A	c.(916-918)cGc>cAc	p.R306H	PRAMEF19_ENST00000540591.1_Missense_Mutation_p.R375H			Q5SWL8	PRA19_HUMAN	PRAME family member 19	306					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R306H(1)		lung(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTTGGAGCAGCGGCTCAGGGC	0.557																																							uc009vny.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1123-1125)CGC>CAC		PRAME family member 18							98.0	119.0	112.0					1																	13695841		2198	4297	6495	SO:0001583	missense	391003							g.chr1:13695841C>T			1p36.21	2013-01-17			ENSG00000204480	ENSG00000204480		"""-"""	24908	protein-coding gene	gene with protein product							Standard	NM_001099790		Approved	OTTHUMG00000007919	uc009vnu.1	Q5SWL8	OTTHUMG00000007919	ENST00000376101.2:c.917G>A	1.37:g.13695841C>T	ENSP00000365269:p.Arg306His		Somatic					p.R375H	NM_001099850	NP_001093320	WXS	Illumina HiSeq	Unspecified	Q5VWM3	PRA18_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	1171	-	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	375						Missense_Mutation	SNP	ENST00000376101.2	37	c.1124G>A		.	.	.	.	.	.	.	.	.	.	C	5.356	0.251005	0.10130	.	.	ENSG00000204480	ENST00000376101;ENST00000540591	T;T	0.09538	2.97;2.97	1.18	-0.416	0.12351	.	1.164400	0.06173	N	0.678136	T	0.06416	0.0165	N	0.21448	0.665	0.19300	N	0.99998	B	0.14805	0.011	B	0.10450	0.005	T	0.43845	-0.9366	10	0.15952	T	0.53	.	3.639	0.08160	0.0:0.614:0.0:0.386	.	375	F5H544	.	H	306;375	ENSP00000365269:R306H;ENSP00000446004:R375H	ENSP00000365269:R306H	R	-	2	0	PRAMEF19	13568428	0.729000	0.28090	0.401000	0.26359	0.310000	0.27922	-0.733000	0.04898	-0.106000	0.12110	0.162000	0.16502	CGC		0.557	PRAMEF19-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000021794.2	NM_001099790		36	135	0	0	0	0.013114	0	36	135				
KLHDC7A	127707	broad.mit.edu	37	1	18809312	18809312	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:18809312G>C	ENST00000400664.1	+	1	1889	c.1837G>C	c.(1837-1839)Gac>Cac	p.D613H		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	613						integral component of membrane (GO:0016021)		p.D613H(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGACCGCTGGGACTTTGCCCC	0.692																																							uc001bax.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1837-1839)GAC>CAC		kelch domain containing 7A							22.0	24.0	23.0					1																	18809312		2203	4294	6497	SO:0001583	missense	127707					integral to membrane		g.chr1:18809312G>C	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1837G>C	1.37:g.18809312G>C	ENSP00000383505:p.Asp613His		Somatic				KLHDC7A_uc009vpg.2_Missense_Mutation_p.D395H	p.D613H	NM_152375	NP_689588	WXS	Illumina HiSeq	Unspecified	Q5VTJ3	KLD7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	1	1889	+		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)	613			Kelch 4.		Q8N8W6	Missense_Mutation	SNP	ENST00000400664.1	37	c.1837G>C	CCDS185.2	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907550	0.52333	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.77098	-1.07	5.2	-0.2	0.13216	Kelch-type beta propeller (1);	1.171700	0.06167	N	0.676940	T	0.77082	0.4078	N	0.25144	0.715	0.24597	N	0.993792	D;D	0.55800	0.973;0.973	P;P	0.59115	0.852;0.852	T	0.66662	-0.5867	10	0.62326	D	0.03	.	9.3699	0.38248	0.4916:0.0:0.5084:0.0	.	550;613	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	H	613;550	ENSP00000383505:D613H	ENSP00000383505:D613H	D	+	1	0	KLHDC7A	18681899	0.071000	0.21146	0.215000	0.23724	0.798000	0.45092	0.397000	0.20883	-0.056000	0.13221	0.561000	0.74099	GAC		0.692	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375		7	17	0	0	0	0.004482	0	7	17				
LUZP1	7798	broad.mit.edu	37	1	23417973	23417973	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:23417973G>A	ENST00000302291.4	-	4	3583	c.2782C>T	c.(2782-2784)Cga>Tga	p.R928*	LUZP1_ENST00000418342.1_Nonsense_Mutation_p.R928*|LUZP1_ENST00000374623.3_Nonsense_Mutation_p.R928*|LUZP1_ENST00000314174.5_Nonsense_Mutation_p.R928*			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	928					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)		p.R928*(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TTCAAGTCTCGCCTACTCTTC	0.493																																							uc001bgk.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(2782-2784)CGA>TGA		leucine zipper protein 1							107.0	107.0	107.0					1																	23417973		2203	4300	6503	SO:0001587	stop_gained	7798					nucleus		g.chr1:23417973G>A	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2782C>T	1.37:g.23417973G>A	ENSP00000303758:p.Arg928*		Somatic				LUZP1_uc010odv.1_Nonsense_Mutation_p.R928*|LUZP1_uc001bgl.2_Nonsense_Mutation_p.R928*|LUZP1_uc001bgm.1_Nonsense_Mutation_p.R928*	p.R928*	NM_033631	NP_361013	WXS	Illumina HiSeq	Unspecified	Q86V48	LUZP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)	4	3166	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)	928					Q5TH93|Q8N4X3|Q8TEH1	Nonsense_Mutation	SNP	ENST00000302291.4	37	c.2782C>T	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	G	40	7.936392	0.98571	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	.	.	.	5.08	2.08	0.27032	.	0.178937	0.27039	N	0.021226	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.851	0.13537	0.1795:0.0:0.6428:0.1777	.	.	.	.	X	928	.	ENSP00000303758:R928X	R	-	1	2	LUZP1	23290560	0.996000	0.38824	0.993000	0.49108	0.863000	0.49368	2.164000	0.42387	0.512000	0.28257	0.485000	0.47835	CGA		0.493	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631		37	172	0	0	0	0.00623	0	37	172				
SLC30A2	7780	broad.mit.edu	37	1	26369043	26369043	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:26369043G>C	ENST00000374278.3	-	4	798	c.582C>G	c.(580-582)ttC>ttG	p.F194L	SLC30A2_ENST00000498060.1_5'Flank|SLC30A2_ENST00000374276.3_Missense_Mutation_p.F243L	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	194					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)	p.F243L(1)		cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTGACCTTGAAGTATAAAA	0.542																																							uc001blh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(580-582)TTC>TTG		solute carrier family 30, member 2 isoform 2							85.0	88.0	87.0					1																	26369043		2203	4300	6503	SO:0001583	missense	7780				positive regulation of sequestering of zinc ion|zinc ion transport	integral to membrane|late endosome|lysosomal membrane	cation transmembrane transporter activity	g.chr1:26369043G>C	AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.582C>G	1.37:g.26369043G>C	ENSP00000363396:p.Phe194Leu		Somatic				SLC30A2_uc001blg.1_Missense_Mutation_p.F243L	p.F194L	NM_032513	NP_115902	WXS	Illumina HiSeq	Unspecified	Q9BRI3	ZNT2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)	4	799	-		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	194			Vacuolar (Potential).		Q71RC8	Missense_Mutation	SNP	ENST00000374278.3	37	c.582C>G	CCDS272.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484465	0.63962	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.63417	-0.04;-0.04	5.78	4.86	0.63082	.	0.155671	0.45867	D	0.000337	T	0.66752	0.2821	M	0.71036	2.16	0.80722	D	1	B;B	0.24963	0.011;0.115	B;B	0.39419	0.033;0.299	T	0.68025	-0.5518	10	0.59425	D	0.04	-21.069	10.4524	0.44531	0.1517:0.0:0.8483:0.0	.	194;243	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	L	194;243	ENSP00000363396:F194L;ENSP00000363394:F243L	ENSP00000363394:F243L	F	-	3	2	SLC30A2	26241630	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	1.119000	0.31258	2.730000	0.93505	0.549000	0.68633	TTC		0.542	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019742.1	NM_032513		23	86	0	0	0	0.003954	0	23	86				
FAM76A	199870	broad.mit.edu	37	1	28081716	28081716	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:28081716G>T	ENST00000373954.6	+	7	712	c.610G>T	c.(610-612)Gac>Tac	p.D204Y	FAM76A_ENST00000530324.1_Missense_Mutation_p.D204Y|FAM76A_ENST00000419687.2_Missense_Mutation_p.D124Y|FAM76A_ENST00000010299.6_Missense_Mutation_p.D238Y|FAM76A_ENST00000234549.7_Missense_Mutation_p.D209Y|FAM76A_ENST00000373949.1_Missense_Mutation_p.D175Y	NM_001143912.1|NM_152660.2	NP_001137384.1|NP_689873.1	Q8TAV0	FA76A_HUMAN	family with sequence similarity 76, member A	204								p.D204Y(1)		endometrium(4)|kidney(2)|large_intestine(1)|lung(2)	9		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		CTTCTCCCCAGACCTGGCTCT	0.438																																							uc001boq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(610-612)GAC>TAC		hypothetical protein LOC199870 isoform 3							99.0	98.0	98.0					1																	28081716		2203	4300	6503	SO:0001583	missense	199870							g.chr1:28081716G>T	AK098318	CCDS309.1, CCDS44092.1, CCDS44093.1, CCDS44094.1, CCDS44095.1	1p35.3	2008-02-05			ENSG00000009780	ENSG00000009780			28530	protein-coding gene	gene with protein product							Standard	NM_001143912		Approved	MGC34648	uc001bor.3	Q8TAV0	OTTHUMG00000003729	ENST00000373954.6:c.610G>T	1.37:g.28081716G>T	ENSP00000363065:p.Asp204Tyr		Somatic				FAM76A_uc009vtb.2_Missense_Mutation_p.D204Y|FAM76A_uc001bor.2_Missense_Mutation_p.D238Y|FAM76A_uc001bos.2_Missense_Mutation_p.D209Y|FAM76A_uc001bot.2_Missense_Mutation_p.D175Y|FAM76A_uc010ofm.1_Missense_Mutation_p.D124Y	p.D204Y	NM_152660	NP_689873	WXS	Illumina HiSeq	Unspecified	Q8TAV0	FA76A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)	7	712	+		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)	204					B4DWT3|O95565|O95566|Q8N7J5	Missense_Mutation	SNP	ENST00000373954.6	37	c.610G>T	CCDS309.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608079	0.66558	.	.	ENSG00000009780	ENST00000373954;ENST00000419687;ENST00000530324;ENST00000234549;ENST00000373949;ENST00000010299;ENST00000446647	T;T	0.32023	1.47;1.48	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000002	T	0.35885	0.0947	N	0.04508	-0.205	0.37006	D	0.895506	D;D;D;D;D;D	0.89917	0.994;0.964;0.984;1.0;0.98;0.964	P;P;P;D;P;P	0.91635	0.808;0.891;0.904;0.999;0.782;0.782	T	0.53968	-0.8363	10	0.62326	D	0.03	-3.1718	17.5641	0.87914	0.0:0.0:1.0:0.0	.	124;204;175;209;238;204	B4DWT3;E9PQL1;Q8TAV0-2;Q8TAV0-4;Q8TAV0-3;Q8TAV0	.;.;.;.;.;FA76A_HUMAN	Y	204;124;204;209;175;238;17	ENSP00000234549:D209Y;ENSP00000010299:D238Y	ENSP00000010299:D238Y	D	+	1	0	FAM76A	27954303	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.915000	0.69973	2.814000	0.96858	0.655000	0.94253	GAC		0.438	FAM76A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000010514.3	NM_152660		26	158	1	0	4.87955e-14	0.005443	6.2123e-14	26	158				
YTHDF2	51441	broad.mit.edu	37	1	29069062	29069062	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:29069062A>T	ENST00000373812.3	+	4	642	c.280A>T	c.(280-282)Aac>Tac	p.N94Y	YTHDF2_ENST00000541996.1_Missense_Mutation_p.N44Y|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000542507.1_Missense_Mutation_p.N94Y	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	94	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.N94Y(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGCTGAGCAACGGAGAGCC	0.512																																							uc001brc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(280-282)AAC>TAC		high glucose-regulated protein 8							181.0	172.0	175.0					1																	29069062		1965	4162	6127	SO:0001583	missense	51441				humoral immune response			g.chr1:29069062A>T	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.280A>T	1.37:g.29069062A>T	ENSP00000362918:p.Asn94Tyr		Somatic				YTHDF2_uc001brd.2_Missense_Mutation_p.N91Y|YTHDF2_uc010ofx.1_Missense_Mutation_p.N44Y|YTHDF2_uc001bre.2_Missense_Mutation_p.N44Y	p.N94Y	NM_016258	NP_057342	WXS	Illumina HiSeq	Unspecified	Q9Y5A9	YTHD2_HUMAN		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)	4	777	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	94					A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	ENST00000373812.3	37	c.280A>T	CCDS41296.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.394351	0.62066	.	.	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.55588	0.51;0.51;0.51	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.63428	1.95	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.64687	0.928;0.928	T	0.68519	-0.5387	10	0.48119	T	0.1	-18.6424	14.3703	0.66836	1.0:0.0:0.0:0.0	.	94;94	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	Y	94;94;44;94	ENSP00000444660:N94Y;ENSP00000362918:N94Y;ENSP00000439394:N44Y	ENSP00000362918:N94Y	N	+	1	0	YTHDF2	28941649	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.194000	0.94962	2.097000	0.63578	0.477000	0.44152	AAC		0.512	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258		29	173	0	0	0	0.013726	0	29	173				
SLC6A9	6536	broad.mit.edu	37	1	44463634	44463634	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:44463634C>G	ENST00000360584.2	-	13	2010	c.1819G>C	c.(1819-1821)Ggc>Cgc	p.G607R	SLC6A9_ENST00000475075.2_Missense_Mutation_p.G423R|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000357730.2_Missense_Mutation_p.G553R|SLC6A9_ENST00000372310.3_Missense_Mutation_p.G534R|SLC6A9_ENST00000372306.3_Intron	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	607					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G534R(1)|p.G607R(1)		endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	ACGGCCCAGCCTGGGTACTGG	0.607																																							uc001cll.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1819-1821)GGC>CGC		solute carrier family 6 member 9 isoform 2	Glycine(DB00145)						123.0	123.0	123.0					1																	44463634		2203	4300	6503	SO:0001583	missense	6536					integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr1:44463634C>G	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1819G>C	1.37:g.44463634C>G	ENSP00000353791:p.Gly607Arg		Somatic				SLC6A9_uc009vxe.2_Intron|SLC6A9_uc010okm.1_Intron|SLC6A9_uc001clm.2_Missense_Mutation_p.G553R|SLC6A9_uc009vxd.2_RNA|SLC6A9_uc010okn.1_Missense_Mutation_p.G538R|SLC6A9_uc001cln.2_Missense_Mutation_p.G534R|SLC6A9_uc010oko.1_Missense_Mutation_p.G423R	p.G607R	NM_201649	NP_964012	WXS	Illumina HiSeq	Unspecified	P48067	SC6A9_HUMAN			13	2011	-	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	607					A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	ENST00000360584.2	37	c.1819G>C	CCDS41317.1	.	.	.	.	.	.	.	.	.	.	C	9.611	1.131329	0.21041	.	.	ENSG00000196517	ENST00000372310;ENST00000475075;ENST00000360584;ENST00000357730	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.7	3.84	0.44239	.	0.255413	0.45606	D	0.000355	T	0.66587	0.2804	L	0.42686	1.345	0.80722	D	1	B;B;B;P	0.48162	0.188;0.001;0.001;0.906	B;B;B;P	0.47346	0.238;0.009;0.009;0.544	T	0.60727	-0.7206	10	0.11485	T	0.65	.	8.7328	0.34510	0.0:0.7158:0.0:0.2842	.	538;534;553;607	B7Z3W8;P48067-2;P48067-3;P48067	.;.;.;SC6A9_HUMAN	R	534;423;607;553	ENSP00000361384:G534R;ENSP00000434460:G423R;ENSP00000353791:G607R;ENSP00000350362:G553R	ENSP00000350362:G553R	G	-	1	0	SLC6A9	44236221	0.166000	0.22962	0.998000	0.56505	0.992000	0.81027	0.438000	0.21559	0.782000	0.33613	0.609000	0.83330	GGC		0.607	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649		7	42	0	0	0	0.013537	0	7	42				
AK5	26289	broad.mit.edu	37	1	77752671	77752671	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:77752671G>T	ENST00000354567.2	+	2	369	c.106G>T	c.(106-108)Gaa>Taa	p.E36*	AK5_ENST00000344720.5_Nonsense_Mutation_p.E10*|AK5_ENST00000317704.4_3'UTR	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	36					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)	p.E36*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						AGATCCAGTAGAATACTTGGA	0.363																																							uc001dhn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(106-108)GAA>TAA		adenylate kinase 5 isoform 1							82.0	85.0	84.0					1																	77752671		2203	4300	6503	SO:0001587	stop_gained	26289				ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity	g.chr1:77752671G>T	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.106G>T	1.37:g.77752671G>T	ENSP00000346577:p.Glu36*		Somatic				AK5_uc001dho.2_Nonsense_Mutation_p.E10*|AK5_uc001dhm.1_Nonsense_Mutation_p.E36*	p.E36*	NM_174858	NP_777283	WXS	Illumina HiSeq	Unspecified	Q9Y6K8	KAD5_HUMAN			2	363	+			36					Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Nonsense_Mutation	SNP	ENST00000354567.2	37	c.106G>T	CCDS675.1	.	.	.	.	.	.	.	.	.	.	G	46	12.274064	0.99652	.	.	ENSG00000154027	ENST00000354567;ENST00000344720;ENST00000478407	.	.	.	5.59	5.59	0.84812	.	0.057448	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-25.3137	19.9742	0.97299	0.0:0.0:1.0:0.0	.	.	.	.	X	36;10;10	.	ENSP00000341430:E10X	E	+	1	0	AK5	77525259	1.000000	0.71417	0.957000	0.39632	0.631000	0.37964	9.406000	0.97321	2.809000	0.96659	0.650000	0.86243	GAA		0.363	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858		28	54	1	0	1.08312e-15	0.009535	1.41001e-15	28	54				
VCAM1	7412	broad.mit.edu	37	1	101188709	101188709	+	Silent	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:101188709C>G	ENST00000294728.2	+	3	575	c.474C>G	c.(472-474)ctC>ctG	p.L158L	VCAM1_ENST00000347652.2_Silent_p.L158L|VCAM1_ENST00000370119.4_Silent_p.L96L|VCAM1_ENST00000370115.1_Silent_p.L158L	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	158	Ig-like C2-type 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.L158L(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	GAGATCATCTCATGAAGAGTC	0.463																																							uc001dti.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(472-474)CTC>CTG		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						91.0	86.0	88.0					1																	101188709		2203	4300	6503	SO:0001819	synonymous_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101188709C>G	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.474C>G	1.37:g.101188709C>G			Somatic				VCAM1_uc001dtj.2_Silent_p.L158L|VCAM1_uc010ouj.1_Silent_p.L96L	p.L158L	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	3	594	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	158			Ig-like C2-type 2.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	ENST00000294728.2	37	c.474C>G	CCDS773.1																																																																																				0.463	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		6	39	0	0	0	0.001168	0	6	39				
OR10T2	128360	broad.mit.edu	37	1	158368421	158368421	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:158368421G>T	ENST00000334438.1	-	1	835	c.836C>A	c.(835-837)aCa>aAa	p.T279K		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T279K(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					AGTAACCACTGTGTAGGTCAC	0.473																																							uc010pih.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(835-837)ACA>AAA		olfactory receptor, family 10, subfamily T,							85.0	72.0	76.0					1																	158368421		2203	4300	6503	SO:0001583	missense	128360				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158368421G>T	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.836C>A	1.37:g.158368421G>T	ENSP00000334115:p.Thr279Lys		Somatic					p.T279K	NM_001004475	NP_001004475	WXS	Illumina HiSeq	Unspecified	Q8NGX3	O10T2_HUMAN			1	836	-	all_hematologic(112;0.0378)		279			Helical; Name=7; (Potential).		Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	c.836C>A	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037234	0.54896	.	.	ENSG00000186306	ENST00000334438	T	0.00265	8.39	4.57	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000589	T	0.00356	0.0011	H	0.95816	3.725	0.19300	N	0.99997	D	0.89917	1.0	D	0.97110	1.0	T	0.29027	-1.0025	10	0.87932	D	0	.	8.455	0.32893	0.1826:0.0:0.8174:0.0	.	279	Q8NGX3	O10T2_HUMAN	K	279	ENSP00000334115:T279K	ENSP00000334115:T279K	T	-	2	0	OR10T2	156635045	0.054000	0.20591	0.694000	0.30210	0.979000	0.70002	2.350000	0.44063	1.137000	0.42214	0.655000	0.94253	ACA		0.473	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475		5	35	1	0	0.000602214	0.000602	0.000632873	5	35				
OR10K2	391107	broad.mit.edu	37	1	158389737	158389737	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:158389737C>A	ENST00000314902.2	-	1	919	c.920G>T	c.(919-921)aGa>aTa	p.R307I		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R307I(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GGAAATTGTTCTTCTCACAAT	0.373																																							uc010pii.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(919-921)AGA>ATA		olfactory receptor, family 10, subfamily K,							47.0	52.0	50.0					1																	158389737		2203	4300	6503	SO:0001583	missense	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158389737C>A	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.920G>T	1.37:g.158389737C>A	ENSP00000324251:p.Arg307Ile		Somatic					p.R307I	NM_001004476	NP_001004476	WXS	Illumina HiSeq	Unspecified	Q6IF99	O10K2_HUMAN			1	920	-	all_hematologic(112;0.0378)		307			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000314902.2	37	c.920G>T	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	c	8.441	0.850804	0.17034	.	.	ENSG00000180708	ENST00000314902	T	0.39229	1.09	4.07	3.12	0.35913	.	0.691140	0.12085	U	0.500962	T	0.20007	0.0481	L	0.43554	1.36	0.41878	D	0.990301	P	0.38642	0.641	B	0.38562	0.276	T	0.09840	-1.0656	10	0.87932	D	0	.	6.0983	0.20033	0.0:0.7538:0.0:0.2462	.	307	Q6IF99	O10K2_HUMAN	I	307	ENSP00000324251:R307I	ENSP00000324251:R307I	R	-	2	0	OR10K2	156656361	0.020000	0.18652	0.412000	0.26496	0.289000	0.27227	-0.164000	0.09983	0.989000	0.38761	0.580000	0.79431	AGA		0.373	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		25	55	1	0	2.27525e-19	0.003954	3.0025e-19	25	55				
SPTA1	6708	broad.mit.edu	37	1	158585067	158585067	+	Missense_Mutation	SNP	C	C	A	rs181147022		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:158585067C>A	ENST00000368147.4	-	48	6907	c.6727G>T	c.(6727-6729)Gac>Tac	p.D2243Y		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2243					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.D2243Y(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TAGAGCTGGTCCCACTGCTGA	0.542																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(6727-6729)GAC>TAC		spectrin, alpha, erythrocytic 1							162.0	170.0	168.0					1																	158585067		2124	4244	6368	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158585067C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6727G>T	1.37:g.158585067C>A	ENSP00000357129:p.Asp2243Tyr		Somatic					p.D2243Y	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			48	6926	-	all_hematologic(112;0.0378)		2243			Spectrin 21.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.6727G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723914	0.89298	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.50277	0.75;0.75	5.54	5.54	0.83059	.	0.000000	0.33772	N	0.004580	T	0.69269	0.3092	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72880	-0.4158	10	0.87932	D	0	.	18.234	0.89944	0.0:1.0:0.0:0.0	.	2243	P02549	SPTA1_HUMAN	Y	2243;2240	ENSP00000357130:D2243Y;ENSP00000357129:D2240Y	ENSP00000357129:D2240Y	D	-	1	0	SPTA1	156851691	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.104000	0.77024	2.884000	0.98904	0.655000	0.94253	GAC		0.542	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		112	208	1	0	3.04319e-57	0.01441	4.37554e-57	112	208				
SPTA1	6708	broad.mit.edu	37	1	158654955	158654955	+	Silent	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:158654955G>T	ENST00000368147.4	-	2	387	c.207C>A	c.(205-207)atC>atA	p.I69I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	69					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I69I(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTTCTCCATGATCCACTtcc	0.448																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(205-207)ATC>ATA		spectrin, alpha, erythrocytic 1							117.0	112.0	114.0					1																	158654955		1925	4142	6067	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158654955G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.207C>A	1.37:g.158654955G>T			Somatic					p.I69I	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			2	406	-	all_hematologic(112;0.0378)		69			Spectrin 2.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.207C>A	CCDS41423.1																																																																																				0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		13	91	1	0	5.50884e-06	0.013537	5.98516e-06	13	91				
FCGR3A	2214	broad.mit.edu	37	1	161518298	161518298	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:161518298C>A	ENST00000436743.1	-	4	386	c.232G>T	c.(232-234)Gct>Tct	p.A78S	RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000476031.1_5'UTR|FCGR3A_ENST00000443193.1_Missense_Mutation_p.A113S|FCGR3A_ENST00000540048.1_Missense_Mutation_p.A78S|FCGR3A_ENST00000367969.3_Missense_Mutation_p.A114S	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	78	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A114S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACTGTGGCAGCGTCAATGAAG	0.542																																							uc001gat.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(232-234)GCT>TCT		Fc fragment of IgG, low affinity IIIa, receptor	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						296.0	276.0	283.0					1																	161518298		2203	4300	6503	SO:0001583	missense	2214				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity	g.chr1:161518298C>A	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.232G>T	1.37:g.161518298C>A	ENSP00000416607:p.Ala78Ser		Somatic				FCGR3A_uc001gar.2_Missense_Mutation_p.A114S|FCGR3A_uc001gas.2_Missense_Mutation_p.A113S|FCGR3A_uc009wuh.2_Missense_Mutation_p.A77S|FCGR3A_uc009wui.2_Missense_Mutation_p.A78S	p.A78S	NM_001127595	NP_001121067	WXS	Illumina HiSeq	Unspecified	P08637	FCG3A_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		4	369	-	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		78			Ig-like C2-type 1.|Extracellular (Potential).		A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000436743.1	37	c.232G>T	CCDS44266.1	.	.	.	.	.	.	.	.	.	.	C	3.619	-0.077984	0.07184	.	.	ENSG00000203747	ENST00000367969;ENST00000443193;ENST00000436743;ENST00000367967;ENST00000540048;ENST00000442336	T;T;T;T;T;T	0.06608	3.28;3.28;3.28;3.28;3.28;3.28	4.43	-6.94	0.01633	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.422050	0.01662	N	0.025162	T	0.00695	0.0023	N	0.04820	-0.15	0.09310	N	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.15870	0.003;0.002;0.014	T	0.43376	-0.9395	10	0.16896	T	0.51	.	4.6318	0.12506	0.4878:0.197:0.0:0.3153	.	78;113;78	P08637;E9PG94;Q9UPY7	FCG3A_HUMAN;.;.	S	114;113;78;78;78;77	ENSP00000356946:A114S;ENSP00000392047:A113S;ENSP00000416607:A78S;ENSP00000356944:A78S;ENSP00000444971:A78S;ENSP00000396567:A77S	ENSP00000356944:A78S	A	-	1	0	FCGR3A	159784922	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.455000	0.02379	-1.685000	0.01441	-0.230000	0.12252	GCT		0.542	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102169.2	NM_000569		7	351	1	0	9.31168e-06	0.001855	1.00789e-05	7	351				
FCGR3A	2214	broad.mit.edu	37	1	161599655	161599655	+	Intron	SNP	C	C	A	rs201152581	byFrequency	TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:161599655C>A	ENST00000540048.1	-	2	94				FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.A78S|FCGR3B_ENST00000367964.2_Missense_Mutation_p.A78S|FCGR3B_ENST00000531221.1_Missense_Mutation_p.A114S|FCGR2B_ENST00000367960.5_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A78S(1)|p.A78T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACTGTGGCAGCGTCAATGAAG	0.532																																							uc009wul.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(232-234)GCT>TCT		low affinity immunoglobulin gamma Fc region	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						88.0	98.0	95.0					1																	161599655		2163	4299	6462	SO:0001627	intron_variant	2215				immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity	g.chr1:161599655C>A	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+502G>T	1.37:g.161599655C>A			Somatic					p.A78S	NM_000570	NP_000561	WXS	Illumina HiSeq	Unspecified	O75015	FCG3B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		3	506	-	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		78			Ig-like C2-type 1.		A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37	c.232G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.984|1.984	-0.433458|-0.433458	0.04669|0.04669	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221;ENST00000534776|ENST00000421702	T;T;T;T|.	0.06608|.	3.28;3.28;3.28;3.28|.	2.79|2.79	-2.22|-2.22	0.06952|0.06952	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	2.831670|.	0.01069|.	N|.	0.004789|.	T|T	0.03608|0.03608	0.0103|0.0103	N|N	0.05050|0.05050	-0.12|-0.12	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.38178|0.38178	-0.9673|-0.9673	10|5	0.13470|.	T|.	0.59|.	.|.	2.7747|2.7747	0.05344|0.05344	0.2073:0.3627:0.0:0.43|0.2073:0.3627:0.0:0.43	.|.	78|.	O75015|.	FCG3B_HUMAN|.	S|L	78;78;114;61|98	ENSP00000356941:A78S;ENSP00000294800:A78S;ENSP00000433642:A114S;ENSP00000437084:A61S|.	ENSP00000294800:A78S|.	A|R	-|-	1|2	0|0	FCGR3B|FCGR3B	159866279|159866279	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	-1.266000|-1.266000	0.02842|0.02842	-0.664000|-0.664000	0.05324|0.05324	0.388000|0.388000	0.25769|0.25769	GCT|CGC		0.532	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569		25	136	1	0	1.56442e-22	0.012213	2.12261e-22	25	136				
DDR2	4921	broad.mit.edu	37	1	162740216	162740216	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:162740216G>A	ENST00000367922.3	+	13	1856	c.1418G>A	c.(1417-1419)cGc>cAc	p.R473H	DDR2_ENST00000367921.3_Missense_Mutation_p.R473H	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	473					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R473H(2)		central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ACTTACGATCGCATCTTTCCC	0.512																																					NSCLC(161;314 2006 8283 19651 23192)	NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(1417-1419)CGC>CAC		discoidin domain receptor family, member 2							204.0	172.0	183.0					1																	162740216		2203	4300	6503	SO:0001583	missense	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162740216G>A	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1418G>A	1.37:g.162740216G>A	ENSP00000356899:p.Arg473His		Somatic				DDR2_uc001gcg.2_Missense_Mutation_p.R473H	p.R473H	NM_001014796	NP_001014796	WXS	Illumina HiSeq	Unspecified	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		13	1883	+	all_hematologic(112;0.115)		473			Cytoplasmic (Potential).		Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	c.1418G>A	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454802	0.84209	.	.	ENSG00000162733	ENST00000367922;ENST00000367921;ENST00000458105	D;D;T	0.84516	-1.86;-1.86;1.08	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.79417	0.4442	M	0.70275	2.135	0.39846	D	0.973175	B	0.32507	0.373	B	0.27608	0.081	T	0.79102	-0.1941	9	0.37606	T	0.19	.	18.6038	0.91259	0.0:0.0:1.0:0.0	.	473	Q16832	DDR2_HUMAN	H	473;473;83	ENSP00000356899:R473H;ENSP00000356898:R473H;ENSP00000417030:R83H	ENSP00000356898:R473H	R	+	2	0	DDR2	161006840	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.510000	0.81708	2.733000	0.93635	0.655000	0.94253	CGC		0.512	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		6	270	0	0	0	0.001168	0	6	270				
BLZF1	8548	broad.mit.edu	37	1	169356319	169356319	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:169356319G>T	ENST00000367808.3	+	7	1525	c.1102G>T	c.(1102-1104)Gct>Tct	p.A368S	BLZF1_ENST00000329281.2_Missense_Mutation_p.A368S			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	368				A -> V (in Ref. 2; AAG37822). {ECO:0000305}.	cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)	p.A368S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					CACCTTACTTGCTACAAAGAA	0.358																																							uc001gfx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1102-1104)GCT>TCT		basic leucine zipper nuclear factor 1							88.0	92.0	91.0					1																	169356319		2203	4300	6503	SO:0001583	missense	8548				cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding	g.chr1:169356319G>T	U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.1102G>T	1.37:g.169356319G>T	ENSP00000356782:p.Ala368Ser		Somatic				BLZF1_uc001gfy.2_Missense_Mutation_p.A368S|BLZF1_uc009wvp.1_3'UTR	p.A368S	NM_003666	NP_003657	WXS	Illumina HiSeq	Unspecified	Q9H2G9	GO45_HUMAN			7	1539	+	all_hematologic(923;0.208)		368	A -> V (in Ref. 2; AAG37822).				O15298|Q5T531|Q5T533|Q9GZX4	Missense_Mutation	SNP	ENST00000367808.3	37	c.1102G>T	CCDS1278.1	.	.	.	.	.	.	.	.	.	.	G	8.428	0.848028	0.17034	.	.	ENSG00000117475	ENST00000367808;ENST00000329281	T;T	0.29397	1.57;1.57	5.63	2.39	0.29439	.	0.620208	0.17479	N	0.172810	T	0.03434	0.0099	N	0.04880	-0.145	0.21950	N	0.999456	B	0.09022	0.002	B	0.04013	0.001	T	0.41627	-0.9498	9	0.05959	T	0.93	-20.9781	8.3104	0.32068	0.1653:0.0:0.6644:0.1703	.	368	Q9H2G9	GO45_HUMAN	S	368	ENSP00000356782:A368S;ENSP00000327541:A368S	ENSP00000327541:A368S	A	+	1	0	BLZF1	167622943	0.987000	0.35691	1.000000	0.80357	0.976000	0.68499	0.627000	0.24506	0.719000	0.32188	0.655000	0.94253	GCT		0.358	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086109.1	NM_003666		34	93	1	0	7.04047e-22	0.005524	9.46371e-22	34	93				
F5	2153	broad.mit.edu	37	1	169526011	169526011	+	Silent	SNP	G	G	T	rs144375278		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:169526011G>T	ENST00000367797.3	-	6	1026	c.825C>A	c.(823-825)gtC>gtA	p.V275V	F5_ENST00000546081.1_Silent_p.V138V|F5_ENST00000367796.3_Silent_p.V275V	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	275	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.V275V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TCTGCTCCAGGACCTGGCCGT	0.498																																							uc001ggg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(823-825)GTC>GTA		coagulation factor V precursor	Drotrecogin alfa(DB00055)						151.0	121.0	131.0					1																	169526011		2203	4300	6503	SO:0001819	synonymous_variant	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169526011G>T	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.825C>A	1.37:g.169526011G>T			Somatic				F5_uc010plr.1_RNA	p.V275V	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			6	970	-	all_hematologic(923;0.208)		275			F5/8 type A 1.|Plastocyanin-like 2.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	ENST00000367797.3	37	c.825C>A	CCDS1281.1																																																																																				0.498	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		14	51	1	0	2.31682e-05	0.003163	2.48908e-05	14	51				
CENPL	91687	broad.mit.edu	37	1	173772116	173772116	+	Silent	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:173772116A>C	ENST00000345664.6	-	4	1161	c.948T>G	c.(946-948)acT>acG	p.T316T	CENPL_ENST00000367710.3_Silent_p.T316T|CENPL_ENST00000356198.2_Silent_p.T362T	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	316					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.T316T(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						TTTTTCCATCAGTATGTGCTG	0.303																																							uc001gje.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(946-948)ACT>ACG		centromere protein L isoform 2							77.0	77.0	77.0					1																	173772116		2203	4300	6503	SO:0001819	synonymous_variant	91687				mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus		g.chr1:173772116A>C	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.948T>G	1.37:g.173772116A>C			Somatic				CENPL_uc009wwg.2_Silent_p.T190T|CENPL_uc001gjg.3_Silent_p.T362T|CENPL_uc001gjf.3_Silent_p.T316T	p.T316T	NM_033319	NP_201576	WXS	Illumina HiSeq	Unspecified	Q8N0S6	CENPL_HUMAN			4	1162	-			316					Q5TEL5|Q96ND4	Silent	SNP	ENST00000345664.6	37	c.948T>G	CCDS30938.1																																																																																				0.303	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319		3	77	0	0	0	0.004672	0	3	77				
ASPM	259266	broad.mit.edu	37	1	197062239	197062239	+	Missense_Mutation	SNP	A	A	T	rs535630513		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:197062239A>T	ENST00000367409.4	-	21	9493	c.9237T>A	c.(9235-9237)ttT>ttA	p.F3079L	ASPM_ENST00000367408.1_Missense_Mutation_p.F744L|ASPM_ENST00000294732.7_Missense_Mutation_p.F1494L	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3079	IQ 37. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.F3079L(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAGATTTTTTAAATTCAATAT	0.358													A|||	1	0.000199681	0.0	0.0014	5008	,	,		16596	0.0		0.0	False		,,,				2504	0.0						uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(9235-9237)TTT>TTA		asp (abnormal spindle)-like, microcephaly							72.0	73.0	73.0					1																	197062239		2203	4298	6501	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197062239A>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9237T>A	1.37:g.197062239A>T	ENSP00000356379:p.Phe3079Leu		Somatic				ASPM_uc001gtv.2_Missense_Mutation_p.F1494L|ASPM_uc001gtw.3_Missense_Mutation_p.F927L	p.F3079L	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			21	9494	-			3079			IQ 37.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.9237T>A	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.619712	0.00828	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;D	0.95103	0.64;1.98;-3.61	5.18	-10.4	0.00318	.	1.106600	0.06822	N	0.792338	T	0.77356	0.4118	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.69745	-0.5062	10	0.02654	T	1	.	4.8626	0.13592	0.518:0.2974:0.0859:0.0987	.	1065;1494;3079	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	L	3079;1494;744;1065	ENSP00000356379:F3079L;ENSP00000294732:F1494L;ENSP00000356378:F744L	ENSP00000294732:F1494L	F	-	3	2	ASPM	195328862	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-1.240000	0.02914	-2.183000	0.00763	-1.694000	0.00725	TTT		0.358	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		6	80	0	0	0	0.001168	0	6	80				
IPO9	55705	broad.mit.edu	37	1	201837855	201837855	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:201837855G>A	ENST00000361565.4	+	16	2004	c.1935G>A	c.(1933-1935)atG>atA	p.M645I		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	645					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CAATGCAAATGAGGCTGATTC	0.552																																							uc001gwz.2		NA																	0				ovary(2)	2						c.(1933-1935)ATG>ATA		importin 9							110.0	91.0	97.0					1																	201837855		2203	4300	6503	SO:0001583	missense	55705				protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity	g.chr1:201837855G>A	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1935G>A	1.37:g.201837855G>A	ENSP00000354742:p.Met645Ile		Somatic					p.M645I	NM_018085	NP_060555	WXS	Illumina HiSeq	Unspecified	Q96P70	IPO9_HUMAN			16	1985	+			645					B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	c.1935G>A	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722999	0.68959	.	.	ENSG00000198700	ENST00000361565	T	0.66638	-0.22	6.17	5.27	0.74061	Armadillo-like helical (1);Armadillo-type fold (1);	0.033820	0.85682	D	0.000000	T	0.56906	0.2017	L	0.36672	1.1	0.58432	D	0.999999	B	0.22414	0.069	B	0.18263	0.021	T	0.54146	-0.8337	10	0.42905	T	0.14	-2.5914	13.4045	0.60903	0.0752:0.0:0.9248:0.0	.	645	Q96P70	IPO9_HUMAN	I	645	ENSP00000354742:M645I	ENSP00000354742:M645I	M	+	3	0	IPO9	200104478	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.531000	0.81973	1.634000	0.50500	0.655000	0.94253	ATG		0.552	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085		5	30	0	0	0	0.001168	0	5	30				
GNPAT	8443	broad.mit.edu	37	1	231403468	231403468	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:231403468C>T	ENST00000366647.4	+	9	1267	c.1098C>T	c.(1096-1098)gtC>gtT	p.V366V	GNPAT_ENST00000366646.3_Silent_p.V305V	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	366					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.V366V(2)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				ATGCCTTTGTCACTGAAGTTG	0.433																																							uc001hup.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(1)	4						c.(1096-1098)GTC>GTT		glyceronephosphate O-acyltransferase							123.0	119.0	120.0					1																	231403468		2203	4300	6503	SO:0001819	synonymous_variant	8443				ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity	g.chr1:231403468C>T	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1098C>T	1.37:g.231403468C>T			Somatic				GNPAT_uc009xfp.2_Silent_p.V305V	p.V366V	NM_014236	NP_055051	WXS	Illumina HiSeq	Unspecified	O15228	GNPAT_HUMAN			9	1304	+	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)	366					B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	ENST00000366647.4	37	c.1098C>T	CCDS1592.1																																																																																				0.433	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			38	126	0	0	0	0.00623	0	38	126				
PCNXL2	80003	broad.mit.edu	37	1	233394778	233394778	+	Missense_Mutation	SNP	C	C	T	rs375747180		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:233394778C>T	ENST00000258229.9	-	5	1064	c.830G>A	c.(829-831)gGg>gAg	p.G277E	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	277						integral component of membrane (GO:0016021)		p.G277E(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				ATTCTCACTCCCCCACGGCTG	0.527																																							uc001hvl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(829-831)GGG>GAG		pecanex-like 2							56.0	59.0	58.0					1																	233394778		1940	4125	6065	SO:0001583	missense	80003					integral to membrane		g.chr1:233394778C>T	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.830G>A	1.37:g.233394778C>T	ENSP00000258229:p.Gly277Glu		Somatic				PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	p.G277E	NM_014801	NP_055616	WXS	Illumina HiSeq	Unspecified	A6NKB5	PCX2_HUMAN			5	1065	-		all_cancers(173;0.0347)|Prostate(94;0.137)	277					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.830G>A	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130732	0.56828	.	.	ENSG00000135749	ENST00000258229	T	0.61742	0.08	4.58	4.58	0.56647	.	.	.	.	.	T	0.43233	0.1238	L	0.27053	0.805	0.80722	D	1	P	0.42456	0.78	B	0.40636	0.335	T	0.26326	-1.0106	9	0.31617	T	0.26	.	10.0258	0.42070	0.0:0.8976:0.0:0.1024	.	277	A6NKB5	PCX2_HUMAN	E	277	ENSP00000258229:G277E	ENSP00000258229:G277E	G	-	2	0	PCNXL2	231461401	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.278000	0.51662	2.528000	0.85240	0.555000	0.69702	GGG		0.527	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		3	69	0	0	0	0.004672	0	3	69				
TBCE	6905	broad.mit.edu	37	1	235600787	235600787	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:235600787G>T	ENST00000366601.3	+	12	1290	c.1114G>T	c.(1114-1116)Gag>Tag	p.E372*	TBCE_ENST00000543662.1_Nonsense_Mutation_p.E423*|TBCE_ENST00000406207.1_Nonsense_Mutation_p.E372*|TBCE_ENST00000472011.1_3'UTR			Q15813	TBCE_HUMAN	tubulin folding cofactor E	372	LRRCT.				'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)	p.E372*(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			GAACAAATGTGAGGTGAGCAC	0.493																																							uc001hwz.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1114-1116)GAG>TAG		beta-tubulin cofactor E							72.0	68.0	69.0					1																	235600787		2203	4300	6503	SO:0001587	stop_gained	6905				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding	g.chr1:235600787G>T	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1114G>T	1.37:g.235600787G>T	ENSP00000355560:p.Glu372*		Somatic				TBCE_uc010pxq.1_RNA|TBCE_uc001hxa.1_Nonsense_Mutation_p.E372*|TBCE_uc010pxr.1_Nonsense_Mutation_p.E423*|TBCE_uc001hxb.1_Nonsense_Mutation_p.E259*	p.E372*	NM_003193	NP_003184	WXS	Illumina HiSeq	Unspecified	Q15813	TBCE_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)		12	1237	+	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	372			LRRCT.		A8K8C2|B7Z3P1	Nonsense_Mutation	SNP	ENST00000366601.3	37	c.1114G>T	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	G	36	5.734824	0.96865	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	.	.	.	4.85	1.7	0.24286	.	0.654924	0.16393	N	0.216380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-1.2836	16.9746	0.86309	0.0:0.6049:0.3951:0.0	.	.	.	.	X	372;372;423	.	ENSP00000355560:E372X	E	+	1	0	TBCE	233667410	0.888000	0.30383	0.743000	0.31040	0.951000	0.60555	1.014000	0.29950	0.161000	0.19458	0.655000	0.94253	GAG		0.493	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193		11	61	1	0	3.07112e-06	0.010729	3.34926e-06	11	61				
ZP4	57829	broad.mit.edu	37	1	238048822	238048822	+	Silent	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:238048822C>G	ENST00000366570.4	-	8	1187	c.1029G>C	c.(1027-1029)cgG>cgC	p.R343R	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	343	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.R343R(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AAATGGGATCCCGAAGCAACT	0.498																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1027-1029)CGG>CGC		zona pellucida glycoprotein 4 preproprotein							68.0	67.0	67.0					1																	238048822		2203	4300	6503	SO:0001819	synonymous_variant	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048822C>G	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1029G>C	1.37:g.238048822C>G			Somatic				LOC100130331_uc010pyc.1_Intron	p.R343R	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	1029	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	343			ZP.|Extracellular (Potential).		B2RAE1	Silent	SNP	ENST00000366570.4	37	c.1029G>C	CCDS1615.1																																																																																				0.498	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			34	64	0	0	0	0.004289	0	34	64				
FMN2	56776	broad.mit.edu	37	1	240374446	240374446	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:240374446C>A	ENST00000319653.9	+	6	4206	c.3976C>A	c.(3976-3978)Cat>Aat	p.H1326N		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1326	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CATAGATTGTCATGAATTTGA	0.328																																							uc010pyd.1		NA																	0				ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(3976-3978)CAT>AAT		formin 2							96.0	99.0	98.0					1																	240374446		2203	4300	6503	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240374446C>A	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3976C>A	1.37:g.240374446C>A	ENSP00000318884:p.His1326Asn		Somatic				FMN2_uc010pye.1_Missense_Mutation_p.H1330N	p.H1326N	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		6	4201	+	Ovarian(103;0.127)	all_cancers(173;0.013)	1326			FH2.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.3976C>A	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	8.676	0.903947	0.17760	.	.	ENSG00000155816	ENST00000319653	T	0.16324	2.35	4.49	4.49	0.54785	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000010	T	0.08935	0.0221	N	0.02985	-0.445	0.80722	D	1	B	0.20671	0.047	B	0.13407	0.009	T	0.20438	-1.0275	10	0.39692	T	0.17	.	17.1987	0.86900	0.0:1.0:0.0:0.0	.	1326	Q9NZ56	FMN2_HUMAN	N	1326	ENSP00000318884:H1326N	ENSP00000318884:H1326N	H	+	1	0	FMN2	238441069	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.585000	0.36600	2.051000	0.60960	0.655000	0.94253	CAT		0.328	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		44	118	1	0	1.30916e-28	0.01441	1.82777e-28	44	118				
OR2T2	401992	broad.mit.edu	37	1	248616356	248616356	+	Silent	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:248616356C>G	ENST00000342927.3	+	1	280	c.258C>G	c.(256-258)ctC>ctG	p.L86L		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L86L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCAGGACCTCCTGTCCAAGG	0.532																																							uc001iek.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(256-258)CTC>CTG		olfactory receptor, family 2, subfamily T,							157.0	188.0	177.0					1																	248616356		2203	4298	6501	SO:0001819	synonymous_variant	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616356C>G	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.258C>G	1.37:g.248616356C>G			Somatic					p.L86L	NM_001004136	NP_001004136	WXS	Illumina HiSeq	Unspecified	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	258	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		86			Extracellular (Potential).		B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	c.258C>G	CCDS31116.1																																																																																				0.532	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		7	227	0	0	0	0.014323	0	7	227				
CDC123	8872	broad.mit.edu	37	10	12272994	12272994	+	Splice_Site	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:12272994A>G	ENST00000281141.4	+	7	768	c.488A>G	c.(487-489)gAg>gGg	p.E163G	CDC123_ENST00000455773.3_3'UTR|CDC123_ENST00000378900.2_Splice_Site_p.E163G	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123	163					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)		p.E163G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						ATAGAATATGAGGTAAGAAGC	0.308																																							uc001ill.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(487-489)GAG>GGG		cell division cycle 123							128.0	125.0	126.0					10																	12272994		2202	4298	6500	SO:0001630	splice_region_variant	8872				cell cycle arrest|cell division|positive regulation of cell proliferation|regulation of mitotic cell cycle	cytoplasm		g.chr10:12272994A>G	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.489+1A>G	10.37:g.12272994A>G			Somatic				CDC123_uc001ilm.2_Missense_Mutation_p.E163G	p.E163G	NM_006023	NP_006014	WXS	Illumina HiSeq	Unspecified	O75794	CD123_HUMAN			7	772	+			163					A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	Missense_Mutation	SNP	ENST00000281141.4	37	c.488A>G	CCDS7090.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.72|19.72	3.880906|3.880906	0.72294|0.72294	.|.	.|.	ENSG00000151465|ENSG00000151465	ENST00000281141;ENST00000378900;ENST00000442050;ENST00000455773|ENST00000440613	.|.	.|.	.|.	5.4|5.4	4.27|4.27	0.50696|0.50696	.|.	0.045477|.	0.85682|.	N|.	0.000000|.	T|.	0.77136|.	0.4086|.	M|M	0.88775|0.88775	2.98|2.98	0.54753|0.54753	D|D	0.99998|0.99998	D|.	0.71674|.	0.998|.	D|.	0.72625|.	0.978|.	T|.	0.78620|.	-0.2133|.	8|.	.|.	.|.	.|.	-21.5729|-21.5729	10.2752|10.2752	0.43506|0.43506	0.921:0.0:0.079:0.0|0.921:0.0:0.079:0.0	.|.	163|.	O75794|.	CD123_HUMAN|.	G|W	163;163;131;121|16	.|.	.|.	E|X	+|+	2|3	0|0	CDC123|CDC123	12313000|12313000	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.876000|0.876000	0.50452|0.50452	4.691000|4.691000	0.61738|0.61738	0.892000|0.892000	0.36259|0.36259	0.477000|0.477000	0.44152|0.44152	GAG|TGA		0.308	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046801.1	NM_006023	Missense_Mutation	14	46	0	0	0	0.00499	0	14	46				
ITGA8	8516	broad.mit.edu	37	10	15655663	15655663	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:15655663C>A	ENST00000378076.3	-	15	1902	c.1549G>T	c.(1549-1551)Gcc>Tcc	p.A517S		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	517					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.A517S(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						ACTCACCAGGCAGCAGATGTC	0.438																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(1549-1551)GCC>TCC		integrin, alpha 8 precursor							140.0	147.0	144.0					10																	15655663		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15655663C>A	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1549G>T	10.37:g.15655663C>A	ENSP00000367316:p.Ala517Ser		Somatic				ITGA8_uc010qcb.1_Missense_Mutation_p.A502S	p.A517S	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			15	1549	-			517			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.1549G>T	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.541511	0.00934	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.42131	0.98	5.38	2.15	0.27550	Integrin alpha-2 (1);	0.161857	0.56097	N	0.000026	T	0.18341	0.0440	N	0.05441	-0.05	0.31083	N	0.711745	B;B	0.20261	0.035;0.043	B;B	0.22601	0.023;0.04	T	0.31308	-0.9948	10	0.05436	T	0.98	.	10.3732	0.44066	0.3355:0.5411:0.1234:0.0	.	502;517	F5H818;P53708	.;ITA8_HUMAN	S	517;502	ENSP00000367316:A517S	ENSP00000367316:A517S	A	-	1	0	ITGA8	15695669	0.630000	0.27155	0.829000	0.32907	0.108000	0.19459	0.861000	0.27885	0.601000	0.29879	0.467000	0.42956	GCC		0.438	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		26	209	1	0	7.92952e-12	0.003954	9.83533e-12	26	209				
SLC39A12	221074	broad.mit.edu	37	10	18276417	18276417	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:18276417A>G	ENST00000377369.2	+	7	1379	c.1106A>G	c.(1105-1107)tAc>tGc	p.Y369C	SLC39A12_ENST00000377371.3_Missense_Mutation_p.Y369C|SLC39A12_ENST00000539911.1_Missense_Mutation_p.Y235C|SLC39A12_ENST00000377374.4_Missense_Mutation_p.Y369C	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	369					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.Y369C(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GAATACGGCTACAGCACGGTG	0.527																																							uc001ipo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1105-1107)TAC>TGC		solute carrier family 39 (zinc transporter),							102.0	75.0	84.0					10																	18276417		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18276417A>G		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1106A>G	10.37:g.18276417A>G	ENSP00000366586:p.Tyr369Cys		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.Y369C|SLC39A12_uc001ipp.2_Missense_Mutation_p.Y369C|SLC39A12_uc010qck.1_Missense_Mutation_p.Y235C	p.Y369C	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			7	1379	+			369			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.1106A>G	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990464	0.74589	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.84	4.69	0.59074	.	0.118609	0.64402	D	0.000014	T	0.73575	0.3604	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78590	-0.2145	10	0.66056	D	0.02	-12.7416	12.3877	0.55340	0.8737:0.0:0.0:0.1262	.	369;369;369	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	C	369;369;369;235;289	ENSP00000366586:Y369C;ENSP00000366591:Y369C;ENSP00000366588:Y369C;ENSP00000440445:Y235C	ENSP00000366586:Y369C	Y	+	2	0	SLC39A12	18316423	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.850000	0.75420	1.029000	0.39812	0.533000	0.62120	TAC		0.527	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		8	43	0	0	0	0.001855	0	8	43				
ANKRD30A	91074	broad.mit.edu	37	10	37422904	37422904	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:37422904G>T	ENST00000602533.1	+	5	609	c.510G>T	c.(508-510)caG>caT	p.Q170H	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.Q170H|RNU6-811P_ENST00000384069.1_RNA|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.Q170H			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	226					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q170H(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TGCTTCTTCAGCAAAATGTTG	0.383																																							uc001iza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(508-510)CAG>CAT		ankyrin repeat domain 30A							256.0	237.0	243.0					10																	37422904		1910	4127	6037	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37422904G>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.510G>T	10.37:g.37422904G>T	ENSP00000473551:p.Gln170His		Somatic					p.Q170H	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			5	609	+			226			ANK 5.		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.510G>T		.	.	.	.	.	.	.	.	.	.	.	10.87	1.472861	0.26423	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.66460	-0.13;-0.21	1.43	-0.535	0.11879	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.74230	0.3689	M	0.76574	2.34	0.09310	N	1	D	0.55800	0.973	D	0.65323	0.934	T	0.61327	-0.7085	9	0.62326	D	0.03	.	3.5493	0.07840	0.5041:0.0:0.4959:0.0	.	226	Q9BXX3	AN30A_HUMAN	H	170	ENSP00000354432:Q170H;ENSP00000363792:Q170H	ENSP00000354432:Q170H	Q	+	3	2	ANKRD30A	37462910	0.000000	0.05858	0.005000	0.12908	0.173000	0.22820	-0.365000	0.07573	-0.018000	0.14079	0.289000	0.19496	CAG		0.383	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		75	215	1	0	4.18771e-30	0.01441	5.90365e-30	75	215				
ANKRD30A	91074	broad.mit.edu	37	10	37430832	37430832	+	Missense_Mutation	SNP	C	C	G	rs560930371		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:37430832C>G	ENST00000602533.1	+	7	938	c.839C>G	c.(838-840)tCt>tGt	p.S280C	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.S280C|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.S280C			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	336					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S280C(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAGGGAACATCTGACAAAATT	0.468													.|||	1	0.000199681	0.0	0.0	5008	,	,		18157	0.001		0.0	False		,,,				2504	0.0						uc001iza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(838-840)TCT>TGT		ankyrin repeat domain 30A							70.0	70.0	70.0					10																	37430832		1882	4131	6013	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37430832C>G	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.839C>G	10.37:g.37430832C>G	ENSP00000473551:p.Ser280Cys		Somatic					p.S280C	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			7	938	+			336					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.839C>G		.	.	.	.	.	.	.	.	.	.	.	8.759	0.923100	0.18056	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.07327	3.2;3.2	0.675	0.675	0.17952	.	.	.	.	.	T	0.15176	0.0366	L	0.40543	1.245	0.09310	N	1	D	0.61080	0.989	D	0.70935	0.971	T	0.13899	-1.0492	9	0.59425	D	0.04	.	4.7741	0.13171	0.0:1.0:0.0:0.0	.	336	Q9BXX3	AN30A_HUMAN	C	280	ENSP00000354432:S280C;ENSP00000363792:S280C	ENSP00000354432:S280C	S	+	2	0	ANKRD30A	37470838	0.690000	0.27699	0.003000	0.11579	0.004000	0.04260	-0.221000	0.09202	0.658000	0.30925	0.435000	0.28638	TCT		0.468	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		18	70	0	0	0	0.008871	0	18	70				
ANKRD30A	91074	broad.mit.edu	37	10	37508196	37508196	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:37508196C>G	ENST00000602533.1	+	34	3487	c.3388C>G	c.(3388-3390)Caa>Gaa	p.Q1130E	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.Q1249E|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.Q1130E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1186					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q1130E(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAAGGAAAAACAAGACAAAGA	0.373																																							uc001iza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(3388-3390)CAA>GAA		ankyrin repeat domain 30A							83.0	83.0	83.0					10																	37508196		1855	4089	5944	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37508196C>G	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3388C>G	10.37:g.37508196C>G	ENSP00000473551:p.Gln1130Glu		Somatic					p.Q1130E	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			34	3487	+			1186			Potential.		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.3388C>G		.	.	.	.	.	.	.	.	.	.	c	0.006	-2.100955	0.00360	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.14144	2.53;2.53	2.81	1.85	0.25348	.	.	.	.	.	T	0.08802	0.0218	L	0.31845	0.965	0.23966	N	0.996329	B	0.17667	0.023	B	0.20767	0.031	T	0.41840	-0.9486	9	0.02654	T	1	.	9.0354	0.36284	0.0:0.7703:0.2297:0.0	.	1186	Q9BXX3	AN30A_HUMAN	E	1130;1249	ENSP00000354432:Q1130E;ENSP00000363792:Q1249E	ENSP00000354432:Q1130E	Q	+	1	0	ANKRD30A	37548202	1.000000	0.71417	0.016000	0.15963	0.008000	0.06430	0.739000	0.26173	0.350000	0.24002	0.465000	0.42564	CAA		0.373	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		6	90	0	0	0	0.00308	0	6	90				
SLC16A9	220963	broad.mit.edu	37	10	61413507	61413507	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:61413507T>C	ENST00000395348.3	-	5	1913	c.1277A>G	c.(1276-1278)gAa>gGa	p.E426G	SLC16A9_ENST00000395347.1_Missense_Mutation_p.E426G	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	426					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.E426G(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						GGCTAATTTTTCAATTCCCAC	0.408																																							uc010qig.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1276-1278)GAA>GGA		solute carrier family 16 (monocarboxylic acid							95.0	92.0	93.0					10																	61413507		2203	4300	6503	SO:0001583	missense	220963				urate metabolic process	integral to membrane|plasma membrane	symporter activity	g.chr10:61413507T>C	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1277A>G	10.37:g.61413507T>C	ENSP00000378757:p.Glu426Gly		Somatic					p.E426G	NM_194298	NP_919274	WXS	Illumina HiSeq	Unspecified	Q7RTY1	MOT9_HUMAN			5	1726	-			426			Extracellular (Potential).		Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	c.1277A>G	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137754	0.56936	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	D;D	0.81739	-1.53;-1.53	4.87	4.87	0.63330	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.181972	0.64402	D	0.000018	T	0.79885	0.4523	M	0.70595	2.14	0.50171	D	0.999854	B	0.13594	0.008	B	0.13407	0.009	T	0.77885	-0.2421	10	0.52906	T	0.07	.	14.7702	0.69671	0.0:0.0:0.0:1.0	.	426	Q7RTY1	MOT9_HUMAN	G	426	ENSP00000378757:E426G;ENSP00000378756:E426G	ENSP00000378756:E426G	E	-	2	0	SLC16A9	61083513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.643000	0.83403	1.956000	0.56807	0.482000	0.46254	GAA		0.408	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298		4	161	0	0	0	0.001168	0	4	161				
ANK3	288	broad.mit.edu	37	10	61833291	61833291	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:61833291C>T	ENST00000280772.2	-	37	7539	c.7348G>A	c.(7348-7350)Gac>Aac	p.D2450N	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2450					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D2450N(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AACTCATCGTCATGGTATTCT	0.408																																							uc001jky.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(7348-7350)GAC>AAC		ankyrin 3 isoform 1							97.0	101.0	100.0					10																	61833291		2203	4300	6503	SO:0001583	missense	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:61833291C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7348G>A	10.37:g.61833291C>T	ENSP00000280772:p.Asp2450Asn		Somatic				ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	p.D2450N	NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			37	7540	-			2450					B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	c.7348G>A	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012634	0.54468	.	.	ENSG00000151150	ENST00000280772	T	0.69435	-0.4	5.69	5.69	0.88448	.	0.154650	0.30011	N	0.010628	T	0.66167	0.2762	L	0.48642	1.525	0.80722	D	1	P	0.39665	0.682	B	0.40329	0.326	T	0.67515	-0.5651	10	0.52906	T	0.07	.	19.8006	0.96506	0.0:1.0:0.0:0.0	.	2450	Q12955	ANK3_HUMAN	N	2450	ENSP00000280772:D2450N	ENSP00000280772:D2450N	D	-	1	0	ANK3	61503297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.810000	0.86072	2.687000	0.91594	0.462000	0.41574	GAC		0.408	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		18	128	0	0	0	0.012319	0	18	128				
C10orf107	219621	broad.mit.edu	37	10	63450314	63450314	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:63450314C>G	ENST00000330194.2	+	4	528	c.223C>G	c.(223-225)Caa>Gaa	p.Q75E		NM_173554.2	NP_775825.1	Q8IVU9	CJ107_HUMAN	chromosome 10 open reading frame 107	75								p.Q75*(1)|p.Q75E(1)		breast(1)|kidney(1)|lung(4)|prostate(1)|skin(1)	8	Prostate(12;0.016)					CAGCTTATTTCAACACTACAA	0.308																																							uc010qik.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(1)|skin(1)		0						c.(223-225)CAA>GAA		hypothetical protein LOC219621							117.0	115.0	115.0					10																	63450314		2203	4299	6502	SO:0001583	missense	219621							g.chr10:63450314C>G	BC041932	CCDS7262.1	10q21.3	2012-06-01			ENSG00000183346	ENSG00000183346			28678	protein-coding gene	gene with protein product						12477932	Standard	NM_173554		Approved	bA63A2.1, Em:AC022398.2, MGC44593	uc010qik.2	Q8IVU9	OTTHUMG00000018295	ENST00000330194.2:c.223C>G	10.37:g.63450314C>G	ENSP00000328698:p.Gln75Glu		Somatic					p.Q75E	NM_173554	NP_775825	WXS	Illumina HiSeq	Unspecified	Q8IVU9	CJ107_HUMAN			4	528	+	Prostate(12;0.016)		75					Q5T1B8	Missense_Mutation	SNP	ENST00000330194.2	37	c.223C>G	CCDS7262.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.19|19.19	3.779941|3.779941	0.70222|0.70222	.|.	.|.	ENSG00000183346|ENSG00000183346	ENST00000389639|ENST00000330194	.|.	.|.	.|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.085372	.|0.50627	.|D	.|0.000119	T|T	0.77143|0.77143	0.4087|0.4087	M|M	0.80847|0.80847	2.515|2.515	0.32261|0.32261	N|N	0.570204|0.570204	.|D	.|0.67145	.|0.996	.|D	.|0.76071	.|0.987	T|T	0.82269|0.82269	-0.0541|-0.0541	6|9	0.87932|0.72032	D|D	0|0.01	-16.8621|-16.8621	16.0171|16.0171	0.80450|0.80450	0.1349:0.8651:0.0:0.0|0.1349:0.8651:0.0:0.0	.|.	.|75	.|Q8IVU9	.|CJ107_HUMAN	L|E	63|75	.|.	ENSP00000374290:F63L|ENSP00000328698:Q75E	F|Q	+|+	3|1	2|0	C10orf107|C10orf107	63120320|63120320	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.403000|2.403000	0.44530|0.44530	2.738000|2.738000	0.93877|0.93877	0.591000|0.591000	0.81541|0.81541	TTC|CAA		0.308	C10orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048228.2	NM_173554		5	78	0	0	0	0.001168	0	5	78				
CDH23	64072	broad.mit.edu	37	10	73434908	73434908	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:73434908T>C	ENST00000224721.6	+	14	1509	c.1504T>C	c.(1504-1506)Tac>Cac	p.Y502H	CDH23_ENST00000299366.7_Missense_Mutation_p.Y542H	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	497	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.Y502H(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGAAGTCAGCTACTTCTTCAG	0.577																																							uc001jrx.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(1489-1491)TAC>CAC		cadherin-like 23 isoform 1 precursor							95.0	97.0	96.0					10																	73434908		2090	4223	6313	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73434908T>C	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1504T>C	10.37:g.73434908T>C	ENSP00000224721:p.Tyr502His		Somatic				CDH23_uc001jry.2_Missense_Mutation_p.Y113H|CDH23_uc001jrz.2_Missense_Mutation_p.Y113H	p.Y497H	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			14	1866	+			497			Cadherin 5.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.1489T>C		.	.	.	.	.	.	.	.	.	.	T	25.0	4.594710	0.86953	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.72	5.72	0.89469	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.90820	0.7117	H	0.98936	4.375	0.80722	D	1	D;D;D	0.89917	0.994;1.0;0.989	D;D;D	0.85130	0.968;0.997;0.964	D	0.94468	0.7682	9	0.87932	D	0	.	16.0023	0.80306	0.0:0.0:0.0:1.0	.	497;500;497	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	H	502;497;497;500;500;14	.	ENSP00000224721:Y502H	Y	+	1	0	CDH23	73104914	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.042000	0.76565	2.176000	0.68965	0.533000	0.62120	TAC		0.577	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		6	39	0	0	0	0.006214	0	6	39				
DLG5	9231	broad.mit.edu	37	10	79581303	79581303	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:79581303T>G	ENST00000372391.2	-	15	2944	c.2939A>C	c.(2938-2940)aAa>aCa	p.K980T	DLG5_ENST00000459739.1_5'Flank|DLG5_ENST00000372388.2_Intron	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	980					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.K980T(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CTGGGGGCGTTTGAAAGTGTT	0.567																																							uc001jzk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(3)	8						c.(2938-2940)AAA>ACA		discs large homolog 5							43.0	48.0	46.0					10																	79581303		2057	4090	6147	SO:0001583	missense	9231				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity	g.chr10:79581303T>G	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.2939A>C	10.37:g.79581303T>G	ENSP00000361467:p.Lys980Thr		Somatic				DLG5_uc001jzi.2_5'Flank|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Missense_Mutation_p.K584T	p.K980T	NM_004747	NP_004738	WXS	Illumina HiSeq	Unspecified	Q8TDM6	DLG5_HUMAN	Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)		15	3009	-	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		980					A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	c.2939A>C	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611530	0.87258	.	.	ENSG00000151208	ENST00000372391;ENST00000372392	T	0.08458	3.09	5.81	5.81	0.92471	.	0.000000	0.41500	D	0.000877	T	0.25044	0.0608	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.64687	0.928;0.849	T	0.00290	-1.1843	10	0.41790	T	0.15	.	16.1463	0.81575	0.0:0.0:0.0:1.0	.	870;980	Q8TDM6-4;Q8TDM6	.;DLG5_HUMAN	T	980;529	ENSP00000361467:K980T	ENSP00000361467:K980T	K	-	2	0	DLG5	79251309	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.947000	0.70242	2.216000	0.71823	0.496000	0.49642	AAA		0.567	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			39	110	0	0	0	0.006999	0	39	110				
ANXA11	311	broad.mit.edu	37	10	81930651	81930651	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:81930651C>A	ENST00000438331.1	-	5	558	c.76G>T	c.(76-78)Gct>Tct	p.A26S	ANXA11_ENST00000463657.1_5'Flank|ANXA11_ENST00000372231.3_Missense_Mutation_p.A26S|ANXA11_ENST00000537102.1_5'UTR|ANXA11_ENST00000535999.1_Missense_Mutation_p.A26S|ANXA11_ENST00000360615.4_Missense_Mutation_p.A26S|ANXA11_ENST00000422982.3_Missense_Mutation_p.A26S|ANXA11_ENST00000265447.4_Missense_Mutation_p.A26S	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	26					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.A26S(1)		endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			GGGTAGGCAGCACCTCCCCAG	0.632																																							uc001kbq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(76-78)GCT>TCT		annexin A11							56.0	54.0	54.0					10																	81930651		2203	4300	6503	SO:0001583	missense	311				cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding	g.chr10:81930651C>A	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.76G>T	10.37:g.81930651C>A	ENSP00000398610:p.Ala26Ser		Somatic				ANXA11_uc010qlx.1_Missense_Mutation_p.A126S|ANXA11_uc001kbr.1_Missense_Mutation_p.A26S|ANXA11_uc001kbs.1_Missense_Mutation_p.A26S|ANXA11_uc001kbt.1_Missense_Mutation_p.A26S|ANXA11_uc010qly.1_5'UTR|ANXA11_uc009xsq.1_Missense_Mutation_p.A26S|ANXA11_uc001kbu.1_Missense_Mutation_p.A26S	p.A26S	NM_145869	NP_665876	WXS	Illumina HiSeq	Unspecified	P50995	ANX11_HUMAN	Colorectal(32;0.109)		5	901	-	Prostate(51;0.00985)|all_epithelial(25;0.0951)		26					B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	c.76G>T	CCDS7364.1	.	.	.	.	.	.	.	.	.	.	.	14.41	2.525688	0.44969	.	.	ENSG00000122359	ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000445524;ENST00000437799	T;T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51;4.51	4.7	2.74	0.32292	.	0.423438	0.24396	N	0.038896	T	0.01661	0.0053	L	0.33485	1.01	0.80722	D	1	B;B;B	0.34103	0.437;0.043;0.043	B;B;B	0.26094	0.066;0.027;0.027	T	0.61729	-0.7003	10	0.17369	T	0.5	.	7.3597	0.26739	0.0:0.5786:0.3267:0.0947	.	126;26;26	B7Z6L0;Q5T0G8;P50995	.;.;ANX11_HUMAN	S	26	ENSP00000361305:A26S;ENSP00000404412:A26S;ENSP00000398610:A26S;ENSP00000353827:A26S;ENSP00000265447:A26S;ENSP00000441748:A26S	ENSP00000265447:A26S	A	-	1	0	ANXA11	81920631	0.509000	0.26163	0.998000	0.56505	0.915000	0.54546	0.507000	0.22675	1.079000	0.41038	0.443000	0.29094	GCT		0.632	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869		16	48	1	0	1.67942e-08	0.006122	1.93367e-08	16	48				
C10orf12	26148	broad.mit.edu	37	10	98741603	98741603	+	Silent	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:98741603G>A	ENST00000286067.2	+	1	563	c.456G>A	c.(454-456)agG>agA	p.R152R		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	152								p.R152R(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CAGGGCTGAGGATAAATGATT	0.388																																							uc001kmv.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(454-456)AGG>AGA		hypothetical protein LOC26148							98.0	92.0	94.0					10																	98741603		2203	4300	6503	SO:0001819	synonymous_variant	26148							g.chr10:98741603G>A	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.456G>A	10.37:g.98741603G>A			Somatic				C10orf12_uc009xvg.1_Silent_p.R462R	p.R152R	NM_015652	NP_056467	WXS	Illumina HiSeq	Unspecified	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	563	+		Colorectal(252;0.172)	152					Q9H945|Q9Y457	Silent	SNP	ENST00000286067.2	37	c.456G>A	CCDS7452.1																																																																																				0.388	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		7	77	0	0	0	0.00308	0	7	77				
ARHGAP19	84986	broad.mit.edu	37	10	99024633	99024633	+	Missense_Mutation	SNP	G	G	A	rs554411827		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:99024633G>A	ENST00000358531.4	-	3	381	c.353C>T	c.(352-354)aCg>aTg	p.T118M	ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.T118M|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.T109M|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.T109M|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.T118M|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.T118M	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	118	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.T118M(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GCCTTCCTCCGTCAGTGGGGA	0.343													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20091	0.0		0.0	False		,,,				2504	0.0						uc001knb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(352-354)ACG>ATG		Rho GTPase activating protein 19							98.0	94.0	95.0					10																	99024633		2203	4300	6503	SO:0001583	missense	84986				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	GTPase activator activity	g.chr10:99024633G>A	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.353C>T	10.37:g.99024633G>A	ENSP00000351333:p.Thr118Met		Somatic				ARHGAP19_uc001kmy.2_RNA|ARHGAP19_uc001kna.2_Missense_Mutation_p.T109M|ARHGAP19_uc009xvi.2_RNA|ARHGAP19_uc009xvj.2_Missense_Mutation_p.T118M|ARHGAP19_uc009xvk.2_Intron	p.T118M	NM_032900	NP_116289	WXS	Illumina HiSeq	Unspecified	Q14CB8	RHG19_HUMAN		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)	3	382	-		Colorectal(252;0.0854)	118			Rho-GAP.		A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	37	c.353C>T	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715755	0.89112	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000358308	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.69	5.69	0.88448	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.062176	0.64402	U	0.000008	T	0.64724	0.2624	M	0.64404	1.975	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.98;0.991	T	0.65660	-0.6114	10	0.87932	D	0	-8.8574	19.7977	0.96492	0.0:0.0:1.0:0.0	.	118;118;109	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	M	118;118;109;118;109;118	ENSP00000414774:T118M;ENSP00000324468:T118M;ENSP00000347526:T109M;ENSP00000351333:T118M;ENSP00000360066:T109M;ENSP00000351058:T118M	ENSP00000324468:T118M	T	-	2	0	ARHGAP19	99014623	1.000000	0.71417	0.974000	0.42286	0.830000	0.47004	9.504000	0.97986	2.698000	0.92095	0.655000	0.94253	ACG		0.343	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900		7	98	0	0	0	0.00308	0	7	98				
BLOC1S2	282991	broad.mit.edu	37	10	102035226	102035226	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:102035226T>A	ENST00000370372.2	-	5	474	c.422A>T	c.(421-423)aAg>aTg	p.K141M	BLOC1S2_ENST00000441611.1_Missense_Mutation_p.K98M	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	141					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)	p.K141M(1)		large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		TTCTCATCGCTTCTCCAGCTT	0.368																																							uc001kqw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(421-423)AAG>ATG		biogenesis of lysosome-related organelles							146.0	148.0	147.0					10																	102035226		2203	4300	6503	SO:0001583	missense	282991				melanosome organization|microtubule nucleation|platelet dense granule organization|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of apoptosis	BLOC-1 complex|centrosome|gamma-tubulin complex|nucleus	gamma-tubulin binding|identical protein binding|protein C-terminus binding	g.chr10:102035226T>A	AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.422A>T	10.37:g.102035226T>A	ENSP00000359398:p.Lys141Met		Somatic				BLOC1S2_uc001kqv.1_Missense_Mutation_p.K98M	p.K141M	NM_173809	NP_776170	WXS	Illumina HiSeq	Unspecified	Q6QNY1	BL1S2_HUMAN		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)	5	445	-		Colorectal(252;0.117)	141					B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	ENST00000370372.2	37	c.422A>T	CCDS7490.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888318	0.52014	.	.	ENSG00000196072	ENST00000361832;ENST00000358848;ENST00000441611;ENST00000370372	.	.	.	5.53	4.19	0.49359	.	0.131872	0.64402	D	0.000002	T	0.60064	0.2240	M	0.72479	2.2	0.58432	D	0.99999	P	0.48407	0.91	P	0.46543	0.52	T	0.66264	-0.5967	9	0.87932	D	0	-5.5895	9.8207	0.40880	0.0:0.0915:0.0:0.9085	.	141	Q6QNY1	BL1S2_HUMAN	M	73;141;98;73	.	ENSP00000351716:K141M	K	-	2	0	BLOC1S2	102025216	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.155000	0.64900	2.103000	0.63969	0.454000	0.30748	AAG		0.368	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049861.2	NM_173809		45	136	0	0	0	0.01441	0	45	136				
PRAP1	118471	broad.mit.edu	37	10	135163597	135163597	+	Splice_Site	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:135163597A>C	ENST00000433452.2	+	2	280		c.e2-1		PRAP1_ENST00000423766.1_Splice_Site|ZNF511_ENST00000368554.4_Splice_Site|PRAP1_ENST00000458230.1_Splice_Site|RP11-122K13.7_ENST00000452591.1_RNA			Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1							extracellular region (GO:0005576)		p.?(1)		large_intestine(1)|lung(2)	3		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		GCCCCCCCTCAGGCTCCTCCT	0.662																																							uc001lmp.2		NA																	1	Unknown(1)		lung(1)		0						c.e2-2		proline-rich acidic protein 1 isoform 1							72.0	55.0	61.0					10																	135163597		2203	4300	6503	SO:0001630	splice_region_variant	118471					extracellular region		g.chr10:135163597A>C	AF421885	CCDS7679.1	10q26.3	2012-10-01			ENSG00000165828	ENSG00000165828			23304	protein-coding gene	gene with protein product		609776				14583459, 20674898	Standard	NM_001145201		Approved	UPA		Q96NZ9	OTTHUMG00000019312	ENST00000433452.2:c.9-1A>C	10.37:g.135163597A>C			Somatic				PRAP1_uc001lmr.2_Splice_Site_p.R3_splice|PRAP1_uc001lmq.1_5'Flank	p.R3_splice	NM_145202	NP_660203	WXS	Illumina HiSeq	Unspecified	Q96NZ9	PRAP1_HUMAN		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)	2	87	+		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)						B7ZL57|B7ZL58|E9KL31|Q5VWY4|Q7Z4X5|Q8IWR3|Q8NCS2	Splice_Site	SNP	ENST00000433452.2	37	c.9_splice	CCDS7679.1	.	.	.	.	.	.	.	.	.	.	A	7.486	0.649591	0.14516	.	.	ENSG00000198546;ENSG00000165828;ENSG00000165828;ENSG00000165828;ENSG00000165828	ENST00000368554;ENST00000433452;ENST00000423766;ENST00000458230;ENST00000415747	.	.	.	3.05	3.05	0.35203	.	.	.	.	.	.	.	.	.	.	.	0.32248	N	0.571786	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8753	0.29590	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF511;PRAP1	135013587	0.629000	0.27146	0.042000	0.18584	0.012000	0.07955	0.815000	0.27253	1.618000	0.50286	0.383000	0.25322	.		0.662	PRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051132.1	NM_145202	Intron	3	24	0	0	0	0.00308	0	3	24				
CHID1	66005	broad.mit.edu	37	11	903105	903105	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:903105A>T	ENST00000449825.1	-	3	474	c.118T>A	c.(118-120)Ttt>Att	p.F40I	CHID1_ENST00000336845.5_Missense_Mutation_p.F65I|CHID1_ENST00000454838.2_Missense_Mutation_p.F65I|CHID1_ENST00000323578.8_Missense_Mutation_p.F40I|CHID1_ENST00000528581.1_Missense_Mutation_p.F65I|CHID1_ENST00000436108.2_Missense_Mutation_p.F40I|CHID1_ENST00000323541.7_Missense_Mutation_p.F70I|CHID1_ENST00000526714.1_5'UTR|CHID1_ENST00000429789.2_Missense_Mutation_p.F40I	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	40					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)	p.F40I(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		TTATCTGAAAACTGACTCTGA	0.537																																					Pancreas(117;992 2327 5172 41921)	Pancreas(117;992 2327 5172 41921)	uc001lsl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(118-120)TTT>ATT		chitinase domain containing 1 isoform a							62.0	62.0	62.0					11																	903105		2203	4299	6502	SO:0001583	missense	66005				chitin catabolic process|innate immune response	extracellular region|lysosome	cation binding|chitinase activity	g.chr11:903105A>T	AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.118T>A	11.37:g.903105A>T	ENSP00000391255:p.Phe40Ile		Somatic				CHID1_uc010qwu.1_Missense_Mutation_p.F70I|CHID1_uc010qwv.1_Missense_Mutation_p.F101I|CHID1_uc001lsn.2_Missense_Mutation_p.F65I|CHID1_uc001lsm.2_Missense_Mutation_p.F40I|CHID1_uc001lso.2_Missense_Mutation_p.F40I|CHID1_uc001lsp.2_Missense_Mutation_p.F40I|CHID1_uc010qww.1_Missense_Mutation_p.F40I	p.F40I	NM_023947	NP_076436	WXS	Illumina HiSeq	Unspecified	Q9BWS9	CHID1_HUMAN		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)	3	279	-		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	40					B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Missense_Mutation	SNP	ENST00000449825.1	37	c.118T>A	CCDS7722.1	.	.	.	.	.	.	.	.	.	.	A	6.398	0.441592	0.12164	.	.	ENSG00000177830	ENST00000323541;ENST00000449825;ENST00000454838;ENST00000323578;ENST00000429789;ENST00000528581;ENST00000336845;ENST00000436108;ENST00000531859;ENST00000533056;ENST00000533059;ENST00000530939;ENST00000525225	T;T;T;T;T;T;T;T	0.29142	1.58;1.6;1.62;1.6;1.59;1.62;1.62;1.6	4.79	-2.34	0.06704	.	0.755638	0.13080	N	0.415357	T	0.18964	0.0455	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.002;0.002;0.001	T	0.26189	-1.0110	10	0.22109	T	0.4	0.2219	9.5188	0.39122	0.1695:0.1534:0.677:0.0	.	101;70;40;65;40	B4DN31;B7Z705;Q9BWS9-3;Q9BWS9-2;Q9BWS9	.;.;.;.;CHID1_HUMAN	I	70;40;65;40;40;65;65;40;40;40;40;40;40	ENSP00000324821:F70I;ENSP00000391255:F40I;ENSP00000398722:F65I;ENSP00000325055:F40I;ENSP00000416034:F40I;ENSP00000435503:F65I;ENSP00000338838:F65I;ENSP00000388156:F40I	ENSP00000324821:F70I	F	-	1	0	CHID1	893105	0.014000	0.17966	0.059000	0.19551	0.373000	0.29922	0.558000	0.23469	-0.534000	0.06315	0.379000	0.24179	TTT		0.537	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1	NM_023947		13	29	0	0	0	0.004007	0	13	29				
NLRP10	338322	broad.mit.edu	37	11	7981504	7981504	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:7981504A>T	ENST00000328600.2	-	2	1816	c.1655T>A	c.(1654-1656)aTg>aAg	p.M552K		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	552					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.M552K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CATAGATTCCATCTGTTCTTT	0.393																																							uc001mfv.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1654-1656)ATG>AAG		NLR family, pyrin domain containing 10							63.0	64.0	64.0					11																	7981504		2201	4296	6497	SO:0001583	missense	338322						ATP binding	g.chr11:7981504A>T	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1655T>A	11.37:g.7981504A>T	ENSP00000327763:p.Met552Lys		Somatic					p.M552K	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1672	-			552					Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	c.1655T>A	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	A	1.386	-0.582143	0.03827	.	.	ENSG00000182261	ENST00000328600	D	0.86865	-2.18	4.31	0.108	0.14548	.	0.736942	0.11730	N	0.535024	T	0.68641	0.3023	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.54159	-0.8335	10	0.05436	T	0.98	.	1.8523	0.03172	0.5735:0.1655:0.1001:0.161	.	552	Q86W26	NAL10_HUMAN	K	552	ENSP00000327763:M552K	ENSP00000327763:M552K	M	-	2	0	NLRP10	7938080	0.052000	0.20516	0.000000	0.03702	0.115000	0.19883	2.136000	0.42121	0.152000	0.19188	-0.418000	0.06021	ATG		0.393	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		20	59	0	0	0	0.010504	0	20	59				
NAV2	89797	broad.mit.edu	37	11	20066788	20066788	+	Silent	SNP	C	C	A	rs374804697		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:20066788C>A	ENST00000396087.3	+	15	3642	c.3543C>A	c.(3541-3543)ctC>ctA	p.L1181L	NAV2_ENST00000533917.1_Silent_p.L244L|NAV2_ENST00000527559.2_Silent_p.L1110L|NAV2_ENST00000311043.8_Silent_p.L244L|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000540292.1_Silent_p.L1112L|NAV2_ENST00000396085.1_Silent_p.L1158L|NAV2_ENST00000349880.4_Silent_p.L1158L|NAV2_ENST00000360655.4_Silent_p.L1094L	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1181					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.L1181L(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CATCTGCACTCGTCAGTCGGT	0.582																																							uc010rdm.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)|pancreas(1)	6						c.(3541-3543)CTC>CTA		neuron navigator 2 isoform 2							86.0	83.0	84.0					11																	20066788		2203	4300	6503	SO:0001819	synonymous_variant	89797					nucleus	ATP binding|helicase activity	g.chr11:20066788C>A	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.3543C>A	11.37:g.20066788C>A			Somatic				NAV2_uc001mpp.2_Silent_p.L1094L|NAV2_uc001mpr.3_Silent_p.L1158L|NAV2_uc001mpt.2_Silent_p.L244L|NAV2_uc009yhx.2_Silent_p.L244L|NAV2_uc009yhy.1_Silent_p.L157L	p.L1181L	NM_145117	NP_660093	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			15	3904	+			1181					A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	c.3543C>A	CCDS58126.1																																																																																				0.582	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		30	63	1	0	1.36615e-20	0.013726	1.81108e-20	30	63				
LRRC4C	57689	broad.mit.edu	37	11	40136618	40136618	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:40136618C>A	ENST00000278198.2	-	2	3188	c.1225G>T	c.(1225-1227)Ggt>Tgt	p.G409C	LRRC4C_ENST00000530763.1_Missense_Mutation_p.G409C|LRRC4C_ENST00000527150.1_Missense_Mutation_p.G409C|LRRC4C_ENST00000528697.1_Missense_Mutation_p.G409C			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	409	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.G409C(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TTTAACGTACCATCACTGAGC	0.458																																							uc001mxa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1225-1227)GGT>TGT		netrin-G1 ligand precursor							210.0	181.0	191.0					11																	40136618		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136618C>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1225G>T	11.37:g.40136618C>A	ENSP00000278198:p.Gly409Cys		Somatic				LRRC4C_uc001mxc.1_Missense_Mutation_p.G405C|LRRC4C_uc001mxd.1_Missense_Mutation_p.G405C|LRRC4C_uc001mxb.1_Missense_Mutation_p.G405C	p.G409C	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	3189	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	409			Ig-like C2-type.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1225G>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291451	0.59976	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71846	0.3388	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78674	-0.2112	10	0.87932	D	0	.	19.2865	0.94077	0.0:1.0:0.0:0.0	.	409	Q9HCJ2	LRC4C_HUMAN	C	409	ENSP00000278198:G409C;ENSP00000436976:G409C;ENSP00000437132:G409C;ENSP00000434761:G409C	ENSP00000278198:G409C	G	-	1	0	LRRC4C	40093194	1.000000	0.71417	0.877000	0.34402	0.953000	0.61014	7.757000	0.85209	2.802000	0.96397	0.655000	0.94253	GGT		0.458	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		73	180	1	0	8.41775e-28	0.01441	1.15844e-27	73	180				
OR5W2	390148	broad.mit.edu	37	11	55681268	55681268	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:55681268G>A	ENST00000344514.1	-	1	790	c.791C>T	c.(790-792)tCt>tTt	p.S264F		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S264F(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGAATAGGAAGAACTTGGCCG	0.448																																					Melanoma(48;171 1190 15239 43886 49348)	Melanoma(48;171 1190 15239 43886 49348)	uc010rir.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(790-792)TCT>TTT		olfactory receptor, family 5, subfamily W,							80.0	91.0	88.0					11																	55681268		2201	4296	6497	SO:0001583	missense	390148				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55681268G>A	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.791C>T	11.37:g.55681268G>A	ENSP00000342448:p.Ser264Phe		Somatic					p.S264F	NM_001001960	NP_001001960	WXS	Illumina HiSeq	Unspecified	Q8NH69	OR5W2_HUMAN			1	791	-			264			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000344514.1	37	c.791C>T	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075964	0.36662	.	.	ENSG00000187612	ENST00000344514	T	0.00267	8.38	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	N	0.001243	T	0.00784	0.0026	M	0.93462	3.42	0.09310	N	1	D	0.62365	0.991	D	0.64410	0.925	T	0.22591	-1.0212	10	0.87932	D	0	.	15.8124	0.78576	0.0:0.0:1.0:0.0	.	264	Q8NH69	OR5W2_HUMAN	F	264	ENSP00000342448:S264F	ENSP00000342448:S264F	S	-	2	0	OR5W2	55437844	0.000000	0.05858	0.591000	0.28745	0.467000	0.32768	-0.237000	0.08990	2.311000	0.77944	0.549000	0.68633	TCT		0.448	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960		20	62	0	0	0	0.003954	0	20	62				
OR8H2	390151	broad.mit.edu	37	11	55872945	55872945	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:55872945G>C	ENST00000313503.1	+	1	427	c.427G>C	c.(427-429)Gct>Cct	p.A143P		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A143P(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					GCTCTGCCTCGCTCTCATCAC	0.453										HNSCC(53;0.14)																													uc010riy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(427-429)GCT>CCT		olfactory receptor, family 8, subfamily H,							211.0	192.0	198.0					11																	55872945		2201	4296	6497	SO:0001583	missense	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55872945G>C	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.427G>C	11.37:g.55872945G>C	ENSP00000323982:p.Ala143Pro	HNSCC(53;0.14)	Somatic					p.A143P	NM_001005200	NP_001005200	WXS	Illumina HiSeq	Unspecified	Q8N162	OR8H2_HUMAN			1	427	+	Esophageal squamous(21;0.00693)		143			Helical; Name=4; (Potential).		Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	c.427G>C	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	g	12.59	1.984135	0.35036	.	.	ENSG00000181767	ENST00000313503	T	0.00158	8.65	3.44	-3.64	0.04515	GPCR, rhodopsin-like superfamily (1);	1.327720	0.04831	N	0.438654	T	0.00178	0.0005	N	0.19112	0.55	0.09310	N	1	D	0.55605	0.972	D	0.64237	0.923	T	0.41770	-0.9490	10	0.36615	T	0.2	.	0.3588	0.00361	0.2918:0.2876:0.1795:0.2411	.	143	Q8N162	OR8H2_HUMAN	P	143	ENSP00000323982:A143P	ENSP00000323982:A143P	A	+	1	0	OR8H2	55629521	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-1.417000	0.02464	-0.452000	0.07087	0.281000	0.19383	GCT		0.453	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		28	279	0	0	0	0.007291	0	28	279				
OR8K5	219453	broad.mit.edu	37	11	55927085	55927085	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:55927085C>T	ENST00000313447.1	-	1	708	c.709G>A	c.(709-711)Gct>Act	p.A237T		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237T(1)		large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				GTGGAGAAAGCCTTTTTCCTG	0.408																																							uc010rja.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(709-711)GCT>ACT		olfactory receptor, family 8, subfamily K,							85.0	80.0	82.0					11																	55927085		2201	4296	6497	SO:0001583	missense	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927085C>T	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.709G>A	11.37:g.55927085C>T	ENSP00000323853:p.Ala237Thr		Somatic					p.A237T	NM_001004058	NP_001004058	WXS	Illumina HiSeq	Unspecified	Q8NH50	OR8K5_HUMAN			1	709	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	237			Cytoplasmic (Potential).		Q6IFB5	Missense_Mutation	SNP	ENST00000313447.1	37	c.709G>A	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	c	16.10	3.028476	0.54790	.	.	ENSG00000181752	ENST00000313447	T	0.00357	7.89	3.98	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.351885	0.24431	N	0.038600	T	0.00580	0.0019	M	0.80982	2.52	0.29912	N	0.823486	P	0.52692	0.955	P	0.54100	0.742	T	0.19289	-1.0310	10	0.72032	D	0.01	.	11.6173	0.51096	0.1805:0.8195:0.0:0.0	.	237	Q8NH50	OR8K5_HUMAN	T	237	ENSP00000323853:A237T	ENSP00000323853:A237T	A	-	1	0	OR8K5	55683661	0.994000	0.37717	0.954000	0.39281	0.155000	0.21991	3.064000	0.49986	1.019000	0.39547	-0.377000	0.06932	GCT		0.408	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		7	56	0	0	0	0.001984	0	7	56				
CPT1A	1374	broad.mit.edu	37	11	68566823	68566823	+	Splice_Site	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:68566823A>G	ENST00000265641.5	-	6	710	c.556T>C	c.(556-558)Tat>Cat	p.Y186H	CPT1A_ENST00000538994.1_5'Flank|CPT1A_ENST00000376618.2_Splice_Site_p.Y186H|CPT1A_ENST00000540367.1_Splice_Site_p.Y186H|CPT1A_ENST00000539743.1_Splice_Site_p.Y186H	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	186					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.Y186H(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GACTGTAGATACTGGGATTAT	0.408																																							uc001oog.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(556-558)TAT>CAT		carnitine palmitoyltransferase 1A liver isoform	L-Carnitine(DB00583)|Perhexiline(DB01074)						67.0	67.0	67.0					11																	68566823		2200	4294	6494	SO:0001630	splice_region_variant	1374				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr11:68566823A>G	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.556-1T>C	11.37:g.68566823A>G			Somatic				CPT1A_uc001oof.3_Missense_Mutation_p.Y186H|CPT1A_uc009ysj.2_Missense_Mutation_p.Y186H	p.Y186H	NM_001876	NP_001867	WXS	Illumina HiSeq	Unspecified	P50416	CPT1A_HUMAN	LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		6	726	-	Esophageal squamous(3;3.28e-14)		186			Cytoplasmic (Potential).		Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	c.556T>C	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	a	10.10	1.258278	0.23051	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95	4.66	4.66	0.58398	.	0.064020	0.64402	D	0.000004	D	0.96580	0.8884	M	0.73319	2.225	0.80722	D	1	P;B;P	0.35872	0.525;0.051;0.474	P;B;B	0.46585	0.521;0.168;0.315	D	0.96732	0.9540	10	0.56958	D	0.05	.	14.1003	0.65051	1.0:0.0:0.0:0.0	.	186;186;186	B2RAQ8;P50416;P50416-2	.;CPT1A_HUMAN;.	H	186	ENSP00000439084:Y186H;ENSP00000365803:Y186H;ENSP00000265641:Y186H;ENSP00000446108:Y186H	ENSP00000265641:Y186H	Y	-	1	0	CPT1A	68323399	1.000000	0.71417	0.910000	0.35882	0.046000	0.14306	6.783000	0.75078	1.742000	0.51746	0.379000	0.24179	TAT		0.408	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	Missense_Mutation	3	107	0	0	0	0.009096	0	3	107				
SHANK2	22941	broad.mit.edu	37	11	70319292	70319293	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:70319292_70319293TG>AA	ENST00000423696.2	-	16	4130_4131	c.4094_4095CA>TT	c.(4093-4095)cCA>cTT	p.P1365L	SHANK2_ENST00000338508.4_Missense_Mutation_p.P1745L|SHANK2_ENST00000449833.2_Missense_Mutation_p.P1149L|SHANK2_ENST00000409161.1_Missense_Mutation_p.P1148L			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1365					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.P1745L(1)|p.P1149L(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GGGGCTGGCTTGGAAGGCTAAA	0.579																																							uc001oqc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(5230-5232)CCA>CTT		SH3 and multiple ankyrin repeat domains 2																																				SO:0001583	missense	22941				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding	g.chr11:70319292_70319293TG>AA	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.4094_4095delinsAA	11.37:g.70319292_70319293delinsAA	ENSP00000394536:p.Pro1365Leu		Somatic				SHANK2_uc010rqn.1_Missense_Mutation_p.P1156L|SHANK2_uc001opz.2_Missense_Mutation_p.P1149L|uc009ysn.1_Missense_Mutation_p.G65R|SHANK2_uc001opy.2_Missense_Mutation_p.P80L	p.P1744L	NM_012309	NP_036441	WXS	Illumina HiSeq	Unspecified	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)		22	5309_5310	-			1365					C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	DNP	ENST00000423696.2	37	c.5231_5232CA>TT																																																																																					0.579	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		14	135	0	0	0	0.004672	0	14	135				
HEPHL1	341208	broad.mit.edu	37	11	93844222	93844222	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:93844222C>T	ENST00000315765.9	+	18	3207	c.3199C>T	c.(3199-3201)Cgt>Tgt	p.R1067C		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1067	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.R1071C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CACGGTCCTTCGTAACATAGG	0.507																																							uc001pep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3199-3201)CGT>TGT		hephaestin-like 1 precursor							52.0	53.0	52.0					11																	93844222		2107	4246	6353	SO:0001583	missense	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93844222C>T	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3199C>T	11.37:g.93844222C>T	ENSP00000313699:p.Arg1067Cys		Somatic				uc001pen.1_Intron	p.R1067C	NM_001098672	NP_001092142	WXS	Illumina HiSeq	Unspecified	Q6MZM0	HPHL1_HUMAN			18	3356	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	1067			Extracellular (Potential).|Plastocyanin-like 6.		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.3199C>T	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639775	0.67244	.	.	ENSG00000181333	ENST00000315765	D	0.99789	-6.75	5.97	3.91	0.45181	Cupredoxin (2);	0.294642	0.26863	N	0.022106	D	0.98957	0.9645	N	0.22421	0.69	0.38717	D	0.953368	P	0.44816	0.844	P	0.53062	0.717	D	0.99063	1.0831	10	0.59425	D	0.04	-10.5296	6.6226	0.22812	0.4564:0.4554:0.0:0.0882	.	1067	Q6MZM0	HPHL1_HUMAN	C	1067	ENSP00000313699:R1067C	ENSP00000313699:R1067C	R	+	1	0	HEPHL1	93483870	0.975000	0.34042	1.000000	0.80357	0.912000	0.54170	1.039000	0.30266	1.477000	0.48234	0.655000	0.94253	CGT		0.507	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		3	15	0	0	0	0.009096	0	3	15				
CCDC82	79780	broad.mit.edu	37	11	96117783	96117783	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:96117783C>A	ENST00000278520.5	-	3	557	c.129G>T	c.(127-129)gaG>gaT	p.E43D	CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000423339.2_Missense_Mutation_p.E43D|CCDC82_ENST00000542662.1_Missense_Mutation_p.E43D			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	43								p.E43D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		CACTATCAAGCTCTTCATCAC	0.368																																							uc009ywp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(127-129)GAG>GAT		coiled-coil domain containing 82							124.0	114.0	118.0					11																	96117783		2201	4296	6497	SO:0001583	missense	79780						protein binding	g.chr11:96117783C>A	AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.129G>T	11.37:g.96117783C>A	ENSP00000278520:p.Glu43Asp		Somatic				CCDC82_uc009ywq.2_Missense_Mutation_p.E43D|CCDC82_uc001pfx.3_Missense_Mutation_p.E43D|CCDC82_uc009ywr.2_Missense_Mutation_p.E43D|CCDC82_uc009yws.2_Missense_Mutation_p.E43D	p.E43D	NM_024725	NP_079001	WXS	Illumina HiSeq	Unspecified	Q8N4S0	CCD82_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.154)	1	372	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	43					B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	ENST00000278520.5	37	c.129G>T	CCDS8307.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539476	0.27563	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339;ENST00000538597	T;T;T;T	0.37915	1.55;1.55;1.55;1.17	5.77	-4.7	0.03288	.	0.517343	0.19653	N	0.109176	T	0.26340	0.0643	M	0.72118	2.19	0.18873	N	0.999985	B;B	0.24043	0.096;0.058	B;B	0.22152	0.038;0.017	T	0.17137	-1.0379	10	0.42905	T	0.14	-3.6456	2.371	0.04331	0.1845:0.29:0.346:0.1795	.	43;43	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	D	43	ENSP00000278520:E43D;ENSP00000444010:E43D;ENSP00000397156:E43D;ENSP00000442723:E43D	ENSP00000278520:E43D	E	-	3	2	CCDC82	95757431	0.001000	0.12720	0.003000	0.11579	0.583000	0.36354	-1.680000	0.01939	-0.796000	0.04456	-0.169000	0.13324	GAG		0.368	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2	NM_024725		9	45	1	0	4.68919e-08	0.008291	5.33534e-08	9	45				
CUL5	8065	broad.mit.edu	37	11	107904543	107904543	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:107904543C>T	ENST00000393094.2	+	2	656	c.40C>T	c.(40-42)Cag>Tag	p.Q14*		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	14					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)	p.Q14*(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		AGGTTCTCTTCAGTTTGAAGA	0.323																																							uc001pjv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(40-42)CAG>TAG		Vasopressin-activated calcium-mobilizing							85.0	84.0	84.0					11																	107904543		2201	4298	6499	SO:0001587	stop_gained	8065				cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding	g.chr11:107904543C>T	X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.40C>T	11.37:g.107904543C>T	ENSP00000376808:p.Gln14*		Somatic				CUL5_uc001pju.2_RNA	p.Q14*	NM_003478	NP_003469	WXS	Illumina HiSeq	Unspecified	Q93034	CUL5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)	2	707	+		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	14					A8K960|O14766|Q9BZC6	Nonsense_Mutation	SNP	ENST00000393094.2	37	c.40C>T	CCDS31668.1	.	.	.	.	.	.	.	.	.	.	C	35	5.562002	0.96527	.	.	ENSG00000166266	ENST00000393094	.	.	.	5.51	5.51	0.81932	.	0.055072	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-6.7335	19.4168	0.94704	0.0:1.0:0.0:0.0	.	.	.	.	X	14	.	ENSP00000376808:Q14X	Q	+	1	0	CUL5	107409753	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.310000	0.78947	2.598000	0.87819	0.555000	0.69702	CAG		0.323	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1			7	55	0	0	0	0.006214	0	7	55				
ATM	472	broad.mit.edu	37	11	108206578	108206578	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:108206578G>C	ENST00000452508.2	+	57	8347	c.8158G>C	c.(8158-8160)Gat>Cat	p.D2720H	ATM_ENST00000278616.4_Missense_Mutation_p.D2720H|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2720	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.D2720N(2)|p.D2720H(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GAAGGGCCGTGATGACCTGAG	0.373			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		4	Substitution - Missense(4)		lung(2)|breast(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(8158-8160)GAT>CAT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							98.0	90.0	93.0					11																	108206578		2201	4298	6499	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108206578G>C	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8158G>C	11.37:g.108206578G>C	ENSP00000388058:p.Asp2720His	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.D2720H|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.D1372H	p.D2720H	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	56	8543	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	2720			PI3K/PI4K.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.8158G>C	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875167	0.91664	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.91180	-2.8;-2.8	5.47	5.47	0.80525	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.97349	0.9133	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98548	1.0635	10	0.87932	D	0	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	2720	Q13315	ATM_HUMAN	H	2720	ENSP00000278616:D2720H;ENSP00000388058:D2720H	ENSP00000278616:D2720H	D	+	1	0	ATM	107711788	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.304000	0.96190	2.583000	0.87209	0.591000	0.81541	GAT		0.373	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		5	46	0	0	0	0.001984	0	5	46				
ADAMTS15	170689	broad.mit.edu	37	11	130332082	130332082	+	Silent	SNP	C	C	T	rs369731938		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:130332082C>T	ENST00000299164.2	+	3	1191	c.1191C>T	c.(1189-1191)atC>atT	p.I397I		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	397	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I397I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		TCATCCAGATCGACCGTGCCA	0.607																																							uc010scd.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(1189-1191)ATC>ATT		a disintegrin-like and metalloprotease		C		1,4401	2.1+/-5.4	0,1,2200	129.0	105.0	113.0		1191	-7.9	0.7	11		113	0,8594		0,0,4297	no	coding-synonymous	ADAMTS15	NM_139055.2		0,1,6497	TT,TC,CC		0.0,0.0227,0.0077		397/951	130332082	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130332082C>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1191C>T	11.37:g.130332082C>T			Somatic					p.I397I	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	3	1191	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	397			Peptidase M12B.		Q32MI6	Silent	SNP	ENST00000299164.2	37	c.1191C>T	CCDS8488.1																																																																																				0.607	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		16	83	0	0	0	0.00499	0	16	83				
NTM	50863	broad.mit.edu	37	11	131240725	131240725	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr11:131240725G>A	ENST00000374791.3	+	1	353	c.24G>A	c.(22-24)atG>atA	p.M8I	NTM_ENST00000539799.1_Missense_Mutation_p.M8I	NM_001048209.1	NP_001041674.1	Q9P121	NTRI_HUMAN	neurotrimin	0					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.M8I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AGCCAAAAATGCACAATTCTA	0.398																																							uc010sci.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(22-24)ATG>ATA		neurotrimin isoform 3							113.0	113.0	113.0					11																	131240725		1843	4089	5932	SO:0001583	missense	50863				cell adhesion|neuron recognition	anchored to membrane|plasma membrane		g.chr11:131240725G>A	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374791.3:c.24G>A	11.37:g.131240725G>A	ENSP00000363923:p.Met8Ile		Somatic				NTM_uc001qgm.2_Missense_Mutation_p.M8I|NTM_uc010sch.1_5'UTR	p.M8I	NM_001144058	NP_001137530	WXS	Illumina HiSeq	Unspecified	Q9P121	NTRI_HUMAN			1	355	+			Error:Variant_position_missing_in_Q9P121_after_alignment					A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374791.3	37	c.24G>A	CCDS41733.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437717	0.43224	.	.	ENSG00000182667	ENST00000374791;ENST00000539799	T;T	0.56776	0.45;0.44	6.07	6.07	0.98685	.	0.704369	0.14541	N	0.313261	T	0.35364	0.0929	N	0.08118	0	0.80722	D	1	B;B	0.14012	0.009;0.004	B;B	0.09377	0.004;0.003	T	0.13845	-1.0494	10	0.25751	T	0.34	.	16.144	0.81551	0.0:0.0:1.0:0.0	.	8;8	B7Z1Z5;Q9P121-2	.;.	I	8	ENSP00000363923:M8I;ENSP00000437668:M8I	ENSP00000363923:M8I	M	+	3	0	NTM	130745935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.190000	0.65104	2.884000	0.98904	0.655000	0.94253	ATG		0.398	NTM-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141936.2	NM_016522		27	92	0	0	0	0.012213	0	27	92				
PRMT8	56341	broad.mit.edu	37	12	3649868	3649868	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:3649868C>T	ENST00000382622.3	+	2	562	c.172C>T	c.(172-174)Cgg>Tgg	p.R58W	PRMT8_ENST00000452611.2_Missense_Mutation_p.R49W|PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	58					histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.R58W(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CTGCCCAGGACGGGGCAAGAT	0.592																																							uc001qmf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(172-174)CGG>TGG		HMT1 hnRNP methyltransferase-like 4							193.0	198.0	196.0					12																	3649868		2203	4300	6503	SO:0001583	missense	56341				regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity	g.chr12:3649868C>T	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.172C>T	12.37:g.3649868C>T	ENSP00000372067:p.Arg58Trp		Somatic				PRMT8_uc009zed.2_Missense_Mutation_p.R49W|PRMT8_uc009zee.1_RNA	p.R58W	NM_019854	NP_062828	WXS	Illumina HiSeq	Unspecified	Q9NR22	ANM8_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)		2	539	+			58			SH3-binding 2.		B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	c.172C>T	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090919	0.76756	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.30182	1.58;1.54	5.64	4.73	0.59995	.	0.065615	0.64402	D	0.000008	T	0.41903	0.1179	L	0.46157	1.445	0.58432	D	0.999999	D;D	0.69078	0.997;0.994	P;P	0.57776	0.827;0.676	T	0.32903	-0.9889	10	0.72032	D	0.01	.	11.4931	0.50391	0.3259:0.6741:0.0:0.0	.	49;58	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	W	49;58	ENSP00000414507:R49W;ENSP00000372067:R58W	ENSP00000372067:R58W	R	+	1	2	PRMT8	3520129	0.914000	0.31030	0.895000	0.35142	0.872000	0.50106	1.881000	0.39638	1.342000	0.45619	0.563000	0.77884	CGG		0.592	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		205	367	0	0	0	0.01441	0	205	367				
KLRD1	3824	broad.mit.edu	37	12	10462245	10462245	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:10462245G>A	ENST00000381907.4	+	4	323	c.121G>A	c.(121-123)Gag>Aag	p.E41K	KLRD1_ENST00000350274.5_Missense_Mutation_p.E10K|KLRD1_ENST00000336164.4_Missense_Mutation_p.E41K|KLRD1_ENST00000381908.3_Missense_Mutation_p.E41K|KLRD1_ENST00000538997.1_3'UTR|KLRD1_ENST00000543777.1_Intron|KLRD1_ENST00000543420.1_Missense_Mutation_p.E41K	NM_001114396.1	NP_001107868	Q13241	KLRD1_HUMAN	killer cell lectin-like receptor subfamily D, member 1	41					cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.E41K(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	10						ACTGAGTATTGAGCCAGCATT	0.313																																							uc001qxw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(121-123)GAG>AAG		killer cell lectin-like receptor subfamily D,							49.0	49.0	49.0					12																	10462245		2203	4299	6502	SO:0001583	missense	3824				cell surface receptor linked signaling pathway|regulation of immune response	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:10462245G>A	U30610	CCDS8621.1, CCDS8622.1	12p13	2009-12-03						"""Killer cell lectin-like receptors"", ""CD molecules"""	6378	protein-coding gene	gene with protein product		602894		CD94		7589107	Standard	NM_002262		Approved		uc001qxx.4	Q13241		ENST00000381907.4:c.121G>A	12.37:g.10462245G>A	ENSP00000371332:p.Glu41Lys		Somatic				KLRD1_uc001qxx.3_Missense_Mutation_p.E41K|KLRD1_uc001qxy.3_Missense_Mutation_p.E10K|KLRD1_uc009zhh.2_Intron|KLRD1_uc009zhi.2_Missense_Mutation_p.E41K|KLRD1_uc001qxz.3_Missense_Mutation_p.E41K	p.E41K	NM_001114396	NP_001107868	WXS	Illumina HiSeq	Unspecified	Q13241	KLRD1_HUMAN			4	318	+			41			Extracellular (Potential).		O43321|O43773|Q9UBE3|Q9UEQ0	Missense_Mutation	SNP	ENST00000381907.4	37	c.121G>A	CCDS8621.1	.	.	.	.	.	.	.	.	.	.	G	8.830	0.939740	0.18281	.	.	ENSG00000134539	ENST00000544747;ENST00000381907;ENST00000381908;ENST00000336164;ENST00000350274;ENST00000543420	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04	3.79	0.782	0.18567	.	0.482201	0.15381	N	0.265337	T	0.25494	0.0620	L	0.31065	0.9	0.09310	N	1	B;B;B	0.22146	0.051;0.065;0.03	B;B;B	0.16289	0.015;0.015;0.007	T	0.15206	-1.0445	10	0.27082	T	0.32	.	6.799	0.23740	0.171:0.3922:0.4368:0.0	.	41;10;41	Q13241-2;Q13241-3;Q13241	.;.;KLRD1_HUMAN	K	10;41;41;41;10;41	ENSP00000438669:E10K;ENSP00000371332:E41K;ENSP00000371333:E41K;ENSP00000338130:E41K;ENSP00000310929:E10K;ENSP00000441074:E41K	ENSP00000338130:E41K	E	+	1	0	KLRD1	10353512	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	0.110000	0.15437	0.159000	0.19401	0.585000	0.79938	GAG		0.313	KLRD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399684.2	NM_002262		21	41	0	0	0	0.00278	0	21	41				
SYT10	341359	broad.mit.edu	37	12	33592339	33592339	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:33592339C>T	ENST00000228567.3	-	1	415	c.119G>A	c.(118-120)cGg>cAg	p.R40Q	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	40					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.R40Q(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GCCCCTGTCCCGAGGGAAGAT	0.682																																							uc001rll.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(118-120)CGG>CAG		synaptotagmin X							116.0	113.0	114.0					12																	33592339		2203	4300	6503	SO:0001583	missense	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33592339C>T	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.119G>A	12.37:g.33592339C>T	ENSP00000228567:p.Arg40Gln		Somatic				SYT10_uc009zju.1_5'UTR	p.R40Q	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			1	416	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		40			Vesicular (Potential).		Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	c.119G>A	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.511893	0.27036	.	.	ENSG00000110975	ENST00000228567	T	0.49720	0.77	4.41	-1.65	0.08291	.	1.451420	0.05254	U	0.514423	T	0.35941	0.0949	L	0.36672	1.1	0.34277	D	0.681654	B	0.09022	0.002	B	0.04013	0.001	T	0.34775	-0.9815	10	0.30854	T	0.27	.	7.8966	0.29710	0.0826:0.613:0.1867:0.1177	.	40	Q6XYQ8	SYT10_HUMAN	Q	40	ENSP00000228567:R40Q	ENSP00000228567:R40Q	R	-	2	0	SYT10	33483606	0.941000	0.31946	0.012000	0.15200	0.397000	0.30659	0.419000	0.21247	-0.093000	0.12396	-0.165000	0.13383	CGG		0.682	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		10	181	0	0	0	0.006214	0	10	181				
KRT6B	3854	broad.mit.edu	37	12	52842654	52842654	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:52842654C>A	ENST00000252252.3	-	6	1222	c.1175G>T	c.(1174-1176)aGa>aTa	p.R392I		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	392	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.R392I(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GATCTCAGATCTCAGCCTCTG	0.512																																							uc001sak.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1174-1176)AGA>ATA		keratin 6B							126.0	103.0	111.0					12																	52842654		2203	4298	6501	SO:0001583	missense	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52842654C>A	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1175G>T	12.37:g.52842654C>A	ENSP00000252252:p.Arg392Ile		Somatic					p.R392I	NM_005555	NP_005546	WXS	Illumina HiSeq	Unspecified	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	6	1223	-			392			Rod.|Coil 2.		P48669	Missense_Mutation	SNP	ENST00000252252.3	37	c.1175G>T	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255829	0.39896	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.89123	-2.47	2.75	2.75	0.32379	Filament (1);	0.000000	0.64402	D	0.000007	D	0.94879	0.8345	M	0.93507	3.425	0.51233	D	0.999912	D	0.89917	1.0	D	0.83275	0.996	D	0.94701	0.7883	10	0.87932	D	0	.	9.3611	0.38197	0.0:0.886:0.0:0.114	.	392	P04259	K2C6B_HUMAN	I	392;352	ENSP00000252252:R392I	ENSP00000252252:R392I	R	-	2	0	KRT6B	51128921	0.000000	0.05858	0.992000	0.48379	0.227000	0.25037	0.190000	0.17057	1.865000	0.54081	0.305000	0.20034	AGA		0.512	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		34	150	1	0	7.04047e-22	0.005524	9.46371e-22	34	150				
KRT2	3849	broad.mit.edu	37	12	53045393	53045393	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:53045393C>G	ENST00000309680.3	-	1	555	c.534G>C	c.(532-534)gaG>gaC	p.E178D		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	178	Coil 1A.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.E178D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		TCTGCTCACGCTCTTGGGCCT	0.517																																							uc001sat.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(532-534)GAG>GAC		keratin 2							151.0	143.0	146.0					12																	53045393		2203	4300	6503	SO:0001583	missense	3849				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:53045393C>G		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.534G>C	12.37:g.53045393C>G	ENSP00000310861:p.Glu178Asp		Somatic					p.E178D	NM_000423	NP_000414	WXS	Illumina HiSeq	Unspecified	P35908	K22E_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.19)	1	567	-			178			Coil 1A.|Rod.		Q4VAQ2	Missense_Mutation	SNP	ENST00000309680.3	37	c.534G>C	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908636	0.52439	.	.	ENSG00000172867	ENST00000309680	D	0.93604	-3.25	5.54	2.65	0.31530	Filament (1);	.	.	.	.	D	0.97464	0.9170	H	0.97186	3.955	0.34283	D	0.68232	D	0.89917	1.0	D	0.91635	0.999	D	0.98490	1.0609	9	0.87932	D	0	.	10.0822	0.42397	0.0:0.7242:0.0:0.2758	.	178	P35908	K22E_HUMAN	D	178	ENSP00000310861:E178D	ENSP00000310861:E178D	E	-	3	2	KRT2	51331660	0.993000	0.37304	1.000000	0.80357	0.363000	0.29612	1.056000	0.30480	0.805000	0.34159	0.655000	0.94253	GAG		0.517	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423		47	246	0	0	0	0.01441	0	47	246				
ITGA7	3679	broad.mit.edu	37	12	56096921	56096921	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:56096921T>A	ENST00000555728.1	-	2	276	c.248A>T	c.(247-249)cAg>cTg	p.Q83L	ITGA7_ENST00000394229.2_Missense_Mutation_p.Q83L|ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000257879.6_Missense_Mutation_p.Q83L|ITGA7_ENST00000394230.2_Missense_Mutation_p.Q83L|ITGA7_ENST00000257880.7_Missense_Mutation_p.Q83L|ITGA7_ENST00000347027.6_Missense_Mutation_p.Q83L|ITGA7_ENST00000553804.1_Missense_Mutation_p.Q83L			Q13683	ITA7_HUMAN	integrin, alpha 7	83					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.Q83L(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ATTCGCCTGCTGCCCAGGAAG	0.627																																							uc001shh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(247-249)CAG>CTG		integrin alpha 7 isoform 1 precursor							43.0	41.0	42.0					12																	56096921		2203	4300	6503	SO:0001583	missense	3679				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity	g.chr12:56096921T>A		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.248A>T	12.37:g.56096921T>A	ENSP00000452387:p.Gln83Leu		Somatic				ITGA7_uc001shg.2_Missense_Mutation_p.Q83L|ITGA7_uc010sps.1_Intron|ITGA7_uc009znx.2_5'Flank	p.Q83L	NM_001144996	NP_001138468	WXS	Illumina HiSeq	Unspecified	Q13683	ITA7_HUMAN			2	468	-			83			FG-GAP 1.|Extracellular (Potential).		B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37	c.248A>T		.	.	.	.	.	.	.	.	.	.	T	16.95	3.263135	0.59431	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	4.45	4.45	0.53987	.	0.102199	0.40222	N	0.001159	T	0.81273	0.4788	L	0.51914	1.62	0.54753	D	0.999981	B;B	0.20052	0.041;0.016	B;B	0.33799	0.17;0.007	T	0.72899	-0.4152	10	0.09843	T	0.71	.	12.0276	0.53380	0.0:0.0:0.0:1.0	.	83;146	Q13683-3;Q4LE35	.;.	L	83	ENSP00000452120:Q83L;ENSP00000257879:Q83L;ENSP00000343009:Q83L;ENSP00000257880:Q83L;ENSP00000377777:Q83L;ENSP00000377776:Q83L;ENSP00000452387:Q83L	ENSP00000257879:Q83L	Q	-	2	0	ITGA7	54383188	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	3.331000	0.52075	2.015000	0.59207	0.402000	0.26972	CAG		0.627	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206		69	62	0	0	0	0.01441	0	69	62				
BAZ2A	11176	broad.mit.edu	37	12	56992465	56992465	+	Silent	SNP	G	G	A	rs531488338		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:56992465G>A	ENST00000551812.1	-	29	5848	c.5655C>T	c.(5653-5655)atC>atT	p.I1885I	BAZ2A_ENST00000179765.5_Silent_p.I1853I|BAZ2A_ENST00000549884.1_Silent_p.I1883I|BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000379441.3_Silent_p.I1855I	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1885					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.I1885I(2)|p.I1921I(1)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						AGCGGCGCATGATGTGCCCAG	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18032	0.0		0.0	False		,,,				2504	0.001						uc001slq.1		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(5653-5655)ATC>ATT		bromodomain adjacent to zinc finger domain, 2A							44.0	43.0	43.0					12																	56992465		1945	4133	6078	SO:0001819	synonymous_variant	11176				chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding	g.chr12:56992465G>A	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5655C>T	12.37:g.56992465G>A			Somatic				BAZ2A_uc001slp.1_Silent_p.I1883I|BAZ2A_uc001slo.1_Silent_p.I691I|BAZ2A_uc009zov.1_Silent_p.I851I|BAZ2A_uc009zow.1_Silent_p.I1853I	p.I1885I	NM_013449	NP_038477	WXS	Illumina HiSeq	Unspecified	Q9UIF9	BAZ2A_HUMAN			29	5849	-			1885					B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	ENST00000551812.1	37	c.5655C>T	CCDS44924.1																																																																																				0.557	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449		7	45	0	0	0	0.00308	0	7	45				
ACSS3	79611	broad.mit.edu	37	12	81593168	81593168	+	Silent	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:81593168G>C	ENST00000548058.1	+	9	2209	c.1299G>C	c.(1297-1299)ctG>ctC	p.L433L	ACSS3_ENST00000261206.3_Silent_p.L432L|ACSS3_ENST00000548324.1_Silent_p.L115L			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	433						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.L433L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TAGAGACCCTGGAATGGTCCA	0.358																																							uc001szl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1297-1299)CTG>CTC		acyl-CoA synthetase short-chain family member 3							93.0	87.0	89.0					12																	81593168		2203	4300	6503	SO:0001819	synonymous_variant	79611					mitochondrion	acetate-CoA ligase activity|ATP binding	g.chr12:81593168G>C		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1299G>C	12.37:g.81593168G>C			Somatic				ACSS3_uc001szm.1_Silent_p.L432L|ACSS3_uc001szn.1_Silent_p.L115L	p.L433L	NM_024560	NP_078836	WXS	Illumina HiSeq	Unspecified	Q9H6R3	ACSS3_HUMAN			9	1390	+			433					Q8NC66	Silent	SNP	ENST00000548058.1	37	c.1299G>C	CCDS9022.1																																																																																				0.358	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560		9	42	0	0	0	0.006214	0	9	42				
KERA	11081	broad.mit.edu	37	12	91449755	91449755	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:91449755G>C	ENST00000266719.3	-	2	551	c.304C>G	c.(304-306)Cta>Gta	p.L102V		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	102					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.L102V(1)		breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TTCTTGTTTAGATTTATCCAT	0.368																																							uc001tbl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(304-306)CTA>GTA		keratocan precursor							149.0	136.0	140.0					12																	91449755		2203	4299	6502	SO:0001583	missense	11081				response to stimulus|visual perception	proteinaceous extracellular matrix		g.chr12:91449755G>C	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.304C>G	12.37:g.91449755G>C	ENSP00000266719:p.Leu102Val		Somatic					p.L102V	NM_007035	NP_008966	WXS	Illumina HiSeq	Unspecified	O60938	KERA_HUMAN			2	923	-			102			LRR 2.			Missense_Mutation	SNP	ENST00000266719.3	37	c.304C>G	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282621	0.59867	.	.	ENSG00000139330	ENST00000266719	T	0.76316	-1.01	6.04	4.14	0.48551	.	0.120581	0.56097	D	0.000025	D	0.88603	0.6481	M	0.91140	3.18	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.87997	0.2753	10	0.87932	D	0	-16.1508	7.6565	0.28379	0.2741:0.0:0.7259:0.0	.	102	O60938	KERA_HUMAN	V	102	ENSP00000266719:L102V	ENSP00000266719:L102V	L	-	1	2	KERA	89973886	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.581000	0.46077	0.803000	0.34113	0.650000	0.86243	CTA		0.368	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035		27	76	0	0	0	0.003954	0	27	76				
ANKS1B	56899	broad.mit.edu	37	12	99640276	99640276	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:99640276C>G	ENST00000547776.2	-	13	2122	c.2123G>C	c.(2122-2124)gGa>gCa	p.G708A	ANKS1B_ENST00000550833.1_5'UTR|ANKS1B_ENST00000329257.7_Missense_Mutation_p.G708A|ANKS1B_ENST00000547010.1_Missense_Mutation_p.G288A	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	708						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)	p.G708A(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CTCCACAAATCCCCCTGCGTT	0.453																																							uc001tge.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2122-2124)GGA>GCA		cajalin 2 isoform a							128.0	123.0	124.0					12																	99640276		1908	4121	6029	SO:0001583	missense	56899					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane		g.chr12:99640276C>G	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2123G>C	12.37:g.99640276C>G	ENSP00000449629:p.Gly708Ala		Somatic				ANKS1B_uc001tgf.1_Missense_Mutation_p.G288A|ANKS1B_uc001tgk.2_Missense_Mutation_p.G5A|ANKS1B_uc009ztt.1_Missense_Mutation_p.G674A	p.G708A	NM_152788	NP_690001	WXS	Illumina HiSeq	Unspecified	Q7Z6G8	ANS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)	13	2540	-		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)	708					A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	c.2123G>C	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998997	0.54147	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;T;T	0.67698	0.62;-0.28;0.62	5.34	3.29	0.37713	.	0.682915	0.13879	N	0.356473	T	0.58250	0.2109	N	0.25485	0.75	0.80722	D	1	P;B	0.40619	0.724;0.001	B;B	0.43155	0.41;0.001	T	0.54289	-0.8316	9	.	.	.	-10.6142	15.1647	0.72814	0.0:0.6656:0.3344:0.0	.	288;708	Q7Z6G8-6;Q7Z6G8	.;ANS1B_HUMAN	A	708;288;708;287	ENSP00000449629:G708A;ENSP00000448512:G288A;ENSP00000331381:G708A	.	G	-	2	0	ANKS1B	98164407	0.995000	0.38212	0.998000	0.56505	0.943000	0.58893	2.374000	0.44274	1.334000	0.45468	0.561000	0.74099	GGA		0.453	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140		22	58	0	0	0	0.00333	0	22	58				
SLC41A2	84102	broad.mit.edu	37	12	105199029	105199029	+	Silent	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:105199029G>A	ENST00000258538.3	-	10	1750	c.1623C>T	c.(1621-1623)taC>taT	p.Y541Y	SLC41A2_ENST00000549713.1_5'UTR	NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	541					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.Y458Y(1)|p.Y541Y(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						ATGCTGTTAGGTAGGGGATGG	0.453																																					Esophageal Squamous(195;176 2919 4272 35572)	Esophageal Squamous(195;176 2919 4272 35572)	uc001tla.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1621-1623)TAC>TAT		solute carrier family 41, member 2							202.0	206.0	205.0					12																	105199029		2203	4300	6503	SO:0001819	synonymous_variant	84102					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity	g.chr12:105199029G>A	BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.1623C>T	12.37:g.105199029G>A			Somatic					p.Y541Y	NM_032148	NP_115524	WXS	Illumina HiSeq	Unspecified	Q96JW4	S41A2_HUMAN			10	1790	-			541			Extracellular.		Q3KP68|Q9H0E5	Silent	SNP	ENST00000258538.3	37	c.1623C>T	CCDS9100.2																																																																																				0.453	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346850.3	NM_032148		172	200	0	0	0	0.01441	0	172	200				
CMKLR1	1240	broad.mit.edu	37	12	108686093	108686093	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:108686093C>A	ENST00000312143.7	-	3	1010	c.647G>T	c.(646-648)cGg>cTg	p.R216L	CMKLR1_ENST00000550402.1_Missense_Mutation_p.R216L|CMKLR1_ENST00000397688.2_Missense_Mutation_p.R214L|CMKLR1_ENST00000552995.1_Missense_Mutation_p.R214L|CMKLR1_ENST00000412676.1_Missense_Mutation_p.R216L	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	216					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.R214L(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						CACCATGTGCCGGCTATACCC	0.567																																							uc009zuw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(646-648)CGG>CTG		chemokine-like receptor 1 isoform a							57.0	60.0	59.0					12																	108686093		2130	4237	6367	SO:0001583	missense	1240				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity	g.chr12:108686093C>A	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.647G>T	12.37:g.108686093C>A	ENSP00000311733:p.Arg216Leu		Somatic				CMKLR1_uc001tmw.2_Missense_Mutation_p.R216L|CMKLR1_uc001tmv.2_Missense_Mutation_p.R214L|CMKLR1_uc009zuv.2_Missense_Mutation_p.R216L	p.R216L	NM_001142345	NP_001135817	WXS	Illumina HiSeq	Unspecified	Q99788	CML1_HUMAN			3	838	-			216			Extracellular (Potential).		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	c.647G>T	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	c	9.230	1.035541	0.19590	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.391289	0.24472	N	0.038232	T	0.23249	0.0562	N	0.26130	0.795	0.28677	N	0.905324	B	0.22851	0.076	B	0.28638	0.092	T	0.19353	-1.0308	10	0.02654	T	1	.	11.571	0.50834	0.0:0.9183:0.0:0.0817	.	216	Q99788	CML1_HUMAN	L	216;216;214;214;216	ENSP00000311733:R216L;ENSP00000401293:R216L;ENSP00000380803:R214L;ENSP00000447579:R214L;ENSP00000449716:R216L	ENSP00000311733:R216L	R	-	2	0	CMKLR1	107210223	0.261000	0.24063	0.021000	0.16686	0.143000	0.21401	2.215000	0.42862	2.516000	0.84829	0.550000	0.68814	CGG		0.567	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			37	33	1	0	1.47197e-15	0.007835	1.90762e-15	37	33				
ISCU	23479	broad.mit.edu	37	12	108958090	108958090	+	Silent	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:108958090G>T	ENST00000311893.9	+	2	172	c.150G>T	c.(148-150)ggG>ggT	p.G50G	SART3_ENST00000228284.3_5'Flank|ISCU_ENST00000535729.1_Silent_p.G50G|ISCU_ENST00000338291.4_Silent_p.G25G|ISCU_ENST00000392807.4_Silent_p.G25G|SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000539593.1_Silent_p.G50G|ISCU_ENST00000547005.1_Silent_p.G50G|ISCU_ENST00000431221.2_Silent_p.G50G	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	50					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)	p.G25G(1)		kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						GAAACGTGGGGTCCCTTGACA	0.403																																							uc010sxc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(148-150)GGG>GGT		iron-sulfur cluster assembly enzyme isoform							89.0	88.0	88.0					12																	108958090		2203	4300	6503	SO:0001819	synonymous_variant	23479				iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold	g.chr12:108958090G>T	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.150G>T	12.37:g.108958090G>T			Somatic				SART3_uc001tmz.1_5'Flank|SART3_uc009zux.1_5'Flank|SART3_uc010swx.1_5'Flank|SART3_uc010swz.1_5'Flank|SART3_uc001tna.1_5'Flank|SART3_uc001tnb.2_5'Flank|ISCU_uc010sxa.1_Silent_p.G50G|ISCU_uc010sxb.1_Silent_p.G50G|ISCU_uc001tnc.3_Silent_p.G25G|ISCU_uc009zuy.2_Silent_p.G25G|ISCU_uc010sxd.1_Silent_p.G50G	p.G50G	NM_213595	NP_998760	WXS	Illumina HiSeq	Unspecified	Q9H1K1	ISCU_HUMAN			2	255	+			50					Q6P713|Q99617|Q9H1K2	Silent	SNP	ENST00000311893.9	37	c.150G>T	CCDS44966.1																																																																																				0.403	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301		43	59	1	0	1.86633e-21	0.01441	2.49709e-21	43	59				
CUX2	23316	broad.mit.edu	37	12	111772465	111772465	+	Silent	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr12:111772465G>A	ENST00000261726.6	+	19	3301	c.3147G>A	c.(3145-3147)acG>acA	p.T1049T		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1049					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.T1049T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AGCTGGACACGTACTCCATCA	0.632																																							uc001tsa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|breast(1)	6						c.(3145-3147)ACG>ACA		cut-like 2							38.0	42.0	41.0					12																	111772465		2088	4234	6322	SO:0001819	synonymous_variant	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111772465G>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3147G>A	12.37:g.111772465G>A			Somatic					p.T1049T	NM_015267	NP_056082	WXS	Illumina HiSeq	Unspecified	O14529	CUX2_HUMAN			19	3300	+			1049			CUT 3.		A7E2Y4	Silent	SNP	ENST00000261726.6	37	c.3147G>A	CCDS41837.1																																																																																				0.632	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		17	59	0	0	0	0.006122	0	17	59				
LRCH1	23143	broad.mit.edu	37	13	47279229	47279229	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr13:47279229G>T	ENST00000389798.3	+	12	1624	c.1427G>T	c.(1426-1428)aGt>aTt	p.S476I	LRCH1_ENST00000389797.3_Missense_Mutation_p.S476I|LRCH1_ENST00000311191.6_Missense_Mutation_p.S476I	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	476								p.S476I(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		ACAGAGAGAAGTGTTTTAAAC	0.284																																							uc001vbj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1426-1428)AGT>ATT		leucine-rich repeats and calponin homology (CH)							98.0	108.0	104.0					13																	47279229		2203	4299	6502	SO:0001583	missense	23143							g.chr13:47279229G>T	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1427G>T	13.37:g.47279229G>T	ENSP00000374448:p.Ser476Ile		Somatic				LRCH1_uc010acp.2_Missense_Mutation_p.S476I|LRCH1_uc001vbk.2_Missense_Mutation_p.S476I|LRCH1_uc001vbl.3_Missense_Mutation_p.S476I	p.S476I	NM_015116	NP_055931	WXS	Illumina HiSeq	Unspecified	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)	12	1663	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	476					B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	c.1427G>T	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933146	0.73442	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.59502	0.32;0.37;0.26	5.95	3.23	0.37069	.	0.492145	0.25810	N	0.028143	T	0.65585	0.2705	M	0.67953	2.075	0.35397	D	0.79122	P;P;D;P	0.53312	0.93;0.915;0.959;0.918	P;P;P;P	0.57425	0.665;0.812;0.82;0.534	T	0.70281	-0.4915	10	0.44086	T	0.13	-2.1465	8.5839	0.33646	0.2457:0.0:0.7543:0.0	.	476;476;476;476	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	I	476	ENSP00000308493:S476I;ENSP00000374448:S476I;ENSP00000374447:S476I	ENSP00000308493:S476I	S	+	2	0	LRCH1	46177230	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.859000	0.39418	0.379000	0.24794	0.655000	0.94253	AGT		0.284	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116		15	51	1	0	1.3612e-06	0.003163	1.50148e-06	15	51				
THSD1	55901	broad.mit.edu	37	13	52952787	52952787	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr13:52952787C>T	ENST00000258613.4	-	5	1496	c.1318G>A	c.(1318-1320)Ggc>Agc	p.G440S	THSD1_ENST00000349258.4_Missense_Mutation_p.G387S|THSD1_ENST00000544466.1_Missense_Mutation_p.G61S	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	440					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.G440S(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GCTGGCCGGCCGAACCTCCTC	0.557																																							uc001vgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(1318-1320)GGC>AGC		thrombospondin type I domain-containing 1							82.0	83.0	83.0					13																	52952787		2203	4300	6503	SO:0001583	missense	55901					extracellular region|integral to membrane|intracellular membrane-bounded organelle		g.chr13:52952787C>T	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1318G>A	13.37:g.52952787C>T	ENSP00000258613:p.Gly440Ser		Somatic				THSD1_uc001vgp.2_Missense_Mutation_p.G387S|THSD1_uc010tgz.1_Missense_Mutation_p.G61S|THSD1_uc010aea.2_5'UTR	p.G440S	NM_018676	NP_061146	WXS	Illumina HiSeq	Unspecified	Q9NS62	THSD1_HUMAN		GBM - Glioblastoma multiforme(99;2.8e-08)	5	1863	-		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	440			Cytoplasmic (Potential).		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	37	c.1318G>A	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	c	13.50	2.254916	0.39896	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.31510	2.21;1.49;2.44	6.06	6.06	0.98353	.	0.055508	0.64402	D	0.000001	T	0.44829	0.1312	L	0.60455	1.87	0.38592	D	0.950458	D;P	0.89917	1.0;0.812	D;B	0.63703	0.917;0.27	T	0.29579	-1.0007	10	0.19590	T	0.45	-37.9437	10.5231	0.44931	0.1556:0.711:0.1334:0.0	.	387;440	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	S	387;61;440	ENSP00000340650:G387S;ENSP00000438512:G61S;ENSP00000258613:G440S	ENSP00000258613:G440S	G	-	1	0	THSD1	51850788	1.000000	0.71417	0.981000	0.43875	0.604000	0.37047	4.865000	0.62998	2.879000	0.98667	0.650000	0.86243	GGC		0.557	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3			8	40	0	0	0	0.006214	0	8	40				
LTB4R	1241	broad.mit.edu	37	14	24785095	24785095	+	Missense_Mutation	SNP	C	C	G	rs368817971		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:24785095C>G	ENST00000396789.4	+	2	1963	c.238C>G	c.(238-240)Caa>Gaa	p.Q80E	LTB4R_ENST00000345363.3_Missense_Mutation_p.Q80E|LTB4R_ENST00000396782.2_Missense_Mutation_p.Q80E	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	80					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)	p.Q80E(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CTTCCTGGCCCAAGGCACCTG	0.587																																							uc001wos.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)CAA>GAA		leukotriene B4 receptor							146.0	130.0	135.0					14																	24785095		2203	4300	6503	SO:0001583	missense	1241				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular component movement|immune response|inflammatory response|muscle contraction	integral to plasma membrane	nucleotide binding	g.chr14:24785095C>G	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.238C>G	14.37:g.24785095C>G	ENSP00000380008:p.Gln80Glu		Somatic				LTB4R_uc010alp.2_Missense_Mutation_p.Q80E|LTB4R_uc001wou.2_Missense_Mutation_p.Q80E	p.Q80E	NM_001143919	NP_001137391	WXS	Illumina HiSeq	Unspecified	Q15722	LT4R1_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	2	559	+			80			Extracellular (Potential).		Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	37	c.238C>G	CCDS9626.1	.	.	.	.	.	.	.	.	.	.	C	7.160	0.585415	0.13749	.	.	ENSG00000213903	ENST00000553481;ENST00000345363;ENST00000396789;ENST00000396782	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.89	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.869974	0.09715	U	0.765239	T	0.54565	0.1866	N	0.22421	0.69	0.09310	N	1	B	0.27791	0.189	B	0.25614	0.062	T	0.48364	-0.9042	10	0.56958	D	0.05	.	6.1601	0.20360	0.1383:0.6537:0.1335:0.0745	.	80	Q15722	LT4R1_HUMAN	E	80	ENSP00000450457:Q80E;ENSP00000307445:Q80E;ENSP00000380008:Q80E;ENSP00000380002:Q80E	ENSP00000307445:Q80E	Q	+	1	0	LTB4R	23854935	0.000000	0.05858	0.001000	0.08648	0.254000	0.26022	0.349000	0.20055	0.818000	0.34468	0.655000	0.94253	CAA		0.587	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4			37	126	0	0	0	0.013114	0	37	126				
FSCB	84075	broad.mit.edu	37	14	44976337	44976337	+	De_novo_Start_InFrame	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:44976337A>T	ENST00000340446.4	-	0	145				RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein							sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AAACGTACCAAGTGTCAAAGA	0.348																																							uc001wvn.2		NA																	0				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(-148--144)ACTTG>ACATG		fibrous sheath CABYR binding protein																																						84075					cilium		g.chr14:44976337A>T	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262		14.37:g.44976337A>T			Somatic						NM_032135	NP_115511	WXS	Illumina HiSeq	Unspecified	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	163	-								Q5H9U7|Q86YI2|Q9H0J3	Translation_Start_Site	SNP	ENST00000340446.4	37	c.-146T>A	CCDS9679.1																																																																																				0.348	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		3	19	0	0	0	0.004672	0	3	19				
SIPA1L1	26037	broad.mit.edu	37	14	72176135	72176135	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:72176135C>T	ENST00000555818.1	+	15	4373	c.4025C>T	c.(4024-4026)tCg>tTg	p.S1342L	SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.S1321L|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.S796L|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.S1321L	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1342	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.S1342L(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		AGCACAGCCTCGCTGGGGGCT	0.577																																							uc001xms.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(4024-4026)TCG>TTG		signal-induced proliferation-associated 1 like							47.0	43.0	44.0					14																	72176135		2203	4300	6503	SO:0001583	missense	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72176135C>T	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4025C>T	14.37:g.72176135C>T	ENSP00000450832:p.Ser1342Leu		Somatic				SIPA1L1_uc001xmt.2_Missense_Mutation_p.S1321L|SIPA1L1_uc001xmu.2_Missense_Mutation_p.S1321L|SIPA1L1_uc001xmv.2_Missense_Mutation_p.S1342L|SIPA1L1_uc010ttm.1_Missense_Mutation_p.S796L|SIPA1L1_uc001xmw.2_Missense_Mutation_p.S107L	p.S1342L	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	15	4373	+			1342			Ser-rich.		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	c.4025C>T	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756264	0.89843	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.79	5.79	0.91817	.	0.407510	0.29980	N	0.010714	T	0.64778	0.2629	L	0.36672	1.1	0.80722	D	1	D;D;D;P;D	0.89917	0.996;0.997;0.99;0.584;1.0	P;D;P;B;D	0.77557	0.839;0.968;0.57;0.036;0.99	T	0.56786	-0.7921	10	0.24483	T	0.36	-20.6028	20.04	0.97581	0.0:1.0:0.0:0.0	.	796;1342;796;1321;1342	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	L	1321;1342;1321;796	ENSP00000370630:S1321L;ENSP00000450832:S1342L;ENSP00000351352:S1321L;ENSP00000440682:S796L	ENSP00000351352:S1342L	S	+	2	0	SIPA1L1	71245888	1.000000	0.71417	0.995000	0.50966	0.652000	0.38707	7.487000	0.81328	2.733000	0.93635	0.655000	0.94253	TCG		0.577	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		3	9	0	0	0	0.001984	0	3	9				
TMED10	10972	broad.mit.edu	37	14	75643092	75643092	+	Missense_Mutation	SNP	G	G	A	rs4929		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:75643092G>A	ENST00000303575.4	-	1	242	c.191C>T	c.(190-192)tCt>tTt	p.S64F		NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	64	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.		S -> Y (in dbSNP:rs4929).		beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)	p.S64F(1)		endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		AGCGCCCCCAGACTGGTCGGA	0.652																																							uc001xrm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(190-192)TCT>TTT		transmembrane emp24 domain-containing protein 10							57.0	59.0	58.0					14																	75643092		2203	4300	6503	SO:0001583	missense	10972				protein transport|regulated secretory pathway|vesicle targeting, to, from or within Golgi	cis-Golgi network|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|melanosome|microsome|zymogen granule membrane	protein binding	g.chr14:75643092G>A	AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.191C>T	14.37:g.75643092G>A	ENSP00000303145:p.Ser64Phe		Somatic				TMED10_uc010ash.1_RNA	p.S64F	NM_006827	NP_006818	WXS	Illumina HiSeq	Unspecified	P49755	TMEDA_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0126)	1	258	-			64			Lumenal (Potential).|GOLD.		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	ENST00000303575.4	37	c.191C>T	CCDS9840.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244756	0.79912	.	.	ENSG00000170348	ENST00000303575	T	0.18338	2.22	5.15	5.15	0.70609	GOLD (2);	0.291855	0.33515	N	0.004826	T	0.15435	0.0372	L	0.28608	0.87	0.41646	D	0.989106	B	0.09022	0.002	B	0.15052	0.012	T	0.03068	-1.1076	10	0.62326	D	0.03	-16.1607	15.6604	0.77182	0.0:0.0:1.0:0.0	.	64	P49755	TMEDA_HUMAN	F	64	ENSP00000303145:S64F	ENSP00000303145:S64F	S	-	2	0	TMED10	74712845	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.874000	0.69652	2.683000	0.91414	0.455000	0.32223	TCT		0.652	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827		20	76	0	0	0	0.00278	0	20	76				
UNC79	57578	broad.mit.edu	37	14	94121688	94121688	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:94121688T>A	ENST00000393151.2	+	39	6508	c.6508T>A	c.(6508-6510)Tgg>Agg	p.W2170R	UNC79_ENST00000553484.1_Missense_Mutation_p.W2192R|UNC79_ENST00000256339.4_Missense_Mutation_p.W1993R|UNC79_ENST00000555664.1_Missense_Mutation_p.W2131R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2170					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W1993R(1)|p.W2192R(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TAGTAGCCTCTGGACCACAAT	0.413																																							uc001ybv.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(6043-6045)TGG>AGG		hypothetical protein LOC57578							154.0	151.0	152.0					14																	94121688		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94121688T>A	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6508T>A	14.37:g.94121688T>A	ENSP00000376858:p.Trp2170Arg		Somatic				KIAA1409_uc001ybs.1_Missense_Mutation_p.W1993R	p.W2015R	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	37	6126	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	2170					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.6043T>A		.	.	.	.	.	.	.	.	.	.	T	20.7	4.040713	0.75732	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.56688	0.2002	M	0.74647	2.275	0.58432	D	0.999999	D	0.76494	0.999	D	0.91635	0.999	T	0.61811	-0.6986	10	0.87932	D	0	-10.8561	15.4108	0.74917	0.0:0.0:0.0:1.0	.	2192	C9JQL1	.	R	1993;2131;2192;2170;2192	ENSP00000256339:W1993R;ENSP00000450868:W2131R;ENSP00000451360:W2192R;ENSP00000376858:W2170R	ENSP00000256339:W1993R	W	+	1	0	KIAA1409	93191441	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.040000	0.89188	2.052000	0.61016	0.528000	0.53228	TGG		0.413	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		44	172	0	0	0	0.01441	0	44	172				
DIO3	1735	broad.mit.edu	37	14	102028628	102028628	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr14:102028628G>T	ENST00000510508.4	+	1	941	c.795G>T	c.(793-795)caG>caT	p.Q265H	DIO3OS_ENST00000408206.1_lincRNA|DIO3_ENST00000359323.3_Missense_Mutation_p.Q239H			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	265					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)	p.Q239H(1)|p.Q265H(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				ATGTCATCCAGAGTGGCACTA	0.617																																							uc010txq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(715-717)CAG>CAT		deiodinase, iodothyronine, type III							58.0	65.0	63.0					14																	102028628		2092	4185	6277	SO:0001583	missense	1735				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity	g.chr14:102028628G>T	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.795G>T	14.37:g.102028628G>T	ENSP00000427336:p.Gln265His		Somatic				DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	p.Q239H	NM_001362	NP_001353	WXS	Illumina HiSeq	Unspecified	P55073	IOD3_HUMAN			2	941	+		all_neural(303;0.185)	239			Extracellular (Potential).		G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	37	c.717G>T	CCDS41992.2	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408173	0.62399	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.35789	1.29;1.29	3.86	0.945	0.19543	.	0.215433	0.29053	U	0.013297	T	0.50667	0.1629	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.46652	-0.9176	10	0.54805	T	0.06	.	8.2296	0.31590	0.2735:0.0:0.7265:0.0	.	239	P55073	IOD3_HUMAN	H	239;265	ENSP00000352273:Q239H;ENSP00000427336:Q265H	ENSP00000352273:Q265H	Q	+	3	2	DIO3;AL049836.1	101098381	1.000000	0.71417	0.991000	0.47740	0.951000	0.60555	2.151000	0.42263	0.327000	0.23409	0.462000	0.41574	CAG		0.617	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	NM_001362		9	70	1	0	2.74318e-10	0.006214	3.27595e-10	9	70				
WDR72	256764	broad.mit.edu	37	15	53889352	53889352	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr15:53889352C>T	ENST00000396328.1	-	18	3311	c.3072G>A	c.(3070-3072)atG>atA	p.M1024I	WDR72_ENST00000559418.1_Missense_Mutation_p.M1034I|WDR72_ENST00000360509.5_Missense_Mutation_p.M1024I|WDR72_ENST00000557913.1_Missense_Mutation_p.M1021I	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	1024								p.M1024I(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GCATCTGCTTCATCTCACAGT	0.418																																							uc002acj.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(3070-3072)ATG>ATA		WD repeat domain 72							289.0	249.0	263.0					15																	53889352		2194	4293	6487	SO:0001583	missense	256764							g.chr15:53889352C>T	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.3072G>A	15.37:g.53889352C>T	ENSP00000379619:p.Met1024Ile		Somatic					p.M1024I	NM_182758	NP_877435	WXS	Illumina HiSeq	Unspecified	Q3MJ13	WDR72_HUMAN		all cancers(107;0.0511)	18	3114	-			1024					Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	c.3072G>A	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276059	0.23307	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.34275	1.37;1.37	6.04	4.08	0.47627	.	0.717442	0.13966	N	0.350513	T	0.29491	0.0735	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26710	-1.0095	10	0.19147	T	0.46	.	7.5081	0.27558	0.1629:0.749:0.0:0.0881	.	1024	Q3MJ13	WDR72_HUMAN	I	1024	ENSP00000379619:M1024I;ENSP00000353699:M1024I	ENSP00000353699:M1024I	M	-	3	0	WDR72	51676644	0.000000	0.05858	0.001000	0.08648	0.347000	0.29111	0.224000	0.17738	0.796000	0.33947	0.563000	0.77884	ATG		0.418	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758		39	265	0	0	0	0.007835	0	39	265				
IGFALS	3483	broad.mit.edu	37	16	1838029	1838029	+	IGR	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:1838029G>T	ENST00000215539.3	-	0	2116				NUBP2_ENST00000565134.1_Missense_Mutation_p.G193C|NUBP2_ENST00000543305.1_Missense_Mutation_p.G52C|NUBP2_ENST00000565987.1_Missense_Mutation_p.G133C|NUBP2_ENST00000568706.1_Missense_Mutation_p.G52C|NUBP2_ENST00000262302.9_Missense_Mutation_p.G193C			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit						cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)	p.G193C(1)		endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GAATATGAGCGGCTTCACCTG	0.677																																							uc002cmw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)GGC>TGC		nucleotide binding protein 2 (MinD homolog, E.							83.0	83.0	83.0					16																	1838029		2199	4300	6499	SO:0001628	intergenic_variant	10101					microtubule organizing center|nucleus	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|protein binding	g.chr16:1838029G>T	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638		16.37:g.1838029G>T			Somatic				NUBP2_uc002cmx.3_Missense_Mutation_p.G52C|NUBP2_uc010brx.2_Missense_Mutation_p.G133C	p.G193C	NM_012225	NP_036357	WXS	Illumina HiSeq	Unspecified	Q9Y5Y2	NUBP2_HUMAN			5	666	+			193					B4DZY8|E9PGU3	Missense_Mutation	SNP	ENST00000215539.3	37	c.577G>T	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301231	0.81136	.	.	ENSG00000095906	ENST00000262302;ENST00000543305	T;T	0.44482	0.92;1.44	4.77	3.81	0.43845	.	0.050757	0.85682	D	0.000000	T	0.69205	0.3085	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75141	-0.3422	10	0.72032	D	0.01	-1.467	11.636	0.51204	0.0886:0.0:0.9114:0.0	.	193	Q9Y5Y2	NUBP2_HUMAN	C	193;52	ENSP00000262302:G193C;ENSP00000437763:G52C	ENSP00000262302:G193C	G	+	1	0	NUBP2	1778030	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	6.185000	0.72013	0.998000	0.38996	0.561000	0.74099	GGC		0.677	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250509.2			23	80	1	0	1.22574e-08	0.014323	1.41695e-08	23	80				
TBL3	10607	broad.mit.edu	37	16	2025660	2025660	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:2025660C>T	ENST00000568546.1	+	10	1064	c.936C>T	c.(934-936)gcC>gcT	p.A312A		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	312					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)	p.A312A(1)		breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CCGCCACCGCCGACCACAACC	0.697																																					Melanoma(118;616 1651 35077 38081 48633)	Melanoma(118;616 1651 35077 38081 48633)	uc002cnu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(934-936)GCC>GCT		transducin beta-like 3							31.0	31.0	31.0					16																	2025660		2198	4298	6496	SO:0001819	synonymous_variant	10607				G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity	g.chr16:2025660C>T	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.936C>T	16.37:g.2025660C>T			Somatic				TBL3_uc002cnv.1_Silent_p.A198A|TBL3_uc010bsb.1_Silent_p.A101A|TBL3_uc010bsc.1_Silent_p.A198A|TBL3_uc010uvt.1_5'UTR|TBL3_uc002cnw.1_5'Flank	p.A312A	NM_006453	NP_006444	WXS	Illumina HiSeq	Unspecified	Q12788	TBL3_HUMAN			10	1038	+			312			WD 6.		Q59GD6|Q8IVB7|Q96A78	Silent	SNP	ENST00000568546.1	37	c.936C>T	CCDS10453.1																																																																																				0.697	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	NM_006453		5	35	0	0	0	0.001984	0	5	35				
ZNF263	10127	broad.mit.edu	37	16	3340426	3340426	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:3340426C>G	ENST00000219069.5	+	6	2796	c.1920C>G	c.(1918-1920)ttC>ttG	p.F640L	ZNF263_ENST00000538765.1_Missense_Mutation_p.F288L	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	640					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F640L(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GAGACAGCTTCTCTCACAGCT	0.478																																							uc002cuq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(1918-1920)TTC>TTG		zinc finger protein 263							83.0	84.0	84.0					16																	3340426		2197	4300	6497	SO:0001583	missense	10127				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3340426C>G	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1920C>G	16.37:g.3340426C>G	ENSP00000219069:p.Phe640Leu		Somatic				ZNF263_uc010uww.1_Missense_Mutation_p.F288L|ZNF263_uc002cur.2_Missense_Mutation_p.F288L	p.F640L	NM_005741	NP_005732	WXS	Illumina HiSeq	Unspecified	O14978	ZN263_HUMAN			6	2252	+			640			C2H2-type 8.		B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	c.1920C>G	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689674	0.29962	.	.	ENSG00000006194	ENST00000538765;ENST00000219069	T;T	0.46063	0.88;0.88	5.61	-2.43	0.06522	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.108325	0.41823	D	0.000808	T	0.52853	0.1760	M	0.74647	2.275	0.51767	D	0.999938	D	0.67145	0.996	P	0.56042	0.79	T	0.59731	-0.7399	10	0.66056	D	0.02	.	13.5347	0.61641	0.0:0.5547:0.0:0.4453	.	640	O14978	ZN263_HUMAN	L	288;640	ENSP00000444497:F288L;ENSP00000219069:F640L	ENSP00000219069:F640L	F	+	3	2	ZNF263	3280427	0.000000	0.05858	0.850000	0.33497	0.033000	0.12548	-0.752000	0.04797	-0.576000	0.05974	-1.134000	0.01955	TTC		0.478	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2			15	125	0	0	0	0.004007	0	15	125				
NDE1	54820	broad.mit.edu	37	16	15771720	15771720	+	Silent	SNP	C	C	T	rs189787660		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:15771720C>T	ENST00000396353.2	+	5	1126	c.300C>T	c.(298-300)ctC>ctT	p.L100L	NDE1_ENST00000396354.1_Silent_p.L100L|NDE1_ENST00000396355.1_Silent_p.L100L|NDE1_ENST00000342673.5_Silent_p.L100L			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	100	Interaction with PAFAH1B1. {ECO:0000250}.				centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)	p.L100L(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						AGGATGACCTCGCGCAGACCA	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		21858	0.001		0.0	False		,,,				2504	0.0						uc002ddt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(298-300)CTC>CTT		nuclear distribution gene E homolog 1							109.0	96.0	101.0					16																	15771720		2197	4300	6497	SO:0001819	synonymous_variant	54820				cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding	g.chr16:15771720C>T	AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.300C>T	16.37:g.15771720C>T			Somatic				NDE1_uc010uzy.1_Silent_p.L100L|NDE1_uc002dds.2_Silent_p.L100L	p.L100L	NM_017668	NP_060138	WXS	Illumina HiSeq	Unspecified	Q9NXR1	NDE1_HUMAN			3	343	+			100			Interaction with PAFAH1B1 (By similarity).|Potential.		Q49AQ2	Silent	SNP	ENST00000396353.2	37	c.300C>T																																																																																					0.498	NDE1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017668		24	72	0	0	0	0.014323	0	24	72				
GP2	2813	broad.mit.edu	37	16	20331722	20331722	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:20331722C>T	ENST00000381362.4	-	6	805	c.729G>A	c.(727-729)ctG>ctA	p.L243L	GP2_ENST00000381360.5_Silent_p.L96L|GP2_ENST00000573897.1_5'UTR|GP2_ENST00000341642.5_Silent_p.L93L|GP2_ENST00000302555.5_Silent_p.L240L	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	243	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.			L -> Q (in Ref. 5; BAA07400). {ECO:0000305}.	antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)	p.L240L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CCAGGCCTCCCAGCAAACATT	0.547																																							uc002dgv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(727-729)CTG>CTA		zymogen granule membrane glycoprotein 2 isoform							89.0	76.0	80.0					16																	20331722		2203	4300	6503	SO:0001819	synonymous_variant	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20331722C>T	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.729G>A	16.37:g.20331722C>T			Somatic				GP2_uc002dgw.2_Silent_p.L240L|GP2_uc002dgx.2_Silent_p.L96L|GP2_uc002dgy.2_Silent_p.L93L	p.L243L	NM_001007240	NP_001007241	WXS	Illumina HiSeq	Unspecified	P55259	GP2_HUMAN			6	812	-			243	L -> Q (in Ref. 5; BAA07400).		ZP.		A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	c.729G>A	CCDS42128.1																																																																																				0.547	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		24	66	0	0	0	0.00333	0	24	66				
FUS	2521	broad.mit.edu	37	16	31202719	31202719	+	Splice_Site	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:31202719G>T	ENST00000254108.7	+	15	1646		c.e15-1		FUS_ENST00000380244.3_Splice_Site|FUS_ENST00000568685.1_Splice_Site	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein						cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R514M(1)	FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		tttttttGCAGGGGTGAGCAC	0.468			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																		uc002ebf.2		NA		Dom	yes		16	16p11.2	2521	T	"""fusion, derived from t(12;16) malignant liposarcoma"""			"""M, L"""	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1		liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma	FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	1	Substitution - Missense(1)		lung(1)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958						c.e15-1		fusion (involved in t(12;16) in malignant							69.0	62.0	64.0					16																	31202719		2197	4300	6497	SO:0001630	splice_region_variant	2521				cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding	g.chr16:31202719G>T	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.1542-1G>T	16.37:g.31202719G>T			Somatic				FUS_uc002ebh.2_Splice_Site_p.R513_splice|FUS_uc002ebg.2_Splice_Site_p.R309_splice|FUS_uc002ebi.2_Splice_Site_p.R515_splice|FUS_uc002ebj.2_Splice_Site_p.R310_splice	p.R514_splice	NM_004960	NP_004951	WXS	Illumina HiSeq	Unspecified	P35637	FUS_HUMAN		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)	15	1625	+		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)						Q9H4A8	Splice_Site	SNP	ENST00000254108.7	37	c.1542_splice	CCDS10707.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.721876	0.30503	.	.	ENSG00000089280	ENST00000254108;ENST00000394533	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3818	0.83467	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FUS	31110220	1.000000	0.71417	0.999000	0.59377	0.260000	0.26232	7.998000	0.88491	2.233000	0.73108	0.491000	0.48974	.		0.468	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2	NM_004960	Intron	21	80	1	0	4.47668e-21	0.003954	5.96203e-21	21	80				
NKD1	85407	broad.mit.edu	37	16	50664759	50664759	+	Silent	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:50664759A>C	ENST00000268459.3	+	8	857	c.633A>C	c.(631-633)cgA>cgC	p.R211R		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	211					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R211R(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CAAGGCCCCGAGCAGAGACCA	0.647																																							uc002egg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(631-633)CGA>CGC		naked cuticle homolog 1							39.0	35.0	36.0					16																	50664759		2185	4295	6480	SO:0001819	synonymous_variant	85407				Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding	g.chr16:50664759A>C	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.633A>C	16.37:g.50664759A>C			Somatic					p.R211R	NM_033119	NP_149110	WXS	Illumina HiSeq	Unspecified	Q969G9	NKD1_HUMAN		GBM - Glioblastoma multiforme(240;0.243)	8	857	+		all_cancers(37;0.229)	211					B2RC39|Q8WZ08	Silent	SNP	ENST00000268459.3	37	c.633A>C	CCDS10743.1																																																																																				0.647	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1			4	21	0	0	0	0.00308	0	4	21				
ST3GAL2	6483	broad.mit.edu	37	16	70432107	70432107	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:70432107C>G	ENST00000393640.4	-	1	2434	c.327G>C	c.(325-327)caG>caC	p.Q109H	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.Q109H|ST3GAL2_ENST00000566097.1_5'Flank			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	109					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)	p.Q109H(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				TCCACCACCTCTGGACGTCCG	0.592																																							uc002eyw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(325-327)CAG>CAC		ST3 beta-galactoside alpha-2,3-sialyltransferase							56.0	52.0	53.0					16																	70432107		2198	4300	6498	SO:0001583	missense	6483				amino sugar metabolic process	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity	g.chr16:70432107C>G	U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.327G>C	16.37:g.70432107C>G	ENSP00000377257:p.Gln109His		Somatic				ST3GAL2_uc002eyx.2_Missense_Mutation_p.Q109H	p.Q109H	NM_006927	NP_008858	WXS	Illumina HiSeq	Unspecified	Q16842	SIA4B_HUMAN			1	2435	-		Ovarian(137;0.0694)	109			Lumenal (Potential).		O00654	Missense_Mutation	SNP	ENST00000393640.4	37	c.327G>C	CCDS10890.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.526870	0.64860	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.30448	1.53;1.53	5.32	4.36	0.52297	.	0.171570	0.53938	D	0.000051	T	0.28962	0.0719	L	0.36672	1.1	0.38035	D	0.935298	P	0.47034	0.889	P	0.46758	0.526	T	0.07028	-1.0794	10	0.15952	T	0.53	-13.7427	13.5326	0.61631	0.0:0.9234:0.0:0.0766	.	109	Q16842	SIA4B_HUMAN	H	109	ENSP00000345477:Q109H;ENSP00000377257:Q109H	ENSP00000345477:Q109H	Q	-	3	2	ST3GAL2	68989608	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.729000	0.47327	1.240000	0.43803	0.561000	0.74099	CAG		0.592	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	NM_006927		6	60	0	0	0	0.00308	0	6	60				
PKD1L2	114780	broad.mit.edu	37	16	81181822	81181823	+	RNA	DNP	CC	CC	AA			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr16:81181822_81181823CC>AA	ENST00000525539.1	-	0	4892_4893				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.W1631_D1632>CY(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GACCCCCGGTCCCATTTTCCAG	0.594																																							uc002fgh.1		NA																	1	Complex - compound substitution(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(4891-4896)TGGGAC>TGTTAC		polycystin 1-like 2 isoform a																																						114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81181822_81181823CC>AA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126	ENST00000525539.1:c.4893_4894delinsAA	16.37:g.81181822_81181823delinsAA			Somatic				PKD1L2_uc002fgg.1_RNA	p.1631_1632WD>CY	NM_052892	NP_443124	WXS	Illumina HiSeq	Unspecified	Q7Z442	PK1L2_HUMAN			29	4893_4894	-			1631_1632			Cytoplasmic (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	DNP	ENST00000525539.1	37	c.4893_4894GG>TT																																																																																					0.594	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			7	41	0	0	0	0.004672	0	7	41				
SCARF1	8578	broad.mit.edu	37	17	1549747	1549747	+	5'Flank	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:1549747G>A	ENST00000263071.4	-	0	0				SCARF1_ENST00000574545.1_5'Flank|SCARF1_ENST00000348987.3_5'Flank|SCARF1_ENST00000571272.1_5'Flank|RILP_ENST00000301336.6_Missense_Mutation_p.P399S	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.P399S(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CAGGCCTCTGGGGCGGCTGAG	0.637																																							uc002ftd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1195-1197)CCA>TCA		Rab interacting lysosomal protein							62.0	65.0	64.0					17																	1549747		2203	4300	6503	SO:0001631	upstream_gene_variant	83547				endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding	g.chr17:1549747G>A	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1549747G>A	Exception_encountered		Somatic				SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	p.P399S	NM_031430	NP_113618	WXS	Illumina HiSeq	Unspecified	Q96NA2	RILP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	8	1489	-			399					A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	37	c.1195C>T	CCDS11007.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335440	0.60853	.	.	ENSG00000167705	ENST00000301336	T	0.31247	1.5	4.82	3.84	0.44239	.	.	.	.	.	T	0.22898	0.0553	L	0.34521	1.04	0.09310	N	1	P	0.37781	0.608	B	0.30401	0.115	T	0.09840	-1.0656	9	0.87932	D	0	-2.5162	12.4714	0.55790	0.0:0.1688:0.8312:0.0	.	399	Q96NA2	RILP_HUMAN	S	399	ENSP00000301336:P399S	ENSP00000301336:P399S	P	-	1	0	RILP	1496497	0.004000	0.15560	0.030000	0.17652	0.042000	0.13812	1.306000	0.33505	1.141000	0.42275	0.561000	0.74099	CCA		0.637	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		38	76	0	0	0	0.01441	0	38	76				
GAS7	8522	broad.mit.edu	37	17	9850262	9850262	+	Silent	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:9850262C>G	ENST00000432992.2	-	6	724	c.564G>C	c.(562-564)ccG>ccC	p.P188P	GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000323816.4_Silent_p.P128P|GAS7_ENST00000585266.1_Silent_p.P128P|GAS7_ENST00000583882.1_Silent_p.P48P|GAS7_ENST00000579158.1_Silent_p.P124P|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000437099.2_Silent_p.P124P|GAS7_ENST00000542249.1_Silent_p.P124P|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000580865.1_Silent_p.P48P	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	188					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P188P(2)|p.P48P(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						GCTGCTGTTCCGGCATCGTGT	0.572			T	MLL	AML*																																		uc002gmg.1		NA		Dom	yes		17	17p	8522	T	growth arrest-specific 7			L	MLL		AML*		4	Substitution - coding silent(4)		lung(4)	lung(1)|pancreas(1)	2						c.(562-564)CCG>CCC		growth arrest-specific 7 isoform c							107.0	72.0	84.0					17																	9850262		2203	4300	6503	SO:0001819	synonymous_variant	8522				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity	g.chr17:9850262C>G	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.564G>C	17.37:g.9850262C>G			Somatic				GAS7_uc010vvc.1_Silent_p.P2P|GAS7_uc002gmh.1_Silent_p.P48P|GAS7_uc010vvd.1_Silent_p.P140P|GAS7_uc002gmi.2_Silent_p.P124P|GAS7_uc002gmj.1_Silent_p.P128P|GAS7_uc010coh.1_Silent_p.P128P	p.P188P	NM_201433	NP_958839	WXS	Illumina HiSeq	Unspecified	O60861	GAS7_HUMAN			6	725	-			188					A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Silent	SNP	ENST00000432992.2	37	c.564G>C	CCDS11152.1																																																																																				0.572	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433		21	34	0	0	0	0.004656	0	21	34				
DNAH9	1770	broad.mit.edu	37	17	11757475	11757475	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:11757475C>T	ENST00000262442.4	+	50	9731	c.9663C>T	c.(9661-9663)ttC>ttT	p.F3221F	DNAH9_ENST00000454412.2_Silent_p.F3221F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3221	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.F3221F(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGATGGCTTCCTGGACTCGC	0.542																																							uc002gne.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(9661-9663)TTC>TTT		dynein, axonemal, heavy chain 9 isoform 2							98.0	89.0	92.0					17																	11757475		2203	4300	6503	SO:0001819	synonymous_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11757475C>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9663C>T	17.37:g.11757475C>T			Somatic				DNAH9_uc010coo.2_Silent_p.F2515F	p.F3221F	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	50	9731	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3221			Stalk (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	c.9663C>T	CCDS11160.1																																																																																				0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		25	70	0	0	0	0.005443	0	25	70				
UBBP4	23666	broad.mit.edu	37	17	21730835	21730835	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:21730835C>A	ENST00000578713.1	+	1	141	c.137C>A	c.(136-138)gCa>gAa	p.A46E	UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584398.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.A46E					ubiquitin B pseudogene 4									p.A46E(3)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CTCATCTTTGCAGGCAAGCAG	0.517																																							uc002gyy.3		NA																	3	Substitution - Missense(3)		lung(3)		NA						c.(136-138)GCA>GAA		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21730835C>A	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.137C>A	17.37:g.21730835C>A	ENSP00000464265:p.Ala46Glu		Somatic					p.A46E			WXS	Illumina HiSeq	Unspecified					2	262	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.137C>A																																																																																					0.517	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			14	30	1	0	7.93312e-07	0.00245	8.81797e-07	14	30				
PEX12	5193	broad.mit.edu	37	17	33904426	33904426	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:33904426G>C	ENST00000225873.4	-	2	918	c.311C>G	c.(310-312)gCt>gGt	p.A104G	RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	104					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.A104G(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACCAGCACTAGCCAATCTCTG	0.438																																							uc002hjp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)GCT>GGT		peroxisomal biogenesis factor 12							148.0	166.0	160.0					17																	33904426		2203	4300	6503	SO:0001583	missense	5193				protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding	g.chr17:33904426G>C	U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.311C>G	17.37:g.33904426G>C	ENSP00000225873:p.Ala104Gly		Somatic					p.A104G	NM_000286	NP_000277	WXS	Illumina HiSeq	Unspecified	O00623	PEX12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	927	-			104			Cytoplasmic (Potential).		B2R6M2	Missense_Mutation	SNP	ENST00000225873.4	37	c.311C>G	CCDS11296.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.361429	0.41801	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	D	0.82619	-1.63	5.46	5.46	0.80206	Pex, N-terminal (1);	0.113719	0.64402	D	0.000013	T	0.77405	0.4125	L	0.38175	1.15	0.58432	D	0.999997	B	0.16802	0.019	B	0.19391	0.025	T	0.70930	-0.4738	10	0.20046	T	0.44	-9.2001	18.3052	0.90177	0.0:0.0:1.0:0.0	.	104	O00623	PEX12_HUMAN	G	104	ENSP00000225873:A104G	ENSP00000225873:A104G	A	-	2	0	PEX12	30928539	1.000000	0.71417	0.991000	0.47740	0.414000	0.31173	5.501000	0.66950	2.568000	0.86640	0.650000	0.86243	GCT		0.438	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	NM_000286		19	369	0	0	0	0.010504	0	19	369				
PLXDC1	57125	broad.mit.edu	37	17	37263807	37263807	+	Intron	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:37263807A>G	ENST00000315392.4	-	6	804				PLXDC1_ENST00000444911.2_Intron|PLXDC1_ENST00000539608.1_Intron|PLXDC1_ENST00000493200.1_Intron|PLXDC1_ENST00000394316.2_Intron	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1						angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ACCCGGCTGGACGGGAGATCA	0.577																																							uc002hrf.1		NA																	0					NA						c.(331-333)ACG>GCG		SubName: Full=cDNA FLJ42226 fis, clone THYMU2040824;							43.0	40.0	41.0					17																	37263807		2203	4300	6503	SO:0001627	intron_variant	0							g.chr17:37263807A>G	AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.593-29T>C	17.37:g.37263807A>G			Somatic				PLXDC1_uc002hrg.2_Intron|PLXDC1_uc002hrh.2_Intron|PLXDC1_uc002hri.2_Intron|PLXDC1_uc002hrj.1_Intron|PLXDC1_uc002hrk.1_Intron	p.T111A			WXS	Illumina HiSeq	Unspecified					3	362	+								B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	c.331A>G	CCDS11333.1																																																																																				0.577	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405		3	51	0	0	0	0.009096	0	3	51				
CDK5RAP3	80279	broad.mit.edu	37	17	46054189	46054189	+	Splice_Site	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:46054189G>A	ENST00000338399.4	+	9	1015		c.e9+1		CDK5RAP3_ENST00000536708.2_Splice_Site|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.?(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						AGATTCAAAGGTGAGGAGGCC	0.502																																							uc002imr.2		NA																	1	Unknown(1)		lung(1)		0						c.e9+1		CDK5 regulatory subunit associated protein 3							43.0	43.0	43.0					17																	46054189		1957	4152	6109	SO:0001630	splice_region_variant	80279				brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding	g.chr17:46054189G>A	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.909+1G>A	17.37:g.46054189G>A			Somatic				CDK5RAP3_uc010wlc.1_Splice_Site_p.K323_splice|CDK5RAP3_uc002imq.1_Splice_Site_p.K78_splice|CDK5RAP3_uc002imu.2_Splice_Site_p.K147_splice|CDK5RAP3_uc002ims.2_Splice_Site_p.K216_splice|CDK5RAP3_uc002imv.2_Splice_Site_p.K147_splice|CDK5RAP3_uc002imw.2_Splice_Site_p.K147_splice|CDK5RAP3_uc002imx.2_Splice_Site_p.K78_splice	p.K303_splice	NM_176096	NP_788276	WXS	Illumina HiSeq	Unspecified	Q96JB5	CK5P3_HUMAN			9	993	+								B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Splice_Site	SNP	ENST00000338399.4	37	c.909_splice	CCDS42356.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324483	0.60634	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1776	0.93609	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDK5RAP3	43409188	1.000000	0.71417	0.999000	0.59377	0.439000	0.31926	8.515000	0.90548	2.831000	0.97527	0.655000	0.94253	.		0.502	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	Intron	4	63	0	0	0	0.009096	0	4	63				
B4GALNT2	124872	broad.mit.edu	37	17	47247054	47247054	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:47247054C>T	ENST00000300404.2	+	11	1724	c.1665C>T	c.(1663-1665)ctC>ctT	p.L555L	RP11-708H21.4_ENST00000575159.1_lincRNA|B4GALNT2_ENST00000504681.1_Silent_p.L469L|B4GALNT2_ENST00000393354.2_Silent_p.L495L	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	555					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.L555L(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			AGCTGGCCCTCCACTACTTCA	0.532																																					GBM(124;244 1635 8663 18097 33175)	GBM(124;244 1635 8663 18097 33175)	uc002ion.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1663-1665)CTC>CTT		beta-1,4-N-acetyl-galactosaminyl transferase 2							79.0	66.0	70.0					17																	47247054		2203	4300	6503	SO:0001819	synonymous_variant	124872				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity	g.chr17:47247054C>T	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1665C>T	17.37:g.47247054C>T			Somatic				B4GALNT2_uc010wlt.1_Silent_p.L469L|B4GALNT2_uc010wlu.1_Silent_p.L495L	p.L555L	NM_153446	NP_703147	WXS	Illumina HiSeq	Unspecified	Q8NHY0	B4GN2_HUMAN	all cancers(6;0.000316)		11	1724	+			555			Lumenal (Potential).		B4DZE4|Q14CP1|Q86Y40	Silent	SNP	ENST00000300404.2	37	c.1665C>T	CCDS11544.1																																																																																				0.532	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446		14	37	0	0	0	0.00499	0	14	37				
MYCBPAP	84073	broad.mit.edu	37	17	48603496	48603496	+	Silent	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:48603496T>C	ENST00000323776.5	+	14	2328	c.2166T>C	c.(2164-2166)agT>agC	p.S722S	MYCBPAP_ENST00000436259.2_Silent_p.S685S	NM_032133.4	NP_115509.4			MYCBP associated protein									p.S722S(1)|p.S685S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GGACCAAGAGTCCTCAGCGGA	0.627																																							uc010wmr.1		NA																	2	Substitution - coding silent(2)		lung(2)	urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6						c.(2164-2166)AGT>AGC		Myc-binding protein-associated protein							67.0	64.0	65.0					17																	48603496		2203	4300	6503	SO:0001819	synonymous_variant	84073				cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding	g.chr17:48603496T>C	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.2166T>C	17.37:g.48603496T>C			Somatic				MYCBPAP_uc002iqz.2_RNA	p.S722S	NM_032133	NP_115509	WXS	Illumina HiSeq	Unspecified	Q8TBZ2	MYBPP_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.23e-09)		14	2328	+	Breast(11;1.23e-18)		685						Silent	SNP	ENST00000323776.5	37	c.2166T>C	CCDS32680.2																																																																																				0.627	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133		42	144	0	0	0	0.009718	0	42	144				
DGKE	8526	broad.mit.edu	37	17	54926178	54926178	+	Missense_Mutation	SNP	G	G	A	rs368125102		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:54926178G>A	ENST00000284061.3	+	6	1190	c.1010G>A	c.(1009-1011)cGa>cAa	p.R337Q		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	337	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R337Q(1)		breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					CAGGTTTTGCGAAATGTAATG	0.408																																							uc002iur.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(1009-1011)CGA>CAA		diacylglycerol kinase epsilon		G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	136.0	131.0	133.0		1010	5.6	1.0	17		133	0,8600		0,0,4300	no	missense	DGKE	NM_003647.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	337/568	54926178	1,13005	2203	4300	6503	SO:0001583	missense	8526				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding	g.chr17:54926178G>A	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.1010G>A	17.37:g.54926178G>A	ENSP00000284061:p.Arg337Gln		Somatic				DGKE_uc002ius.1_Missense_Mutation_p.R337Q	p.R337Q	NM_003647	NP_003638	WXS	Illumina HiSeq	Unspecified	P52429	DGKE_HUMAN			6	1190	+	Breast(9;3.59e-07)		337			DAGKc.		Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	ENST00000284061.3	37	c.1010G>A	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584068	0.86748	2.27E-4	0.0	ENSG00000153933	ENST00000284061	T	0.22945	1.93	5.59	5.59	0.84812	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	N	0.16833	0.445	0.80722	D	1	P;P	0.35481	0.504;0.504	B;B	0.34824	0.19;0.19	T	0.04752	-1.0929	10	0.21540	T	0.41	.	19.5907	0.95509	0.0:0.0:1.0:0.0	.	337;337	A1L4Q0;P52429	.;DGKE_HUMAN	Q	337	ENSP00000284061:R337Q	ENSP00000284061:R337Q	R	+	2	0	DGKE	52281177	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.996000	0.70639	2.642000	0.89623	0.563000	0.77884	CGA		0.408	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647		9	195	0	0	0	0.006214	0	9	195				
SCN4A	6329	broad.mit.edu	37	17	62029071	62029071	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:62029071G>T	ENST00000435607.1	-	14	2642	c.2566C>A	c.(2566-2568)Ctc>Atc	p.L856I	SCN4A_ENST00000578147.1_Missense_Mutation_p.L856I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	856					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L856I(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCGAGGCTGAGCATGATGTCC	0.652																																							uc002jds.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(2566-2568)CTC>ATC		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						27.0	28.0	28.0					17																	62029071		1940	4129	6069	SO:0001583	missense	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62029071G>T	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2566C>A	17.37:g.62029071G>T	ENSP00000396320:p.Leu856Ile		Somatic					p.L856I	NM_000334	NP_000325	WXS	Illumina HiSeq	Unspecified	P35499	SCN4A_HUMAN			14	2643	-			856					Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	c.2566C>A	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343613	0.24339	.	.	ENSG00000007314	ENST00000435607	D	0.83506	-1.73	4.58	3.56	0.40772	Sodium ion transport-associated (1);	4.513610	0.00397	N	0.000048	T	0.80523	0.4639	L	0.42245	1.32	0.25719	N	0.985391	B	0.28783	0.222	B	0.30401	0.115	T	0.64740	-0.6336	10	0.37606	T	0.19	.	9.9337	0.41539	0.0:0.0:0.7985:0.2015	.	856	P35499	SCN4A_HUMAN	I	856	ENSP00000396320:L856I	ENSP00000396320:L856I	L	-	1	0	SCN4A	59382803	0.994000	0.37717	0.607000	0.28956	0.233000	0.25261	2.097000	0.41748	2.394000	0.81467	0.455000	0.32223	CTC		0.652	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		4	10	1	0	2.0095e-06	0.001984	2.20816e-06	4	10				
SDK2	54549	broad.mit.edu	37	17	71375670	71375670	+	Missense_Mutation	SNP	C	C	T	rs143525062		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:71375670C>T	ENST00000392650.3	-	35	4781	c.4781G>A	c.(4780-4782)cGg>cAg	p.R1594Q	SDK2_ENST00000388726.3_Missense_Mutation_p.R1575Q	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1594	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R1594Q(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TATCTCGTACCGCCTGTGCTT	0.657																																							uc010dfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(4780-4782)CGG>CAG		sidekick 2		C	GLN/ARG	0,4406		0,0,2203	66.0	48.0	54.0		4781	4.6	0.8	17	dbSNP_134	54	3,8597	3.0+/-9.4	0,3,4297	yes	missense	SDK2	NM_001144952.1	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	1594/2173	71375670	3,13003	2203	4300	6503	SO:0001583	missense	54549				cell adhesion	integral to membrane		g.chr17:71375670C>T	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4781G>A	17.37:g.71375670C>T	ENSP00000376421:p.Arg1594Gln		Somatic				SDK2_uc002jjt.3_Missense_Mutation_p.R734Q|SDK2_uc010dfn.2_Missense_Mutation_p.R1273Q	p.R1594Q	NM_001144952	NP_001138424	WXS	Illumina HiSeq	Unspecified	Q58EX2	SDK2_HUMAN			35	4781	-			1594			Extracellular (Potential).|Fibronectin type-III 10.		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	c.4781G>A	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934543	0.92458	0.0	3.49E-4	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.56275	0.47;0.47;0.47	4.61	4.61	0.57282	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.056823	0.64402	D	0.000001	T	0.45034	0.1322	L	0.35854	1.095	0.58432	D	0.999996	D;B;P	0.56746	0.977;0.145;0.743	B;B;B	0.42087	0.375;0.074;0.375	T	0.40608	-0.9554	10	0.27785	T	0.31	.	17.8103	0.88613	0.0:1.0:0.0:0.0	.	1594;1594;1575	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	Q	1218;1594;1575;751;1594	ENSP00000376421:R1594Q;ENSP00000373378:R1575Q;ENSP00000407098:R751Q	ENSP00000324967:R1594Q	R	-	2	0	SDK2	68887265	1.000000	0.71417	0.772000	0.31596	0.964000	0.63967	7.498000	0.81546	2.275000	0.75901	0.561000	0.74099	CGG		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		15	35	0	0	0	0.00499	0	15	35				
SDK2	54549	broad.mit.edu	37	17	71429966	71429966	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:71429966C>T	ENST00000392650.3	-	10	1217	c.1217G>A	c.(1216-1218)aGa>aAa	p.R406K	SDK2_ENST00000388726.3_Missense_Mutation_p.R406K	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	406	Ig-like C2-type 5.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R406K(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAGGGGGCCTCTGGTGATGTT	0.617																																							uc010dfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1216-1218)AGA>AAA		sidekick 2							46.0	36.0	39.0					17																	71429966		2203	4300	6503	SO:0001583	missense	54549				cell adhesion	integral to membrane		g.chr17:71429966C>T	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1217G>A	17.37:g.71429966C>T	ENSP00000376421:p.Arg406Lys		Somatic				SDK2_uc010dfn.2_Missense_Mutation_p.R85K	p.R406K	NM_001144952	NP_001138424	WXS	Illumina HiSeq	Unspecified	Q58EX2	SDK2_HUMAN			10	1217	-			406			Ig-like C2-type 5.|Extracellular (Potential).		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	c.1217G>A	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	7.279	0.608670	0.14002	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.66280	-0.2;-0.2	4.8	2.78	0.32641	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.283860	0.34802	N	0.003661	T	0.34135	0.0887	N	0.10782	0.045	0.35229	D	0.776739	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.33523	-0.9865	10	0.05959	T	0.93	.	8.8171	0.35002	0.0:0.7548:0.0:0.2452	.	406;406	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	K	30;406;406;406	ENSP00000376421:R406K;ENSP00000373378:R406K	ENSP00000324967:R406K	R	-	2	0	SDK2	68941561	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.708000	0.37899	1.150000	0.42419	0.462000	0.41574	AGA		0.617	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		4	21	0	0	0	0.009096	0	4	21				
KIF19	124602	broad.mit.edu	37	17	72350682	72350682	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:72350682A>T	ENST00000389916.4	+	18	2828	c.2690A>T	c.(2689-2691)gAg>gTg	p.E897V	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	897					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.E897V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CGATCCTTCGAGGTCACCGGG	0.642																																							uc002jkm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2689-2691)GAG>GTG		kinesin family member 19							14.0	18.0	17.0					17																	72350682		1991	4111	6102	SO:0001583	missense	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72350682A>T	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2690A>T	17.37:g.72350682A>T	ENSP00000374566:p.Glu897Val		Somatic					p.E897V	NM_153209	NP_694941	WXS	Illumina HiSeq	Unspecified	Q2TAC6	KIF19_HUMAN			18	2828	+			897					A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	c.2690A>T	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	A	23.1	4.381210	0.82792	.	.	ENSG00000196169	ENST00000389916	T	0.80304	-1.36	5.03	5.03	0.67393	.	.	.	.	.	D	0.87553	0.6206	M	0.61703	1.905	0.52501	D	0.99995	D	0.89917	1.0	D	0.85130	0.997	D	0.88134	0.2840	9	0.54805	T	0.06	.	13.8048	0.63223	1.0:0.0:0.0:0.0	.	897	Q2TAC6	KIF19_HUMAN	V	897	ENSP00000374566:E897V	ENSP00000374566:E897V	E	+	2	0	KIF19	69862277	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.229000	0.78088	1.904000	0.55121	0.454000	0.30748	GAG		0.642	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		3	11	0	0	0	0.009096	0	3	11				
YES1	7525	broad.mit.edu	37	18	743353	743353	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr18:743353G>A	ENST00000584307.1	-	7	957	c.787C>T	c.(787-789)Caa>Taa	p.Q263*	YES1_ENST00000314574.4_Nonsense_Mutation_p.Q263*|YES1_ENST00000577961.1_Nonsense_Mutation_p.Q268*			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	263					blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.Q263*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GCTAGACCTTGAGTCTGAGGT	0.403																																							uc002kky.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|ovary(1)	3						c.(787-789)CAA>TAA		viral oncogene yes-1 homolog 1	Dasatinib(DB01254)						97.0	90.0	93.0					18																	743353		2203	4300	6503	SO:0001587	stop_gained	7525				blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity	g.chr18:743353G>A	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.787C>T	18.37:g.743353G>A	ENSP00000462468:p.Gln263*		Somatic				YES1_uc002kkz.2_Nonsense_Mutation_p.Q263*	p.Q263*	NM_005433	NP_005424	WXS	Illumina HiSeq	Unspecified	P07947	YES_HUMAN			7	1008	-			263					A6NLB3|D3DUH1	Nonsense_Mutation	SNP	ENST00000584307.1	37	c.787C>T	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	G	38	7.209826	0.98136	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8251	0.96614	0.0:0.0:1.0:0.0	.	.	.	.	X	263	.	ENSP00000324740:Q263X	Q	-	1	0	YES1	733353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.737000	0.98831	2.692000	0.91855	0.655000	0.94253	CAA		0.403	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433		31	89	0	0	0	0.012213	0	31	89				
NOL4	8715	broad.mit.edu	37	18	31538324	31538324	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr18:31538324C>G	ENST00000261592.5	-	7	1412	c.1115G>C	c.(1114-1116)gGa>gCa	p.G372A	NOL4_ENST00000535384.1_Missense_Mutation_p.G87A|NOL4_ENST00000589544.1_Missense_Mutation_p.G372A|NOL4_ENST00000535475.1_Missense_Mutation_p.G217A|NOL4_ENST00000269185.4_Missense_Mutation_p.G258A|NOL4_ENST00000538587.1_Missense_Mutation_p.G298A	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	372						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.G372A(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GTCCTCAGCTCCTCGGTCTAC	0.463																																							uc010dmi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1114-1116)GGA>GCA		nucleolar protein 4							254.0	223.0	233.0					18																	31538324		2203	4300	6503	SO:0001583	missense	8715					nucleolus	RNA binding	g.chr18:31538324C>G	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1115G>C	18.37:g.31538324C>G	ENSP00000261592:p.Gly372Ala		Somatic				NOL4_uc010xbs.1_Missense_Mutation_p.G87A|NOL4_uc002kxr.3_Missense_Mutation_p.G208A|NOL4_uc010xbt.1_Missense_Mutation_p.G298A|NOL4_uc010dmh.2_Missense_Mutation_p.G298A|NOL4_uc010xbu.1_Missense_Mutation_p.G372A|NOL4_uc002kxt.3_Missense_Mutation_p.G372A|NOL4_uc010xbv.1_Missense_Mutation_p.G121A|NOL4_uc010xbw.1_Missense_Mutation_p.G258A	p.G372A	NM_003787	NP_003778	WXS	Illumina HiSeq	Unspecified	O94818	NOL4_HUMAN			7	1344	-			372					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	c.1115G>C	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	0.905	-0.720999	0.03182	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	T;T	0.78924	-1.22;-1.22	5.64	4.77	0.60923	.	0.077352	0.56097	D	0.000040	T	0.79673	0.4486	L	0.40543	1.245	0.39443	D	0.967279	P;P;P;B;P;P;B;D	0.76494	0.903;0.942;0.577;0.3;0.587;0.577;0.03;0.999	P;P;B;B;B;B;B;D	0.66497	0.456;0.627;0.269;0.164;0.266;0.269;0.055;0.944	T	0.75659	-0.3241	10	0.02654	T	1	-5.172	15.9768	0.80071	0.136:0.864:0.0:0.0	.	258;121;87;298;372;87;372;217	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	A	372;258;121;87;217;298	ENSP00000445733:G87A;ENSP00000443472:G298A	ENSP00000261592:G372A	G	-	2	0	NOL4	29792322	1.000000	0.71417	0.751000	0.31187	0.072000	0.16883	5.764000	0.68826	1.355000	0.45865	0.557000	0.71058	GGA		0.463	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		56	219	0	0	0	0.01441	0	56	219				
LIPG	9388	broad.mit.edu	37	18	47091826	47091826	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr18:47091826C>G	ENST00000261292.4	+	2	515	c.237C>G	c.(235-237)ttC>ttG	p.F79L	LIPG_ENST00000577628.1_Missense_Mutation_p.F115L|LIPG_ENST00000427224.2_Missense_Mutation_p.F79L|LIPG_ENST00000580036.1_Missense_Mutation_p.F79L	NM_006033.2	NP_006024.1	Q9Y5X9	LIPE_HUMAN	lipase, endothelial	79					cell proliferation (GO:0008283)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|regulation of lipoprotein metabolic process (GO:0050746)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)	extracellular space (GO:0005615)	heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phospholipase activity (GO:0004620)	p.F79L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(2)	18						ACTGCAGTTTCAACATGACAG	0.507																																					Pancreas(126;280 1778 12814 26243 34948)	Pancreas(126;280 1778 12814 26243 34948)	uc002ldv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(235-237)TTC>TTG		endothelial lipase precursor							93.0	88.0	89.0					18																	47091826		2203	4300	6503	SO:0001583	missense	9388				cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity	g.chr18:47091826C>G	AF118767	CCDS11938.1	18q21.1	2006-04-22				ENSG00000101670			6623	protein-coding gene	gene with protein product		603684				10318835, 10192396	Standard	XM_005258390		Approved	EDL	uc002ldv.3	Q9Y5X9		ENST00000261292.4:c.237C>G	18.37:g.47091826C>G	ENSP00000261292:p.Phe79Leu		Somatic				LIPG_uc002ldu.1_Missense_Mutation_p.F79L|LIPG_uc010xdh.1_Missense_Mutation_p.F79L	p.F79L	NM_006033	NP_006024	WXS	Illumina HiSeq	Unspecified	Q9Y5X9	LIPE_HUMAN			2	489	+			79					B0LPG6|Q6P9C8|Q6UW82	Missense_Mutation	SNP	ENST00000261292.4	37	c.237C>G	CCDS11938.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893675	0.52121	.	.	ENSG00000101670	ENST00000261292;ENST00000427224	D;D	0.91996	-2.95;-2.95	5.34	5.34	0.76211	Lipase, N-terminal (1);	0.044254	0.85682	D	0.000000	D	0.92971	0.7763	M	0.80422	2.495	0.54753	D	0.999981	B;B;B	0.18863	0.016;0.016;0.031	B;B;B	0.25291	0.059;0.059;0.057	D	0.90894	0.4763	10	0.87932	D	0	-24.2106	18.6371	0.91383	0.0:1.0:0.0:0.0	.	79;79;79	B4DTR8;Q9Y5X9;Q9Y5X9-2	.;LIPE_HUMAN;.	L	79	ENSP00000261292:F79L;ENSP00000387978:F79L	ENSP00000261292:F79L	F	+	3	2	LIPG	45345824	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	5.942000	0.70203	2.498000	0.84270	0.561000	0.74099	TTC		0.507	LIPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447546.1	NM_006033		7	91	0	0	0	0.008291	0	7	91				
SERPINB3	6317	broad.mit.edu	37	18	61323171	61323171	+	Missense_Mutation	SNP	G	G	A	rs377088096		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr18:61323171G>A	ENST00000283752.5	-	8	1036	c.893C>T	c.(892-894)aCg>aTg	p.T298M	SERPINB3_ENST00000332821.8_Missense_Mutation_p.T246M|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	298					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)	p.T298M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GGTTCTCAACGTGTCCTTGAG	0.488																																							uc002lji.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(892-894)ACG>ATG		serine (or cysteine) proteinase inhibitor, clade		G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	180.0	154.0	163.0		893	-3.2	0.0	18		163	0,8600		0,0,4300	no	missense	SERPINB3	NM_006919.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	298/391	61323171	1,13005	2203	4300	6503	SO:0001583	missense	6317				regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61323171G>A	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.893C>T	18.37:g.61323171G>A	ENSP00000283752:p.Thr298Met		Somatic				SERPINB4_uc002ljg.2_Intron|SERPINB3_uc010dqa.2_Missense_Mutation_p.T246M	p.T298M	NM_006919	NP_008850	WXS	Illumina HiSeq	Unspecified	P29508	SPB3_HUMAN			8	1037	-			298					A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	c.893C>T	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	G	8.978	0.974626	0.18736	2.27E-4	0.0	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.84800	-1.9;-1.9	3.07	-3.17	0.05202	Serpin domain (3);	1.383540	0.04944	N	0.459085	D	0.87732	0.6251	M	0.80746	2.51	0.09310	N	1	B;D	0.55385	0.334;0.971	B;P	0.47941	0.146;0.562	T	0.81123	-0.1076	10	0.66056	D	0.02	.	11.7335	0.51752	0.6699:0.0:0.3301:0.0	.	246;298	P29508-2;P29508	.;SPB3_HUMAN	M	298;246	ENSP00000283752:T298M;ENSP00000329498:T246M	ENSP00000283752:T298M	T	-	2	0	SERPINB3	59474151	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.514000	0.00445	-0.831000	0.04256	-0.403000	0.06358	ACG		0.488	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		25	79	0	0	0	0.003954	0	25	79				
STK11	6794	broad.mit.edu	37	19	1220434	1220434	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:1220434A>C	ENST00000326873.7	+	4	1700	c.527A>C	c.(526-528)gAc>gCc	p.D176A		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> N (in PJS; loss of kinase activity, leading to greatly reduced autophosphorylation; fails to phosphorylate PTEN in vitro; no significant effect on nucleocytoplasmic localization). {ECO:0000269|PubMed:9837816}.|D -> Y (in sporadic cancer; somatic mutation; Loss of kinase activity).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(4)|p.D176A(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCACAAGGACATCAAGCCG	0.657		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		29	Whole gene deletion(20)|Unknown(4)|Deletion - Frameshift(4)|Substitution - Missense(1)	p.0?(19)|p.Y156fs*87(4)|p.?(4)|p.G52_P179del(1)|p.D176Y(1)	cervix(15)|lung(10)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(526-528)GAC>GCC		serine/threonine protein kinase 11							44.0	51.0	49.0					19																	1220434		2101	4240	6341	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220434A>C	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.527A>C	19.37:g.1220434A>C	ENSP00000324856:p.Asp176Ala	TSP Lung(3;<1E-08)	Somatic					p.D176A	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1642	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	176		D -> Y (in sporadic cancer; somatic mutation; Loss of kinase activity).	Protein kinase.	Proton acceptor.	B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.527A>C	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378430	0.82682	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.93019	-3.15	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.093272	0.64402	D	0.000001	D	0.98403	0.9469	H	0.99705	4.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99548	1.0965	10	0.87932	D	0	-57.5296	14.9586	0.71138	1.0:0.0:0.0:0.0	.	176	Q15831	STK11_HUMAN	A	176	ENSP00000324856:D176A	ENSP00000324856:D176A	D	+	2	0	STK11	1171434	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	9.209000	0.95087	2.135000	0.66039	0.459000	0.35465	GAC		0.657	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		4	14	0	0	0	0.000602	0	4	14				
MUC16	94025	broad.mit.edu	37	19	9071203	9071203	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:9071203C>T	ENST00000397910.4	-	3	16446	c.16243G>A	c.(16243-16245)Gcc>Acc	p.A5415T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5417	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A5415T(4)|p.A1048T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGATGCATGGCGGCTTCTGTG	0.498																																							uc002mkp.2		NA																	6	Substitution - Missense(6)		lung(3)|endometrium(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(16243-16245)GCC>ACC		mucin 16							458.0	432.0	441.0					19																	9071203		2099	4233	6332	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9071203C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16243G>A	19.37:g.9071203C>T	ENSP00000381008:p.Ala5415Thr		Somatic					p.A5415T	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	16447	-			5417			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.16243G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.642	-0.073369	0.07184	.	.	ENSG00000181143	ENST00000397910	T	0.20738	2.05	2.2	-4.41	0.03590	.	.	.	.	.	T	0.08582	0.0213	N	0.08118	0	.	.	.	B	0.06786	0.001	B	0.01281	0.0	T	0.27806	-1.0063	8	0.87932	D	0	.	4.1013	0.10015	0.1614:0.3586:0.0:0.48	.	5415	B5ME49	.	T	5415	ENSP00000381008:A5415T	ENSP00000381008:A5415T	A	-	1	0	MUC16	8932203	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.188000	0.01249	-1.724000	0.01373	-2.140000	0.00339	GCC		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		181	389	0	0	0	0.01441	0	181	389				
KEAP1	9817	broad.mit.edu	37	19	10600447	10600447	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:10600447G>A	ENST00000171111.5	-	4	1955	c.1408C>T	c.(1408-1410)Cgt>Tgt	p.R470C	KEAP1_ENST00000393623.2_Missense_Mutation_p.R470C|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	470					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R470C(3)|p.R470S(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TAAAGGAGACGATTGAGGACA	0.557																																							uc002moq.1		NA																	4	Substitution - Missense(4)		lung(4)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1408-1410)CGT>TGT		kelch-like ECH-associated protein 1							74.0	61.0	65.0					19																	10600447		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600447G>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1408C>T	19.37:g.10600447G>A	ENSP00000171111:p.Arg470Cys		Somatic				KEAP1_uc002mop.1_Missense_Mutation_p.R188C|KEAP1_uc002mor.1_Missense_Mutation_p.R470C	p.R470C	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1564	-			470			Kelch 3.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1408C>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867320	0.32977	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.77877	-1.13;-1.13	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.055235	0.64402	D	0.000001	T	0.77598	0.4154	M	0.74647	2.275	0.80722	D	1	P	0.40083	0.702	B	0.39217	0.294	T	0.80473	-0.1367	10	0.72032	D	0.01	.	12.5198	0.56052	0.0:0.0:0.8334:0.1666	.	470	Q14145	KEAP1_HUMAN	C	470	ENSP00000171111:R470C;ENSP00000377245:R470C	ENSP00000171111:R470C	R	-	1	0	KEAP1	10461447	1.000000	0.71417	0.997000	0.53966	0.153000	0.21895	1.138000	0.31491	2.752000	0.94435	0.558000	0.71614	CGT		0.557	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		24	36	0	0	0	0.003954	0	24	36				
B3GNT3	10331	broad.mit.edu	37	19	17922725	17922725	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:17922725G>C	ENST00000318683.6	+	3	1060	c.913G>C	c.(913-915)Gag>Cag	p.E305Q	B3GNT3_ENST00000595387.1_Missense_Mutation_p.E305Q	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	305					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)	p.E305Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						TATGTGTCTGGAGCTTGAGGG	0.622																																							uc002nhk.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(913-915)GAG>CAG		UDP-GlcNAc:betaGal							138.0	122.0	128.0					19																	17922725		2203	4300	6503	SO:0001583	missense	10331				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity	g.chr19:17922725G>C	AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.913G>C	19.37:g.17922725G>C	ENSP00000321874:p.Glu305Gln		Somatic				B3GNT3_uc002nhl.1_Missense_Mutation_p.E305Q|B3GNT3_uc010ebd.1_Missense_Mutation_p.E305Q|B3GNT3_uc010ebe.1_Missense_Mutation_p.E305Q	p.E305Q	NM_014256	NP_055071	WXS	Illumina HiSeq	Unspecified	Q9Y2A9	B3GN3_HUMAN			3	998	+			305			Lumenal (Potential).		B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Missense_Mutation	SNP	ENST00000318683.6	37	c.913G>C	CCDS12364.1	.	.	.	.	.	.	.	.	.	.	G	2.501	-0.315113	0.05422	.	.	ENSG00000179913	ENST00000318683	T	0.44083	0.93	5.23	-4.26	0.03755	.	0.656003	0.14337	N	0.325981	T	0.16128	0.0388	N	0.11201	0.11	0.09310	N	0.999999	B	0.20368	0.044	B	0.22152	0.038	T	0.34254	-0.9836	10	0.08837	T	0.75	.	6.8567	0.24044	0.2821:0.4601:0.2577:0.0	.	305	Q9Y2A9	B3GN3_HUMAN	Q	305	ENSP00000321874:E305Q	ENSP00000321874:E305Q	E	+	1	0	B3GNT3	17783725	0.236000	0.23804	0.022000	0.16811	0.003000	0.03518	0.308000	0.19314	-0.468000	0.06922	-0.258000	0.10820	GAG		0.622	B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466877.1	NM_014256		37	174	0	0	0	0.003755	0	37	174				
ZNF43	7594	broad.mit.edu	37	19	21990838	21990838	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:21990838T>A	ENST00000354959.4	-	4	2170	c.2001A>T	c.(1999-2001)aaA>aaT	p.K667N	ZNF43_ENST00000594012.1_Missense_Mutation_p.K661N|ZNF43_ENST00000595461.1_Missense_Mutation_p.K661N|ZNF43_ENST00000598381.1_Missense_Mutation_p.K661N	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	667					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K667N(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTATCTTATGTTTAGTAAGGG	0.358																																							uc002nqj.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1999-2001)AAA>AAT		zinc finger protein 43							47.0	51.0	49.0					19																	21990838		2173	4283	6456	SO:0001583	missense	7594				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21990838T>A	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2001A>T	19.37:g.21990838T>A	ENSP00000347045:p.Lys667Asn		Somatic				ZNF43_uc010ecv.2_Missense_Mutation_p.K661N|ZNF43_uc002nql.2_Missense_Mutation_p.K661N|ZNF43_uc002nqm.2_Missense_Mutation_p.K661N|ZNF43_uc002nqk.2_Missense_Mutation_p.K597N	p.K667N	NM_003423	NP_003414	WXS	Illumina HiSeq	Unspecified	P17038	ZNF43_HUMAN		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)	4	2131	-		Renal(1328;0.000219)|Hepatocellular(1079;0.121)	667			C2H2-type 18.		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	c.2001A>T	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.652053	0.00785	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.07327	3.2	1.76	0.595	0.17490	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06280	0.0162	L	0.38838	1.175	0.09310	N	0.999999	B	0.12013	0.005	B	0.17979	0.02	T	0.46020	-0.9221	9	0.16420	T	0.52	.	6.9282	0.24426	0.0:0.0:0.4549:0.5451	.	667	P17038	ZNF43_HUMAN	N	666;667	ENSP00000347045:K667N	ENSP00000347045:K667N	K	-	3	2	ZNF43	21782678	0.000000	0.05858	0.001000	0.08648	0.771000	0.43674	-4.911000	0.00171	-0.049000	0.13379	0.254000	0.18369	AAA		0.358	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423		19	45	0	0	0	0.008871	0	19	45				
ZNF681	148213	broad.mit.edu	37	19	23927473	23927473	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:23927473C>T	ENST00000402377.3	-	4	1020	c.879G>A	c.(877-879)caG>caA	p.Q293Q	ZNF681_ENST00000395385.3_Silent_p.Q224Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q224Q(1)|p.Q293Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GGGTTAAGGACTGATTAAAGG	0.383																																							uc002nrk.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(877-879)CAG>CAA		zinc finger protein 681							129.0	131.0	130.0					19																	23927473		2203	4300	6503	SO:0001819	synonymous_variant	148213				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:23927473C>T	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.879G>A	19.37:g.23927473C>T			Somatic				ZNF681_uc002nrl.3_Silent_p.Q224Q|ZNF681_uc002nrj.3_Silent_p.Q224Q	p.Q293Q	NM_138286	NP_612143	WXS	Illumina HiSeq	Unspecified	Q96N22	ZN681_HUMAN			4	1021	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	293			C2H2-type 5; degenerate.		B3KVF7	Silent	SNP	ENST00000402377.3	37	c.879G>A	CCDS12414.2																																																																																				0.383	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286		26	61	0	0	0	0.010818	0	26	61				
RYR1	6261	broad.mit.edu	37	19	39076591	39076591	+	Missense_Mutation	SNP	C	C	A	rs193922895		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:39076591C>A	ENST00000359596.3	+	103	14817	c.14817C>A	c.(14815-14817)gaC>gaA	p.D4939E	RYR1_ENST00000360985.3_Missense_Mutation_p.D4934E|RYR1_ENST00000355481.4_Missense_Mutation_p.D4934E			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4939			D -> E (in MHS1). {ECO:0000269|PubMed:14985404, ECO:0000269|PubMed:16163667}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.D4939E(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGATCATCGACGCTTTTGGTG	0.587																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	GRCh37	CM043571	RYR1	M		c.(14815-14817)GAC>GAA		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						95.0	88.0	90.0					19																	39076591		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39076591C>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14817C>A	19.37:g.39076591C>A	ENSP00000352608:p.Asp4939Glu		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.D4934E	p.D4939E	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		103	14947	+	all_cancers(60;7.91e-06)		4939		D -> E (in MHS1).			Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.14817C>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	7.194	0.592152	0.13812	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98701	-5.08;-5.08;-5.08	4.67	-4.28	0.03732	.	0.000000	0.64402	U	0.000001	D	0.98836	0.9607	M	0.89478	3.035	0.40849	D	0.983737	D;D	0.76494	0.999;0.998	D;P	0.67382	0.951;0.894	D	0.98883	1.0770	10	0.87932	D	0	.	13.9043	0.63823	0.0:0.1466:0.0:0.8534	.	4934;4939	P21817-2;P21817	.;RYR1_HUMAN	E	4939;4934;4934	ENSP00000352608:D4939E;ENSP00000347667:D4934E;ENSP00000354254:D4934E	ENSP00000347667:D4934E	D	+	3	2	RYR1	43768431	0.039000	0.19947	0.930000	0.37139	0.092000	0.18411	-0.784000	0.04633	-0.596000	0.05821	-0.131000	0.14894	GAC		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			21	102	1	0	6.21321e-17	0.00278	8.1619e-17	21	102				
PRKD2	25865	broad.mit.edu	37	19	47207494	47207494	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:47207494C>T	ENST00000291281.4	-	5	1046	c.821G>A	c.(820-822)cGg>cAg	p.R274Q	PRKD2_ENST00000433867.1_Missense_Mutation_p.R274Q|PRKD2_ENST00000595515.1_Missense_Mutation_p.R274Q|PRKD2_ENST00000601806.1_Missense_Mutation_p.R117Q|PRKD2_ENST00000600194.1_Missense_Mutation_p.R117Q			Q9BZL6	KPCD2_HUMAN	protein kinase D2	274					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.R274Q(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AACGGTGGGCCGTGTATAGCT	0.592											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002pfh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7						c.(820-822)CGG>CAG		protein kinase D2 isoform A							149.0	135.0	140.0					19																	47207494		2203	4300	6503	SO:0001583	missense	25865				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity	g.chr19:47207494C>T	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.821G>A	19.37:g.47207494C>T	ENSP00000291281:p.Arg274Gln		Somatic	OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	945	PRKD2_uc002pfg.2_Missense_Mutation_p.R117Q|PRKD2_uc002pfi.2_Missense_Mutation_p.R274Q|PRKD2_uc002pfj.2_Missense_Mutation_p.R274Q|PRKD2_uc010xye.1_Missense_Mutation_p.R274Q|PRKD2_uc002pfk.2_Missense_Mutation_p.R117Q	p.R274Q	NM_001079881	NP_001073350	WXS	Illumina HiSeq	Unspecified	Q9BZL6	KPCD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)	6	1163	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	274			Phorbol-ester/DAG-type 2.		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	c.821G>A	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	34	5.405082	0.96051	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	D;D	0.92249	-3.0;-3.0	5.18	5.18	0.71444	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.178892	0.35936	N	0.002885	D	0.93226	0.7842	L	0.37897	1.145	0.52099	D	0.99994	D;D	0.65815	0.991;0.995	P;P	0.62491	0.861;0.903	D	0.93113	0.6518	10	0.46703	T	0.11	-45.0909	17.8348	0.88693	0.0:1.0:0.0:0.0	.	274;274	E7ER94;Q9BZL6	.;KPCD2_HUMAN	Q	274	ENSP00000291281:R274Q;ENSP00000393978:R274Q	ENSP00000291281:R274Q	R	-	2	0	PRKD2	51899334	1.000000	0.71417	0.999000	0.59377	0.873000	0.50193	7.426000	0.80270	2.579000	0.87056	0.448000	0.29417	CGG		0.592	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457		6	72	0	0	0	0.004482	0	6	72				
ARHGAP35	2909	broad.mit.edu	37	19	47422497	47422497	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:47422497G>A	ENST00000404338.3	+	1	565	c.565G>A	c.(565-567)Gca>Aca	p.A189T		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	189					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.A189T(2)									CAATCAGCTTGCAAAAACAAA	0.418																																							uc010ekv.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(565-567)GCA>ACA		glucocorticoid receptor DNA binding factor 1							91.0	86.0	88.0					19																	47422497		1897	4107	6004	SO:0001583	missense	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47422497G>A	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.565G>A	19.37:g.47422497G>A	ENSP00000385720:p.Ala189Thr		Somatic					p.A189T	NM_004491	NP_004482	WXS	Illumina HiSeq	Unspecified	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	1	565	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	189					A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	c.565G>A	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513515	0.27123	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.76709	-1.04	5.76	5.76	0.90799	.	0.099518	0.64402	D	0.000002	T	0.74604	0.3738	M	0.65975	2.015	0.58432	D	0.999995	B	0.09022	0.002	B	0.10450	0.005	T	0.68017	-0.5520	10	0.27082	T	0.32	-14.304	12.7899	0.57528	0.0787:0.0:0.9213:0.0	.	189	Q9NRY4-2	.	T	189	ENSP00000385720:A189T	ENSP00000324820:A189T	A	+	1	0	ARHGAP35	52114337	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.438000	0.52871	2.736000	0.93811	0.655000	0.94253	GCA		0.418	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		30	43	0	0	0	0.009535	0	30	43				
HSD17B14	51171	broad.mit.edu	37	19	49316528	49316528	+	Silent	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:49316528C>A	ENST00000263278.4	-	9	983	c.717G>T	c.(715-717)acG>acT	p.T239T	BCAT2_ENST00000316273.6_5'Flank|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000402551.1_5'Flank|BCAT2_ENST00000597011.1_5'Flank|HSD17B14_ENST00000599157.1_Silent_p.T215T|BCAT2_ENST00000599246.1_5'Flank|BCAT2_ENST00000598162.1_5'Flank|BCAT2_ENST00000545387.2_5'Flank	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	239					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)	p.T239T(1)		large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		GTTCAATGCCCGTGCAGAAGT	0.667																																							uc002pkv.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(715-717)ACG>ACT		dehydrogenase/reductase (SDR family) member 10							24.0	22.0	22.0					19																	49316528		2199	4293	6492	SO:0001819	synonymous_variant	51171				steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity	g.chr19:49316528C>A	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.717G>T	19.37:g.49316528C>A			Somatic				BCAT2_uc002pkq.3_5'Flank|BCAT2_uc002pkr.2_5'Flank|BCAT2_uc002pks.2_5'Flank|BCAT2_uc002pkt.2_5'Flank|BCAT2_uc010emh.1_5'Flank|BCAT2_uc010emi.1_5'Flank|BCAT2_uc010emj.1_5'Flank|HSD17B14_uc010emk.1_Missense_Mutation_p.R207L	p.T239T	NM_016246	NP_057330	WXS	Illumina HiSeq	Unspecified	Q9BPX1	DHB14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)	9	983	-		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	239					Q9UKU3	Silent	SNP	ENST00000263278.4	37	c.717G>T	CCDS12736.1																																																																																				0.667	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466212.1	NM_016246		4	7	1	0	2.56e-06	0.009096	2.80242e-06	4	7				
MYADM	91663	broad.mit.edu	37	19	54377186	54377186	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:54377186G>C	ENST00000391769.2	+	3	683	c.403G>C	c.(403-405)Gac>Cac	p.D135H	MYADM_ENST00000391768.2_Missense_Mutation_p.D135H|MYADM_ENST00000336967.3_Missense_Mutation_p.D135H|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391770.4_Missense_Mutation_p.D135H|MYADM_ENST00000391771.1_Missense_Mutation_p.D135H	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	135	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.D135H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CCGTTCGCGGGACCACGCCAT	0.662																																							uc002qcl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(403-405)GAC>CAC		myeloid-associated differentiation marker							78.0	77.0	77.0					19																	54377186		2203	4300	6503	SO:0001583	missense	91663					integral to membrane		g.chr19:54377186G>C	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.403G>C	19.37:g.54377186G>C	ENSP00000375649:p.Asp135His		Somatic				MYADM_uc002qcm.2_Missense_Mutation_p.D135H|MYADM_uc002qcn.2_Missense_Mutation_p.D135H|MYADM_uc002qco.2_Missense_Mutation_p.D135H|MYADM_uc002qcp.2_Missense_Mutation_p.D135H	p.D135H	NM_001020820	NP_001018656	WXS	Illumina HiSeq	Unspecified	Q96S97	MYADM_HUMAN		GBM - Glioblastoma multiforme(134;0.0488)	3	551	+	Ovarian(34;0.19)		135			MARVEL 1.		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	c.403G>C	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656972	0.29425	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000391769;ENST00000391768;ENST00000414489	T;T;T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75	4.21	2.04	0.26737	Marvel (1);MARVEL-like domain (1);	0.277387	0.32093	N	0.006591	T	0.23370	0.0565	L	0.61036	1.89	0.25619	N	0.986411	B	0.30068	0.267	B	0.31290	0.127	T	0.13980	-1.0489	10	0.40728	T	0.16	-23.1936	6.596	0.22674	0.3105:0.0:0.6895:0.0	.	135	Q96S97	MYADM_HUMAN	H	135	ENSP00000398269:D135H;ENSP00000337222:D135H;ENSP00000375650:D135H;ENSP00000399722:D135H;ENSP00000416919:D135H;ENSP00000375651:D135H;ENSP00000375649:D135H;ENSP00000375648:D135H;ENSP00000404958:D135H	ENSP00000337222:D135H	D	+	1	0	MYADM	59068998	0.998000	0.40836	0.683000	0.30040	0.569000	0.35902	3.263000	0.51546	0.369000	0.24510	0.313000	0.20887	GAC		0.662	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		21	63	0	0	0	0.004656	0	21	63				
LENG8	114823	broad.mit.edu	37	19	54963275	54963275	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:54963275C>T	ENST00000326764.5	+	3	523	c.44C>T	c.(43-45)tCt>tTt	p.S15F	LENG8_ENST00000376514.2_Missense_Mutation_p.S15F	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	0								p.S15F(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGCAGGTCTTCTCAGTACAGC	0.602																																							uc002qfv.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(43-45)TCT>TTT		RecName: Full=Leukocyte receptor cluster member 8;							80.0	78.0	79.0					19																	54963275		2203	4300	6503	SO:0001583	missense	114823						protein binding	g.chr19:54963275C>T	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.44C>T	19.37:g.54963275C>T	ENSP00000318374:p.Ser15Phe		Somatic				LENG8_uc002qfw.2_Missense_Mutation_p.S15F	p.S15F			WXS	Illumina HiSeq	Unspecified	Q96PV6	LENG8_HUMAN		GBM - Glioblastoma multiforme(193;0.139)	3	188	+	Ovarian(34;0.19)		15					B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	ENST00000326764.5	37	c.44C>T	CCDS12894.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825826	0.50739	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000439657;ENST00000376514;ENST00000376526;ENST00000443957;ENST00000431846	T;T;T;T	0.48836	1.37;0.8;1.33;1.34	4.91	4.91	0.64330	.	0.425449	0.23483	N	0.047693	T	0.44456	0.1294	L	0.36672	1.1	0.26381	N	0.976732	B;D	0.54207	0.115;0.965	B;P	0.48141	0.176;0.568	T	0.43621	-0.9380	10	0.72032	D	0.01	-13.1979	11.1291	0.48336	0.1844:0.8156:0.0:0.0	.	15;15	Q96PV6-2;F8W9Q9	.;.	F	15	ENSP00000318374:S15F;ENSP00000399507:S15F;ENSP00000365709:S15F;ENSP00000388053:S15F	ENSP00000301196:S15F	S	+	2	0	LENG8	59655087	0.313000	0.24554	0.999000	0.59377	0.938000	0.57974	2.141000	0.42168	2.455000	0.83008	0.561000	0.74099	TCT		0.602	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925		20	57	0	0	0	0.00278	0	20	57				
SNTG2	54221	broad.mit.edu	37	2	1093936	1093936	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:1093936A>G	ENST00000308624.5	+	3	394	c.265A>G	c.(265-267)Aag>Gag	p.K89E	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	89	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.K89E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CCTGAGTATAAAGGTATGGAA	0.388																																							uc002qwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)	3						c.(265-267)AAG>GAG		syntrophin, gamma 2							229.0	233.0	231.0					2																	1093936		1850	4093	5943	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1093936A>G	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.265A>G	2.37:g.1093936A>G	ENSP00000311837:p.Lys89Glu		Somatic				SNTG2_uc002qwp.2_RNA|SNTG2_uc010ewi.2_Intron	p.K89E	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	3	393	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	89			PDZ.		Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.265A>G	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.536552	0.65085	.	.	ENSG00000172554	ENST00000308624	T	0.29655	1.56	4.68	4.68	0.58851	PDZ/DHR/GLGF (4);	0.104975	0.64402	D	0.000005	T	0.50343	0.1610	L	0.58925	1.835	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.53121	-0.8483	10	0.87932	D	0	.	12.3811	0.55307	1.0:0.0:0.0:0.0	.	89	Q9NY99	SNTG2_HUMAN	E	89	ENSP00000311837:K89E	ENSP00000311837:K89E	K	+	1	0	SNTG2	1083936	1.000000	0.71417	0.997000	0.53966	0.417000	0.31264	7.035000	0.76517	1.723000	0.51488	0.460000	0.39030	AAG		0.388	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		76	242	0	0	0	0.01441	0	76	242				
ROCK2	9475	broad.mit.edu	37	2	11484135	11484135	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:11484135A>T	ENST00000315872.6	-	1	576	c.128T>A	c.(127-129)gTg>gAg	p.V43E	ROCK2_ENST00000462366.1_Intron	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	43					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)	p.V43E(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CAAGCTCTCCACGTTGATGGG	0.726																																							uc002rbd.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(2)|skin(2)	4						c.(127-129)GTG>GAG		Rho-associated, coiled-coil containing protein							27.0	32.0	31.0					2																	11484135		1969	4146	6115	SO:0001583	missense	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11484135A>T	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.128T>A	2.37:g.11484135A>T	ENSP00000317985:p.Val43Glu		Somatic					p.V43E	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	1	577	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		43					Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	c.128T>A	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186101	0.57909	.	.	ENSG00000134318	ENST00000315872	T	0.65178	-0.14	3.43	3.43	0.39272	.	0.109367	0.36893	U	0.002357	T	0.56062	0.1960	M	0.64997	1.995	0.80722	D	1	B	0.32245	0.361	B	0.31337	0.128	T	0.57370	-0.7823	10	0.40728	T	0.16	.	10.299	0.43642	1.0:0.0:0.0:0.0	.	43	O75116	ROCK2_HUMAN	E	43	ENSP00000317985:V43E	ENSP00000261535:V43E	V	-	2	0	ROCK2	11401586	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.555000	0.45854	1.409000	0.46915	0.379000	0.24179	GTG		0.726	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			13	23	0	0	0	0.004007	0	13	23				
ETAA1	54465	broad.mit.edu	37	2	67632126	67632126	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:67632126C>G	ENST00000272342.5	+	5	2442	c.2312C>G	c.(2311-2313)cCa>cGa	p.P771R	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	771			P -> S (in dbSNP:rs3770655). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)		p.P771R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TTGGTTCTTCCAGGAAGTTCA	0.318																																							uc002sdz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(2311-2313)CCA>CGA		ETAA16 protein							45.0	47.0	46.0					2																	67632126		2202	4299	6501	SO:0001583	missense	54465					cytoplasm|nucleus		g.chr2:67632126C>G	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2312C>G	2.37:g.67632126C>G	ENSP00000272342:p.Pro771Arg		Somatic					p.P771R	NM_019002	NP_061875	WXS	Illumina HiSeq	Unspecified	Q9NY74	ETAA1_HUMAN			5	2451	+			771					Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	c.2312C>G	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	C	4.581	0.108008	0.08780	.	.	ENSG00000143971	ENST00000272342	T	0.16324	2.35	5.83	-1.01	0.10169	.	1.402030	0.04371	N	0.359154	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.33777	-0.9855	10	0.45353	T	0.12	5.3941	3.833	0.08882	0.1195:0.3999:0.3407:0.1399	.	771	Q9NY74	ETAA1_HUMAN	R	771	ENSP00000272342:P771R	ENSP00000272342:P771R	P	+	2	0	ETAA1	67485630	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.266000	0.08631	0.072000	0.16694	0.655000	0.94253	CCA		0.318	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		7	38	0	0	0	0.001984	0	7	38				
DCTN1	1639	broad.mit.edu	37	2	74590188	74590189	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:74590188_74590189CT>AA	ENST00000361874.3	-	29	3778_3779	c.3461_3462AG>TT	c.(3460-3462)cAG>cTT	p.Q1154L	DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000394003.3_Missense_Mutation_p.Q1147L|DCTN1_ENST00000409438.1_Missense_Mutation_p.Q1015L|RP11-287D1.3_ENST00000451608.2_Missense_Mutation_p.Q67L|DCTN1_ENST00000409868.1_Missense_Mutation_p.Q1132L|DCTN1_ENST00000407639.2_Missense_Mutation_p.Q1020L|DCTN1_ENST00000409240.1_Missense_Mutation_p.Q1112L|DCTN1_ENST00000409567.3_Missense_Mutation_p.Q1129L	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	1154					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.Q1154L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TCTCCAGCAGCTGGCTGGTCTT	0.54																																							uc002skx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(3460-3462)CAG>CTT		dynactin 1 isoform 1																																				SO:0001583	missense	1639				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding	g.chr2:74590188_74590189CT>AA		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.3461_3462delinsAA	2.37:g.74590188_74590189delinsAA	ENSP00000354791:p.Gln1154Leu		Somatic				SLC4A5_uc002skl.2_RNA|DCTN1_uc002skt.1_Missense_Mutation_p.Q88L|DCTN1_uc002skv.2_Missense_Mutation_p.Q1020L|DCTN1_uc002sku.2_Missense_Mutation_p.Q1015L|DCTN1_uc002skw.1_Missense_Mutation_p.Q1130L|DCTN1_uc010ffd.2_Missense_Mutation_p.Q1129L|DCTN1_uc002sky.2_Missense_Mutation_p.Q1112L	p.Q1154L	NM_004082	NP_004073	WXS	Illumina HiSeq	Unspecified	Q14203	DCTN1_HUMAN			29	3772_3773	-			1154					A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	DNP	ENST00000361874.3	37	c.3461_3462AG>TT	CCDS1939.1																																																																																				0.540	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082		25	55	0	0	0	0.004672	0	25	55				
SEMA4F	10505	broad.mit.edu	37	2	74903002	74903002	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:74903002G>T	ENST00000357877.2	+	12	1758	c.1609G>T	c.(1609-1611)Gat>Tat	p.D537Y	SEMA4F_ENST00000339773.5_Missense_Mutation_p.D382Y|SEMA4F_ENST00000473350.1_3'UTR	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	537	PSI.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.D537Y(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CTTCCGGCTGGATGAGTGTGT	0.582																																							uc002sna.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1609-1611)GAT>TAT		semaphorin W precursor							74.0	70.0	71.0					2																	74903002		2203	4300	6503	SO:0001583	missense	10505				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity	g.chr2:74903002G>T	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1609G>T	2.37:g.74903002G>T	ENSP00000350547:p.Asp537Tyr		Somatic				SEMA4F_uc010ffq.1_Missense_Mutation_p.D504Y|SEMA4F_uc010ffr.1_Missense_Mutation_p.D149Y|SEMA4F_uc002snb.1_Missense_Mutation_p.D149Y|SEMA4F_uc002snc.1_Missense_Mutation_p.D382Y	p.D537Y	NM_004263	NP_004254	WXS	Illumina HiSeq	Unspecified	O95754	SEM4F_HUMAN			12	1720	+			537			PSI.|Extracellular (Potential).		Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	c.1609G>T	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	G	1.988	-0.432537	0.04669	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.17370	2.28;2.28	4.38	1.19	0.21007	.	0.531595	0.14582	U	0.310782	T	0.08846	0.0219	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.12156	0.007;0.001	T	0.27536	-1.0071	10	0.52906	T	0.07	.	1.8545	0.03176	0.1205:0.2077:0.4583:0.2136	.	382;537	O95754-2;O95754	.;SEM4F_HUMAN	Y	537;382	ENSP00000350547:D537Y;ENSP00000342675:D382Y	ENSP00000342675:D382Y	D	+	1	0	SEMA4F	74756510	0.002000	0.14202	0.047000	0.18901	0.371000	0.29859	1.119000	0.31258	0.449000	0.26747	-0.470000	0.05040	GAT		0.582	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263		28	73	1	0	1.08312e-15	0.009535	1.41001e-15	28	73				
VWA3B	200403	broad.mit.edu	37	2	98851134	98851134	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:98851134A>G	ENST00000477737.1	+	17	2536	c.2332A>G	c.(2332-2334)Aga>Gga	p.R778G		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	778								p.R778G(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CAGCCTGCTCAGAAGCCAGAT	0.473																																							uc002syo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(1)	6						c.(2332-2334)AGA>GGA		von Willebrand factor A domain containing 3B							79.0	82.0	81.0					2																	98851134		1979	4164	6143	SO:0001583	missense	200403							g.chr2:98851134A>G	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2332A>G	2.37:g.98851134A>G	ENSP00000417955:p.Arg778Gly		Somatic				VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.R297G|VWA3B_uc002sym.2_Missense_Mutation_p.R778G|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.R435G|VWA3B_uc002syp.1_Missense_Mutation_p.R170G|VWA3B_uc002syq.1_Missense_Mutation_p.R54G|VWA3B_uc002syr.1_Missense_Mutation_p.R95G|VWA3B_uc010fih.1_5'Flank	p.R778G	NM_144992	NP_659429	WXS	Illumina HiSeq	Unspecified	Q502W6	VWA3B_HUMAN			17	2596	+			778					B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	c.2332A>G	CCDS42718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.02|18.02	3.531247|3.531247	0.64972|0.64972	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000473149|ENST00000477737	.|T	.|0.19806	.|2.12	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	.|0.230840	.|0.30676	.|N	.|0.009101	T|T	0.38506|0.38506	0.1043|0.1043	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|P;B;D;D	.|0.71674	.|0.906;0.011;0.996;0.998	.|P;B;D;D	.|0.63877	.|0.677;0.009;0.919;0.919	T|T	0.19484|0.19484	-1.0304|-1.0304	5|10	.|0.87932	.|D	.|0	.|.	11.3674|11.3674	0.49679|0.49679	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|170;778;778;778	.|Q502W6-5;Q502W6;Q502W6-8;Q502W6-6	.|.;VWA3B_HUMAN;.;.	R|G	188|778	.|ENSP00000417955:R778G	.|ENSP00000417955:R778G	Q|R	+|+	2|1	0|2	VWA3B|VWA3B	98217566|98217566	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.458000|0.458000	0.32498|0.32498	4.528000|4.528000	0.60580|0.60580	1.990000|1.990000	0.58119|0.58119	0.397000|0.397000	0.26171|0.26171	CAG|AGA		0.473	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		18	60	0	0	0	0.008871	0	18	60				
SLC9A2	6549	broad.mit.edu	37	2	103281707	103281707	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:103281707G>T	ENST00000233969.2	+	3	1044	c.902G>T	c.(901-903)cGa>cTa	p.R301L		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	301					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.R301L(1)		breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TTTACTACTCGATTCACCCAT	0.448																																							uc002tca.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|skin(3)|breast(2)	8						c.(901-903)CGA>CTA		solute carrier family 9 (sodium/hydrogen							210.0	190.0	197.0					2																	103281707		2203	4300	6503	SO:0001583	missense	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103281707G>T		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.902G>T	2.37:g.103281707G>T	ENSP00000233969:p.Arg301Leu		Somatic					p.R301L	NM_003048	NP_003039	WXS	Illumina HiSeq	Unspecified	Q9UBY0	SL9A2_HUMAN			3	1044	+			301			Cytoplasmic (Potential).		B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	c.902G>T	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	G	34	5.404384	0.96051	.	.	ENSG00000115616	ENST00000233969	T	0.19250	2.16	5.6	5.6	0.85130	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.51973	-0.8637	10	0.87932	D	0	.	19.9773	0.97314	0.0:0.0:1.0:0.0	.	301	Q9UBY0	SL9A2_HUMAN	L	301	ENSP00000233969:R301L	ENSP00000233969:R301L	R	+	2	0	SLC9A2	102648139	1.000000	0.71417	0.500000	0.27589	0.983000	0.72400	9.790000	0.99075	2.797000	0.96272	0.650000	0.86243	CGA		0.448	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			26	106	1	0	0.00395357	0.003954	0.00412485	26	106				
CLASP1	23332	broad.mit.edu	37	2	122363412	122363412	+	Silent	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:122363412T>A	ENST00000263710.4	-	2	449	c.60A>T	c.(58-60)cgA>cgT	p.R20R	CLASP1_ENST00000455322.2_Silent_p.R20R|CLASP1_ENST00000541377.1_Silent_p.R20R|Y_RNA_ENST00000410535.1_RNA|CLASP1_ENST00000397587.3_Silent_p.R20R|CLASP1_ENST00000409078.3_Silent_p.R20R	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	20					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)	p.R20R(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CAACCTGCAATCGTTTCCCCA	0.493																																							uc002tnc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(58-60)CGA>CGT		CLIP-associating protein 1 isoform 1							144.0	145.0	144.0					2																	122363412		2046	4176	6222	SO:0001819	synonymous_variant	23332				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding	g.chr2:122363412T>A	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.60A>T	2.37:g.122363412T>A			Somatic				CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Silent_p.R20R|CLASP1_uc010yza.1_Silent_p.R20R|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Silent_p.R20R	p.R20R	NM_015282	NP_056097	WXS	Illumina HiSeq	Unspecified	Q7Z460	CLAP1_HUMAN			2	450	-	Renal(3;0.0496)		20					B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Silent	SNP	ENST00000263710.4	37	c.60A>T																																																																																					0.493	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282		29	69	0	0	0	0.00632	0	29	69				
KCNJ3	3760	broad.mit.edu	37	2	155711649	155711649	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:155711649C>T	ENST00000295101.2	+	3	1807	c.1330C>T	c.(1330-1332)Ccg>Tcg	p.P444S		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	444					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.P444S(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	AAGTTCAGTTCCGGGCAACTC	0.423																																							uc002tyv.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1330-1332)CCG>TCG		potassium inwardly-rectifying channel J3	Halothane(DB01159)						57.0	63.0	61.0					2																	155711649		2203	4299	6502	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711649C>T	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1330C>T	2.37:g.155711649C>T	ENSP00000295101:p.Pro444Ser		Somatic				KCNJ3_uc010zce.1_3'UTR	p.P444S	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			3	1525	+			444			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.1330C>T	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290607	0.40494	.	.	ENSG00000162989	ENST00000295101	D	0.88896	-2.44	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	N	0.11560	0.145	0.80722	D	1	B	0.12013	0.005	B	0.04013	0.001	T	0.73588	-0.3935	10	0.15066	T	0.55	.	19.3906	0.94581	0.0:1.0:0.0:0.0	.	444	P48549	IRK3_HUMAN	S	444	ENSP00000295101:P444S	ENSP00000295101:P444S	P	+	1	0	KCNJ3	155419895	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.827000	0.97445	0.650000	0.86243	CCG		0.423	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		17	83	0	0	0	0.007413	0	17	83				
TTN	7273	broad.mit.edu	37	2	179610711	179610711	+	Intron	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:179610711A>G	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Silent_p.D5472D|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTTCAGAATCTCCCATGG	0.393																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16414-16416)GAT>GAC		titin isoform novex-3							111.0	109.0	110.0					2																	179610711		2203	4300	6503	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179610711A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4063T>C	2.37:g.179610711A>G			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.D5472D	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	16640	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.16416T>C																																																																																					0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	186	0	0	0	0.009096	0	4	186				
ZNF804A	91752	broad.mit.edu	37	2	185803192	185803192	+	Silent	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:185803192C>A	ENST00000302277.6	+	4	3663	c.3069C>A	c.(3067-3069)atC>atA	p.I1023I		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1023							metal ion binding (GO:0046872)	p.I1023I(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CTGAGCAAATCCTGGCTCCAT	0.413																																							uc002uph.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(3067-3069)ATC>ATA		zinc finger protein 804A							87.0	83.0	85.0					2																	185803192		2203	4300	6503	SO:0001819	synonymous_variant	91752					intracellular	zinc ion binding	g.chr2:185803192C>A	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3069C>A	2.37:g.185803192C>A			Somatic					p.I1023I	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	3663	+			1023					A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	c.3069C>A	CCDS2291.1																																																																																				0.413	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		46	146	1	0	8.72198e-27	0.01441	1.19462e-26	46	146				
ORC2	4999	broad.mit.edu	37	2	201785052	201785052	+	Silent	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:201785052A>C	ENST00000234296.2	-	15	1608	c.1359T>G	c.(1357-1359)ccT>ccG	p.P453P		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	453					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)	p.P453P(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						CTTCAGTATAAGGACTGTATG	0.413																																							uc002uwr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1357-1359)CCT>CCG		origin recognition complex, subunit 2							111.0	115.0	114.0					2																	201785052		2203	4300	6503	SO:0001819	synonymous_variant	4999				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding	g.chr2:201785052A>C		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1359T>G	2.37:g.201785052A>C			Somatic				ORC2L_uc010zhj.1_Silent_p.P453P	p.P453P	NM_006190	NP_006181	WXS	Illumina HiSeq	Unspecified	Q13416	ORC2_HUMAN			15	1616	-			453					Q13204|Q53TX5	Silent	SNP	ENST00000234296.2	37	c.1359T>G	CCDS2334.1																																																																																				0.413	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190		7	80	0	0	0	0.004482	0	7	80				
CASP8	841	broad.mit.edu	37	2	202149749	202149749	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:202149749C>G	ENST00000432109.2	+	9	1202	c.1013C>G	c.(1012-1014)tCt>tGt	p.S338C	CASP8_ENST00000264274.9_Missense_Mutation_p.S254C|CASP8_ENST00000358485.4_Missense_Mutation_p.S397C|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Missense_Mutation_p.S355C|CASP8_ENST00000323492.7_Missense_Mutation_p.S323C	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	338					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.S355C(2)|p.S397C(1)|p.S355F(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GAGCTGACATCTCAGTTCACT	0.478										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	Melanoma(82;831 1348 20716 36952 40159)	uc002uxr.1		NA																	4	Substitution - Missense(4)		lung(3)|upper_aerodigestive_tract(1)	upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						c.(1012-1014)TCT>TGT		caspase 8 isoform B precursor							139.0	124.0	129.0					2																	202149749		2203	4300	6503	SO:0001583	missense	841				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding	g.chr2:202149749C>G	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1013C>G	2.37:g.202149749C>G	ENSP00000412523:p.Ser338Cys	HNSCC(4;0.00038)	Somatic				CASP8_uc002uxp.1_Missense_Mutation_p.S355C|CASP8_uc002uxq.1_Missense_Mutation_p.S323C|CASP8_uc002uxt.1_Missense_Mutation_p.S397C|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Missense_Mutation_p.S323C|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Missense_Mutation_p.S254C	p.S338C	NM_033355	NP_203519	WXS	Illumina HiSeq	Unspecified	Q14790	CASP8_HUMAN			9	1222	+			338					O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	c.1013C>G	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266121	0.59540	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.68	5.68	0.88126	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.306666	0.35013	N	0.003503	T	0.77698	0.4169	M	0.87269	2.87	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.928;0.999;1.0	D;D;P;D;D	0.72338	0.977;0.939;0.607;0.916;0.959	T	0.80768	-0.1235	10	0.72032	D	0.01	.	19.7761	0.96393	0.0:1.0:0.0:0.0	.	254;397;338;323;355	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	C	323;254;338;355;397;323;117	ENSP00000376091:S323C;ENSP00000264274:S254C;ENSP00000412523:S338C;ENSP00000264275:S355C;ENSP00000351273:S397C;ENSP00000325722:S323C;ENSP00000394434:S117C	ENSP00000264274:S254C	S	+	2	0	CASP8	201857994	0.101000	0.21875	1.000000	0.80357	0.675000	0.39556	2.574000	0.46016	2.687000	0.91594	0.561000	0.74099	TCT		0.478	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228		33	181	0	0	0	0.005524	0	33	181				
PIKFYVE	200576	broad.mit.edu	37	2	209212732	209212732	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:209212732G>A	ENST00000264380.4	+	35	5517	c.5359G>A	c.(5359-5361)Ggc>Agc	p.G1787S		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1787	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.G1787S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CGAGAATCAAGGCGTTGAGCC	0.428																																							uc002vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						c.(5359-5361)GGC>AGC		phosphatidylinositol-3-phosphate 5-kinase type							110.0	108.0	108.0					2																	209212732		2203	4300	6503	SO:0001583	missense	200576				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding	g.chr2:209212732G>A	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5359G>A	2.37:g.209212732G>A	ENSP00000264380:p.Gly1787Ser		Somatic					p.G1787S	NM_015040	NP_055855	WXS	Illumina HiSeq	Unspecified	Q9Y2I7	FYV1_HUMAN			35	5517	+			1787			PIPK.		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	c.5359G>A	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389420	0.61956	.	.	ENSG00000115020	ENST00000264380	T	0.28895	1.59	5.58	5.58	0.84498	Phosphatidylinositol-4-phosphate 5-kinase, core (1);	0.080567	0.52532	D	0.000064	T	0.23249	0.0562	L	0.33485	1.01	0.80722	D	1	B	0.34015	0.435	B	0.30401	0.115	T	0.04976	-1.0914	10	0.06236	T	0.91	-15.1885	19.5735	0.95432	0.0:0.0:1.0:0.0	.	1787	Q9Y2I7	FYV1_HUMAN	S	1787	ENSP00000264380:G1787S	ENSP00000264380:G1787S	G	+	1	0	PIKFYVE	208920977	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.235000	0.78143	2.636000	0.89361	0.655000	0.94253	GGC		0.428	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		12	107	0	0	0	0.00245	0	12	107				
SLC23A3	151295	broad.mit.edu	37	2	220028231	220028231	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:220028231G>C	ENST00000409878.3	-	10	1352	c.1320C>G	c.(1318-1320)ttC>ttG	p.F440L	SLC23A3_ENST00000295738.7_Missense_Mutation_p.F323L|SLC23A3_ENST00000396775.3_3'UTR|NHEJ1_ENST00000356853.5_5'Flank|SLC23A3_ENST00000455516.2_Missense_Mutation_p.F448L	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	440					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.F323L(1)|p.F448L(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAAGCTGGAGAATCCAGCAG	0.537																																							uc010zks.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1318-1320)TTC>TTG		solute carrier family 23 (nucleobase							115.0	121.0	119.0					2																	220028231		1926	4141	6067	SO:0001583	missense	151295				transmembrane transport	integral to membrane	protein binding|transporter activity	g.chr2:220028231G>C	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.1320C>G	2.37:g.220028231G>C	ENSP00000386473:p.Phe440Leu		Somatic				NHEJ1_uc002vjp.3_5'Flank|NHEJ1_uc002vjq.3_Intron|SLC23A3_uc010zkr.1_Missense_Mutation_p.F448L|SLC23A3_uc010fwb.2_Missense_Mutation_p.F323L	p.F440L	NM_001144889	NP_001138361	WXS	Illumina HiSeq	Unspecified	Q6PIS1	S23A3_HUMAN		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	10	1431	-		Renal(207;0.0474)	440			Helical; (Potential).		B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	ENST00000409878.3	37	c.1320C>G	CCDS46518.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830881	0.32329	.	.	ENSG00000213901	ENST00000295738;ENST00000409878;ENST00000455516	T;T;T	0.15372	2.43;2.43;2.43	4.39	2.51	0.30379	.	0.634017	0.15616	N	0.253153	T	0.10252	0.0251	N	0.17345	0.48	0.80722	D	1	B;B;B	0.26002	0.139;0.139;0.005	B;B;B	0.28385	0.089;0.089;0.011	T	0.17410	-1.0370	9	.	.	.	.	10.0582	0.42259	0.0803:0.1414:0.7784:0.0	.	440;448;323	Q6PIS1;B7Z512;Q6PIS1-2	S23A3_HUMAN;.;.	L	323;440;448	ENSP00000295738:F323L;ENSP00000386473:F440L;ENSP00000406546:F448L	.	F	-	3	2	SLC23A3	219736475	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.183000	0.50918	1.148000	0.42385	0.655000	0.94253	TTC		0.537	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712		32	224	0	0	0	0.004878	0	32	224				
PTMA	5757	broad.mit.edu	37	2	232576109	232576109	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:232576109G>T	ENST00000341369.7	+	2	288	c.97G>T	c.(97-99)Gcc>Tcc	p.A33S	PTMA_ENST00000409683.1_Missense_Mutation_p.A33S|PTMA_ENST00000410064.1_Missense_Mutation_p.A59S|PTMA_ENST00000409321.1_Missense_Mutation_p.A54S|PTMA_ENST00000409115.3_Missense_Mutation_p.A33S|PTMA_ENST00000466801.1_3'UTR	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	33					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGGAAGAGACGCCCCTGCTAA	0.468																																							uc002vsc.3		NA																	0					0						c.(97-99)GCC>TCC		prothymosin, alpha isoform 1							74.0	83.0	80.0					2																	232576109		1978	4153	6131	SO:0001583	missense	5757				transcription, DNA-dependent	nucleus		g.chr2:232576109G>T		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.97G>T	2.37:g.232576109G>T	ENSP00000344547:p.Ala33Ser		Somatic				PTMA_uc002vsb.3_Missense_Mutation_p.A33S|PTMA_uc010zmf.1_RNA|MIR1244_hsa-mir-1244-1|MI0006379_5'Flank	p.A33S	NM_001099285	NP_001092755	WXS	Illumina HiSeq	Unspecified	P06454	PTMA_HUMAN		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)	2	279	+		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)	33					Q15249|Q15592	Missense_Mutation	SNP	ENST00000341369.7	37	c.97G>T	CCDS42833.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073864	0.36566	.	.	ENSG00000187514	ENST00000409321;ENST00000409115;ENST00000341369;ENST00000409683;ENST00000410064;ENST00000358839	.	.	.	4.29	3.37	0.38596	.	0.197687	0.30901	U	0.008642	T	0.40670	0.1126	M	0.67700	2.07	0.24925	N	0.991956	P;P	0.44521	0.837;0.743	B;B	0.42495	0.19;0.389	T	0.40059	-0.9583	9	0.72032	D	0.01	.	7.2647	0.26224	0.0951:0.1748:0.7301:0.0	.	33;33	P06454;Q53S24	PTMA_HUMAN;.	S	54;33;33;33;59;58	.	ENSP00000344547:A33S	A	+	1	0	PTMA	232284353	1.000000	0.71417	0.073000	0.20177	0.988000	0.76386	4.761000	0.62243	1.040000	0.40099	0.549000	0.68633	GCC		0.468	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332553.1			27	97	1	0	7.38237e-10	0.00632	8.70818e-10	27	97				
ALPP	250	broad.mit.edu	37	2	233245131	233245131	+	Splice_Site	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:233245131G>A	ENST00000392027.2	+	7	1063	c.794G>A	c.(793-795)gGt>gAt	p.G265D	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	265					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)	p.G265D(1)		NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCCCCACAGGGTGCCCGGTAT	0.672																																							uc002vsq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(793-795)GGT>GAT		placental alkaline phosphatase preproprotein							78.0	88.0	85.0					2																	233245131		2203	4300	6503	SO:0001630	splice_region_variant	250					anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	g.chr2:233245131G>A	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.793-1G>A	2.37:g.233245131G>A			Somatic				ALPP_uc002vsr.2_5'Flank	p.G265D	NM_001632	NP_001623	WXS	Illumina HiSeq	Unspecified	P05187	PPB1_HUMAN		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	7	959	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	265					P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	c.794G>A	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	.	9.941	1.217390	0.22373	.	.	ENSG00000163283	ENST00000392027	D	0.96992	-4.2	3.2	2.29	0.28610	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.226083	0.46442	D	0.000287	D	0.96417	0.8831	M	0.84846	2.72	0.34589	D	0.71527	P	0.52692	0.955	P	0.51582	0.674	D	0.95554	0.8623	10	0.35671	T	0.21	.	8.2902	0.31952	0.1175:0.0:0.8825:0.0	.	265	P05187	PPB1_HUMAN	D	265	ENSP00000375881:G265D	ENSP00000375881:G265D	G	+	2	0	ALPP	232953375	0.218000	0.23608	0.031000	0.17742	0.082000	0.17680	0.516000	0.22817	0.434000	0.26340	0.305000	0.20034	GGT		0.672	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	Missense_Mutation	22	138	0	0	0	0.014323	0	22	138				
ATRN	8455	broad.mit.edu	37	20	3529977	3529977	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:3529977G>T	ENST00000262919.5	+	6	1172	c.1104G>T	c.(1102-1104)atG>atT	p.M368I	ATRN_ENST00000446916.2_Missense_Mutation_p.M368I	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	368					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.M368I(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						ATTATAACATGGTTCTAGCGT	0.333																																							uc002wim.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1102-1104)ATG>ATT		attractin isoform 1							124.0	114.0	117.0					20																	3529977		2203	4300	6503	SO:0001583	missense	8455				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr20:3529977G>T	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.1104G>T	20.37:g.3529977G>T	ENSP00000262919:p.Met368Ile		Somatic				ATRN_uc002wil.2_Missense_Mutation_p.M368I	p.M368I	NM_139321	NP_647537	WXS	Illumina HiSeq	Unspecified	O75882	ATRN_HUMAN			6	1194	+			368			Extracellular (Potential).|Kelch 1.		A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	c.1104G>T	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917372	0.73098	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.77489	-1.1;-1.1	5.39	5.39	0.77823	Kelch-type beta propeller (1);	0.273316	0.46145	D	0.000311	T	0.74816	0.3766	L	0.43152	1.355	0.58432	D	0.999998	P;P	0.45827	0.589;0.867	B;P	0.44811	0.309;0.461	T	0.70417	-0.4877	10	0.19147	T	0.46	-18.3997	18.929	0.92556	0.0:0.0:1.0:0.0	.	368;368	O75882;O75882-2	ATRN_HUMAN;.	I	368;368;294	ENSP00000262919:M368I;ENSP00000416587:M368I	ENSP00000262919:M368I	M	+	3	0	ATRN	3477977	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.616000	0.98359	2.809000	0.96659	0.655000	0.94253	ATG		0.333	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321		34	110	1	0	1.71298e-08	0.003755	1.96449e-08	34	110				
ZNF133	7692	broad.mit.edu	37	20	18296557	18296557	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:18296557C>T	ENST00000316358.4	+	4	1159	c.1062C>T	c.(1060-1062)atC>atT	p.I354I	RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000535822.1_Silent_p.I259I|ZNF133_ENST00000538547.1_Silent_p.I259I|ZNF133_ENST00000401790.1_Silent_p.I354I|ZNF133_ENST00000402618.2_Silent_p.I291I|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000377671.3_Silent_p.I353I|ZNF133_ENST00000396026.3_Silent_p.I357I	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	354					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I353I(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						AGAAGACCATCGTGTGCAGTG	0.582																																							uc010gcq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1060-1062)ATC>ATT		zinc finger protein 133							71.0	65.0	67.0					20																	18296557		2203	4300	6503	SO:0001819	synonymous_variant	7692					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:18296557C>T	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1062C>T	20.37:g.18296557C>T			Somatic				ZNF133_uc010zrv.1_Silent_p.I357I|ZNF133_uc010zrw.1_Silent_p.I291I|ZNF133_uc010gcr.2_Silent_p.I354I|ZNF133_uc010zrx.1_Silent_p.I259I|ZNF133_uc002wql.3_Silent_p.I353I|ZNF133_uc010gcs.2_Silent_p.I353I|ZNF133_uc010zry.1_Silent_p.I259I|ZNF133_uc002wqm.2_Silent_p.I354I	p.I354I	NM_003434	NP_003425	WXS	Illumina HiSeq	Unspecified	P52736	ZN133_HUMAN			5	1367	+			354			C2H2-type 6.		A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Silent	SNP	ENST00000316358.4	37	c.1062C>T																																																																																					0.582	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434		10	56	0	0	0	0.013537	0	10	56				
CD93	22918	broad.mit.edu	37	20	23066668	23066668	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:23066668G>T	ENST00000246006.4	-	1	309	c.162C>A	c.(160-162)aaC>aaA	p.N54K		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	54	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.N54K(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCCCGTTCTGGTTGCAGTGGT	0.692																																							uc002wsv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(160-162)AAC>AAA		CD93 antigen precursor							36.0	30.0	32.0					20																	23066668		2203	4300	6503	SO:0001583	missense	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23066668G>T	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.162C>A	20.37:g.23066668G>T	ENSP00000246006:p.Asn54Lys		Somatic					p.N54K	NM_012072	NP_036204	WXS	Illumina HiSeq	Unspecified	Q9NPY3	C1QR1_HUMAN			1	310	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		54			Extracellular (Potential).|C-type lectin.		O00274	Missense_Mutation	SNP	ENST00000246006.4	37	c.162C>A	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.660767	0.00772	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.17691	2.26	5.88	-8.94	0.00768	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.695682	0.13868	N	0.357186	T	0.04407	0.0121	N	0.10945	0.07	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34179	-0.9839	10	0.05959	T	0.93	-0.5066	5.1408	0.14957	0.3545:0.4002:0.1693:0.0761	.	54	Q9NPY3	C1QR1_HUMAN	K	54	ENSP00000246006:N54K	ENSP00000246006:N54K	N	-	3	2	CD93	23014668	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.281000	0.02802	-1.635000	0.01535	-0.175000	0.13238	AAC		0.692	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		4	17	1	0	1.23904e-05	0.000602	1.33613e-05	4	17				
NINL	22981	broad.mit.edu	37	20	25470571	25470571	+	Silent	SNP	C	C	T	rs374076242		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:25470571C>T	ENST00000278886.6	-	12	1609	c.1536G>A	c.(1534-1536)tcG>tcA	p.S512S	NINL_ENST00000422516.1_Silent_p.S512S	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	512					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.S512S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TCTCCGAATCCGAAAGCTTTT	0.577																																							uc002wux.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(1534-1536)TCG>TCA		ninein-like		T		0,4406		0,0,2203	186.0	174.0	178.0		1536	-9.0	0.0	20		178	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	NINL	NM_025176.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		512/1383	25470571	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22981				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding	g.chr20:25470571C>T		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1536G>A	20.37:g.25470571C>T			Somatic				NINL_uc010gdn.1_Silent_p.S512S|NINL_uc010gdo.1_Silent_p.S295S	p.S512S	NM_025176	NP_079452	WXS	Illumina HiSeq	Unspecified	Q9Y2I6	NINL_HUMAN			12	1610	-			512			Potential.		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	c.1536G>A	CCDS33452.1																																																																																				0.577	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		25	150	0	0	0	0.013726	0	25	150				
SOGA1	140710	broad.mit.edu	37	20	35433300	35433300	+	Silent	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:35433300A>G	ENST00000357779.3	-	10	2537	c.2211T>C	c.(2209-2211)aaT>aaC	p.N737N	SOGA1_ENST00000279034.6_Silent_p.N737N|SOGA1_ENST00000237536.4_Silent_p.N975N|SOGA1_ENST00000456801.2_Silent_p.N578N			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	737					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.N975N(3)|p.N737N(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TGATGTACTCATTGGGCTGCA	0.577																																							uc002xgd.1		NA																	4	Substitution - coding silent(4)		lung(4)		0						c.(2209-2211)AAT>AAC		hypothetical protein LOC140710 isoform 2							73.0	75.0	75.0					20																	35433300		2096	4237	6333	SO:0001819	synonymous_variant	140710							g.chr20:35433300A>G	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2211T>C	20.37:g.35433300A>G			Somatic				C20orf117_uc002xge.1_RNA	p.N737N	NM_199181	NP_954650	WXS	Illumina HiSeq	Unspecified	O94964	K0889_HUMAN			10	2538	-		Myeloproliferative disorder(115;0.00874)	737					A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37	c.2211T>C																																																																																					0.577	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181		8	49	0	0	0	0.006214	0	8	49				
CSE1L	1434	broad.mit.edu	37	20	47682795	47682795	+	Silent	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:47682795T>C	ENST00000262982.2	+	4	418	c.295T>C	c.(295-297)Ttg>Ctg	p.L99L	CSE1L_ENST00000396192.3_Silent_p.L99L|CSE1L_ENST00000542325.1_Intron	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	99	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)	p.L99L(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CATAGTGCACTTGATGCTTAG	0.418																																							uc002xty.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(295-297)TTG>CTG		CSE1 chromosome segregation 1-like protein							112.0	104.0	107.0					20																	47682795		2203	4300	6503	SO:0001819	synonymous_variant	1434				apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity	g.chr20:47682795T>C	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.295T>C	20.37:g.47682795T>C			Somatic				CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Silent_p.L99L	p.L99L	NM_001316	NP_001307	WXS	Illumina HiSeq	Unspecified	P55060	XPO2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)		4	429	+			99			Importin N-terminal.		A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	37	c.295T>C	CCDS13412.1																																																																																				0.418	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316		7	93	0	0	0	0.010729	0	7	93				
DDX27	55661	broad.mit.edu	37	20	47853035	47853035	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:47853035A>G	ENST00000371764.4	+	14	1777	c.1768A>G	c.(1768-1770)Ata>Gta	p.I590V	ZNFX1_ENST00000469991.1_5'Flank|DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	590	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.I590V(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAAGGCCAGGATACTTCCCCA	0.587																																							uc002xuh.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)	2						c.(1768-1770)ATA>GTA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							44.0	47.0	46.0					20																	47853035		2203	4300	6503	SO:0001583	missense	55661					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr20:47853035A>G	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1768A>G	20.37:g.47853035A>G	ENSP00000360828:p.Ile590Val		Somatic					p.I590V	NM_017895	NP_060365	WXS	Illumina HiSeq	Unspecified	Q96GQ7	DDX27_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		14	1829	+			590			Helicase C-terminal.		A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	c.1768A>G	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	A	11.70	1.716156	0.30413	.	.	ENSG00000124228	ENST00000371764	T	0.01414	4.92	6.04	6.04	0.98038	Helicase, C-terminal (1);	0.048899	0.85682	D	0.000000	T	0.00845	0.0028	N	0.02973	-0.45	0.45250	D	0.99825	B	0.09022	0.002	B	0.19946	0.027	T	0.64597	-0.6370	10	0.20046	T	0.44	-8.8638	8.9572	0.35825	0.9186:0.0:0.0814:0.0	.	590	Q96GQ7	DDX27_HUMAN	V	590	ENSP00000360828:I590V	ENSP00000360828:I590V	I	+	1	0	DDX27	47286442	1.000000	0.71417	0.957000	0.39632	0.872000	0.50106	3.954000	0.56708	2.317000	0.78254	0.459000	0.35465	ATA		0.587	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1			10	73	0	0	0	0.008291	0	10	73				
SALL4	57167	broad.mit.edu	37	20	50407847	50407847	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:50407847C>A	ENST00000217086.4	-	2	1286	c.1175G>T	c.(1174-1176)gGg>gTg	p.G392V	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Intron|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	392					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G392V(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTATCAGTCCCAAAAACCTT	0.562																																							uc002xwh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1174-1176)GGG>GTG		sal-like 4							79.0	69.0	72.0					20																	50407847		2203	4300	6503	SO:0001583	missense	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50407847C>A	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1175G>T	20.37:g.50407847C>A	ENSP00000217086:p.Gly392Val		Somatic				SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	p.G392V	NM_020436	NP_065169	WXS	Illumina HiSeq	Unspecified	Q9UJQ4	SALL4_HUMAN			2	1276	-			392			C2H2-type 1.		A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	c.1175G>T	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158395	0.78114	.	.	ENSG00000101115	ENST00000217086	T	0.07444	3.19	5.29	5.29	0.74685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.304018	0.24014	N	0.042345	T	0.15782	0.0380	N	0.11341	0.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.33523	-0.9865	10	0.66056	D	0.02	-18.3382	18.9212	0.92526	0.0:1.0:0.0:0.0	.	392	Q9UJQ4	SALL4_HUMAN	V	392	ENSP00000217086:G392V	ENSP00000217086:G392V	G	-	2	0	SALL4	49841254	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.760000	0.85248	2.466000	0.83321	0.655000	0.94253	GGG		0.562	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			17	115	1	0	1.01871e-10	0.008871	1.2267e-10	17	115				
SALL4	57167	broad.mit.edu	37	20	50408823	50408823	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr20:50408823G>A	ENST00000217086.4	-	2	310	c.199C>T	c.(199-201)Cgt>Tgt	p.R67C	SALL4_ENST00000483130.1_5'UTR|SALL4_ENST00000395997.3_Missense_Mutation_p.R67C|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	67					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R67C(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCTCCCGACGAAGCCGCTTT	0.498																																							uc002xwh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(199-201)CGT>TGT		sal-like 4							58.0	60.0	59.0					20																	50408823		2203	4300	6503	SO:0001583	missense	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50408823G>A	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.199C>T	20.37:g.50408823G>A	ENSP00000217086:p.Arg67Cys		Somatic				SALL4_uc010gii.2_Missense_Mutation_p.R67C|SALL4_uc002xwi.3_Intron	p.R67C	NM_020436	NP_065169	WXS	Illumina HiSeq	Unspecified	Q9UJQ4	SALL4_HUMAN			2	300	-			67					A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	c.199C>T	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354992	0.61293	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.52754	0.65;0.65	5.53	4.54	0.55810	.	0.376195	0.19737	N	0.107213	T	0.61324	0.2338	M	0.63428	1.95	0.30436	N	0.776665	D;D	0.89917	1.0;0.999	P;P	0.60117	0.869;0.791	T	0.63532	-0.6616	10	0.87932	D	0	-15.6869	13.4643	0.61245	0.0:0.0:0.7184:0.2816	.	67;67	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	C	67	ENSP00000217086:R67C;ENSP00000379319:R67C	ENSP00000217086:R67C	R	-	1	0	SALL4	49842230	0.999000	0.42202	0.041000	0.18516	0.099000	0.18886	3.667000	0.54547	2.582000	0.87167	0.655000	0.94253	CGT		0.498	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			17	62	0	0	0	0.010504	0	17	62				
KRTAP19-3	337970	broad.mit.edu	37	21	31864110	31864110	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr21:31864110C>A	ENST00000334063.4	-	1	165	c.166G>T	c.(166-168)Ggc>Tgc	p.G56C		NM_181609.3	NP_853640.1	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	56						intermediate filament (GO:0005882)		p.G56C(1)		large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	9						AAGCCAGAGCCATATCCATAG	0.527																																							uc002yog.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(166-168)GGC>TGC		keratin associated protein 19-3							189.0	195.0	193.0					21																	31864110		2203	4300	6503	SO:0001583	missense	337970					intermediate filament		g.chr21:31864110C>A	AP001708	CCDS13596.1	21q22.1	2011-02-10			ENSG00000244025	ENSG00000244025		"""Keratin associated proteins"""	18938	protein-coding gene	gene with protein product						12359730	Standard	NM_181609		Approved	KAP19.3	uc002yog.1	Q7Z4W3	OTTHUMG00000057782	ENST00000334063.4:c.166G>T	21.37:g.31864110C>A	ENSP00000386376:p.Gly56Cys		Somatic					p.G56C	NM_181609	NP_853640	WXS	Illumina HiSeq	Unspecified	Q7Z4W3	KR193_HUMAN			1	166	-			56						Missense_Mutation	SNP	ENST00000334063.4	37	c.166G>T	CCDS13596.1	.	.	.	.	.	.	.	.	.	.	C	5.690	0.311833	0.10789	.	.	ENSG00000244025	ENST00000334063	T	0.50277	0.75	4.33	-1.26	0.09376	.	0.000000	0.28742	U	0.014281	T	0.50051	0.1593	.	.	.	0.09310	N	1	D	0.67145	0.996	P	0.59825	0.864	T	0.46679	-0.9174	9	0.87932	D	0	.	1.5991	0.02670	0.1559:0.3524:0.3044:0.1873	.	56	Q7Z4W3	KR193_HUMAN	C	56	ENSP00000386376:G56C	ENSP00000386376:G56C	G	-	1	0	KRTAP19-3	30785981	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.283000	0.18846	-0.563000	0.06078	-0.859000	0.03014	GGC		0.527	KRTAP19-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128234.2			53	139	1	0	3.41413e-29	0.01441	4.78973e-29	53	139				
GAB4	128954	broad.mit.edu	37	22	17472980	17472980	+	Silent	SNP	G	G	T	rs377302369		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr22:17472980G>T	ENST00000400588.1	-	2	368	c.261C>A	c.(259-261)tcC>tcA	p.S87S	GAB4_ENST00000523144.1_5'UTR	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	87	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.							p.S87S(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGGGCTTCTTGGAGCCATCAT	0.502																																							uc002zlw.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(259-261)TCC>TCA		GRB2-associated binding protein family, member							201.0	211.0	207.0					22																	17472980		2193	4299	6492	SO:0001819	synonymous_variant	128954							g.chr22:17472980G>T	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.261C>A	22.37:g.17472980G>T			Somatic				GAB4_uc010gqs.1_Silent_p.S87S	p.S87S	NM_001037814	NP_001032903	WXS	Illumina HiSeq	Unspecified	Q2WGN9	GAB4_HUMAN			2	369	-		all_epithelial(15;0.112)|Lung NSC(13;0.248)	87			PH.			Silent	SNP	ENST00000400588.1	37	c.261C>A	CCDS42976.1																																																																																				0.502	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882		53	240	1	0	2.27459e-33	0.01441	3.22234e-33	53	240				
RSPH14	27156	broad.mit.edu	37	22	23401887	23401887	+	Missense_Mutation	SNP	G	G	A	rs571048891		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr22:23401887G>A	ENST00000216036.4	-	7	996	c.800C>T	c.(799-801)gCg>gTg	p.A267V		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		267								p.A267V(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		CTCCAGGGCCGCATACTTCCC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16582	0.0		0.001	False		,,,				2504	0.0						uc002zwt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(799-801)GCG>GTG		rhabdoid tumor deletion region protein 1							57.0	54.0	55.0					22																	23401887		2203	4300	6503	SO:0001583	missense	27156						binding	g.chr22:23401887G>A																												ENST00000216036.4:c.800C>T	22.37:g.23401887G>A	ENSP00000216036:p.Ala267Val		Somatic					p.A267V	NM_014433	NP_055248	WXS	Illumina HiSeq	Unspecified	Q9UHP6	RTDR1_HUMAN		READ - Rectum adenocarcinoma(21;0.175)	7	958	-	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		267						Missense_Mutation	SNP	ENST00000216036.4	37	c.800C>T	CCDS13803.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619464	0.66787	.	.	ENSG00000100218	ENST00000216036	T	0.50548	0.74	5.07	5.07	0.68467	Armadillo-like helical (1);Armadillo-type fold (1);	0.563321	0.18788	N	0.131143	T	0.48642	0.1511	M	0.62088	1.915	0.80722	D	1	D	0.53462	0.96	P	0.44394	0.448	T	0.45411	-0.9263	10	0.30078	T	0.28	-14.3509	14.3177	0.66463	0.0:0.0:1.0:0.0	.	267	Q9UHP6	RTDR1_HUMAN	V	267	ENSP00000216036:A267V	ENSP00000216036:A267V	A	-	2	0	RTDR1	21731887	0.515000	0.26210	0.505000	0.27651	0.518000	0.34316	2.724000	0.47285	2.543000	0.85770	0.655000	0.94253	GCG		0.632	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1			4	83	0	0	0	0.009096	0	4	83				
PLA2G3	50487	broad.mit.edu	37	22	31536292	31536292	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr22:31536292C>G	ENST00000215885.3	-	1	301	c.49G>C	c.(49-51)Gcc>Ccc	p.A17P		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	17					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)	p.A17P(2)		large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						CCCCCCAGGGCCACCCCCAGG	0.662																																							uc003aka.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(49-51)GCC>CCC		phospholipase A2, group III precursor							28.0	34.0	32.0					22																	31536292		2196	4291	6487	SO:0001583	missense	50487				cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity	g.chr22:31536292C>G	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.49G>C	22.37:g.31536292C>G	ENSP00000215885:p.Ala17Pro		Somatic					p.A17P	NM_015715	NP_056530	WXS	Illumina HiSeq	Unspecified	Q9NZ20	PA2G3_HUMAN			1	178	-			17					O95768	Missense_Mutation	SNP	ENST00000215885.3	37	c.49G>C	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827755	0.32329	.	.	ENSG00000100078	ENST00000215885	T	0.13089	2.62	5.44	3.31	0.37934	.	0.524667	0.19145	N	0.121594	T	0.14657	0.0354	L	0.38838	1.175	0.09310	N	1	P	0.48911	0.917	P	0.49226	0.603	T	0.07139	-1.0788	10	0.42905	T	0.14	-5.1518	7.4786	0.27391	0.0:0.7426:0.1672:0.0902	.	17	Q9NZ20	PA2G3_HUMAN	P	17	ENSP00000215885:A17P	ENSP00000215885:A17P	A	-	1	0	PLA2G3	29866292	0.000000	0.05858	0.012000	0.15200	0.460000	0.32559	0.406000	0.21032	0.626000	0.30322	0.643000	0.83706	GCC		0.662	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715		13	70	0	0	0	0.00245	0	13	70				
MYH9	4627	broad.mit.edu	37	22	36723529	36723529	+	Silent	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr22:36723529T>A	ENST00000216181.5	-	4	725	c.495A>T	c.(493-495)cgA>cgT	p.R165R	MYH9_ENST00000401701.1_Silent_p.R165R	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	165	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.R165R(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						ATTGATCTTCTCGGTCTGAAA	0.498			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(493-495)CGA>CGT		myosin, heavy polypeptide 9, non-muscle							146.0	116.0	126.0					22																	36723529		2203	4300	6503	SO:0001819	synonymous_variant	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36723529T>A		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.495A>T	22.37:g.36723529T>A			Somatic				MYH9_uc003aph.1_Silent_p.R29R|MYH9_uc003api.1_Silent_p.R165R	p.R165R	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			4	726	-			165			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	c.495A>T	CCDS13927.1																																																																																				0.498	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		9	43	0	0	0	0.013537	0	9	43				
KCNH8	131096	broad.mit.edu	37	3	19436596	19436596	+	Splice_Site	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:19436596G>T	ENST00000328405.2	+	7	1236	c.970G>T	c.(970-972)Gtg>Ttg	p.V324L	KCNH8_ENST00000475063.1_3'UTR|KCNH8_ENST00000537696.1_5'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	324					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.V324L(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTTACCACAGGTGTCTCTCGT	0.438																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(1)	5						c.(970-972)GTG>TTG		potassium voltage-gated channel, subfamily H,							131.0	119.0	123.0					3																	19436596		2203	4300	6503	SO:0001630	splice_region_variant	131096					integral to membrane	two-component sensor activity	g.chr3:19436596G>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.970-1G>T	3.37:g.19436596G>T			Somatic				KCNH8_uc011awe.1_Missense_Mutation_p.V324L|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_5'UTR	p.V324L	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			7	1165	+			324			Extracellular (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.970G>T	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974240	0.34848	.	.	ENSG00000183960	ENST00000328405	D	0.98178	-4.77	5.78	5.78	0.91487	Ion transport (1);	0.000000	0.28940	U	0.013655	D	0.94483	0.8224	N	0.05441	-0.05	0.80722	D	1	B;B	0.32968	0.009;0.392	B;B	0.33960	0.021;0.173	D	0.92953	0.6382	9	.	.	.	.	20.0118	0.97458	0.0:0.0:1.0:0.0	.	324;324	B7Z398;Q96L42	.;KCNH8_HUMAN	L	324	ENSP00000328813:V324L	.	V	+	1	0	KCNH8	19411600	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	3.386000	0.52492	2.742000	0.94016	0.650000	0.86243	GTG		0.438	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	Missense_Mutation	44	82	1	0	2.13883e-14	0.01441	2.74721e-14	44	82				
SCN10A	6336	broad.mit.edu	37	3	38830506	38830506	+	Silent	SNP	C	C	G	rs139793167		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:38830506C>G	ENST00000449082.2	-	3	410	c.411G>C	c.(409-411)acG>acC	p.T137T		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	137					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T137T(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AAATAGTGACCGTAATAAATA	0.398																																							uc003ciq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(409-411)ACG>ACC		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						133.0	121.0	125.0					3																	38830506		2203	4300	6503	SO:0001819	synonymous_variant	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38830506C>G	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.411G>C	3.37:g.38830506C>G			Somatic					p.T137T	NM_006514	NP_006505	WXS	Illumina HiSeq	Unspecified	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	3	411	-			137			Helical; Name=S1 of repeat I; (Potential).|I.		A6NDQ1	Silent	SNP	ENST00000449082.2	37	c.411G>C	CCDS33736.1																																																																																				0.398	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		14	54	0	0	0	0.003163	0	14	54				
TRAK1	22906	broad.mit.edu	37	3	42264897	42264897	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:42264897G>T	ENST00000327628.5	+	16	2930	c.2530G>T	c.(2530-2532)Gtg>Ttg	p.V844L	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000396175.1_Missense_Mutation_p.V786L|RNU4-78P_ENST00000410940.1_RNA	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	844					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.V786L(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCTCAACCTCGTGGACAAAGT	0.612																																					GBM(44;195 884 22595 31865 41850)	GBM(44;195 884 22595 31865 41850)	uc003cky.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2530-2532)GTG>TTG		OGT(O-Glc-NAc transferase)-interacting protein							31.0	35.0	34.0					3																	42264897		1984	4178	6162	SO:0001583	missense	22906				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus		g.chr3:42264897G>T		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2530G>T	3.37:g.42264897G>T	ENSP00000328998:p.Val844Leu		Somatic				TRAK1_uc011azi.1_Missense_Mutation_p.V823L	p.V844L	NM_001042646	NP_001036111	WXS	Illumina HiSeq	Unspecified	Q9UPV9	TRAK1_HUMAN			16	2746	+			844					E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	37	c.2530G>T	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.561039	0.65538	.	.	ENSG00000182606	ENST00000327628;ENST00000396175	T;T	0.54279	0.58;0.58	5.32	5.32	0.75619	Trafficking kinesin-binding protein domain (1);	0.000000	0.64402	D	0.000002	T	0.50051	0.1593	L	0.52905	1.665	0.80722	D	1	P;P	0.39131	0.661;0.661	B;B	0.35510	0.204;0.204	T	0.55049	-0.8201	10	0.51188	T	0.08	.	17.9738	0.89121	0.0:0.0:1.0:0.0	.	786;844	C9JC32;Q9UPV9	.;TRAK1_HUMAN	L	844;786	ENSP00000328998:V844L;ENSP00000379478:V786L	ENSP00000328998:V844L	V	+	1	0	TRAK1	42239901	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.313000	0.72844	2.514000	0.84764	0.591000	0.81541	GTG		0.612	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965		8	47	1	0	5.4927e-09	0.004482	6.40077e-09	8	47				
TGM4	7047	broad.mit.edu	37	3	44945470	44945470	+	Silent	SNP	C	C	A	rs200982271	byFrequency	TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:44945470C>A	ENST00000296125.4	+	9	1134	c.1066C>A	c.(1066-1068)Cga>Aga	p.R356R		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	356					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.R356R(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GCCGCAGGAGCGAAGCCAGGG	0.632																																							uc003coc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1066-1068)CGA>AGA		transglutaminase 4 (prostate)	L-Glutamine(DB00130)						60.0	62.0	62.0					3																	44945470		2203	4300	6503	SO:0001819	synonymous_variant	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44945470C>A	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1066C>A	3.37:g.44945470C>A			Somatic					p.R356R	NM_003241	NP_003232	WXS	Illumina HiSeq	Unspecified	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	9	1139	+			356					Q16707|Q96QN4	Silent	SNP	ENST00000296125.4	37	c.1066C>A	CCDS2723.1																																																																																				0.632	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		15	87	1	0	6.31663e-08	0.003163	7.15884e-08	15	87				
SEMA3G	56920	broad.mit.edu	37	3	52470040	52470040	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:52470040C>A	ENST00000231721.2	-	16	1927	c.1928G>T	c.(1927-1929)cGc>cTc	p.R643L		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	643	Ig-like C2-type.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R643L(1)		kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GCTAAGCCTGCGGAACAGCAG	0.637																																							uc003dea.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1927-1929)CGC>CTC		semaphorin sem2 precursor							49.0	46.0	47.0					3																	52470040		2203	4300	6503	SO:0001583	missense	56920				multicellular organismal development	extracellular region|membrane	receptor activity	g.chr3:52470040C>A		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1928G>T	3.37:g.52470040C>A	ENSP00000231721:p.Arg643Leu		Somatic					p.R643L	NM_020163	NP_064548	WXS	Illumina HiSeq	Unspecified	Q9NS98	SEM3G_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)	16	1928	-			643			Ig-like C2-type.		Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	c.1928G>T	CCDS2856.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980881	0.53827	.	.	ENSG00000010319	ENST00000231721	T	0.01584	4.75	4.97	4.97	0.65823	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.065311	0.64402	D	0.000006	T	0.02494	0.0076	L	0.46567	1.45	0.58432	D	0.999997	B	0.25048	0.117	B	0.24269	0.052	T	0.51474	-0.8701	10	0.07990	T	0.79	.	18.4841	0.90823	0.0:1.0:0.0:0.0	.	643	Q9NS98	SEM3G_HUMAN	L	643	ENSP00000231721:R643L	ENSP00000231721:R643L	R	-	2	0	SEMA3G	52445080	0.993000	0.37304	1.000000	0.80357	0.978000	0.69477	3.034000	0.49751	2.601000	0.87937	0.558000	0.71614	CGC		0.637	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163		8	39	1	0	3.09899e-07	0.004482	3.47134e-07	8	39				
OR5H15	403274	broad.mit.edu	37	3	97887972	97887972	+	Silent	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:97887972G>T	ENST00000356526.2	+	1	429	c.429G>T	c.(427-429)cgG>cgT	p.R143R		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R143R(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TGTGCATCCGGCTATTAATCT	0.373																																							uc011bgu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(427-429)CGG>CGT		olfactory receptor, family 5, subfamily H,							74.0	73.0	73.0					3																	97887972		2203	4297	6500	SO:0001819	synonymous_variant	403274				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97887972G>T		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.429G>T	3.37:g.97887972G>T			Somatic					p.R143R	NM_001005515	NP_001005515	WXS	Illumina HiSeq	Unspecified	A6NDH6	O5H15_HUMAN			1	429	+			143			Cytoplasmic (Potential).			Silent	SNP	ENST00000356526.2	37	c.429G>T	CCDS33799.1																																																																																				0.373	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1			21	69	1	0	4.22769e-11	0.00632	5.15529e-11	21	69				
TRMT10C	54931	broad.mit.edu	37	3	101283774	101283774	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:101283774C>T	ENST00000309922.6	+	2	303	c.149C>T	c.(148-150)cCt>cTt	p.P50L		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	50					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.P50L(1)									GTTACTTATCCTAAAAATGAG	0.373																																						Colon(61;905 1056 3196 19548 40505)	uc003duz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(148-150)CCT>CTT		RNA (guanine-9-) methyltransferase domain							146.0	134.0	138.0					3																	101283774		1851	4093	5944	SO:0001583	missense	54931				tRNA processing	mitochondrion	methyltransferase activity|protein binding	g.chr3:101283774C>T	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.149C>T	3.37:g.101283774C>T	ENSP00000312356:p.Pro50Leu		Somatic					p.P50L	NM_017819	NP_060289	WXS	Illumina HiSeq	Unspecified	Q7L0Y3	MRRP1_HUMAN			2	297	+			50					Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	c.149C>T	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	C	3.416	-0.119176	0.06838	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.23147	2.53;1.92	5.9	5.01	0.66863	.	1.208230	0.05619	N	0.579494	T	0.28300	0.0699	L	0.50333	1.59	0.09310	N	1	P	0.37500	0.597	B	0.37650	0.255	T	0.22173	-1.0224	10	0.34782	T	0.22	-15.9445	8.5183	0.33259	0.1591:0.7633:0.0:0.0776	.	50	Q7L0Y3	MRRP1_HUMAN	L	50	ENSP00000312356:P50L;ENSP00000419389:P50L	ENSP00000312356:P50L	P	+	2	0	RG9MTD1	102766464	0.544000	0.26441	0.006000	0.13384	0.010000	0.07245	1.691000	0.37721	1.431000	0.47355	0.563000	0.77884	CCT		0.373	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819		66	207	0	0	0	0.01441	0	66	207				
PCNP	57092	broad.mit.edu	37	3	101298713	101298713	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:101298713C>A	ENST00000265260.3	+	2	265	c.144C>A	c.(142-144)agC>agA	p.S48R	PCNP_ENST00000296024.5_Missense_Mutation_p.S48R|PCNP_ENST00000469941.1_Intron|PCNP_ENST00000486406.1_Intron	NM_020357.1	NP_065090.1	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear protein	48					cell cycle (GO:0007049)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)		p.S48R(1)		large_intestine(1)|lung(1)	2						CCAGTCGCAGCGCTGAGAAGC	0.463																																							uc003dva.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)AGC>AGA		PEST proteolytic signal containing nuclear							76.0	77.0	77.0					3																	101298713		2203	4300	6503	SO:0001583	missense	57092				cell cycle|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	nucleus	protein binding	g.chr3:101298713C>A		CCDS2942.1	3q12.3	2006-03-09			ENSG00000081154	ENSG00000081154			30023	protein-coding gene	gene with protein product		615210				12176013	Standard	NM_020357		Approved		uc003dva.3	Q8WW12	OTTHUMG00000159108	ENST00000265260.3:c.144C>A	3.37:g.101298713C>A	ENSP00000265260:p.Ser48Arg		Somatic				PCNP_uc003dvb.2_RNA|PCNP_uc003dvc.2_Intron|PCNP_uc003dvd.2_Missense_Mutation_p.S48R	p.S48R	NM_020357	NP_065090	WXS	Illumina HiSeq	Unspecified	Q8WW12	PCNP_HUMAN			2	162	+			48					B2RBE7|D3DN52|Q53GF3|Q6AI44|Q96CU3|Q9NS81	Missense_Mutation	SNP	ENST00000265260.3	37	c.144C>A	CCDS2942.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292642	0.59976	.	.	ENSG00000081154	ENST00000265260;ENST00000296024	.	.	.	5.76	5.76	0.90799	.	0.086167	0.85682	D	0.000000	T	0.76673	0.4020	M	0.68317	2.08	0.49389	D	0.999786	D;D	0.76494	0.999;0.996	D;D	0.66351	0.943;0.918	T	0.70554	-0.4840	9	0.22109	T	0.4	.	19.9658	0.97266	0.0:1.0:0.0:0.0	.	48;48	Q8WW12-2;Q8WW12	.;PCNP_HUMAN	R	48	.	ENSP00000265260:S48R	S	+	3	2	PCNP	102781403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.837000	0.39201	2.721000	0.93114	0.591000	0.81541	AGC		0.463	PCNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353338.2	NM_020357		29	69	1	0	9.39395e-14	0.00632	1.19072e-13	29	69				
BOC	91653	broad.mit.edu	37	3	112991383	112991383	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:112991383C>A	ENST00000495514.1	+	7	1498	c.794C>A	c.(793-795)gCc>gAc	p.A265D	BOC_ENST00000355385.3_Missense_Mutation_p.A265D|BOC_ENST00000273395.4_Missense_Mutation_p.A265D			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	265	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.A265D(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GTCACCTGGGCCAAGGATGGG	0.607																																							uc003dzx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(793-795)GCC>GAC		brother of CDO precursor							139.0	139.0	139.0					3																	112991383		2203	4300	6503	SO:0001583	missense	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112991383C>A	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.794C>A	3.37:g.112991383C>A	ENSP00000418663:p.Ala265Asp		Somatic				BOC_uc003dzy.2_Missense_Mutation_p.A265D|BOC_uc003dzz.2_Missense_Mutation_p.A265D|BOC_uc003eab.2_5'UTR	p.A265D	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		7	1415	+			265			Ig-like C2-type 3.|Extracellular (Potential).		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	c.794C>A	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	35	5.578423	0.96565	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.29917	1.55;1.55;1.55	5.92	5.92	0.95590	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052559	0.85682	D	0.000000	T	0.41488	0.1161	N	0.22421	0.69	0.80722	D	1	P;P	0.46987	0.864;0.888	P;P	0.59424	0.777;0.857	T	0.05289	-1.0894	10	0.32370	T	0.25	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	265;265	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	D	265	ENSP00000418663:A265D;ENSP00000273395:A265D;ENSP00000347546:A265D	ENSP00000273395:A265D	A	+	2	0	BOC	114474073	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.347000	0.79356	2.810000	0.96702	0.650000	0.86243	GCC		0.607	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		27	263	1	0	2.38352e-08	0.004289	2.72268e-08	27	263				
KIAA2018	205717	broad.mit.edu	37	3	113389016	113389016	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:113389016C>T	ENST00000478658.1	-	3	128	c.111G>A	c.(109-111)ggG>ggA	p.G37G	KIAA2018_ENST00000316407.4_Silent_p.G37G|KIAA2018_ENST00000491165.1_Silent_p.G37G			Q68DE3	K2018_HUMAN	KIAA2018	37	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.G37G(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTCTGTTTATCCCAGCATTAA	0.398																																							uc003eam.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(109-111)GGG>GGA		hypothetical protein LOC205717							181.0	165.0	170.0					3																	113389016		1847	4098	5945	SO:0001819	synonymous_variant	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113389016C>T	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.111G>A	3.37:g.113389016C>T			Somatic				KIAA2018_uc003eal.2_5'UTR	p.G37G	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			5	522	-			37			Helix-loop-helix motif.		Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	c.111G>A	CCDS43133.1																																																																																				0.398	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		18	62	0	0	0	0.010504	0	18	62				
ACAD9	28976	broad.mit.edu	37	3	128623262	128623262	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:128623262G>A	ENST00000308982.7	+	11	1144	c.1063G>A	c.(1063-1065)Gtc>Atc	p.V355I	ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	355						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.V355I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						GAAGGCTTACGTCATGGAGAG	0.493																																							uc003ela.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1063-1065)GTC>ATC		acyl-Coenzyme A dehydrogenase family, member 9							96.0	86.0	90.0					3																	128623262		2203	4300	6503	SO:0001583	missense	28976					mitochondrion	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding	g.chr3:128623262G>A	AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1063G>A	3.37:g.128623262G>A	ENSP00000312618:p.Val355Ile		Somatic				ACAD9_uc010hsw.1_Missense_Mutation_p.V232I|ACAD9_uc011bks.1_Missense_Mutation_p.V232I|ACAD9_uc003elb.2_Missense_Mutation_p.V232I|ACAD9_uc003eld.1_RNA|ACAD9_uc003ele.2_Missense_Mutation_p.V7I	p.V355I	NM_014049	NP_054768	WXS	Illumina HiSeq	Unspecified	Q9H845	ACAD9_HUMAN			11	1265	+			355					D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	c.1063G>A	CCDS3053.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686713	0.68157	.	.	ENSG00000177646	ENST00000308982;ENST00000334167	D	0.96232	-3.95	5.7	5.7	0.88788	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.052493	0.85682	D	0.000000	D	0.92427	0.7596	L	0.31578	0.945	0.80722	D	1	B;P	0.47762	0.299;0.9	B;B	0.36244	0.137;0.22	D	0.93254	0.6637	10	0.56958	D	0.05	.	17.3409	0.87296	0.0:0.0:1.0:0.0	.	232;355	Q9H9W4;Q9H845	.;ACAD9_HUMAN	I	355;222	ENSP00000312618:V355I	ENSP00000312618:V355I	V	+	1	0	ACAD9	130105952	1.000000	0.71417	0.193000	0.23327	0.763000	0.43281	7.102000	0.77005	2.688000	0.91661	0.655000	0.94253	GTC		0.493	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049		24	122	0	0	0	0.004656	0	24	122				
CLDN18	51208	broad.mit.edu	37	3	137717893	137717893	+	Silent	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:137717893C>A	ENST00000343735.4	+	1	317	c.183C>A	c.(181-183)acC>acA	p.T61T		NM_001002026.2	NP_001002026.1	P56856	CLD18_HUMAN	claudin 18	61					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						CTGGCTTCACCGAGTGCCGGG	0.602																																							uc003ero.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(181-183)ACC>ACA		claudin 18 isoform 2							76.0	75.0	75.0					3																	137717893		2203	4300	6503	SO:0001819	synonymous_variant	51208				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr3:137717893C>A	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000343735.4:c.183C>A	3.37:g.137717893C>A			Somatic					p.T61T	NM_001002026	NP_001002026	WXS	Illumina HiSeq	Unspecified	P56856	CLD18_HUMAN			1	236	+			61			Extracellular (Potential).		A5PL21|Q96PH4	Silent	SNP	ENST00000343735.4	37	c.183C>A	CCDS33862.1																																																																																				0.602	CLDN18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357198.2	NM_001002026		14	98	1	0	3.41278e-10	0.00499	4.05882e-10	14	98				
ZBBX	79740	broad.mit.edu	37	3	167035342	167035342	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:167035342G>T	ENST00000392766.2	-	13	1367	c.1027C>A	c.(1027-1029)Cca>Aca	p.P343T	ZBBX_ENST00000392767.2_Missense_Mutation_p.P343T|ZBBX_ENST00000455345.2_Missense_Mutation_p.P343T|ZBBX_ENST00000307529.5_Missense_Mutation_p.P343T|ZBBX_ENST00000392764.1_Missense_Mutation_p.P314T|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	343						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.P343T(4)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TGTGGATGTGGGAACGTATCT	0.338																																							uc003fep.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(1027-1029)CCA>ACA		zinc finger, B-box domain containing							190.0	173.0	178.0					3																	167035342		1850	4089	5939	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167035342G>T	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1027C>A	3.37:g.167035342G>T	ENSP00000376519:p.Pro343Thr		Somatic				ZBBX_uc011bpc.1_Missense_Mutation_p.P343T|ZBBX_uc003feq.2_Missense_Mutation_p.P314T	p.P343T	NM_024687	NP_078963	WXS	Illumina HiSeq	Unspecified	A8MT70	ZBBX_HUMAN			13	1350	-			343					A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.1027C>A	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	G	7.461	0.644732	0.14451	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.09163	3.18;3.18;3.19;3.19;3.01	5.34	-1.83	0.07833	.	1.885390	0.02115	N	0.055113	T	0.04770	0.0129	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.37384	-0.9708	10	0.20046	T	0.44	1.1555	9.0635	0.36449	0.0:0.0776:0.5546:0.3677	.	343;343	A8MT70-2;A8MT70	.;ZBBX_HUMAN	T	343;343;343;343;314	ENSP00000376519:P343T;ENSP00000376520:P343T;ENSP00000390232:P343T;ENSP00000305065:P343T;ENSP00000376517:P314T	ENSP00000305065:P343T	P	-	1	0	ZBBX	168518036	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.898000	0.04105	-0.350000	0.08262	-0.271000	0.10264	CCA		0.338	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		14	107	1	0	0.00316338	0.003163	0.00331238	14	107				
SPATA16	83893	broad.mit.edu	37	3	172642104	172642104	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:172642104T>C	ENST00000351008.3	-	8	1415	c.1232A>G	c.(1231-1233)cAt>cGt	p.H411R		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	411					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)		p.H411R(1)		breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			AGGTGTTTTATGCTCTAAAAA	0.328																																							uc003fin.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1231-1233)CAT>CGT		spermatogenesis associated 16							86.0	84.0	85.0					3																	172642104		2203	4300	6503	SO:0001583	missense	83893				cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding	g.chr3:172642104T>C	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1232A>G	3.37:g.172642104T>C	ENSP00000341765:p.His411Arg		Somatic					p.H411R	NM_031955	NP_114161	WXS	Illumina HiSeq	Unspecified	Q9BXB7	SPT16_HUMAN	LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)		8	1390	-	Ovarian(172;0.00319)|Breast(254;0.197)		411					Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	c.1232A>G	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487101	0.44249	.	.	ENSG00000144962	ENST00000351008	T	0.16597	2.33	5.81	4.65	0.58169	.	0.526463	0.20178	N	0.097598	T	0.13114	0.0318	L	0.27053	0.805	0.26506	N	0.974685	B	0.31548	0.328	B	0.33521	0.165	T	0.16070	-1.0415	10	0.66056	D	0.02	-2.5523	8.4696	0.32977	0.0:0.1552:0.0:0.8448	.	411	Q9BXB7	SPT16_HUMAN	R	411	ENSP00000341765:H411R	ENSP00000341765:H411R	H	-	2	0	SPATA16	174124798	0.985000	0.35326	1.000000	0.80357	0.985000	0.73830	1.570000	0.36439	1.027000	0.39758	0.455000	0.32223	CAT		0.328	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955		34	81	0	0	0	0.003271	0	34	81				
EIF4A2	1974	broad.mit.edu	37	3	186504304	186504304	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr3:186504304C>G	ENST00000323963.5	+	7	705	c.641C>G	c.(640-642)tCt>tGt	p.S214C	EIF4A2_ENST00000356531.5_Missense_Mutation_p.S119C|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA|SNORA4_ENST00000584302.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.S215C|SNORA81_ENST00000408493.2_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	214	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.S214C(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GTGTTGCTTTCTGCCACAATG	0.378			T	BCL6	NHL																																		uc003fqs.2		NA		Dom	yes		3	3q27.3	1974	T	"""eukaryotic translation initiation factor 4A, isoform 2"""			L	BCL6		NHL		1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(640-642)TCT>TGT		eukaryotic translation initiation factor 4A2							102.0	104.0	103.0					3																	186504304		2203	4299	6502	SO:0001583	missense	1974				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity	g.chr3:186504304C>G	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.641C>G	3.37:g.186504304C>G	ENSP00000326381:p.Ser214Cys		Somatic				EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.S215C|EIF4A2_uc003fqv.2_Missense_Mutation_p.S119C|EIF4A2_uc003fqw.2_Missense_Mutation_p.S119C|EIF4A2_uc011bsb.1_Missense_Mutation_p.S87C|MIR1248_hsa-mir-1248|MI0006383_5'Flank|SNORA81_uc010hyv.1_5'Flank|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	p.S214C	NM_001967	NP_001958	WXS	Illumina HiSeq	Unspecified	Q14240	IF4A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)	7	680	+	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		214			Helicase ATP-binding.		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	c.641C>G	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808842	0.70797	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.12774	2.65;2.65;2.65	5.13	5.13	0.70059	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	H	0.99650	4.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;0.999	T	0.78669	-0.2114	10	0.87932	D	0	-27.6825	16.4642	0.84073	0.0:1.0:0.0:0.0	.	70;119;215;214	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	C	214;215;119	ENSP00000326381:S214C;ENSP00000398370:S215C;ENSP00000348925:S119C	ENSP00000326381:S214C	S	+	2	0	EIF4A2	187986998	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.075000	0.76798	2.827000	0.97445	0.650000	0.86243	TCT		0.378	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967		4	107	0	0	0	0.000602	0	4	107				
QDPR	5860	broad.mit.edu	37	4	17506088	17506088	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr4:17506088T>A	ENST00000281243.5	-	3	388	c.209A>T	c.(208-210)gAg>gTg	p.E70V	QDPR_ENST00000428702.2_Missense_Mutation_p.E39V|QDPR_ENST00000508623.1_Missense_Mutation_p.E70V|QDPR_ENST00000513615.1_Missense_Mutation_p.E70V	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	70					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)	p.E70V(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						CTTTCCAACCTCAGCAGTCAC	0.453																																							uc003gpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(208-210)GAG>GTG		quinoid dihydropteridine reductase	NADH(DB00157)						115.0	110.0	112.0					4																	17506088		2203	4300	6503	SO:0001583	missense	5860				dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity	g.chr4:17506088T>A	AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.209A>T	4.37:g.17506088T>A	ENSP00000281243:p.Glu70Val		Somatic				QDPR_uc003gpe.2_Missense_Mutation_p.E39V|QDPR_uc003gpf.2_RNA	p.E70V	NM_000320	NP_000311	WXS	Illumina HiSeq	Unspecified	P09417	DHPR_HUMAN			3	389	-			70					A8K158|B3KW71|Q53F52|Q9H3M5	Missense_Mutation	SNP	ENST00000281243.5	37	c.209A>T	CCDS3421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.98|14.98	2.696461|2.696461	0.48202|0.48202	.|.	.|.	ENSG00000151552|ENSG00000151552	ENST00000513615;ENST00000281243;ENST00000428702;ENST00000508623|ENST00000505710	D;D;D;D|.	0.94931|.	-3.56;-2.08;-3.24;-3.56|.	5.5|5.5	5.5|5.5	0.81552|0.81552	NAD(P)-binding domain (1);|.	0.264156|.	0.42821|.	D|.	0.000652|.	T|T	0.42966|0.42966	0.1226|0.1226	N|N	0.20685|0.20685	0.6|0.6	0.42623|0.42623	D|D	0.993352|0.993352	B;B|.	0.27140|.	0.169;0.02|.	B;B|.	0.28553|.	0.091;0.014|.	T|T	0.37009|0.37009	-0.9724|-0.9724	10|5	0.27082|.	T|.	0.32|.	-9.3834|-9.3834	10.7135|10.7135	0.45997|0.45997	0.0:0.0:0.1598:0.8402|0.0:0.0:0.1598:0.8402	.|.	39;70|.	B3KW71;P09417|.	.;DHPR_HUMAN|.	V|W	70;70;39;70|46	ENSP00000422759:E70V;ENSP00000281243:E70V;ENSP00000390944:E39V;ENSP00000426377:E70V|.	ENSP00000281243:E70V|.	E|R	-|-	2|1	0|2	QDPR|QDPR	17115186|17115186	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.897000|0.897000	0.52465|0.52465	3.996000|3.996000	0.57009|0.57009	2.082000|2.082000	0.62665|0.62665	0.460000|0.460000	0.39030|0.39030	GAG|AGG		0.453	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250372.1	NM_000320		31	56	0	0	0	0.012213	0	31	56				
MUC7	4589	broad.mit.edu	37	4	71346522	71346522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr4:71346522G>T	ENST00000304887.5	+	3	251	c.61G>T	c.(61-63)Gaa>Taa	p.E21*	MUC7_ENST00000413702.1_Nonsense_Mutation_p.E21*|MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000456088.1_Nonsense_Mutation_p.E21*	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	21					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.E21*(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			gcagTTCAGTGAAGGTCGAGA	0.403																																							uc011cat.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(61-63)GAA>TAA		mucin 7, secreted precursor							109.0	108.0	108.0					4																	71346522		2203	4300	6503	SO:0001587	stop_gained	4589					extracellular region	protein binding	g.chr4:71346522G>T	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.61G>T	4.37:g.71346522G>T	ENSP00000302021:p.Glu21*		Somatic				MUC7_uc011cau.1_Nonsense_Mutation_p.E21*|MUC7_uc003hfj.2_Nonsense_Mutation_p.E21*	p.E21*	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	349	+			21					Q9UCD7|Q9UCD8	Nonsense_Mutation	SNP	ENST00000304887.5	37	c.61G>T	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131998	0.77662	.	.	ENSG00000171195	ENST00000413702;ENST00000505411;ENST00000456088;ENST00000304887	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6009	11.5705	0.50830	0.0:0.0:1.0:0.0	.	.	.	.	X	21	.	ENSP00000302021:E21X	E	+	1	0	MUC7	71381111	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	3.214000	0.51161	2.432000	0.82394	0.655000	0.94253	GAA		0.403	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		34	154	1	0	4.34311e-12	0.003271	5.41016e-12	34	154				
CENPE	1062	broad.mit.edu	37	4	104061004	104061004	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr4:104061004T>C	ENST00000265148.3	-	38	6235	c.6146A>G	c.(6145-6147)gAa>gGa	p.E2049G	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2049					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.E2049G(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTGAGAGATTCTTTTATCCT	0.353																																							uc003hxb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(4)	9						c.(6145-6147)GAA>GGA		centromere protein E							159.0	153.0	155.0					4																	104061004		2203	4300	6503	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104061004T>C	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6146A>G	4.37:g.104061004T>C	ENSP00000265148:p.Glu2049Gly		Somatic				CENPE_uc003hxc.1_Intron|CENPE_uc003hxd.1_Intron	p.E2049G	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	38	6236	-			2049			Potential.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.6146A>G	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910704	0.72983	.	.	ENSG00000138778	ENST00000265148;ENST00000394771	T	0.72282	-0.64	5.05	5.05	0.67936	.	.	.	.	.	T	0.78704	0.4325	M	0.62723	1.935	0.28098	N	0.931524	D	0.60575	0.988	P	0.57204	0.815	T	0.73335	-0.4015	9	0.56958	D	0.05	.	13.8134	0.63276	0.0:0.0:0.0:1.0	.	2049	Q02224	CENPE_HUMAN	G	2049	ENSP00000265148:E2049G	ENSP00000265148:E2049G	E	-	2	0	CENPE	104280453	0.052000	0.20516	0.500000	0.27589	0.938000	0.57974	1.970000	0.40520	1.903000	0.55091	0.450000	0.29827	GAA		0.353	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				22	57	0	0	0	0.003954	0	22	57				
TET2	54790	broad.mit.edu	37	4	106156700	106156700	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr4:106156700G>C	ENST00000540549.1	+	3	2461	c.1601G>C	c.(1600-1602)aGa>aCa	p.R534T	TET2_ENST00000305737.2_Missense_Mutation_p.R534T|TET2_ENST00000413648.2_Missense_Mutation_p.R534T|TET2_ENST00000380013.4_Missense_Mutation_p.R534T|TET2_ENST00000394764.1_Missense_Mutation_p.R534T|TET2_ENST00000545826.1_Missense_Mutation_p.R534T|TET2_ENST00000513237.1_Missense_Mutation_p.R555T			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	534					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.R534T(2)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CAGTTGATGAGAAACAAAGAG	0.458			"""Mis N, F"""		MDS																																		uc003hxk.2		NA		Rec	yes		4	4q24	54790	Mis N|F	tet oncogene family member 2			L			MDS		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733						c.(1600-1602)AGA>ACA		tet oncogene family member 2 isoform a							76.0	72.0	73.0					4																	106156700		2203	4300	6503	SO:0001583	missense	54790				cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr4:106156700G>C	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.1601G>C	4.37:g.106156700G>C	ENSP00000442788:p.Arg534Thr		Somatic				TET2_uc011cez.1_Missense_Mutation_p.R555T|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.R534T|TET2_uc003hxi.1_Missense_Mutation_p.R534T	p.R534T	NM_001127208	NP_001120680	WXS	Illumina HiSeq	Unspecified	Q6N021	TET2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)	3	1987	+		Myeloproliferative disorder(5;0.0393)	534					B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	c.1601G>C	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	G	4.831	0.154404	0.09236	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3;2.3	5.12	4.26	0.50523	.	4.118860	0.00496	N	0.000147	T	0.14227	0.0344	N	0.14661	0.345	0.09310	N	1	B;B;B	0.25521	0.076;0.076;0.128	B;B;B	0.23716	0.013;0.013;0.048	T	0.11743	-1.0575	10	0.37606	T	0.19	.	11.3109	0.49364	0.0838:0.0:0.9162:0.0	.	555;534;534	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	T	534;534;534;555;534;534;534;534	ENSP00000306705:R534T;ENSP00000442788:R534T;ENSP00000442867:R534T;ENSP00000425443:R555T;ENSP00000369351:R534T;ENSP00000378245:R534T;ENSP00000391448:R534T	ENSP00000265149:R534T	R	+	2	0	TET2	106376149	0.999000	0.42202	0.377000	0.26055	0.108000	0.19459	3.593000	0.54001	2.384000	0.81235	0.650000	0.86243	AGA		0.458	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628		19	59	0	0	0	0.007413	0	19	59				
NPNT	255743	broad.mit.edu	37	4	106863478	106863478	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr4:106863478A>C	ENST00000379987.2	+	8	994	c.778A>C	c.(778-780)Atg>Ctg	p.M260L	NPNT_ENST00000305572.8_Missense_Mutation_p.M260L|NPNT_ENST00000427316.2_Missense_Mutation_p.M290L|NPNT_ENST00000506666.1_Missense_Mutation_p.M290L|NPNT_ENST00000514622.1_Missense_Mutation_p.M260L|NPNT_ENST00000453617.2_Missense_Mutation_p.M277L	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	260					branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.M260L(1)		kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		CCCAAAAGTTATGATTGAACC	0.353																																							uc003hya.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(778-780)ATG>CTG		nephronectin precursor							65.0	61.0	62.0					4																	106863478		2203	4300	6503	SO:0001583	missense	255743				cell differentiation	membrane	calcium ion binding	g.chr4:106863478A>C		CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.778A>C	4.37:g.106863478A>C	ENSP00000369323:p.Met260Leu		Somatic				NPNT_uc011cfc.1_Missense_Mutation_p.M277L|NPNT_uc011cfd.1_Missense_Mutation_p.M290L|NPNT_uc011cfe.1_Missense_Mutation_p.M290L|NPNT_uc010ilt.1_Missense_Mutation_p.M260L|NPNT_uc011cff.1_Missense_Mutation_p.M260L|NPNT_uc010ilu.1_Missense_Mutation_p.M156L	p.M260L	NM_001033047	NP_001028219	WXS	Illumina HiSeq	Unspecified	Q6UXI9	NPNT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)	8	983	+		Hepatocellular(203;0.217)	260					A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Missense_Mutation	SNP	ENST00000379987.2	37	c.778A>C	CCDS34046.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.38|12.38	1.919608|1.919608	0.33908|0.33908	.|.	.|.	ENSG00000168743|ENSG00000168743	ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451|ENST00000514837	T;T;T;T;T;T;T|.	0.77358|.	-0.69;-1.05;-0.78;-1.09;-0.78;-0.77;0.06|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.088458|.	0.85682|.	D|.	0.000000|.	T|T	0.30854|0.30854	0.0778|0.0778	N|N	0.08118|0.08118	0|0	0.33066|0.33066	D|D	0.534671|0.534671	B;B;B;B;B;B;B|.	0.24768|.	0.023;0.024;0.024;0.022;0.024;0.111;0.039|.	B;B;B;B;B;B;B|.	0.19391|.	0.011;0.014;0.014;0.011;0.024;0.025;0.011|.	T|T	0.42699|0.42699	-0.9436|-0.9436	10|5	0.25106|.	T|.	0.35|.	.|.	11.9511|11.9511	0.52956|0.52956	0.8553:0.1447:0.0:0.0|0.8553:0.1447:0.0:0.0	.|.	260;290;290;277;307;260;260|.	E9PF04;E9PE64;E9PCQ1;E9PCK8;D6RH31;Q6UXI9-2;Q6UXI9|.	.;.;.;.;.;.;NPNT_HUMAN|.	L|S	260;277;290;260;260;290;307|236	ENSP00000369323:M260L;ENSP00000402884:M277L;ENSP00000389252:M290L;ENSP00000422044:M260L;ENSP00000302557:M260L;ENSP00000422474:M290L;ENSP00000426146:M307L|.	ENSP00000302557:M260L|.	M|Y	+|+	1|2	0|0	NPNT|NPNT	107082927|107082927	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	2.441000|2.441000	0.44864|0.44864	1.942000|1.942000	0.56320|0.56320	0.459000|0.459000	0.35465|0.35465	ATG|TAT		0.353	NPNT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364083.1	NM_198278		27	46	0	0	0	0.008361	0	27	46				
CCT5	22948	broad.mit.edu	37	5	10256185	10256185	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:10256185G>C	ENST00000280326.4	+	4	870	c.450G>C	c.(448-450)aaG>aaC	p.K150N	CCT5_ENST00000506600.1_Missense_Mutation_p.K57N|CCT5_ENST00000515676.1_Missense_Mutation_p.K112N|CCT5_ENST00000503026.1_Missense_Mutation_p.K129N|CCT5_ENST00000515390.1_Missense_Mutation_p.K95N	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	150					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)	p.K150N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						ACCTGGACAAGATCAGCGATA	0.488																																							uc003jeq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(448-450)AAG>AAC		chaperonin containing TCP1, subunit 5 (epsilon)							102.0	78.0	86.0					5																	10256185		2203	4300	6503	SO:0001583	missense	22948				'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding	g.chr5:10256185G>C	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.450G>C	5.37:g.10256185G>C	ENSP00000280326:p.Lys150Asn		Somatic				CCT5_uc011cmq.1_Intron|CCT5_uc003jer.2_Missense_Mutation_p.K150N|CCT5_uc010its.2_Missense_Mutation_p.K150N|CCT5_uc011cmr.1_Missense_Mutation_p.K95N|CCT5_uc011cms.1_Missense_Mutation_p.K112N|CCT5_uc011cmt.1_Missense_Mutation_p.K57N	p.K150N	NM_012073	NP_036205	WXS	Illumina HiSeq	Unspecified	P48643	TCPE_HUMAN			4	621	+			150					A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	ENST00000280326.4	37	c.450G>C	CCDS3877.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332136	0.41297	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	5.61	1.15	0.20763	.	0.268444	0.46758	D	0.000277	T	0.70745	0.3259	L	0.50919	1.6	0.58432	D	0.999992	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.14578	0.011;0.007;0.007;0.007;0.007	T	0.61053	-0.7140	10	0.40728	T	0.16	-8.2693	6.665	0.23035	0.3016:0.1532:0.5452:0.0	.	57;95;148;150;150	B4DYD8;E7ENZ3;Q9BU08;A8K2X8;P48643	.;.;.;.;TCPE_HUMAN	N	150;129;95;123;112;57	ENSP00000280326:K150N;ENSP00000423318:K129N;ENSP00000426923:K95N;ENSP00000427297:K112N;ENSP00000423052:K57N	ENSP00000280326:K150N	K	+	3	2	CCT5	10309185	0.999000	0.42202	0.998000	0.56505	0.998000	0.95712	0.527000	0.22987	0.284000	0.22305	0.644000	0.83932	AAG		0.488	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			3	42	0	0	0	0.001168	0	3	42				
CCT5	22948	broad.mit.edu	37	5	10258364	10258364	+	Silent	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:10258364G>C	ENST00000280326.4	+	5	1092	c.672G>C	c.(670-672)ctG>ctC	p.L224L	CCT5_ENST00000506600.1_Silent_p.L131L|CCT5_ENST00000515676.1_Silent_p.L186L|CCT5_ENST00000503026.1_Silent_p.L203L|CCT5_ENST00000515390.1_Silent_p.L169L	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	224					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)	p.L224L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						ACACTAAACTGATTAAGGGCG	0.483																																							uc003jeq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(670-672)CTG>CTC		chaperonin containing TCP1, subunit 5 (epsilon)							88.0	76.0	80.0					5																	10258364		2203	4300	6503	SO:0001819	synonymous_variant	22948				'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding	g.chr5:10258364G>C	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.672G>C	5.37:g.10258364G>C			Somatic				CCT5_uc011cmq.1_Silent_p.L71L|CCT5_uc003jer.2_Silent_p.L224L|CCT5_uc010its.2_Silent_p.L224L|CCT5_uc011cmr.1_Silent_p.L169L|CCT5_uc011cms.1_Silent_p.L186L|CCT5_uc011cmt.1_Silent_p.L131L	p.L224L	NM_012073	NP_036205	WXS	Illumina HiSeq	Unspecified	P48643	TCPE_HUMAN			5	843	+			224					A8JZY8|A8K2X8|B4DYD8	Silent	SNP	ENST00000280326.4	37	c.672G>C	CCDS3877.1																																																																																				0.483	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			4	67	0	0	0	0.009096	0	4	67				
CCT5	22948	broad.mit.edu	37	5	10258515	10258515	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:10258515G>C	ENST00000280326.4	+	6	1161	c.741G>C	c.(739-741)aaG>aaC	p.K247N	CCT5_ENST00000506600.1_Missense_Mutation_p.K154N|CCT5_ENST00000515676.1_Missense_Mutation_p.K209N|CCT5_ENST00000503026.1_Missense_Mutation_p.K226N|CCT5_ENST00000515390.1_Missense_Mutation_p.K192N	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	247					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)	p.K247N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						AAGATGCGAAGATTGCAATTC	0.408																																							uc003jeq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(739-741)AAG>AAC		chaperonin containing TCP1, subunit 5 (epsilon)							117.0	111.0	113.0					5																	10258515		2203	4300	6503	SO:0001583	missense	22948				'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding	g.chr5:10258515G>C	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.741G>C	5.37:g.10258515G>C	ENSP00000280326:p.Lys247Asn		Somatic				CCT5_uc011cmq.1_Missense_Mutation_p.K94N|CCT5_uc003jer.2_Missense_Mutation_p.K247N|CCT5_uc010its.2_Missense_Mutation_p.K247N|CCT5_uc011cmr.1_Missense_Mutation_p.K192N|CCT5_uc011cms.1_Missense_Mutation_p.K209N|CCT5_uc011cmt.1_Missense_Mutation_p.K154N	p.K247N	NM_012073	NP_036205	WXS	Illumina HiSeq	Unspecified	P48643	TCPE_HUMAN			6	912	+			247					A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	ENST00000280326.4	37	c.741G>C	CCDS3877.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687183	0.68157	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58	5.59	2.86	0.33363	.	0.085403	0.85682	D	0.000000	D	0.83788	0.5330	M	0.94101	3.495	0.80722	D	1	P;P;P;D;D;D	0.58970	0.708;0.598;0.943;0.984;0.984;0.984	P;P;P;P;P;P	0.62740	0.503;0.475;0.806;0.906;0.906;0.906	T	0.83011	-0.0172	10	0.66056	D	0.02	-33.8046	6.3226	0.21227	0.4149:0.0:0.5851:0.0	.	154;192;96;245;247;247	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	N	247;226;192;220;209;154	ENSP00000280326:K247N;ENSP00000423318:K226N;ENSP00000426923:K192N;ENSP00000427297:K209N;ENSP00000423052:K154N	ENSP00000280326:K247N	K	+	3	2	CCT5	10311515	1.000000	0.71417	0.987000	0.45799	0.970000	0.65996	3.328000	0.52052	0.745000	0.32763	0.650000	0.86243	AAG		0.408	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			22	156	0	0	0	0.004656	0	22	156				
CCT5	22948	broad.mit.edu	37	5	10258621	10258621	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:10258621G>T	ENST00000280326.4	+	6	1267	c.847G>T	c.(847-849)Gag>Tag	p.E283*	CCT5_ENST00000506600.1_Nonsense_Mutation_p.E190*|CCT5_ENST00000515676.1_Nonsense_Mutation_p.E245*|CCT5_ENST00000503026.1_Nonsense_Mutation_p.E262*|CCT5_ENST00000515390.1_Nonsense_Mutation_p.E228*	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	283					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)	p.E283*(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						ATACGAAAAGGAGAAATTTGA	0.373																																							uc003jeq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(847-849)GAG>TAG		chaperonin containing TCP1, subunit 5 (epsilon)							85.0	81.0	82.0					5																	10258621		2203	4300	6503	SO:0001587	stop_gained	22948				'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding	g.chr5:10258621G>T	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.847G>T	5.37:g.10258621G>T	ENSP00000280326:p.Glu283*		Somatic				CCT5_uc011cmq.1_Nonsense_Mutation_p.E130*|CCT5_uc003jer.2_Nonsense_Mutation_p.E283*|CCT5_uc010its.2_Nonsense_Mutation_p.E283*|CCT5_uc011cmr.1_Nonsense_Mutation_p.E228*|CCT5_uc011cms.1_Nonsense_Mutation_p.E245*|CCT5_uc011cmt.1_Nonsense_Mutation_p.E190*	p.E283*	NM_012073	NP_036205	WXS	Illumina HiSeq	Unspecified	P48643	TCPE_HUMAN			6	1018	+			283					A8JZY8|A8K2X8|B4DYD8	Nonsense_Mutation	SNP	ENST00000280326.4	37	c.847G>T	CCDS3877.1	.	.	.	.	.	.	.	.	.	.	G	42	9.271313	0.99120	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	.	.	.	5.35	5.35	0.76521	.	0.093557	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-24.741	18.1495	0.89669	0.0:0.0:1.0:0.0	.	.	.	.	X	283;262;228;256;245;190	.	ENSP00000280326:E283X	E	+	1	0	CCT5	10311621	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.262000	0.95591	2.513000	0.84729	0.650000	0.86243	GAG		0.373	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			23	101	1	0	1.10513e-12	0.014323	1.38862e-12	23	101				
CDH12	1010	broad.mit.edu	37	5	21752001	21752001	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:21752001T>A	ENST00000382254.1	-	15	3316	c.2230A>T	c.(2230-2232)Agt>Tgt	p.S744C	CDH12_ENST00000522262.1_Missense_Mutation_p.S704C|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.S744C|RP11-804N13.1_ENST00000522350.1_RNA	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	744					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S744C(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ACGGACCCACTCCCTTCGTAG	0.507										HNSCC(59;0.17)																													uc010iuc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2230-2232)AGT>TGT		cadherin 12, type 2 preproprotein							182.0	161.0	168.0					5																	21752001		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21752001T>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2230A>T	5.37:g.21752001T>A	ENSP00000371689:p.Ser744Cys	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Missense_Mutation_p.S704C|CDH12_uc003jgk.2_Missense_Mutation_p.S744C|uc003jgj.2_Intron	p.S744C	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			12	2688	-			744			Cytoplasmic (Potential).		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.2230A>T	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	T	8.553	0.875889	0.17395	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.77750	-1.12;-1.12;-1.12	4.94	3.77	0.43336	Cadherin, cytoplasmic domain (1);	0.812508	0.11767	N	0.531496	T	0.82204	0.4986	L	0.48218	1.51	0.09310	N	1	B;B	0.32302	0.363;0.225	P;B	0.51016	0.656;0.183	T	0.74478	-0.3652	10	0.66056	D	0.02	.	10.3952	0.44196	0.0:0.0777:0.0:0.9223	.	704;744	B7Z2U6;P55289	.;CAD12_HUMAN	C	744;744;704	ENSP00000423577:S744C;ENSP00000371689:S744C;ENSP00000428786:S704C	ENSP00000371689:S744C	S	-	1	0	CDH12	21787758	0.007000	0.16637	0.002000	0.10522	0.035000	0.12851	1.683000	0.37638	0.747000	0.32809	0.383000	0.25322	AGT		0.507	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		12	120	0	0	0	0.004007	0	12	120				
ZFR	51663	broad.mit.edu	37	5	32379244	32379244	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:32379244T>A	ENST00000265069.8	-	17	2914	c.2812A>T	c.(2812-2814)Act>Tct	p.T938S	AC008949.1_ENST00000411029.1_RNA|ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	938	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T938S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TCAGACCAAGTTGGAACTCGC	0.403																																							uc003jhr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2812-2814)ACT>TCT		zinc finger RNA binding protein							78.0	74.0	75.0					5																	32379244		2203	4300	6503	SO:0001583	missense	51663				multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding	g.chr5:32379244T>A	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2812A>T	5.37:g.32379244T>A	ENSP00000265069:p.Thr938Ser		Somatic				ZFR_uc010ium.1_Missense_Mutation_p.T69S|ZFR_uc011cny.1_RNA	p.T938S	NM_016107	NP_057191	WXS	Illumina HiSeq	Unspecified	Q96KR1	ZFR_HUMAN		STAD - Stomach adenocarcinoma(35;0.19)	17	2892	-			938			DZF.		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	c.2812A>T	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	T	14.02	2.410023	0.42715	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.44083	0.93	5.7	4.51	0.55191	DZF (2);	0.046932	0.85682	D	0.000000	T	0.57460	0.2055	L	0.59967	1.855	0.58432	D	0.999998	D;B	0.65815	0.995;0.258	D;B	0.64506	0.926;0.134	T	0.58244	-0.7670	10	0.56958	D	0.05	.	12.8444	0.57821	0.0:0.0:0.1363:0.8637	.	917;938	B5MEH6;Q96KR1	.;ZFR_HUMAN	S	938;917	ENSP00000265069:T938S	ENSP00000265069:T938S	T	-	1	0	ZFR	32415001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.266000	0.72540	0.945000	0.37605	0.482000	0.46254	ACT		0.403	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			13	32	0	0	0	0.007413	0	13	32				
ARL15	54622	broad.mit.edu	37	5	53409207	53409207	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:53409207T>A	ENST00000504924.1	-	4	380	c.287A>T	c.(286-288)tAc>tTc	p.Y96F	ARL15_ENST00000510591.2_5'UTR|ARL15_ENST00000502271.1_5'UTR|ARL15_ENST00000507646.2_Missense_Mutation_p.Y96F	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	96					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)	p.Y96F(1)|p.Y84F(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				TCCTTGGTAGTAGCGGCTCCA	0.408																																							uc003jpg.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(286-288)TAC>TTC		ADP-ribosylation factor-like 15							80.0	75.0	76.0					5																	53409207		1843	4090	5933	SO:0001583	missense	54622						GTP binding	g.chr5:53409207T>A	BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.287A>T	5.37:g.53409207T>A	ENSP00000433427:p.Tyr96Phe		Somatic				ARL15_uc010ivs.1_RNA	p.Y96F	NM_019087	NP_061960	WXS	Illumina HiSeq	Unspecified	Q9NXU5	ARL15_HUMAN			4	381	-		Lung NSC(810;0.000779)	96					Q6IAD0	Missense_Mutation	SNP	ENST00000504924.1	37	c.287A>T	CCDS54850.1	.	.	.	.	.	.	.	.	.	.	T	34	5.310385	0.95629	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;T	0.78595	-1.19;-1.19	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.89343	0.6688	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90914	0.4778	10	0.87932	D	0	-15.4941	16.3083	0.82859	0.0:0.0:0.0:1.0	.	96	Q9NXU5	ARL15_HUMAN	F	96	ENSP00000433427:Y96F;ENSP00000432680:Y96F	ENSP00000433427:Y96F	Y	-	2	0	ARL15	53444964	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.250000	0.74265	0.455000	0.32223	TAC		0.408	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368432.2	NM_019087		14	44	0	0	0	0.004007	0	14	44				
RASGRF2	5924	broad.mit.edu	37	5	80388718	80388718	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:80388718T>A	ENST00000265080.4	+	10	1556	c.1489T>A	c.(1489-1491)Tta>Ata	p.L497I		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	497	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L497I(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ACAATGCTTCTTATTTACAAA	0.393																																							uc003kha.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(1489-1491)TTA>ATA		Ras protein-specific guanine							114.0	114.0	114.0					5																	80388718		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80388718T>A	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1489T>A	5.37:g.80388718T>A	ENSP00000265080:p.Leu497Ile		Somatic				RASGRF2_uc011ctn.1_RNA	p.L497I	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	10	1489	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	497			PH 2.		B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.1489T>A	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.716794	0.68844	.	.	ENSG00000113319	ENST00000265080	T	0.68765	-0.35	5.27	0.0519	0.14300	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.195954	0.42821	D	0.000641	T	0.73953	0.3653	M	0.83012	2.62	0.36233	D	0.852741	D	0.53151	0.958	P	0.53809	0.735	T	0.79215	-0.1895	10	0.87932	D	0	.	9.964	0.41712	0.0:0.2753:0.0:0.7247	.	497	O14827	RGRF2_HUMAN	I	497	ENSP00000265080:L497I	ENSP00000265080:L497I	L	+	1	2	RASGRF2	80424474	1.000000	0.71417	0.998000	0.56505	0.699000	0.40488	1.297000	0.33400	0.080000	0.16959	-0.256000	0.11100	TTA		0.393	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		16	147	0	0	0	0.007413	0	16	147				
LNPEP	4012	broad.mit.edu	37	5	96329658	96329658	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:96329658C>T	ENST00000231368.5	+	6	2082	c.1390C>T	c.(1390-1392)Cat>Tat	p.H464Y	LNPEP_ENST00000395770.3_Missense_Mutation_p.H450Y	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	464					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H464Y(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AATCATTGCTCATGAGCTGGC	0.448																																							uc003kmv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1390-1392)CAT>TAT		leucyl/cystinyl aminopeptidase isoform 1							107.0	108.0	108.0					5																	96329658		2203	4300	6503	SO:0001583	missense	4012				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr5:96329658C>T	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1390C>T	5.37:g.96329658C>T	ENSP00000231368:p.His464Tyr		Somatic				LNPEP_uc003kmw.1_Missense_Mutation_p.H450Y	p.H464Y	NM_005575	NP_005566	WXS	Illumina HiSeq	Unspecified	Q9UIQ6	LCAP_HUMAN		COAD - Colon adenocarcinoma(37;0.072)	6	1904	+		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)	464			Extracellular (Potential).	Zinc; catalytic (By similarity).	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	c.1390C>T	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559258	0.86335	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.20069	2.1;2.1	4.89	4.89	0.63831	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.62720	0.2451	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77699	-0.2490	10	0.87932	D	0	.	18.0246	0.89264	0.0:1.0:0.0:0.0	.	464	Q9UIQ6	LCAP_HUMAN	Y	464;450	ENSP00000231368:H464Y;ENSP00000379117:H450Y	ENSP00000231368:H464Y	H	+	1	0	LNPEP	96355414	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.767000	0.85331	2.409000	0.81822	0.655000	0.94253	CAT		0.448	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575		21	105	0	0	0	0.00333	0	21	105				
APC	324	broad.mit.edu	37	5	112178162	112178162	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:112178162C>T	ENST00000457016.1	+	16	7251	c.6871C>T	c.(6871-6873)Caa>Taa	p.Q2291*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q2291*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q2291*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2291	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q2291*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAGACATCCCAAATAGGTGG	0.488		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	uc010jby.2		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	D|Mis|N|F|S	adenomatous polyposis of the colon gene			"""E, M, O"""		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS		2	Substitution - Nonsense(1)|Unknown(1)	p.?(1)	lung(1)|skin(1)	large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515						c.(6871-6873)CAA>TAA		adenomatous polyposis coli							55.0	52.0	53.0					5																	112178162		2202	4300	6502	SO:0001587	stop_gained	324	Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	g.chr5:112178162C>T	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6871C>T	5.37:g.112178162C>T	ENSP00000413133:p.Gln2291*	TSP Lung(16;0.13)	Somatic				APC_uc011cvt.1_Nonsense_Mutation_p.Q2273*|APC_uc003kpz.3_Nonsense_Mutation_p.Q2291*|APC_uc003kpy.3_Nonsense_Mutation_p.Q2291*|APC_uc010jbz.2_Nonsense_Mutation_p.Q2008*|APC_uc010jca.2_Nonsense_Mutation_p.Q1591*	p.Q2291*	NM_001127511	NP_001120983	WXS	Illumina HiSeq	Unspecified	P25054	APC_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	16	7251	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	2291			Ser-rich.		D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	c.6871C>T	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	42	9.433446	0.99169	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.02	6.02	0.97574	.	0.456401	0.26362	N	0.024808	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8261	11.922	0.52797	0.1273:0.7346:0.1381:0.0	.	.	.	.	X	2291	.	.	Q	+	1	0	APC	112206061	0.640000	0.27243	0.293000	0.24932	0.097000	0.18754	1.143000	0.31553	2.857000	0.98124	0.650000	0.86243	CAA		0.488	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		7	60	0	0	0	0.00308	0	7	60				
PCDHAC1	56135	broad.mit.edu	37	5	140307479	140307479	+	Silent	SNP	C	C	T	rs372774238		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:140307479C>T	ENST00000253807.2	+	1	1002	c.1002C>T	c.(1000-1002)aaC>aaT	p.N334N	PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHAC1_ENST00000409700.3_Silent_p.N334N|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	334	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N334N(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACGTGAACGATCATGCCC	0.537																																							uc003lih.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)	5						c.(1000-1002)AAC>AAT		protocadherin alpha subfamily C, 1 isoform 1							178.0	163.0	168.0					5																	140307479		2203	4300	6503	SO:0001819	synonymous_variant	56135				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140307479C>T	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1002C>T	5.37:g.140307479C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Silent_p.N334N	p.N334N	NM_018898	NP_061721	WXS	Illumina HiSeq	Unspecified	Q9H158	PCDC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1178	+			334			Extracellular (Potential).|Cadherin 3.		Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	c.1002C>T	CCDS4241.1																																																																																				0.537	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898		33	217	0	0	0	0.003271	0	33	217				
PCDHB13	56123	broad.mit.edu	37	5	140595778	140595778	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:140595778G>T	ENST00000341948.4	+	1	2270	c.2083G>T	c.(2083-2085)Gcc>Tcc	p.A695S		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	695					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A695S(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCGTTGGCCTCGGTGTC	0.687																																							uc003lja.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(2083-2085)GCC>TCC		protocadherin beta 13 precursor							86.0	90.0	88.0					5																	140595778		2197	4284	6481	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140595778G>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2083G>T	5.37:g.140595778G>T	ENSP00000345491:p.Ala695Ser		Somatic					p.A695S	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2270	+			695			Helical; (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.2083G>T	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	-	36	5.859216	0.97036	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.38240	1.15	3.5	3.5	0.40072	.	.	.	.	.	T	0.58694	0.2140	H	0.98314	4.2	0.42195	D	0.99174	P	0.50819	0.939	B	0.42555	0.391	T	0.79492	-0.1781	9	0.62326	D	0.03	.	15.0318	0.71713	0.0:0.0:1.0:0.0	.	695	Q9Y5F0	PCDBD_HUMAN	S	695;695;641	ENSP00000345491:A695S	ENSP00000345491:A695S	A	+	1	0	PCDHB13	140575962	0.998000	0.40836	0.853000	0.33588	0.764000	0.43329	2.526000	0.45607	1.688000	0.51068	0.298000	0.19748	GCC		0.687	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		49	170	1	0	2.9001e-28	0.01441	4.02947e-28	49	170				
PCDHGB4	8641	broad.mit.edu	37	5	140768714	140768714	+	Silent	SNP	G	G	A	rs530113846	byFrequency	TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:140768714G>A	ENST00000519479.1	+	1	1263	c.1263G>A	c.(1261-1263)acG>acA	p.T421T	PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T421T(1)		endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACCGTTACGGCAACAGATC	0.448																																							uc003lkc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1261-1263)ACG>ACA		protocadherin gamma subfamily B, 4 isoform 1							123.0	128.0	127.0					5																	140768714		1958	4152	6110	SO:0001819	synonymous_variant	8641				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140768714G>A	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1263G>A	5.37:g.140768714G>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.T421T	p.T421T	NM_003736	NP_003727	WXS	Illumina HiSeq	Unspecified	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1263	+			421			Cadherin 4.|Extracellular (Potential).		O15099|Q2M267|Q9UN64	Silent	SNP	ENST00000519479.1	37	c.1263G>A	CCDS54928.1																																																																																				0.448	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		20	135	0	0	0	0.014323	0	20	135				
PCDHGA11	56105	broad.mit.edu	37	5	140802658	140802658	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr5:140802658G>A	ENST00000398587.2	+	1	1897	c.1864G>A	c.(1864-1866)Gag>Aag	p.E622K	PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.E622K|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E622K(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGGTGGGGGAGCACACGGG	0.667																																							uc003lkq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1864-1866)GAG>AAG		protocadherin gamma subfamily A, 11 isoform 1							46.0	55.0	52.0					5																	140802658		2202	4300	6502	SO:0001583	missense	56105				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140802658G>A	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1864G>A	5.37:g.140802658G>A	ENSP00000381589:p.Glu622Lys		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.E622K|PCDHGA11_uc003lkp.1_Missense_Mutation_p.E622K	p.E622K	NM_018914	NP_061737	WXS	Illumina HiSeq	Unspecified	Q9Y5H2	PCDGB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2122	+			622			Extracellular (Potential).|Cadherin 6.		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	c.1864G>A	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	g	4.234	0.042265	0.08196	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;D	0.94687	0.7;-3.49	5.37	3.57	0.40892	Cadherin (4);Cadherin-like (1);	0.000000	0.24585	U	0.037267	D	0.87803	0.6269	N	0.16037	0.36	0.09310	N	1	B;B;B	0.14012	0.001;0.009;0.002	B;B;B	0.15052	0.003;0.006;0.012	T	0.79697	-0.1695	10	0.87932	D	0	.	10.1928	0.43037	0.0:0.6351:0.2915:0.0734	.	622;622;622	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	K	622	ENSP00000381589:E622K;ENSP00000428333:E622K	ENSP00000381589:E622K	E	+	1	0	PCDHGA11	140782842	0.000000	0.05858	1.000000	0.80357	0.015000	0.08874	-1.269000	0.02834	0.642000	0.30620	-0.270000	0.10280	GAG		0.667	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		7	66	0	0	0	0.006214	0	7	66				
FAM8A1	51439	broad.mit.edu	37	6	17600920	17600920	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:17600920G>A	ENST00000259963.3	+	1	335	c.280G>A	c.(280-282)Gag>Aag	p.E94K		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	94						integral component of membrane (GO:0016021)		p.E94K(1)|p.E94Q(1)		endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			GGCGGGCTGCGAGGCGCCCGA	0.731																																							uc003ncc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(280-282)GAG>AAG		family with sequence similarity 8, member A1							8.0	9.0	9.0					6																	17600920		1943	3891	5834	SO:0001583	missense	51439					integral to membrane		g.chr6:17600920G>A	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.280G>A	6.37:g.17600920G>A	ENSP00000259963:p.Glu94Lys		Somatic					p.E94K	NM_016255	NP_057339	WXS	Illumina HiSeq	Unspecified	Q9UBU6	FA8A1_HUMAN	all cancers(50;0.176)|Epithelial(50;0.204)		1	403	+	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	94					B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	c.280G>A	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264359	0.59431	.	.	ENSG00000137414	ENST00000259963	.	.	.	3.27	3.27	0.37495	.	0.665957	0.13296	N	0.398619	T	0.07503	0.0189	L	0.27053	0.805	0.25404	N	0.988415	P	0.36438	0.553	B	0.20384	0.029	T	0.09228	-1.0684	9	0.21540	T	0.41	-4.5181	8.4962	0.33130	0.0:0.0:0.7685:0.2315	.	94	Q9UBU6	FA8A1_HUMAN	K	94	.	ENSP00000259963:E94K	E	+	1	0	FAM8A1	17708899	0.989000	0.36119	0.299000	0.25016	0.280000	0.26924	3.423000	0.52756	1.751000	0.51876	0.484000	0.47621	GAG		0.731	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1			7	5	0	0	0	0.008291	0	7	5				
ZBED9	114821	broad.mit.edu	37	6	28541412	28541412	+	Missense_Mutation	SNP	C	C	A	rs137872757	byFrequency	TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:28541412C>A	ENST00000452236.2	-	4	2871	c.2254G>T	c.(2254-2256)Ggt>Tgt	p.G752C	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.G752C(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						agtacttcaccatcaattaca	0.333																																							uc003nlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2254-2256)GGT>TGT		SCAN domain containing 3							74.0	66.0	69.0					6																	28541412		2202	4300	6502	SO:0001583	missense	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28541412C>A																												ENST00000452236.2:c.2254G>T	6.37:g.28541412C>A	ENSP00000395259:p.Gly752Cys		Somatic					p.G752C	NM_052923	NP_443155	WXS	Illumina HiSeq	Unspecified	Q6R2W3	SCND3_HUMAN			4	2872	-			752						Missense_Mutation	SNP	ENST00000452236.2	37	c.2254G>T	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003387	0.35320	.	.	ENSG00000232040	ENST00000452236	T	0.01527	4.8	2.14	2.14	0.27477	.	0.342338	0.16953	U	0.192786	T	0.01870	0.0059	L	0.29908	0.895	0.30084	N	0.808958	D	0.89917	1.0	D	0.91635	0.999	T	0.50180	-0.8858	10	0.62326	D	0.03	.	7.8595	0.29501	0.0:1.0:0.0:0.0	.	752	Q6R2W3	SCND3_HUMAN	C	752	ENSP00000395259:G752C	ENSP00000395259:G752C	G	-	1	0	SCAND3	28649391	1.000000	0.71417	0.983000	0.44433	0.804000	0.45430	1.852000	0.39348	1.508000	0.48769	0.563000	0.77884	GGT		0.333	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			7	26	1	0	0.000157383	0.00308	0.000165999	7	26				
HSPA1L	3305	broad.mit.edu	37	6	31777944	31777944	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:31777944C>G	ENST00000375654.4	-	2	1995	c.1806G>C	c.(1804-1806)gaG>gaC	p.E602D	HSPA1L_ENST00000417199.3_Missense_Mutation_p.E602D	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	602			E -> K (in dbSNP:rs2075800). {ECO:0000269|Ref.5}.		binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.E602D(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TACACATCTGCTCCAATTCCT	0.478																																							uc003nxh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pleura(1)|kidney(1)|skin(1)	6						c.(1804-1806)GAG>GAC		heat shock 70kDa protein 1-like							137.0	123.0	127.0					6																	31777944		2203	4300	6503	SO:0001583	missense	3305				response to unfolded protein		ATP binding	g.chr6:31777944C>G	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1806G>C	6.37:g.31777944C>G	ENSP00000364805:p.Glu602Asp		Somatic				HSPA1L_uc010jte.2_Missense_Mutation_p.E602D	p.E602D	NM_005527	NP_005518	WXS	Illumina HiSeq	Unspecified	P34931	HS71L_HUMAN			2	1989	-			602					A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	c.1806G>C	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.477685	0.26511	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.17691	2.26;2.26	5.94	3.19	0.36642	.	0.000000	0.35067	N	0.003477	T	0.29620	0.0739	M	0.91663	3.23	0.46901	D	0.99924	P	0.48834	0.916	P	0.58391	0.838	T	0.13495	-1.0507	10	0.87932	D	0	-23.9259	7.2961	0.26393	0.0:0.6747:0.0:0.3253	.	602	P34931	HS71L_HUMAN	D	602;602;547	ENSP00000364805:E602D;ENSP00000387691:E602D	ENSP00000364804:E547D	E	-	3	2	HSPA1L	31885923	1.000000	0.71417	0.878000	0.34440	0.345000	0.29048	1.356000	0.34079	0.828000	0.34709	0.591000	0.81541	GAG		0.478	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			13	109	0	0	0	0.003163	0	13	109				
ZNF318	24149	broad.mit.edu	37	6	43316154	43316154	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:43316154C>G	ENST00000361428.2	-	6	3057	c.2980G>C	c.(2980-2982)Gac>Cac	p.D994H	ZNF318_ENST00000318149.3_Missense_Mutation_p.D994H	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	994					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.D994H(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TCTCTACTGTCACTTAAAGAC	0.438																																							uc003oux.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(2980-2982)GAC>CAC		zinc finger protein 318							219.0	216.0	217.0					6																	43316154		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43316154C>G	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2980G>C	6.37:g.43316154C>G	ENSP00000354964:p.Asp994His		Somatic				ZNF318_uc003ouw.2_RNA	p.D994H	NM_014345	NP_055160	WXS	Illumina HiSeq	Unspecified	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		6	3058	-			994					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.2980G>C	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270601	0.59540	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.33654	1.4;2.62	6.03	6.03	0.97812	.	0.194501	0.44483	D	0.000450	T	0.41880	0.1178	N	0.24115	0.695	0.37871	D	0.930073	D	0.89917	1.0	D	0.91635	0.999	T	0.35624	-0.9781	10	0.52906	T	0.07	-15.4007	20.5568	0.99304	0.0:1.0:0.0:0.0	.	994	Q5VUA4	ZN318_HUMAN	H	994	ENSP00000323032:D994H;ENSP00000354964:D994H	ENSP00000323032:D994H	D	-	1	0	ZNF318	43424132	0.994000	0.37717	1.000000	0.80357	0.496000	0.33645	2.763000	0.47605	2.861000	0.98227	0.655000	0.94253	GAC		0.438	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		6	392	0	0	0	0.001984	0	6	392				
CDC5L	988	broad.mit.edu	37	6	44371578	44371578	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:44371578T>G	ENST00000371477.3	+	6	871	c.572T>G	c.(571-573)cTt>cGt	p.L191R		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	191	Nuclear localization signal. {ECO:0000255}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)	p.L191R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGAAGAGAACTTCGAGCAGCT	0.383																																							uc003oxl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|kidney(1)|skin(1)	6						c.(571-573)CTT>CGT		CDC5-like							51.0	55.0	53.0					6																	44371578		2203	4299	6502	SO:0001583	missense	988				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|cytoplasm|nuclear speck|nucleolus	DNA binding|RNA binding	g.chr6:44371578T>G	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.572T>G	6.37:g.44371578T>G	ENSP00000360532:p.Leu191Arg		Somatic					p.L191R	NM_001253	NP_001244	WXS	Illumina HiSeq	Unspecified	Q99459	CDC5L_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		6	831	+	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		191			Potential.		Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	37	c.572T>G	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779518	0.90195	.	.	ENSG00000096401	ENST00000371477	T	0.47177	0.85	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.75324	0.3834	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.84171	0.0434	10	0.87932	D	0	-12.0952	16.3594	0.83251	0.0:0.0:0.0:1.0	.	191	Q99459	CDC5L_HUMAN	R	191	ENSP00000360532:L191R	ENSP00000360532:L191R	L	+	2	0	CDC5L	44479556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.833000	0.86765	2.266000	0.75297	0.455000	0.32223	CTT		0.383	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1			14	65	0	0	0	0.00499	0	14	65				
DST	667	broad.mit.edu	37	6	56462573	56462573	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:56462573G>A	ENST00000361203.3	-	43	11534	c.11527C>T	c.(11527-11529)Cag>Tag	p.Q3843*	DST_ENST00000370769.4_Nonsense_Mutation_p.Q3845*|DST_ENST00000421834.2_Nonsense_Mutation_p.Q1757*|DST_ENST00000244364.6_Nonsense_Mutation_p.Q1431*|DST_ENST00000446842.2_Nonsense_Mutation_p.Q3519*|DST_ENST00000370788.2_Nonsense_Mutation_p.Q1757*|DST_ENST00000312431.6_Nonsense_Mutation_p.Q3843*|DST_ENST00000370754.5_Nonsense_Mutation_p.Q4023*			Q03001	DYST_HUMAN	dystonin	3843					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.Q1431*(1)|p.Q3845*(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGATTCTCCTGAGTGGTTCCA	0.383																																							uc003pdf.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(5803-5805)CAG>TAG		dystonin isoform 2							200.0	185.0	190.0					6																	56462573		1942	4148	6090	SO:0001587	stop_gained	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56462573G>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.11527C>T	6.37:g.56462573G>A	ENSP00000354508:p.Gln3843*		Somatic				DST_uc003pcz.3_Nonsense_Mutation_p.Q1757*|DST_uc011dxj.1_Nonsense_Mutation_p.Q1786*|DST_uc011dxk.1_Nonsense_Mutation_p.Q1797*|DST_uc003pcy.3_Nonsense_Mutation_p.Q1431*|DST_uc010kaa.1_RNA	p.Q1935*	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		41	5831	-	Lung NSC(77;0.103)		3843					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	37	c.5803C>T		.	.	.	.	.	.	.	.	.	.	G	52	18.680818	0.99909	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	.	.	.	5.67	1.75	0.24633	.	0.529435	0.16785	N	0.199620	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	9.0255	0.36227	0.0:0.4792:0.3921:0.1288	.	.	.	.	X	1431;4023;3845;1757;3519;3843;1757;3843	.	ENSP00000244364:Q1431X	Q	-	1	0	DST	56570532	0.749000	0.28305	0.650000	0.29550	0.573000	0.36030	0.717000	0.25851	0.087000	0.17167	-0.219000	0.12488	CAG		0.383	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		20	104	0	0	0	0.010504	0	20	104				
MMS22L	253714	broad.mit.edu	37	6	97679434	97679434	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:97679434C>A	ENST00000275053.4	-	13	1662	c.1397G>T	c.(1396-1398)tGt>tTt	p.C466F	MMS22L_ENST00000369251.2_Missense_Mutation_p.C426F	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	466					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.C466F(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TTTATCGCAACAGCAAGTCTT	0.343																																							uc003ppb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1396-1398)TGT>TTT		hypothetical protein LOC253714							95.0	92.0	93.0					6																	97679434		2203	4300	6503	SO:0001583	missense	253714				double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding	g.chr6:97679434C>A		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1397G>T	6.37:g.97679434C>A	ENSP00000275053:p.Cys466Phe		Somatic				C6orf167_uc011eaf.1_Missense_Mutation_p.C426F|C6orf167_uc010kcn.1_Missense_Mutation_p.C240F	p.C466F	NM_198468	NP_940870	WXS	Illumina HiSeq	Unspecified	Q6ZRQ5	MMS22_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0457)	13	1663	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)	466					D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	c.1397G>T	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	6.647	0.487948	0.12641	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.35048	1.33;1.33	4.78	2.91	0.33838	.	0.120753	0.56097	D	0.000026	T	0.20170	0.0485	M	0.74258	2.255	0.58432	D	0.999998	B;B	0.13145	0.007;0.004	B;B	0.11329	0.006;0.004	T	0.05241	-1.0897	10	0.49607	T	0.09	-2.3041	8.0515	0.30581	0.1564:0.7612:0.0:0.0824	.	426;466	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	F	466;426	ENSP00000275053:C466F;ENSP00000358254:C426F	ENSP00000275053:C466F	C	-	2	0	MMS22L	97786155	0.998000	0.40836	0.998000	0.56505	0.153000	0.21895	2.252000	0.43196	0.375000	0.24679	0.655000	0.94253	TGT		0.343	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468		8	66	1	0	5.16669e-11	0.010729	6.27383e-11	8	66				
SOBP	55084	broad.mit.edu	37	6	107854781	107854782	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr6:107854781_107854782GG>CT	ENST00000317357.5	+	4	1199_1200	c.540_541GG>CT	c.(538-543)gcGGcc>gcCTcc	p.A181S		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)									p.A181S(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		AGTGCTTTGCGGCCTGCCGACG	0.55																																							uc003prx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(538-543)GCGGCC>GCCTCC		sine oculis binding protein homolog																																				SO:0001583	missense	55084						metal ion binding	g.chr6:107854781_107854782GG>CT	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	Exception_encountered	6.37:g.107854781_107854782delinsCT	ENSP00000318900:p.Ala181Ser		Somatic				SOBP_uc003prw.1_Missense_Mutation_p.A181S	p.A181S	NM_018013	NP_060483	WXS	Illumina HiSeq	Unspecified	A7XYQ1	SOBP_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)	4	1044_1045	+		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)	181						Missense_Mutation	DNP	ENST00000317357.5	37	c.540_541GG>CT	CCDS43488.1																																																																																				0.550	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013		23	134	0	0	0	0.004672	0	23	134				
RADIL	55698	broad.mit.edu	37	7	4874839	4874839	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:4874839C>T	ENST00000399583.3	-	4	1002	c.815G>A	c.(814-816)cGg>cAg	p.R272Q	RADIL_ENST00000538469.1_Missense_Mutation_p.R32Q|RADIL_ENST00000536091.1_Missense_Mutation_p.R272Q	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	272					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)		p.R272Q(1)		NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACCGTGTGCCGGTCCCGGTT	0.652																																							uc003snj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7						c.(814-816)CGG>CAG		Rap GTPase interactor							18.0	25.0	23.0					7																	4874839		2176	4262	6438	SO:0001583	missense	55698				cell adhesion|multicellular organismal development|signal transduction		protein binding	g.chr7:4874839C>T	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.815G>A	7.37:g.4874839C>T	ENSP00000382492:p.Arg272Gln		Somatic				RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_5'Flank|RADIL_uc011jwc.1_Missense_Mutation_p.R32Q|RADIL_uc011jwd.1_RNA	p.R272Q	NM_018059	NP_060529	WXS	Illumina HiSeq	Unspecified	Q96JH8	RADIL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	4	988	-		Ovarian(82;0.0175)	272					A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	c.815G>A	CCDS43544.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.581|6.581	0.475549|0.475549	0.12521|0.12521	.|.	.|.	ENSG00000157927|ENSG00000157927	ENST00000544486|ENST00000399583;ENST00000536091;ENST00000538469	.|T;T;T	.|0.06371	.|3.31;3.31;3.31	4.75|4.75	-0.306|-0.306	0.12780|0.12780	.|Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	.|0.730467	.|0.13294	.|N	.|0.398817	T|T	0.02418|0.02418	0.0074|0.0074	N|N	0.11131|0.11131	0.1|0.1	0.29505|0.29505	N|N	0.85463|0.85463	.|B	.|0.12013	.|0.005	.|B	.|0.04013	.|0.001	T|T	0.46048|0.46048	-0.9219|-0.9219	6|10	0.56958|0.09590	D|T	0.05|0.72	-2.0556|-2.0556	2.9803|2.9803	0.05951|0.05951	0.2412:0.2458:0.0:0.5131|0.2412:0.2458:0.0:0.5131	.|.	.|272	.|Q96JH8	.|RADIL_HUMAN	S|Q	7|272;272;32	.|ENSP00000382492:R272Q;ENSP00000442533:R272Q;ENSP00000442966:R32Q	ENSP00000437686:G7S|ENSP00000382492:R272Q	G|R	-|-	1|2	0|0	RADIL|RADIL	4841365|4841365	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.997000|0.997000	0.91878|0.91878	1.812000|1.812000	0.38952|0.38952	0.026000|0.026000	0.15269|0.15269	0.655000|0.655000	0.94253|0.94253	GGC|CGG		0.652	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059		3	29	0	0	0	0.004672	0	3	29				
ZDHHC4	55146	broad.mit.edu	37	7	6628266	6628266	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:6628266C>G	ENST00000396706.2	+	8	1203	c.760C>G	c.(760-762)Cca>Gca	p.P254A	AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000396713.2_Missense_Mutation_p.P254A|ZDHHC4_ENST00000335965.6_Missense_Mutation_p.P254A|C7orf26_ENST00000359073.5_5'Flank|ZDHHC4_ENST00000396709.1_Missense_Mutation_p.P254A|ZDHHC4_ENST00000405731.3_Missense_Mutation_p.P254A|ZDHHC4_ENST00000396707.2_Missense_Mutation_p.P254A|C7orf26_ENST00000344417.5_5'Flank			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	254						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P254A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		CCTGACTTTTCCACGGATTGT	0.537																																							uc003sqi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|pancreas(1)	2						c.(760-762)CCA>GCA		zinc finger, DHHC-type containing 4							211.0	188.0	196.0					7																	6628266		2203	4300	6503	SO:0001583	missense	55146					integral to membrane	acyltransferase activity|zinc ion binding	g.chr7:6628266C>G	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.760C>G	7.37:g.6628266C>G	ENSP00000379934:p.Pro254Ala		Somatic				ZDHHC4_uc003sql.2_Missense_Mutation_p.P254A|ZDHHC4_uc003sqh.2_Missense_Mutation_p.P254A|ZDHHC4_uc003sqj.2_Missense_Mutation_p.P254A|ZDHHC4_uc003sqk.2_Missense_Mutation_p.P254A|ZDHHC4_uc003sqm.2_Missense_Mutation_p.P254A|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	p.P254A	NM_001134388	NP_001127860	WXS	Illumina HiSeq	Unspecified	Q9NPG8	ZDHC4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)	9	1118	+		Ovarian(82;0.232)	254					A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Missense_Mutation	SNP	ENST00000396706.2	37	c.760C>G	CCDS5352.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955063	0.73902	.	.	ENSG00000136247	ENST00000405731;ENST00000396713;ENST00000396707;ENST00000335965;ENST00000396709;ENST00000396706	T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51679	-0.8675	10	0.40728	T	0.16	-12.9279	15.4607	0.75353	0.0:1.0:0.0:0.0	.	254	Q9NPG8	ZDHC4_HUMAN	A	254	ENSP00000385027:P254A;ENSP00000379941:P254A;ENSP00000379935:P254A;ENSP00000337475:P254A;ENSP00000379937:P254A;ENSP00000379934:P254A	ENSP00000337475:P254A	P	+	1	0	ZDHHC4	6594791	1.000000	0.71417	0.854000	0.33618	0.790000	0.44656	7.506000	0.81665	2.412000	0.81896	0.655000	0.94253	CCA		0.537	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207477.3	NM_018106		46	288	0	0	0	0.01441	0	46	288				
TWISTNB	221830	broad.mit.edu	37	7	19738143	19738143	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:19738143C>A	ENST00000222567.5	-	4	883	c.813G>T	c.(811-813)tgG>tgT	p.W271C		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	271	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.W271C(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						GCTCCTCCTCCCAGATGCCAT	0.473																																							uc003sup.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(811-813)TGG>TGT		TWIST neighbor							287.0	310.0	302.0					7																	19738143		2203	4300	6503	SO:0001583	missense	221830					microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity	g.chr7:19738143C>A	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.813G>T	7.37:g.19738143C>A	ENSP00000222567:p.Trp271Cys		Somatic					p.W271C	NM_001002926	NP_001002926	WXS	Illumina HiSeq	Unspecified	Q3B726	RPA43_HUMAN			4	834	-			271			Lys-rich.		A0PJ45|B7Z724	Missense_Mutation	SNP	ENST00000222567.5	37	c.813G>T	CCDS34606.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.484360	0.26598	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.84	-7.01	0.01594	.	1.477610	0.03093	N	0.160111	T	0.32041	0.0816	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29058	-1.0024	9	0.38643	T	0.18	12.4601	14.4909	0.67649	0.7391:0.1782:0.0827:0.0	.	271	Q3B726	RPA43_HUMAN	C	271	.	ENSP00000222567:W271C	W	-	3	0	TWISTNB	19704668	0.000000	0.05858	0.000000	0.03702	0.399000	0.30720	-0.900000	0.04097	-0.724000	0.04908	-0.516000	0.04426	TGG		0.473	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1			180	574	1	0	1.41964e-80	0.01441	2.05138e-80	180	574				
NPC1L1	29881	broad.mit.edu	37	7	44553237	44553237	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:44553237T>A	ENST00000289547.4	-	20	3944	c.3889A>T	c.(3889-3891)Aac>Tac	p.N1297Y	NPC1L1_ENST00000546276.1_Missense_Mutation_p.N1224Y|NPC1L1_ENST00000381160.3_Missense_Mutation_p.N1270Y	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1297					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.N1297Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AGAGCCGGGTTAACGTCAGGC	0.607																																							uc003tlb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3889-3891)AAC>TAC		Niemann-Pick C1-like protein 1 isoform 1	Ezetimibe(DB00973)						54.0	56.0	56.0					7																	44553237		2203	4300	6503	SO:0001583	missense	29881				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding	g.chr7:44553237T>A		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3889A>T	7.37:g.44553237T>A	ENSP00000289547:p.Asn1297Tyr		Somatic				NPC1L1_uc003tlc.2_Missense_Mutation_p.N1270Y|NPC1L1_uc011kbw.1_Missense_Mutation_p.N1224Y|NPC1L1_uc003tla.2_3'UTR	p.N1297Y	NM_013389	NP_037521	WXS	Illumina HiSeq	Unspecified	Q9UHC9	NPCL1_HUMAN			20	3945	-			1297			Cytoplasmic (Potential).		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	c.3889A>T	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.825970	0.32237	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	T;T;T	0.58797	0.31;0.31;0.31	3.49	3.49	0.39957	.	0.062472	0.64402	D	0.000012	T	0.56093	0.1962	L	0.34521	1.04	0.35387	D	0.790426	D;D;D	0.76494	0.995;0.999;0.999	P;D;D	0.67231	0.903;0.95;0.915	T	0.57843	-0.7741	10	0.02654	T	1	-35.5149	10.616	0.45451	0.0:0.0:0.0:1.0	.	1224;1270;1297	B7ZLE6;Q17RV5;D3DVK9	.;.;.	Y	1297;1270;1224	ENSP00000289547:N1297Y;ENSP00000370552:N1270Y;ENSP00000438033:N1224Y	ENSP00000289547:N1297Y	N	-	1	0	NPC1L1	44519762	0.983000	0.35010	0.353000	0.25747	0.046000	0.14306	2.978000	0.49305	1.830000	0.53286	0.379000	0.24179	AAC		0.607	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		28	86	0	0	0	0.013726	0	28	86				
KCTD7	154881	broad.mit.edu	37	7	66104162	66104162	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:66104162C>T	ENST00000275532.3	+	4	997	c.813C>T	c.(811-813)ctC>ctT	p.L271L	KCTD7_ENST00000443322.1_Silent_p.L271L	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	271					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.L271L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						ACAAGCACCTCGTGAACCACT	0.587																																							uc003tve.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(811-813)CTC>CTT		potassium channel tetramerisation domain							94.0	75.0	81.0					7																	66104162		2203	4300	6503	SO:0001819	synonymous_variant	154881					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr7:66104162C>T	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.813C>T	7.37:g.66104162C>T			Somatic				RABGEF1_uc003tvf.2_Intron|KCTD7_uc003tvd.3_Silent_p.L271L	p.L271L	NM_153033	NP_694578	WXS	Illumina HiSeq	Unspecified	Q96MP8	KCTD7_HUMAN			4	975	+			271					A4D2M4|Q8IVR0	Silent	SNP	ENST00000275532.3	37	c.813C>T	CCDS5534.1																																																																																				0.587	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033		13	86	0	0	0	0.001855	0	13	86				
CLIP2	7461	broad.mit.edu	37	7	73768246	73768246	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:73768246G>T	ENST00000395060.1	+	3	715	c.715G>T	c.(715-717)Ggg>Tgg	p.G239W	CLIP2_ENST00000361545.5_Missense_Mutation_p.G239W|CLIP2_ENST00000223398.6_Missense_Mutation_p.G239W			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	239	CAP-Gly 2. {ECO:0000255|PROSITE- ProRule:PRU00045}.					cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)		p.G239W(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GCGGTACGTGGGGGAGACAGA	0.647																																							uc003uam.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(715-717)GGG>TGG		CAP-GLY domain containing linker protein 2							133.0	111.0	119.0					7																	73768246		2203	4300	6503	SO:0001583	missense	7461					microtubule associated complex		g.chr7:73768246G>T	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.715G>T	7.37:g.73768246G>T	ENSP00000378500:p.Gly239Trp		Somatic				CLIP2_uc003uan.2_Missense_Mutation_p.G239W	p.G239W	NM_003388	NP_003379	WXS	Illumina HiSeq	Unspecified	Q9UDT6	CLIP2_HUMAN			4	1042	+			239			CAP-Gly 2.		O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	c.715G>T	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723511	0.68959	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	D;D;D	0.97870	-4.58;-4.58;-4.58	5.5	5.5	0.81552	Cytoskeleton-associated protein, Gly-rich domain (4);Cytoskeleton-associated protein, Gly-rich conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	H	0.99783	4.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97889	1.0296	10	0.87932	D	0	-76.4731	18.1332	0.89608	0.0:0.0:1.0:0.0	.	239;239	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	W	239	ENSP00000223398:G239W;ENSP00000355151:G239W;ENSP00000378500:G239W	ENSP00000223398:G239W	G	+	1	0	CLIP2	73406182	1.000000	0.71417	0.998000	0.56505	0.166000	0.22503	9.399000	0.97285	2.861000	0.98227	0.655000	0.94253	GGG		0.647	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388		19	174	1	0	1.2644e-06	0.010504	1.40005e-06	19	174				
PCLO	27445	broad.mit.edu	37	7	82387923	82387923	+	Nonsense_Mutation	SNP	T	T	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:82387923T>A	ENST00000333891.9	-	25	15734	c.15397A>T	c.(15397-15399)Aaa>Taa	p.K5133*		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.K5133*(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACCAAAAGTTTGTGCCAGTTG	0.393																																							uc003uhx.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(7)	7						c.(15397-15399)AAA>TAA		piccolo isoform 1							268.0	255.0	259.0					7																	82387923		1851	4092	5943	SO:0001587	stop_gained	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82387923T>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15397A>T	7.37:g.82387923T>A	ENSP00000334319:p.Lys5133*		Somatic					p.K5133*	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			25	15686	-			5056						Nonsense_Mutation	SNP	ENST00000333891.9	37	c.15397A>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	57	28.229744	0.99973	.	.	ENSG00000186472	ENST00000333891	.	.	.	5.51	5.51	0.81932	.	0.000000	0.46442	U	0.000290	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.6222	0.76816	0.0:0.0:0.0:1.0	.	.	.	.	X	5133	.	ENSP00000334319:K5133X	K	-	1	0	PCLO	82225859	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	2.100000	0.63781	0.477000	0.44152	AAA		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		28	187	0	0	0	0.010818	0	28	187				
PCLO	27445	broad.mit.edu	37	7	82784916	82784916	+	Silent	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:82784916C>A	ENST00000333891.9	-	2	1378	c.1041G>T	c.(1039-1041)ggG>ggT	p.G347G	PCLO_ENST00000423517.2_Silent_p.G347G	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.G347G(3)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTTCACTGTCCCTGGTTGTT	0.587																																							uc003uhx.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(7)	7						c.(1039-1041)GGG>GGT		piccolo isoform 1							47.0	47.0	47.0					7																	82784916		1958	4146	6104	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82784916C>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1041G>T	7.37:g.82784916C>A			Somatic				PCLO_uc003uhv.2_Silent_p.G347G	p.G347G	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			2	1330	-			320			Gln-rich.|Pro-rich.			Silent	SNP	ENST00000333891.9	37	c.1041G>T	CCDS47630.1																																																																																				0.587	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		6	43	1	0	8.12818e-05	0.001984	8.60456e-05	6	43				
DLX6	1750	broad.mit.edu	37	7	96637044	96637044	+	Silent	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:96637044G>A	ENST00000518156.2	+	2	961	c.531G>A	c.(529-531)ctG>ctA	p.L177L	DLX6_ENST00000555308.1_Silent_p.L49L|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6_ENST00000007660.5_Silent_p.L149L|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS2_ENST00000606174.1_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	59					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L149L(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					ATTCCAGCCTGCAGCTCCAGG	0.468																																							uc003uom.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(445-447)CTG>CTA		distal-less homeobox 6							47.0	46.0	47.0					7																	96637044		1856	4105	5961	SO:0001819	synonymous_variant	1750				nervous system development|skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:96637044G>A		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.531G>A	7.37:g.96637044G>A			Somatic				DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron	p.L149L	NM_005222	NP_005213	WXS	Illumina HiSeq	Unspecified	P56179	DLX6_HUMAN			3	447	+	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)		59			Homeobox.		A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	ENST00000518156.2	37	c.447G>A	CCDS47647.2																																																																																				0.468	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222		5	15	0	0	0	0.00308	0	5	15				
CPED1	79974	broad.mit.edu	37	7	120629802	120629802	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:120629802G>T	ENST00000310396.5	+	2	594	c.127G>T	c.(127-129)Gcc>Tcc	p.A43S	CPED1_ENST00000340646.5_Missense_Mutation_p.A43S|CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000450913.2_Missense_Mutation_p.A43S	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	43						endoplasmic reticulum (GO:0005783)		p.A43S(1)									GAAGCTCACAGCCGCTGCCCC	0.572																																							uc003vjq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(127-129)GCC>TCC		hypothetical protein LOC79974 isoform 1							100.0	102.0	101.0					7																	120629802		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120629802G>T		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.127G>T	7.37:g.120629802G>T	ENSP00000309772:p.Ala43Ser		Somatic				C7orf58_uc003vjr.1_Missense_Mutation_p.A43S|C7orf58_uc003vjs.3_Missense_Mutation_p.A43S	p.A43S	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			2	574	+	all_neural(327;0.117)		43					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.127G>T	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	4.927	0.172184	0.09391	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000340646	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.54	2.49	0.30216	.	0.530493	0.18553	N	0.137843	T	0.26666	0.0652	L	0.33137	0.985	0.09310	N	1	B;B	0.31193	0.312;0.028	B;B	0.25884	0.064;0.007	T	0.12400	-1.0549	10	0.42905	T	0.14	.	6.4489	0.21892	0.17:0.0:0.6531:0.177	.	43;43	A4D0V7-2;A4D0V7	.;CG058_HUMAN	S	43	ENSP00000309772:A43S;ENSP00000398082:A43S;ENSP00000406122:A43S;ENSP00000345235:A43S	ENSP00000309772:A43S	A	+	1	0	C7orf58	120417038	0.000000	0.05858	0.004000	0.12327	0.095000	0.18619	0.289000	0.18957	0.717000	0.32145	0.655000	0.94253	GCC		0.572	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		14	134	1	0	2.32078e-09	0.003163	2.71541e-09	14	134				
CCDC136	64753	broad.mit.edu	37	7	128454821	128454821	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:128454821C>G	ENST00000297788.4	+	15	3260	c.2893C>G	c.(2893-2895)Cgc>Ggc	p.R965G	CCDC136_ENST00000471729.1_3'UTR|CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	965						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R965G(2)|p.R1081G(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GGAGGAGCTCCGCCAGCTCAG	0.547																																							uc003vnv.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(2893-2895)CGC>GGC		coiled-coil domain containing 136							27.0	30.0	29.0					7																	128454821		1896	4124	6020	SO:0001583	missense	64753					integral to membrane	protein binding	g.chr7:128454821C>G		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2893C>G	7.37:g.128454821C>G	ENSP00000297788:p.Arg965Gly		Somatic				CCDC136_uc003vnu.1_Intron|CCDC136_uc003vnw.1_Intron|CCDC136_uc003vnx.1_Missense_Mutation_p.R781G|CCDC136_uc010llq.1_Missense_Mutation_p.R334G|CCDC136_uc003vny.1_Intron	p.R965G	NM_022742	NP_073579	WXS	Illumina HiSeq	Unspecified	Q96JN2	CC136_HUMAN			15	3260	+			965			Potential.		A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	c.2893C>G	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285380	0.59867	.	.	ENSG00000128596	ENST00000297788;ENST00000397697	T	0.34275	1.37	6.16	0.677	0.17964	.	0.600532	0.17171	N	0.184268	T	0.30198	0.0757	M	0.66939	2.045	0.09310	N	1	B;B	0.26258	0.145;0.011	B;B	0.23852	0.049;0.008	T	0.18241	-1.0343	10	0.30854	T	0.27	-0.8715	5.5912	0.17301	0.0:0.5206:0.1407:0.3386	.	965;965	Q96JN2-4;Q96JN2	.;CC136_HUMAN	G	965	ENSP00000297788:R965G	ENSP00000297788:R965G	R	+	1	0	CCDC136	128242057	0.028000	0.19301	0.642000	0.29436	0.976000	0.68499	0.640000	0.24705	0.170000	0.19704	-0.142000	0.14014	CGC		0.547	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742		10	25	0	0	0	0.001855	0	10	25				
EXOC4	60412	broad.mit.edu	37	7	132973716	132973716	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:132973716G>T	ENST00000253861.4	+	3	346	c.317G>T	c.(316-318)tGc>tTc	p.C106F	EXOC4_ENST00000393161.2_Missense_Mutation_p.C106F|EXOC4_ENST00000539845.1_Missense_Mutation_p.C5F	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	106					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.C106F(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				CTGCTGCACTGCAAACGGGAT	0.423																																							uc003vrk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(316-318)TGC>TTC		SEC8 protein isoform a							105.0	91.0	96.0					7																	132973716		2203	4300	6503	SO:0001583	missense	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:132973716G>T	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.317G>T	7.37:g.132973716G>T	ENSP00000253861:p.Cys106Phe		Somatic				EXOC4_uc011kpo.1_Missense_Mutation_p.C5F|EXOC4_uc003vri.2_Missense_Mutation_p.C106F|EXOC4_uc003vrj.2_Missense_Mutation_p.C106F	p.C106F	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			3	352	+		Esophageal squamous(399;0.129)	106			Potential.		E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	c.317G>T	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117983	0.77323	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000539845	.	.	.	5.88	5.88	0.94601	Sec8 exocyst complex component specific domain (1);	0.000000	0.85682	D	0.000000	T	0.77384	0.4122	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.994	T	0.70306	-0.4908	9	0.21540	T	0.41	.	20.2441	0.98394	0.0:0.0:1.0:0.0	.	106;106	Q96A65;Q8TAR2	EXOC4_HUMAN;.	F	106;106;5	.	ENSP00000253861:C106F	C	+	2	0	EXOC4	132624256	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.462000	0.97649	2.774000	0.95407	0.655000	0.94253	TGC		0.423	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		9	70	1	0	3.09899e-07	0.004482	3.47134e-07	9	70				
AKR1B1	231	broad.mit.edu	37	7	134132119	134132119	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:134132119G>T	ENST00000285930.4	-	8	835	c.756C>A	c.(754-756)ttC>ttA	p.F252L	AKR1B1_ENST00000489022.1_5'Flank	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	252					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)	p.F252L(1)		kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	TCTGCATGGGGAACCGGATCA	0.542																																							uc003vrp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(754-756)TTC>TTA		aldo-keto reductase family 1, member B1	NADH(DB00157)|Sulindac(DB00605)						139.0	108.0	118.0					7																	134132119		2203	4300	6503	SO:0001583	missense	231				C21-steroid hormone biosynthetic process|carbohydrate metabolic process|response to stress	cytosol|extracellular space|nucleus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding	g.chr7:134132119G>T	J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.756C>A	7.37:g.134132119G>T	ENSP00000285930:p.Phe252Leu		Somatic				AKR1B1_uc003vrq.1_RNA	p.F252L	NM_001628	NP_001619	WXS	Illumina HiSeq	Unspecified	P15121	ALDR_HUMAN			8	830	-			252			NADP.		B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	ENST00000285930.4	37	c.756C>A	CCDS5831.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836371	0.71373	.	.	ENSG00000085662	ENST00000285930	T	0.14266	2.52	5.12	0.0961	0.14488	NADP-dependent oxidoreductase domain (3);	0.043064	0.85682	D	0.000000	T	0.19565	0.0470	M	0.62266	1.93	0.53005	D	0.999963	P	0.41102	0.738	P	0.48368	0.575	T	0.02037	-1.1225	10	0.87932	D	0	.	8.5015	0.33161	0.3946:0.0:0.6054:0.0	.	252	P15121	ALDR_HUMAN	L	252	ENSP00000285930:F252L	ENSP00000285930:F252L	F	-	3	2	AKR1B1	133782659	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	1.590000	0.36654	0.020000	0.15106	0.561000	0.74099	TTC		0.542	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339448.2	NM_001628		16	68	1	0	1.01871e-10	0.008871	1.2267e-10	16	68				
CNTNAP2	26047	broad.mit.edu	37	7	147914548	147914548	+	Missense_Mutation	SNP	C	C	A	rs369254596		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:147914548C>A	ENST00000361727.3	+	19	3695	c.3179C>A	c.(3178-3180)gCg>gAg	p.A1060E	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.A119E	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1060	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A1060E(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCACCAAGGCGCCCTGCATT	0.572										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(3178-3180)GCG>GAG		cell recognition molecule Caspr2 precursor							113.0	102.0	106.0					7																	147914548		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:147914548C>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3179C>A	7.37:g.147914548C>A	ENSP00000354778:p.Ala1060Glu	HNSCC(39;0.1)	Somatic					p.A1060E	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		19	3695	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	1060			Laminin G-like 4.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.3179C>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	30	5.056426	0.93793	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	T;T	0.77229	-1.08;-1.08	5.25	5.25	0.73442	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.135014	0.49916	D	0.000123	T	0.82102	0.4964	M	0.68952	2.095	0.45139	D	0.99815	P	0.42941	0.794	P	0.51355	0.667	T	0.77918	-0.2408	10	0.13470	T	0.59	.	17.4392	0.87561	0.0:1.0:0.0:0.0	.	1060	Q9UHC6	CNTP2_HUMAN	E	1060;119	ENSP00000354778:A1060E;ENSP00000440732:A119E	ENSP00000354778:A1060E	A	+	2	0	CNTNAP2	147545481	0.998000	0.40836	0.995000	0.50966	0.983000	0.72400	4.038000	0.57318	2.438000	0.82558	0.561000	0.74099	GCG		0.572	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			46	133	1	0	2.51966e-14	0.01441	3.22204e-14	46	133				
SLC4A2	6522	broad.mit.edu	37	7	150773267	150773267	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr7:150773267G>A	ENST00000485713.1	+	22	4679	c.3639G>A	c.(3637-3639)atG>atA	p.M1213I	SLC4A2_ENST00000461735.1_Missense_Mutation_p.M1199I|SLC4A2_ENST00000310317.5_Missense_Mutation_p.M1131I|SLC4A2_ENST00000392826.2_Missense_Mutation_p.M1204I|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000413384.2_Missense_Mutation_p.M1213I|RP11-148K1.12_ENST00000485974.1_RNA	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1213	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)	p.M1213I(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACCGAGAGATGAAATGTGTAA	0.617																																							uc003wit.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3637-3639)ATG>ATA		solute carrier family 4, anion exchanger, member							121.0	122.0	121.0					7																	150773267		2203	4300	6503	SO:0001583	missense	6522				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity	g.chr7:150773267G>A		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3639G>A	7.37:g.150773267G>A	ENSP00000419412:p.Met1213Ile		Somatic				SLC4A2_uc011kve.1_Missense_Mutation_p.M1204I|SLC4A2_uc003wiu.3_Missense_Mutation_p.M1199I|SLC4A2_uc003wiv.3_Missense_Mutation_p.M407I|uc011kvf.1_Missense_Mutation_p.H60Y	p.M1213I	NM_003040	NP_003031	WXS	Illumina HiSeq	Unspecified	P04920	B3A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	22	3895	+			1213			Membrane (anion exchange).		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	c.3639G>A	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786206	0.49997	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	4.97	4.97	0.65823	.	0.046400	0.85682	D	0.000000	T	0.47040	0.1424	N	0.21142	0.635	0.58432	D	0.999997	B;B;B	0.16396	0.006;0.017;0.01	B;B;B	0.16722	0.016;0.016;0.007	T	0.43734	-0.9373	10	0.49607	T;T	0.09;0.09	.	10.5526	0.45099	0.0883:0.0:0.9117:0.0	.	1204;1199;1213	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	I	1213;1213;1131;1204;1199	ENSP00000419412:M1213I;ENSP00000405600:M1213I;ENSP00000311402:M1131I;ENSP00000376571:M1204I;ENSP00000419164:M1199I	ENSP00000311402:M1131I;ENSP00000311402:M1131I	M	+	3	0	SLC4A2	150404200	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.466000	0.35310	2.594000	0.87642	0.655000	0.94253	ATG		0.617	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040		27	174	0	0	0	0.013726	0	27	174				
EFCAB1	79645	broad.mit.edu	37	8	49647699	49647699	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr8:49647699C>T	ENST00000262103.3	-	1	92	c.12G>A	c.(10-12)aaG>aaA	p.K4K	EFCAB1_ENST00000523092.1_Silent_p.K4K|EFCAB1_ENST00000433756.1_Silent_p.K4K|EFCAB1_ENST00000521002.1_5'UTR	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	4							calcium ion binding (GO:0005509)	p.K4K(1)		endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TCTGCAGTTTCTTGCGGTTCA	0.622																																							uc003xqo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(10-12)AAG>AAA		EF-hand calcium binding domain 1 isoform a							163.0	151.0	155.0					8																	49647699		2203	4300	6503	SO:0001819	synonymous_variant	79645						calcium ion binding	g.chr8:49647699C>T		CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.12G>A	8.37:g.49647699C>T			Somatic				EFCAB1_uc003xqn.3_RNA|EFCAB1_uc011ldj.1_Silent_p.K4K|EFCAB1_uc010lxx.2_RNA|EFCAB1_uc011ldk.1_RNA	p.K4K	NM_024593	NP_078869	WXS	Illumina HiSeq	Unspecified	Q9HAE3	EFCB1_HUMAN			1	172	-		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)	4					B4DSB4|E7EVN7	Silent	SNP	ENST00000262103.3	37	c.12G>A	CCDS6145.1																																																																																				0.622	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	NM_024593		21	152	0	0	0	0.00333	0	21	152				
ABRA	137735	broad.mit.edu	37	8	107773333	107773333	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr8:107773333C>T	ENST00000311955.3	-	2	1132	c.1078G>A	c.(1078-1080)Gta>Ata	p.V360I		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.V360I(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TCAAAGTCTACCAGTCCATGT	0.443																																							uc003ymm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1078-1080)GTA>ATA		actin-binding Rho activating protein							196.0	179.0	185.0					8																	107773333		2203	4300	6503	SO:0001583	missense	137735				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding	g.chr8:107773333C>T	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.1078G>A	8.37:g.107773333C>T	ENSP00000311436:p.Val360Ile		Somatic					p.V360I	NM_139166	NP_631905	WXS	Illumina HiSeq	Unspecified	Q8N0Z2	ABRA_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)		2	1132	-			360			Interaction with actin (By similarity).			Missense_Mutation	SNP	ENST00000311955.3	37	c.1078G>A	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206650	0.95033	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.73273	0.3566	L	0.38733	1.17	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69420	-0.5150	9	0.37606	T	0.19	-28.3389	20.3501	0.98811	0.0:1.0:0.0:0.0	.	360	Q8N0Z2	ABRA_HUMAN	I	360	.	ENSP00000311436:V360I	V	-	1	0	ABRA	107842509	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.814000	0.86154	2.807000	0.96579	0.650000	0.86243	GTA		0.443	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166		47	242	0	0	0	0.013114	0	47	242				
PKHD1L1	93035	broad.mit.edu	37	8	110461710	110461710	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr8:110461710A>G	ENST00000378402.5	+	40	6273	c.6169A>G	c.(6169-6171)Aat>Gat	p.N2057D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2057	IPT/TIG 13.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.N2059D(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATTCCATCTAATAATGGTAA	0.299										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(6169-6171)AAT>GAT		fibrocystin L precursor							52.0	50.0	51.0					8																	110461710		1818	4073	5891	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110461710A>G	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6169A>G	8.37:g.110461710A>G	ENSP00000367655:p.Asn2057Asp	HNSCC(38;0.096)	Somatic					p.N2057D	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		40	6273	+			2057			Extracellular (Potential).|IPT/TIG 13.		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.6169A>G	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825329	0.32237	.	.	ENSG00000205038	ENST00000378402	T	0.76448	-1.02	5.32	2.81	0.32909	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.444950	0.21740	N	0.069821	T	0.72875	0.3515	M	0.61703	1.905	0.22880	N	0.998617	B	0.19935	0.04	B	0.18561	0.022	T	0.61038	-0.7143	10	0.39692	T	0.17	.	11.4227	0.49991	0.4465:0.5535:0.0:0.0	.	2057	Q86WI1	PKHL1_HUMAN	D	2057	ENSP00000367655:N2057D	ENSP00000367655:N2057D	N	+	1	0	PKHD1L1	110530886	0.067000	0.21026	0.905000	0.35620	0.988000	0.76386	0.500000	0.22562	0.257000	0.21650	0.482000	0.46254	AAT		0.299	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		2	11	0	0	0	0.004672	0	2	11				
OC90	729330	broad.mit.edu	37	8	133036873	133036873	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr8:133036873T>C	ENST00000443356.2	-	15	1423	c.1337A>G	c.(1336-1338)cAc>cGc	p.H446R	OC90_ENST00000254627.3_Missense_Mutation_p.H430R|OC90_ENST00000262283.5_Missense_Mutation_p.H642R|OC90_ENST00000603859.1_Missense_Mutation_p.H430R			Q02509	OC90_HUMAN	otoconin 90	446					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.H642R(1)|p.H404R(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GGGCACAGGGTGCAGGCTGTC	0.647																																							uc003ytg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1288-1290)CAC>CGC		otoconin 90							18.0	22.0	21.0					8																	133036873		1982	4145	6127	SO:0001583	missense	729330				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity	g.chr8:133036873T>C	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.1337A>G	8.37:g.133036873T>C	ENSP00000390050:p.His446Arg		Somatic				OC90_uc011lix.1_Missense_Mutation_p.H430R	p.H430R	NM_001080399	NP_001073868	WXS	Illumina HiSeq	Unspecified	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)		13	1289	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		446					B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37	c.1289A>G		.	.	.	.	.	.	.	.	.	.	T	9.811	1.183287	0.21870	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.30448	1.54;1.55;1.53	5.6	-9.17	0.00691	.	1.516090	0.03719	N	0.251507	T	0.13841	0.0335	N	0.19112	0.55	0.09310	N	1	B;B	0.18610	0.029;0.003	B;B	0.17979	0.02;0.003	T	0.12268	-1.0554	10	0.25106	T	0.35	5.9634	2.6406	0.04970	0.1316:0.4011:0.2039:0.2634	.	430;446	Q02509-2;Q02509	.;OC90_HUMAN	R	430;446;642	ENSP00000254627:H430R;ENSP00000390050:H446R;ENSP00000262283:H642R	ENSP00000254627:H430R	H	-	2	0	RP11-240B13.2;OC90	133106055	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.578000	0.05841	-1.399000	0.02063	-0.242000	0.12053	CAC		0.647	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		11	16	0	0	0	0.00245	0	11	16				
PLEC	5339	broad.mit.edu	37	8	144992968	144992968	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr8:144992968C>T	ENST00000322810.4	-	32	11601	c.11432G>A	c.(11431-11433)cGt>cAt	p.R3811H	PLEC_ENST00000345136.3_Missense_Mutation_p.R3674H|PLEC_ENST00000398774.2_Missense_Mutation_p.R3642H|PLEC_ENST00000527096.1_Missense_Mutation_p.R3697H|PLEC_ENST00000356346.3_Missense_Mutation_p.R3660H|PLEC_ENST00000354958.2_Missense_Mutation_p.R3652H|PLEC_ENST00000436759.2_Missense_Mutation_p.R3701H|PLEC_ENST00000357649.2_Missense_Mutation_p.R3678H|PLEC_ENST00000354589.3_Missense_Mutation_p.R3674H	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3811	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.R3811H(1)|p.R3674H(1)|p.R3701H(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GAGAGCCTCACGGAGGCTCCT	0.652																																							uc003zaf.1		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(11431-11433)CGT>CAT		plectin isoform 1							25.0	31.0	29.0					8																	144992968		1941	4122	6063	SO:0001583	missense	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144992968C>T	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11432G>A	8.37:g.144992968C>T	ENSP00000323856:p.Arg3811His		Somatic				PLEC_uc003zab.1_Missense_Mutation_p.R3674H|PLEC_uc003zac.1_Missense_Mutation_p.R3678H|PLEC_uc003zad.2_Missense_Mutation_p.R3674H|PLEC_uc003zae.1_Missense_Mutation_p.R3642H|PLEC_uc003zag.1_Missense_Mutation_p.R3652H|PLEC_uc003zah.2_Missense_Mutation_p.R3660H|PLEC_uc003zaj.2_Missense_Mutation_p.R3701H	p.R3811H	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			32	11602	-			3811			Globular 2.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	c.11432G>A	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486298	0.26686	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	4.25	2.38	0.29361	.	0.000000	0.64402	U	0.000008	T	0.57110	0.2031	L	0.53249	1.67	0.49389	D	0.99978	B;B;B;B;B;B;B;B	0.25007	0.116;0.116;0.116;0.071;0.116;0.116;0.116;0.116	B;B;B;B;B;B;B;B	0.19391	0.025;0.025;0.025;0.011;0.025;0.025;0.025;0.025	T	0.58945	-0.7546	10	0.72032	D	0.01	.	8.0669	0.30665	0.0:0.7351:0.0:0.2649	.	3701;3660;3652;3811;3642;3674;3678;3674	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	H	3674;3678;3674;3642;3811;3652;3660;3701;3697	ENSP00000344848:R3674H;ENSP00000350277:R3678H;ENSP00000346602:R3674H;ENSP00000381756:R3642H;ENSP00000323856:R3811H;ENSP00000347044:R3652H;ENSP00000348702:R3660H;ENSP00000388180:R3701H;ENSP00000434583:R3697H	ENSP00000323856:R3811H	R	-	2	0	PLEC	145064956	0.998000	0.40836	0.635000	0.29338	0.846000	0.48090	3.898000	0.56281	1.000000	0.39049	0.448000	0.29417	CGT		0.652	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		8	60	0	0	0	0.006214	0	8	60				
SLC24A2	25769	broad.mit.edu	37	9	19786748	19786748	+	Silent	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:19786748G>T	ENST00000341998.2	-	1	178	c.117C>A	c.(115-117)gtC>gtA	p.V39V	SLC24A2_ENST00000286344.3_Silent_p.V39V	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	39					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.V39V(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		AAAGGCCTAAGACTCGAATTA	0.448																																							uc003zoa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(115-117)GTC>GTA		solute carrier family 24							129.0	132.0	131.0					9																	19786748		2203	4300	6503	SO:0001819	synonymous_variant	25769				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr9:19786748G>T	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.117C>A	9.37:g.19786748G>T			Somatic				SLC24A2_uc003zob.1_Silent_p.V39V	p.V39V	NM_020344	NP_065077	WXS	Illumina HiSeq	Unspecified	Q9UI40	NCKX2_HUMAN		GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)	1	179	-			39					B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	ENST00000341998.2	37	c.117C>A	CCDS6493.1																																																																																				0.448	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344		26	98	1	0	7.41945e-09	0.005443	8.61133e-09	26	98				
KIF24	347240	broad.mit.edu	37	9	34255858	34255858	+	Silent	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:34255858T>C	ENST00000402558.2	-	10	3771	c.3747A>G	c.(3745-3747)gaA>gaG	p.E1249E	KIF24_ENST00000345050.2_Silent_p.E1115E|KIF24_ENST00000379166.2_Silent_p.E1249E|KIF24_ENST00000379174.3_Silent_p.E1115E			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1249					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E731E(1)|p.E1249E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			ATGTGACATTTTCACTGTTGC	0.547											OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zua.3		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(3745-3747)GAA>GAG		kinesin family member 24							82.0	71.0	75.0					9																	34255858		2203	4300	6503	SO:0001819	synonymous_variant	347240				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:34255858T>C	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3747A>G	9.37:g.34255858T>C			Somatic	OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	846	KIF24_uc010mkb.2_Intron	p.E1249E	NM_194313	NP_919289	WXS	Illumina HiSeq	Unspecified	Q5T7B8	KIF24_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)		11	3867	-			1249					Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Silent	SNP	ENST00000402558.2	37	c.3747A>G	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.604913	0.00842	.	.	ENSG00000186638	ENST00000443226	.	.	.	4.73	0.676	0.17958	.	.	.	.	.	T	0.32164	0.0820	.	.	.	0.20489	N	0.999892	.	.	.	.	.	.	T	0.26780	-1.0093	4	.	.	.	.	7.5416	0.27742	0.0:0.6182:0.0:0.3818	.	.	.	.	E	201	.	.	K	-	1	0	KIF24	34245858	0.003000	0.15002	0.006000	0.13384	0.002000	0.02628	-0.093000	0.11111	-0.043000	0.13513	-1.179000	0.01719	AAA		0.547	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			19	48	0	0	0	0.008871	0	19	48				
GDA	9615	broad.mit.edu	37	9	74764526	74764526	+	Silent	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:74764526C>T	ENST00000358399.3	+	1	144	c.51C>T	c.(49-51)ttC>ttT	p.F17F	GDA_ENST00000545168.1_Intron|GDA_ENST00000238018.4_Silent_p.F17F|GDA_ENST00000376986.1_5'UTR|GDA_ENST00000376989.3_5'UTR	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	17					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)	p.F17F(4)		central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GAGGGACGTTCGTCCACTCCA	0.697																																							uc004aiq.2		NA																	4	Substitution - coding silent(4)		urinary_tract(2)|lung(2)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(49-51)TTC>TTT		guanine deaminase							32.0	26.0	28.0					9																	74764526		2202	4299	6501	SO:0001819	synonymous_variant	9615				nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding	g.chr9:74764526C>T	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.51C>T	9.37:g.74764526C>T			Somatic				GDA_uc011lse.1_Intron|GDA_uc011lsf.1_5'UTR|GDA_uc004air.2_Silent_p.F17F|GDA_uc010mow.1_RNA|GDA_uc004ais.2_5'UTR	p.F17F	NM_004293	NP_004284	WXS	Illumina HiSeq	Unspecified	Q9Y2T3	GUAD_HUMAN		Lung(182;0.0583)	1	234	+		Myeloproliferative disorder(762;0.0122)	17					B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Silent	SNP	ENST00000358399.3	37	c.51C>T	CCDS6641.1																																																																																				0.697	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1			13	25	0	0	0	0.007413	0	13	25				
PCSK5	5125	broad.mit.edu	37	9	78506251	78506251	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:78506251C>T	ENST00000545128.1	+	1	692	c.154C>T	c.(154-156)Cgt>Tgt	p.R52C	PCSK5_ENST00000376767.3_Missense_Mutation_p.R52C|PCSK5_ENST00000376752.4_Missense_Mutation_p.R52C	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	52					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.R52S(3)|p.R52C(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GGAGGCCAACCGTATCGCCAG	0.637																																							uc004ajz.2		NA																	6	Substitution - Missense(6)		lung(6)	ovary(2)|skin(1)	3						c.(154-156)CGT>TGT		proprotein convertase subtilisin/kexin type 5							60.0	69.0	66.0					9																	78506251		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78506251C>T		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.154C>T	9.37:g.78506251C>T	ENSP00000446280:p.Arg52Cys		Somatic				PCSK5_uc004ajy.2_Missense_Mutation_p.R52C|PCSK5_uc004aka.2_RNA	p.R52C	NM_006200	NP_006191	WXS	Illumina HiSeq	Unspecified	Q92824	PCSK5_HUMAN			1	692	+			52					F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.154C>T	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208274	0.79240	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	T;T;T	0.45276	0.9;0.9;0.9	5.17	4.2	0.49525	.	.	.	.	.	T	0.63010	0.2475	M	0.85630	2.765	0.49798	D	0.999826	D;D	0.76494	0.999;0.997	P;P	0.61275	0.886;0.772	T	0.69235	-0.5198	9	0.72032	D	0.01	.	12.0751	0.53638	0.2679:0.7321:0.0:0.0	.	52;52	Q92824-2;B1AMG5	.;.	C	52	ENSP00000446280:R52C;ENSP00000365958:R52C;ENSP00000365943:R52C	ENSP00000365943:R52C	R	+	1	0	PCSK5	77696071	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.907000	0.39897	2.407000	0.81776	0.561000	0.74099	CGT		0.637	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				16	124	0	0	0	0.010504	0	16	124				
PCSK5	5125	broad.mit.edu	37	9	78686660	78686660	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:78686660G>A	ENST00000545128.1	+	7	1278	c.740G>A	c.(739-741)gGa>gAa	p.G247E	PCSK5_ENST00000376767.3_Missense_Mutation_p.G247E|PCSK5_ENST00000376752.4_Missense_Mutation_p.G247E	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	247	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.G247E(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ATGCTGGACGGAGATGTCACG	0.522																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(739-741)GGA>GAA		proprotein convertase subtilisin/kexin type 5							143.0	140.0	141.0					9																	78686660		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78686660G>A		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.740G>A	9.37:g.78686660G>A	ENSP00000446280:p.Gly247Glu		Somatic				PCSK5_uc004ajy.2_Missense_Mutation_p.G247E|PCSK5_uc004aka.2_RNA	p.G247E	NM_006200	NP_006191	WXS	Illumina HiSeq	Unspecified	Q92824	PCSK5_HUMAN			7	1278	+			247			Catalytic.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.740G>A	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016438	0.93404	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	D;D;D	0.87966	-2.32;-2.32;-2.32	5.66	5.66	0.87406	.	.	.	.	.	D	0.95236	0.8455	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95695	0.8744	9	0.87932	D	0	.	19.7365	0.96208	0.0:0.0:1.0:0.0	.	247;247	Q92824-2;B1AMG5	.;.	E	247	ENSP00000446280:G247E;ENSP00000365958:G247E;ENSP00000365943:G247E	ENSP00000365943:G247E	G	+	2	0	PCSK5	77876480	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.476000	0.97823	2.672000	0.90937	0.655000	0.94253	GGA		0.522	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				39	213	0	0	0	0.006999	0	39	213				
PCSK5	5125	broad.mit.edu	37	9	78749075	78749075	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:78749075G>T	ENST00000545128.1	+	10	1797	c.1259G>T	c.(1258-1260)cGt>cTt	p.R420L	PCSK5_ENST00000376767.3_Missense_Mutation_p.R420L|PCSK5_ENST00000376752.4_Missense_Mutation_p.R420L	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	420	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.R420L(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						AGGACTTCCCGTGCGGGACAT	0.403																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(1258-1260)CGT>CTT		proprotein convertase subtilisin/kexin type 5							133.0	122.0	126.0					9																	78749075		2203	4299	6502	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78749075G>T		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1259G>T	9.37:g.78749075G>T	ENSP00000446280:p.Arg420Leu		Somatic				PCSK5_uc004ajy.2_Missense_Mutation_p.R420L|PCSK5_uc004aka.2_Intron	p.R420L	NM_006200	NP_006191	WXS	Illumina HiSeq	Unspecified	Q92824	PCSK5_HUMAN			10	1797	+			420			Catalytic.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.1259G>T	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611542	0.87258	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	5.65	5.65	0.86999	.	0.095024	0.64402	D	0.000001	D	0.93151	0.7819	M	0.77820	2.39	0.50813	D	0.999897	P;P	0.52842	0.956;0.785	P;P	0.61070	0.883;0.559	D	0.93273	0.6653	10	0.87932	D	0	-28.2279	20.0781	0.97751	0.0:0.0:1.0:0.0	.	420;420	Q92824-2;B1AMG5	.;.	L	420;123;420;420;420;93	ENSP00000446280:R420L;ENSP00000365958:R420L;ENSP00000365943:R420L;ENSP00000411654:R93L	ENSP00000365943:R420L	R	+	2	0	PCSK5	77938895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.547000	0.82146	2.817000	0.96982	0.563000	0.77884	CGT		0.403	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				19	75	1	0	2.89027e-11	0.014323	3.53935e-11	19	75				
SECISBP2	79048	broad.mit.edu	37	9	91943573	91943573	+	Splice_Site	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:91943573A>T	ENST00000375807.3	+	5	645		c.e5-1		SECISBP2_ENST00000339901.4_Splice_Site|SECISBP2_ENST00000534113.2_Splice_Site|SECISBP2_ENST00000470305.1_Splice_Site	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2						translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TTGTAATTACAGATGGTTACC	0.343																																							uc004aqj.1		NA																	1	Unknown(1)		lung(1)	ovary(2)|skin(1)	3						c.e5-2		SECIS binding protein 2							43.0	41.0	42.0					9																	91943573		2203	4300	6503	SO:0001630	splice_region_variant	79048				translation	nucleus	mRNA 3'-UTR binding	g.chr9:91943573A>T	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.575-1A>T	9.37:g.91943573A>T			Somatic				SECISBP2_uc010mqn.1_Splice_Site_p.D192_splice|SECISBP2_uc004aqi.1_Splice_Site_p.D119_splice|SECISBP2_uc011ltk.1_Splice_Site_p.D191_splice|SECISBP2_uc004aqk.1_Splice_Site_p.D119_splice|SECISBP2_uc010mqo.1_Splice_Site|SECISBP2_uc011ltl.1_Splice_Site_p.D124_splice	p.D192_splice	NM_024077	NP_076982	WXS	Illumina HiSeq	Unspecified	Q96T21	SEBP2_HUMAN			5	655	+								F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Splice_Site	SNP	ENST00000375807.3	37	c.575_splice	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488903	0.26686	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113;ENST00000425851	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5001	0.50433	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SECISBP2	91133393	1.000000	0.71417	0.956000	0.39512	0.221000	0.24807	4.639000	0.61361	2.283000	0.76528	0.477000	0.44152	.		0.343	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	Intron	8	63	0	0	0	0.00308	0	8	63				
GRIN3A	116443	broad.mit.edu	37	9	104499870	104499870	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:104499870G>T	ENST00000361820.3	-	1	992	c.392C>A	c.(391-393)gCc>gAc	p.A131D		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	131					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.A131D(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GTTGTCCACGGCAAATAGGAG	0.672																																							uc004bbp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(391-393)GCC>GAC		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						47.0	46.0	46.0					9																	104499870		2203	4300	6503	SO:0001583	missense	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104499870G>T		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.392C>A	9.37:g.104499870G>T	ENSP00000355155:p.Ala131Asp		Somatic				GRIN3A_uc004bbq.1_Missense_Mutation_p.A131D	p.A131D	NM_133445	NP_597702	WXS	Illumina HiSeq	Unspecified	Q8TCU5	NMD3A_HUMAN			1	993	-		Acute lymphoblastic leukemia(62;0.0568)	131			Extracellular (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.392C>A	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600712	0.87055	.	.	ENSG00000198785	ENST00000361820	D	0.93488	-3.23	5.12	5.12	0.69794	.	0.351400	0.28192	N	0.016254	D	0.90287	0.6962	L	0.50333	1.59	0.80722	D	1	P	0.42409	0.779	B	0.32149	0.141	D	0.91853	0.5493	10	0.87932	D	0	.	18.5725	0.91140	0.0:0.0:1.0:0.0	.	131	Q8TCU5	NMD3A_HUMAN	D	131	ENSP00000355155:A131D	ENSP00000355155:A131D	A	-	2	0	GRIN3A	103539691	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.189000	0.77747	2.392000	0.81423	0.655000	0.94253	GCC		0.672	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			4	45	1	0	8.12818e-05	0.001984	8.60456e-05	4	45				
GLRA2	2742	broad.mit.edu	37	X	14748448	14748448	+	Silent	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:14748448G>A	ENST00000218075.4	+	9	1730	c.1200G>A	c.(1198-1200)ccG>ccA	p.P400P	GLRA2_ENST00000355020.4_Silent_p.P400P|GLRA2_ENST00000443437.2_Silent_p.P311P	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	400					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.P400P(3)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	TCCCACAACCGCCAAAAGATG	0.483																																							uc010nep.2		NA																	3	Substitution - coding silent(3)		lung(2)|breast(1)	ovary(1)|lung(1)	2						c.(1198-1200)CCG>CCA		glycine receptor, alpha 2 isoform A	Ethanol(DB00898)|Glycine(DB00145)						141.0	131.0	134.0					X																	14748448		2203	4300	6503	SO:0001819	synonymous_variant	2742				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chrX:14748448G>A		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.1200G>A	X.37:g.14748448G>A			Somatic				GLRA2_uc010neq.2_Silent_p.P400P|GLRA2_uc004cwe.3_Silent_p.P400P|GLRA2_uc011mio.1_Silent_p.P311P|GLRA2_uc011mip.1_Silent_p.P378P	p.P400P	NM_001118885	NP_001112357	WXS	Illumina HiSeq	Unspecified	P23416	GLRA2_HUMAN			10	1532	+	Hepatocellular(33;0.128)		400			Cytoplasmic (Probable).		A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Silent	SNP	ENST00000218075.4	37	c.1200G>A	CCDS14160.1																																																																																				0.483	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1			5	130	0	0	0	0.001168	0	5	130				
GRPR	2925	broad.mit.edu	37	X	16142311	16142311	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:16142311A>G	ENST00000380289.2	+	1	633	c.235A>G	c.(235-237)Att>Gtt	p.I79V		NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	79					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)	p.I79V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					AAACCTGTTCATTTCCAGTCT	0.478											OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004cxj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)	4						c.(235-237)ATT>GTT		gastrin-releasing peptide receptor							221.0	177.0	192.0					X																	16142311		2203	4300	6503	SO:0001583	missense	2925				cell proliferation	integral to plasma membrane	bombesin receptor activity	g.chrX:16142311A>G		CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.235A>G	X.37:g.16142311A>G	ENSP00000369643:p.Ile79Val		Somatic	OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	708		p.I79V	NM_005314	NP_005305	WXS	Illumina HiSeq	Unspecified	P30550	GRPR_HUMAN			1	888	+	Hepatocellular(33;0.183)		79			Helical; Name=2; (Potential).		B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	c.235A>G	CCDS14174.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699878	0.68501	.	.	ENSG00000126010	ENST00000380289	T	0.40225	1.04	6.02	6.02	0.97574	GPCR, rhodopsin-like superfamily (1);	0.139235	0.64402	D	0.000004	T	0.52386	0.1731	M	0.73430	2.235	0.48696	D	0.999698	P	0.45474	0.859	P	0.46629	0.522	T	0.57854	-0.7739	10	0.62326	D	0.03	-29.0089	14.5447	0.68020	1.0:0.0:0.0:0.0	.	79	P30550	GRPR_HUMAN	V	79	ENSP00000369643:I79V	ENSP00000369643:I79V	I	+	1	0	GRPR	16052232	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.058000	0.64300	2.034000	0.60081	0.486000	0.48141	ATT		0.478	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		31	208	0	0	0	0.012213	0	31	208				
DCAF8L1	139425	broad.mit.edu	37	X	27998579	27998579	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:27998579C>A	ENST00000441525.1	-	1	987	c.873G>T	c.(871-873)gaG>gaT	p.E291D		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	291								p.E291D(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CCAGAGCCAACTCGTGGGCAG	0.512																																							uc004dbx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(871-873)GAG>GAT		DDB1 and CUL4 associated factor 8-like 1							80.0	69.0	73.0					X																	27998579		2202	4300	6502	SO:0001583	missense	139425							g.chrX:27998579C>A		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.873G>T	X.37:g.27998579C>A	ENSP00000405222:p.Glu291Asp		Somatic					p.E291D	NM_001017930	NP_001017930	WXS	Illumina HiSeq	Unspecified	A6NGE4	DC8L1_HUMAN			1	988	-			291			WD 3.		B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	c.873G>T	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994263	0.35226	.	.	ENSG00000226372	ENST00000441525	T	0.80214	-1.35	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.115064	0.56097	D	0.000024	T	0.65565	0.2703	N	0.25890	0.77	0.24490	N	0.994303	B	0.28933	0.228	B	0.29077	0.098	T	0.59526	-0.7438	10	0.59425	D	0.04	-6.895	7.2758	0.26283	0.0:0.9999:0.0:1.0E-4	.	291	A6NGE4	DC8L1_HUMAN	D	291	ENSP00000405222:E291D	ENSP00000405222:E291D	E	-	3	2	DCAF8L1	27908500	0.998000	0.40836	0.929000	0.37066	0.328000	0.28507	2.262000	0.43285	0.691000	0.31592	0.284000	0.19432	GAG		0.512	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		13	70	1	0	4.93089e-13	0.00245	6.22283e-13	13	70				
SSX3	10214	broad.mit.edu	37	X	48213500	48213500	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:48213500G>T	ENST00000298396.2	-	4	266	c.214C>A	c.(214-216)Cgt>Agt	p.R72S	SSX3_ENST00000376893.3_Missense_Mutation_p.R72S|SSX3_ENST00000376895.1_5'Flank	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	72	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R72S(2)		endometrium(3)|large_intestine(1)|lung(9)	13						CGTTTATTACGCATGAAAGAT	0.478																																					Colon(37;227 826 19399 40970 48007)	Colon(37;227 826 19399 40970 48007)	uc004djd.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(214-216)CGT>AGT		synovial sarcoma, X breakpoint 3 isoform a							133.0	118.0	123.0					X																	48213500		2203	4300	6503	SO:0001583	missense	10214				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	g.chrX:48213500G>T	U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.214C>A	X.37:g.48213500G>T	ENSP00000298396:p.Arg72Ser		Somatic				SSX3_uc004dje.2_Missense_Mutation_p.R72S|SSX3_uc010nic.2_Missense_Mutation_p.R72S	p.R72S	NM_021014	NP_066294	WXS	Illumina HiSeq	Unspecified	Q99909	SSX3_HUMAN			4	308	-			72			KRAB-related.		O60223|Q5JQZ3|Q9BRW7	Missense_Mutation	SNP	ENST00000298396.2	37	c.214C>A	CCDS14291.1	.	.	.	.	.	.	.	.	.	.	g	1.247	-0.619595	0.03663	.	.	ENSG00000165584	ENST00000298396;ENST00000376893	T;T	0.09255	3.06;3.0	1.52	-3.04	0.05412	Krueppel-associated box (2);Krueppel-associated box-related (1);	2.446520	0.01248	N	0.008799	T	0.04724	0.0128	N	0.10618	0.005	0.09310	N	1	P;B	0.37636	0.603;0.325	B;B	0.37692	0.256;0.106	T	0.16070	-1.0415	10	0.07990	T	0.79	.	3.0174	0.06064	0.3604:0.2372:0.4024:0.0	.	72;72	Q9BRW7;Q99909	.;SSX3_HUMAN	S	72	ENSP00000298396:R72S;ENSP00000366090:R72S	ENSP00000298396:R72S	R	-	1	0	SSX3	48098444	0.000000	0.05858	0.009000	0.14445	0.022000	0.10575	-1.529000	0.02223	-1.119000	0.02958	0.181000	0.17075	CGT		0.478	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056486.1	NM_021014		12	177	1	0	6.81908e-15	0.00245	8.79783e-15	12	177				
IGBP1	3476	broad.mit.edu	37	X	69366622	69366622	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:69366622A>T	ENST00000342206.6	+	3	1121	c.622A>T	c.(622-624)Att>Ttt	p.I208F	IGBP1-AS2_ENST00000403371.2_RNA|IGBP1_ENST00000356413.4_Missense_Mutation_p.I208F			P78318	IGBP1_HUMAN	immunoglobulin (CD79A) binding protein 1	208					B cell activation (GO:0042113)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dephosphorylation (GO:0035306)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microtubule-based movement (GO:0060632)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	protein phosphatase type 2A regulator activity (GO:0008601)	p.I208F(1)		kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(2)	11						CTTAGAAGAGATTGAGAGCAT	0.418																																					NSCLC(167;1189 1558 6576 8216 30387 37980 41450)	NSCLC(167;1189 1558 6576 8216 30387 37980 41450)	uc004dxv.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|pancreas(1)	2						c.(622-624)ATT>TTT		immunoglobulin binding protein 1							73.0	61.0	65.0					X																	69366622		2203	4300	6503	SO:0001583	missense	3476				B cell activation|negative regulation of caspase activity|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|regulation of microtubule-based movement|response to interleukin-1|response to tumor necrosis factor|signal transduction	cytoplasm	protein phosphatase type 2A regulator activity	g.chrX:69366622A>T	Y08915	CCDS14396.1	Xq13.1-q13.3	2008-02-05			ENSG00000089289	ENSG00000089289			5461	protein-coding gene	gene with protein product	"""alpha 4"""	300139		IBP1		9441740	Standard	NM_001551		Approved		uc004dxw.3	P78318	OTTHUMG00000021767	ENST00000342206.6:c.622A>T	X.37:g.69366622A>T	ENSP00000363661:p.Ile208Phe		Somatic				IGBP1_uc004dxw.2_Missense_Mutation_p.I208F	p.I208F	NM_001551	NP_001542	WXS	Illumina HiSeq	Unspecified	P78318	IGBP1_HUMAN			3	1121	+			208					Q8TAB2	Missense_Mutation	SNP	ENST00000342206.6	37	c.622A>T	CCDS14396.1	.	.	.	.	.	.	.	.	.	.	.	19.54	3.847713	0.71603	.	.	ENSG00000089289	ENST00000342206;ENST00000356413	T;T	0.49720	0.77;0.77	5.14	2.7	0.31948	.	0.246863	0.44483	D	0.000441	T	0.55449	0.1921	M	0.73962	2.25	0.43830	D	0.9964	P	0.46912	0.886	P	0.53146	0.719	T	0.54330	-0.8310	10	0.87932	D	0	.	5.8079	0.18450	0.7429:0.166:0.091:0.0	.	208	P78318	IGBP1_HUMAN	F	208	ENSP00000363661:I208F;ENSP00000348784:I208F	ENSP00000363661:I208F	I	+	1	0	IGBP1	69283347	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.059000	0.41384	0.330000	0.23485	0.481000	0.45027	ATT		0.418	IGBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057052.1			16	156	0	0	0	0.006122	0	16	156				
DLG3	1741	broad.mit.edu	37	X	69720818	69720818	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:69720818G>A	ENST00000374360.3	+	18	2559	c.2326G>A	c.(2326-2328)Gaa>Aaa	p.E776K	DLG3_ENST00000374355.3_Missense_Mutation_p.E471K|DLG3_ENST00000542398.1_Missense_Mutation_p.E325K|DLG3_ENST00000461646.1_3'UTR|DLG3_ENST00000194900.4_Missense_Mutation_p.E808K	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	776	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)	p.E776K(1)|p.E471K(1)		endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					ACTGGAGCAGGAATTTGGAGA	0.448																																							uc004dyi.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|pancreas(1)	2						c.(2326-2328)GAA>AAA		synapse-associated protein 102 isoform a							87.0	76.0	80.0					X																	69720818		2203	4299	6502	SO:0001583	missense	1741				axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity	g.chrX:69720818G>A	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.2326G>A	X.37:g.69720818G>A	ENSP00000363480:p.Glu776Lys		Somatic				DLG3_uc004dyj.1_Missense_Mutation_p.E471K|DLG3_uc011mpn.1_Missense_Mutation_p.E324K	p.E776K	NM_021120	NP_066943	WXS	Illumina HiSeq	Unspecified	Q92796	DLG3_HUMAN			18	2654	+	Renal(35;0.156)		776			Guanylate kinase-like.		B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	ENST00000374360.3	37	c.2326G>A	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	G	34	5.311094	0.95629	.	.	ENSG00000082458	ENST00000194900;ENST00000374360;ENST00000374355;ENST00000542398	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.13	5.13	0.70059	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.069372	0.56097	D	0.000024	T	0.54983	0.1892	M	0.62088	1.915	0.58432	D	0.999999	P;P;P	0.49358	0.778;0.923;0.806	P;P;P	0.48921	0.522;0.573;0.595	T	0.55082	-0.8196	9	.	.	.	.	16.7905	0.85588	0.0:0.0:1.0:0.0	.	325;471;776	B4E0H1;Q5JUW6;Q92796	.;.;DLG3_HUMAN	K	808;776;471;325	ENSP00000194900:E808K;ENSP00000363480:E776K;ENSP00000363475:E471K;ENSP00000441393:E325K	.	E	+	1	0	DLG3	69637543	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.208000	0.95075	2.518000	0.84900	0.600000	0.82982	GAA		0.448	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120		9	27	0	0	0	0.010729	0	9	27				
MED12	9968	broad.mit.edu	37	X	70349021	70349021	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:70349021A>G	ENST00000374080.3	+	25	3565	c.3533A>G	c.(3532-3534)cAc>cGc	p.H1178R	MED12_ENST00000374102.1_Missense_Mutation_p.H1178R|MED12_ENST00000333646.6_Missense_Mutation_p.H1178R			Q93074	MED12_HUMAN	mediator complex subunit 12	1178					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.H1178R(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					ATCCTCCTTCACCTTTTCAAG	0.512			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(3532-3534)CAC>CGC		mediator complex subunit 12							72.0	73.0	73.0					X																	70349021		2022	4162	6184	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70349021A>G	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3533A>G	X.37:g.70349021A>G	ENSP00000363193:p.His1178Arg		Somatic	OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1121	MED12_uc011mpq.1_Missense_Mutation_p.H1178R|MED12_uc004dyz.2_Missense_Mutation_p.H1178R|MED12_uc004dza.2_Missense_Mutation_p.H1025R|MED12_uc010nla.2_5'Flank	p.H1178R	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			25	3732	+	Renal(35;0.156)		1178					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.3533A>G	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	8.577	0.881411	0.17467	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.15522	0.0374	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.32753	0.383;0.068;0.037;0.264	B;B;B;B	0.32928	0.155;0.026;0.12;0.083	T	0.02950	-1.1090	10	0.02654	T	1	-25.0235	14.0799	0.64914	1.0:0.0:0.0:0.0	.	1178;1025;1178;1178	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	R	1178;1178;1178;1178;1146	ENSP00000333125:H1178R;ENSP00000363215:H1178R;ENSP00000363193:H1178R;ENSP00000414203:H1146R	ENSP00000333125:H1178R	H	+	2	0	MED12	70265746	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.500000	0.90498	1.968000	0.57251	0.430000	0.28490	CAC		0.512	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		14	405	0	0	0	0.00499	0	14	405				
GJB1	2705	broad.mit.edu	37	X	70443955	70443955	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:70443955G>A	ENST00000374022.3	+	2	493	c.398G>A	c.(397-399)tGg>tAg	p.W133*	GJB1_ENST00000361726.6_Nonsense_Mutation_p.W133*|GJB1_ENST00000374029.1_Nonsense_Mutation_p.W133*	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	133			W -> C (in CMTX1; moderate). {ECO:0000269|PubMed:9452099}.|W -> R (in CMTX1). {ECO:0000269|PubMed:10732813, ECO:0000269|PubMed:11571214, ECO:0000269|PubMed:7477983, ECO:0000269|PubMed:9361298, ECO:0000269|PubMed:9401007}.		cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)	p.W133*(2)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					ACACTGTGGTGGACCTATGTC	0.547																																							uc004dzf.3		NA																	2	Substitution - Nonsense(2)	p.W133*(1)	lung(1)|breast(1)	breast(1)	1						c.(397-399)TGG>TAG		gap junction protein, beta 1, 32kDa							215.0	176.0	189.0					X																	70443955		2203	4300	6503	SO:0001587	stop_gained	2705				cell-cell signaling|cellular membrane organization|gap junction assembly|nervous system development	connexon complex|endoplasmic reticulum membrane|integral to membrane	gap junction channel activity	g.chrX:70443955G>A	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.398G>A	X.37:g.70443955G>A	ENSP00000363134:p.Trp133*		Somatic				BCYRN1_uc011mpt.1_Intron|GJB1_uc004dzg.3_Nonsense_Mutation_p.W133*	p.W133*	NM_001097642	NP_001091111	WXS	Illumina HiSeq	Unspecified	P08034	CXB1_HUMAN			2	493	+	Renal(35;0.156)		133		W -> R (in CMTX1).|W -> C (in CMTX1; moderate).	Helical; (Probable).		B2R8R2|D3DVV2|Q5U0S4	Nonsense_Mutation	SNP	ENST00000374022.3	37	c.398G>A	CCDS14408.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470331	0.84533	.	.	ENSG00000169562	ENST00000374029;ENST00000374022;ENST00000361726	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.9597	0.86269	0.0:0.0:1.0:0.0	.	.	.	.	X	133	.	ENSP00000354900:W133X	W	+	2	0	GJB1	70360680	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.657000	0.83745	2.181000	0.69327	0.521000	0.50471	TGG		0.547	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166		9	97	0	0	0	0.004482	0	9	97				
ABCB7	22	broad.mit.edu	37	X	74295224	74295224	+	Silent	SNP	A	A	G			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:74295224A>G	ENST00000373394.3	-	6	835	c.828T>C	c.(826-828)ttT>ttC	p.F276F	ABCB7_ENST00000339447.4_Silent_p.F236F|ABCB7_ENST00000253577.3_Silent_p.F277F|ABCB7_ENST00000534570.1_5'Flank			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	276	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.			LLPIMF -> PLPNHV (in Ref. 4; AAC39865). {ECO:0000305}.	cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)	p.F277F(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						GCATCACTTCAAACATGATGG	0.363																																							uc004eca.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(826-828)TTT>TTC		ATP-binding cassette, sub-family B, member 7							89.0	74.0	79.0					X																	74295224		2203	4300	6503	SO:0001819	synonymous_variant	22				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity	g.chrX:74295224A>G	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.828T>C	X.37:g.74295224A>G			Somatic				ABCB7_uc004ebz.2_Silent_p.F277F|ABCB7_uc011mqn.1_Silent_p.F250F|ABCB7_uc010nls.2_Silent_p.F237F|ABCB7_uc010nlt.2_Silent_p.F236F	p.F276F	NM_004299	NP_004290	WXS	Illumina HiSeq	Unspecified	O75027	ABCB7_HUMAN			6	853	-			276	LLPIMF -> PLPNHV (in Ref. 4; AAC39865).		ABC transmembrane type-1.|Helical; (Potential).		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	ENST00000373394.3	37	c.828T>C																																																																																					0.363	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		9	151	0	0	0	0.008291	0	9	151				
UPRT	139596	broad.mit.edu	37	X	74494131	74494131	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:74494131C>A	ENST00000373383.4	+	1	209	c.42C>A	c.(40-42)caC>caA	p.H14Q	UPRT_ENST00000373379.1_Missense_Mutation_p.H14Q|UPRT_ENST00000531704.1_3'UTR|UPRT_ENST00000530743.1_5'Flank	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	14					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.H14Q(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						TGCCCTGTCACAACCAGCAAG	0.597																																							uc004ecb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(40-42)CAC>CAA		uracil phosphoribosyltransferase (FUR1) homolog							47.0	40.0	42.0					X																	74494131		2203	4300	6503	SO:0001583	missense	139596				nucleoside metabolic process	cytoplasm|nucleus		g.chrX:74494131C>A	BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.42C>A	X.37:g.74494131C>A	ENSP00000362481:p.His14Gln		Somatic				UPRT_uc010nlu.1_Missense_Mutation_p.H14Q|UPRT_uc004ecc.1_RNA|UPRT_uc004ecd.1_Missense_Mutation_p.H14Q|UPRT_uc004ece.1_5'Flank	p.H14Q	NM_145052	NP_659489	WXS	Illumina HiSeq	Unspecified	Q96BW1	UPP_HUMAN			1	171	+			14					Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Missense_Mutation	SNP	ENST00000373383.4	37	c.42C>A	CCDS14429.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276294	0.59649	.	.	ENSG00000094841	ENST00000373383;ENST00000373379	.	.	.	5.18	1.3	0.21679	.	0.482216	0.20950	N	0.082776	T	0.32224	0.0822	L	0.27053	0.805	0.80722	D	1	B;B;B	0.25563	0.129;0.024;0.024	B;B;B	0.26202	0.067;0.021;0.021	T	0.04551	-1.0943	9	0.30078	T	0.28	-8.1589	3.7585	0.08595	0.3363:0.4719:0.0:0.1918	.	14;14;14	Q96BW1-2;A8KAF9;Q96BW1	.;.;UPP_HUMAN	Q	14	.	ENSP00000362471:H14Q	H	+	3	2	UPRT	74410856	1.000000	0.71417	0.955000	0.39395	0.896000	0.52359	0.273000	0.18662	0.179000	0.19938	0.600000	0.82982	CAC		0.597	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057278.1	NM_145052		104	29	1	0	2.90702e-44	0.01441	4.15905e-44	104	29				
RPA4	29935	broad.mit.edu	37	X	96139803	96139803	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:96139803A>T	ENST00000373040.3	+	1	897	c.494A>T	c.(493-495)cAc>cTc	p.H165L	DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000373049.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	165					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.H165L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						GTCAATGCACACATGATGCTG	0.473								Other identified genes with known or suspected DNA repair function																															uc004efv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(493-495)CAC>CTC	Other_identified_genes_with_known_or_suspected_DNA_repair_function	replication protein A4, 34kDa							142.0	112.0	122.0					X																	96139803		2203	4300	6503	SO:0001583	missense	29935				DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding	g.chrX:96139803A>T	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.494A>T	X.37:g.96139803A>T	ENSP00000362131:p.His165Leu		Somatic				DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	p.H165L	NM_013347	NP_037479	WXS	Illumina HiSeq	Unspecified	Q13156	RFA4_HUMAN			1	792	+			165					Q3SY03	Missense_Mutation	SNP	ENST00000373040.3	37	c.494A>T	CCDS35345.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016090	0.75161	.	.	ENSG00000204086	ENST00000373040	T	0.70399	-0.48	3.81	3.81	0.43845	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Replication protein A, C-terminal (1);	.	.	.	.	T	0.78078	0.4227	L	0.55213	1.73	0.09310	N	1	D	0.76494	0.999	D	0.70935	0.971	T	0.65545	-0.6142	9	0.87932	D	0	-33.3314	8.0966	0.30833	1.0:0.0:0.0:0.0	.	165	Q13156	RFA4_HUMAN	L	165	ENSP00000362131:H165L	ENSP00000362131:H165L	H	+	2	0	RPA4	96026459	0.993000	0.37304	0.008000	0.14137	0.735000	0.41995	4.681000	0.61663	1.727000	0.51537	0.486000	0.48141	CAC		0.473	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347		18	75	0	0	0	0.014323	0	18	75				
MCTS1	28985	broad.mit.edu	37	X	119739399	119739399	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chrX:119739399T>C	ENST00000371317.5	+	2	406	c.149T>C	c.(148-150)gTc>gCc	p.V50A	MCTS1_ENST00000371315.3_Missense_Mutation_p.V51A|MCTS1_ENST00000487133.1_3'UTR	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	50					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)	p.V51A(1)|p.V50A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						AAAGATCCTGTCAAAATAGTC	0.318																																							uc004esx.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(148-150)GTC>GCC		malignant T cell amplified sequence 1 isoform 1							74.0	73.0	73.0					X																	119739399		2203	4297	6500	SO:0001583	missense	28985				cell cycle|positive regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm	RNA binding	g.chrX:119739399T>C	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.149T>C	X.37:g.119739399T>C	ENSP00000360367:p.Val50Ala		Somatic				MCTS1_uc011mub.1_Missense_Mutation_p.V51A	p.V50A	NM_014060	NP_054779	WXS	Illumina HiSeq	Unspecified	Q9ULC4	MCTS1_HUMAN			2	497	+			50					B4DGY2|Q502X6	Missense_Mutation	SNP	ENST00000371317.5	37	c.149T>C	CCDS14601.1	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444292	0.43429	.	.	ENSG00000232119	ENST00000371317;ENST00000371315	T;T	0.51325	0.72;0.71	5.03	5.03	0.67393	.	0.061365	0.64402	D	0.000005	T	0.34279	0.0892	N	0.12920	0.275	0.80722	D	1	B;B	0.24721	0.11;0.023	B;B	0.34873	0.191;0.03	T	0.15093	-1.0449	9	.	.	.	0.6352	13.0664	0.59036	0.0:0.0:0.0:1.0	.	51;50	Q9ULC4-3;Q9ULC4	.;MCTS1_HUMAN	A	50;51	ENSP00000360367:V50A;ENSP00000360365:V51A	.	V	+	2	0	MCTS1	119623427	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.930000	0.87610	1.676000	0.50930	0.417000	0.27973	GTC		0.318	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060		21	89	0	0	0	0.014323	0	21	89				
C1orf116	79098	broad.mit.edu	37	1	207196009	207196010	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:207196009_207196010insAC	ENST00000359470.5	-	4	1348_1349	c.1099_1100insGT	c.(1099-1101)ttafs	p.L367fs	C1orf116_ENST00000461135.2_Frame_Shift_Ins_p.L121fs	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	367						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					GGGCTTACTTAAGTGGAGTCCA	0.579																																							uc001hfd.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1099-1101)TTAfs		specifically androgen-regulated protein isoform																																				SO:0001589	frameshift_variant	79098					cytoplasm|plasma membrane	receptor activity	g.chr1:207196009_207196010insAC		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.1099_1100insGT	1.37:g.207196009_207196010insAC	ENSP00000352447:p.Leu367fs		Somatic				C1orf116_uc009xcb.1_Frame_Shift_Ins_p.L121fs	p.L367fs	NM_023938	NP_076427	WXS	Illumina HiSeq	Unspecified	Q9BW04	SARG_HUMAN			4	1358_1359	-	Prostate(682;0.19)		367					C9JV41|Q658X3	Frame_Shift_Ins	INS	ENST00000359470.5	37	c.1099_1100insGT	CCDS1475.1																																																																																				0.579	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115		20	183	NA	NA	NA	NA	NA	20	183	---	---	---	---
PSEN2	5664	broad.mit.edu	37	1	227071533	227071534	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr1:227071533_227071534insCA	ENST00000366783.3	+	5	705_706	c.269_270insCA	c.(268-273)atgctgfs	p.ML90fs	PSEN2_ENST00000340188.4_Frame_Shift_Ins_p.ML90fs|PSEN2_ENST00000472139.2_5'Flank|PSEN2_ENST00000391872.2_Frame_Shift_Ins_p.ML123fs|PSEN2_ENST00000366782.1_Frame_Shift_Ins_p.ML123fs|PSEN2_ENST00000422240.2_Frame_Shift_Ins_p.ML90fs	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	90					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CACGTGATCATGCTGTTTGTGC	0.584																																							uc009xeo.1		NA																	0				lung(2)	2						c.(268-270)ATGfs		presenilin 2 isoform 1																																				SO:0001589	frameshift_variant	5664				amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding	g.chr1:227071533_227071534insCA	BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	Exception_encountered	1.37:g.227071533_227071534insCA	ENSP00000355747:p.Met90fs		Somatic				PSEN2_uc009xep.1_Frame_Shift_Ins_p.M90fs|PSEN2_uc001hqk.2_RNA	p.M90fs	NM_000447	NP_000438	WXS	Illumina HiSeq	Unspecified	P49810	PSN2_HUMAN			5	696_697	+		Prostate(94;0.0771)	90			Helical; (Potential).		A8K8D4|B1AP21|Q96P32	Frame_Shift_Ins	INS	ENST00000366783.3	37	c.269_270insCA	CCDS1556.1																																																																																				0.584	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1	NM_000447		62	164	NA	NA	NA	NA	NA	62	164	---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	5014908	5014909	+	Frame_Shift_Ins	INS	-	-	T	rs368796352		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr10:5014908_5014909insT	ENST00000380872.4	+	7	1005_1006	c.813_814insT	c.(814-816)tacfs	p.Y272fs	AKR1C1_ENST00000434459.2_Frame_Shift_Ins_p.Y272fs|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	272					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	TGGCCAAGAGCTACAATGAGCA	0.584																																					Colon(130;2054 2316 13360 15380)	Colon(130;2054 2316 13360 15380)	uc001iho.2		NA																	0				ovary(2)	2						c.(811-816)AGCTACfs		aldo-keto reductase family 1, member C1	NADH(DB00157)																																			SO:0001589	frameshift_variant	1645				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity	g.chr10:5014908_5014909insT	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.814dupT	10.37:g.5014909_5014909dupT	ENSP00000370254:p.Tyr272fs		Somatic				AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc001ihq.2_Frame_Shift_Ins_p.S271fs	p.S271fs	NM_001353	NP_001344	WXS	Illumina HiSeq	Unspecified	Q04828	AK1C1_HUMAN			12	1654_1655	+			271_272			NADP (By similarity).		P52896|Q5SR15|Q7M4N2|Q9UCX2	Frame_Shift_Ins	INS	ENST00000380872.4	37	c.813_814insT	CCDS7061.1																																																																																				0.584	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353		12	94	NA	NA	NA	NA	NA	12	94	---	---	---	---
OTOP2	92736	broad.mit.edu	37	17	72920942	72920944	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	TGG	TGG	-	-	TGG	TGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr17:72920942_72920944delTGG	ENST00000580223.1	+	1	245_247	c.215_217delTGG	c.(214-219)ctggca>cca	p.72_73LA>P	USH1G_ENST00000319642.1_5'Flank|OTOP2_ENST00000331427.4_In_Frame_Del_p.72_73LA>P			Q7RTS6	OTOP2_HUMAN	otopetrin 2	72						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					ATGATGCTGCTGGCAACGCTCTG	0.665																																							uc010wrp.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(214-219)CTGGCA>CCA		otopetrin 2																																				SO:0001651	inframe_deletion	92736					integral to membrane		g.chr17:72920942_72920944delTGG	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.215_217delTGG	17.37:g.72920942_72920944delTGG	ENSP00000463837:p.Leu72_Ala73delinsPro		Somatic				USH1G_uc002jme.1_5'Flank|USH1G_uc010wro.1_5'Flank|OTOP2_uc002jmf.1_In_Frame_Del_p.72_73LA>P	p.72_73LA>P	NM_178160	NP_835454	WXS	Illumina HiSeq	Unspecified	Q7RTS6	OTOP2_HUMAN			3	304_306	+	all_lung(278;0.172)|Lung NSC(278;0.207)		72_73			Helical; (Potential).			In_Frame_Del	DEL	ENST00000580223.1	37	c.215_217delTGG	CCDS11708.1																																																																																				0.665	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160		7	23	NA	NA	NA	NA	NA	7	23	---	---	---	---
ZNF98	148198	broad.mit.edu	37	19	22575752	22575752	+	Frame_Shift_Del	DEL	C	C	-	rs201005982		TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr19:22575752delC	ENST00000357774.5	-	4	406	c.285delG	c.(283-285)tggfs	p.W95fs		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CCTGCTTTGGCCAAAGGTCTT	0.284																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(283-285)TGGfs		zinc finger protein 98							31.0	25.0	27.0					19																	22575752		1846	4113	5959	SO:0001589	frameshift_variant	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22575752delC		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.285delG	19.37:g.22575752delC	ENSP00000350418:p.Trp95fs		Somatic					p.W95fs	NM_001098626	NP_001092096	WXS	Illumina HiSeq	Unspecified	A6NK75	ZNF98_HUMAN			4	407	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	95						Frame_Shift_Del	DEL	ENST00000357774.5	37	c.285delG	CCDS46031.1																																																																																				0.284	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		6	12	NA	NA	NA	NA	NA	6	12	---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218682516	218682516	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr2:218682516delC	ENST00000171887.4	-	24	4679	c.4227delG	c.(4225-4227)gggfs	p.G1409fs	TNS1_ENST00000430930.1_Frame_Shift_Del_p.G1388fs|TNS1_ENST00000419504.1_Frame_Shift_Del_p.G1396fs	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1409					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AAGACACCTTCCCATTGATGG	0.622																																							uc002vgt.2		NA																	0				ovary(3)|breast(1)	4						c.(4225-4227)GGGfs		tensin							99.0	86.0	90.0					2																	218682516		2203	4300	6503	SO:0001589	frameshift_variant	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218682516delC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4227delG	2.37:g.218682516delC	ENSP00000171887:p.Gly1409fs		Somatic				TNS1_uc002vgr.2_Frame_Shift_Del_p.G1396fs|TNS1_uc002vgs.2_Frame_Shift_Del_p.G1388fs|TNS1_uc010zjv.1_Frame_Shift_Del_p.G1388fs	p.G1409fs	NM_022648	NP_072174	WXS	Illumina HiSeq	Unspecified	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	24	4625	-		Renal(207;0.0483)|Lung NSC(271;0.213)	1409					Q4ZG71|Q6IPI5	Frame_Shift_Del	DEL	ENST00000171887.4	37	c.4227delG	CCDS2407.1																																																																																				0.622	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		30	128	NA	NA	NA	NA	NA	30	128	---	---	---	---
DDX31	64794	broad.mit.edu	37	9	135522364	135522364	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4507-01A-01D-1265-08	TCGA-49-4507-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	562a09a1-b491-45c8-a87d-3c2471353c0d	0629ddb0-d7ba-441d-b3ed-c2822cde4332	g.chr9:135522364delG	ENST00000372159.3	-	12	1515	c.1364delC	c.(1363-1365)ccafs	p.P455fs	DDX31_ENST00000310532.2_Frame_Shift_Del_p.P455fs|DDX31_ENST00000438527.3_Frame_Shift_Del_p.P326fs|DDX31_ENST00000372153.1_Frame_Shift_Del_p.P455fs	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	455						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		TTTGTCCTTTGGGTTCAACTG	0.498																																							uc004cbq.1		NA																	0				central_nervous_system(1)	1						c.(1363-1365)CCAfs		DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							104.0	94.0	97.0					9																	135522364		2203	4300	6503	SO:0001589	frameshift_variant	64794					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr9:135522364delG	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1364delC	9.37:g.135522364delG	ENSP00000361232:p.Pro455fs		Somatic				DDX31_uc010mzu.1_Frame_Shift_Del_p.P455fs|DDX31_uc004cbr.1_Frame_Shift_Del_p.P455fs	p.P455fs	NM_022779	NP_073616	WXS	Illumina HiSeq	Unspecified	Q9H8H2	DDX31_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)	12	1516	-			455					Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Frame_Shift_Del	DEL	ENST00000372159.3	37	c.1364delC	CCDS6951.1																																																																																				0.498	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620		41	110	NA	NA	NA	NA	NA	41	110	---	---	---	---
