#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ESPN	83715	broad.mit.edu	37	1	6488379	6488379	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:6488379G>A	ENST00000377828.1	+	2	556	c.388G>A	c.(388-390)Gac>Aac	p.D130N	MIR4252_ENST00000585139.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	130					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)	p.D130N(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TGGCGGTGGGGACCCCACCGC	0.632																																							uc001amy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)GAC>AAC		espin							56.0	63.0	61.0					1																	6488379		2203	4300	6503	SO:0001583	missense	83715				sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding	g.chr1:6488379G>A	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.388G>A	1.37:g.6488379G>A	ENSP00000367059:p.Asp130Asn		Somatic					p.D130N	NM_031475	NP_113663	WXS	Illumina HiSeq	Unspecified	B1AK53	ESPN_HUMAN		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)	2	556	+	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)	130			ANK 4.		Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	37	c.388G>A	CCDS70.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685551	0.47991	.	.	ENSG00000187017	ENST00000377828	T	0.15834	2.39	4.32	2.42	0.29668	Ankyrin repeat-containing domain (4);	0.220596	0.35838	N	0.002946	T	0.13457	0.0326	L	0.33668	1.02	0.80722	D	1	B	0.20887	0.049	B	0.31390	0.129	T	0.10291	-1.0636	10	0.28530	T	0.3	-20.217	8.5707	0.33567	0.1952:0.0:0.8048:0.0	.	130	B1AK53	ESPN_HUMAN	N	130	ENSP00000367059:D130N	ENSP00000367059:D130N	D	+	1	0	ESPN	6410966	1.000000	0.71417	0.193000	0.23327	0.991000	0.79684	4.310000	0.59141	0.439000	0.26476	0.563000	0.77884	GAC		0.632	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475		33	63	0	0	0	0.010818	0	33	63				
PRAMEF17	391004	broad.mit.edu	37	1	13718412	13718412	+	Missense_Mutation	SNP	A	A	G	rs367575766		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:13718412A>G	ENST00000376098.4	+	3	901	c.875A>G	c.(874-876)aAg>aGg	p.K292R		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	292					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.K292R(1)		kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTGCCTCAAGAACCCCTTG	0.493																																							uc009vnz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(874-876)AAG>AGG		PRAME family member 17		A	ARG/LYS	1,3257		0,1,1628	41.0	40.0	41.0		875	-0.5	0.1	1		41	0,7228		0,0,3614	no	missense	PRAMEF17	NM_001099851.1	26	0,1,5242	GG,GA,AA		0.0,0.0307,0.0095	benign	292/475	13718412	1,10485	1629	3614	5243	SO:0001583	missense	391004							g.chr1:13718412A>G		CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.875A>G	1.37:g.13718412A>G	ENSP00000365266:p.Lys292Arg		Somatic					p.K292R	NM_001099851	NP_001093321	WXS	Illumina HiSeq	Unspecified	Q5VTA0	PRA17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	905	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	292					B2RUU4	Missense_Mutation	SNP	ENST00000376098.4	37	c.875A>G	CCDS41264.1	.	.	.	.	.	.	.	.	.	.	A	4.112	0.018988	0.08006	3.07E-4	0.0	ENSG00000204479	ENST00000376098	T	0.53206	0.63	1.04	-0.484	0.12071	.	0.865181	0.10435	N	0.674994	T	0.37183	0.0994	L	0.60455	1.87	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.31888	-0.9927	10	0.33940	T	0.23	.	2.9171	0.05756	0.5962:0.0:0.0:0.4038	.	292	Q5VTA0	PRA17_HUMAN	R	292	ENSP00000365266:K292R	ENSP00000365266:K292R	K	+	2	0	PRAMEF17	13590999	0.015000	0.18098	0.108000	0.21378	0.036000	0.12997	-1.105000	0.03323	-0.140000	0.11394	0.333000	0.21579	AAG		0.493	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021780.2	NM_001099851		15	196	0	0	0	0.021523	0	15	196				
PRDM2	7799	broad.mit.edu	37	1	14108929	14108929	+	Missense_Mutation	SNP	C	C	T	rs144820187		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:14108929C>T	ENST00000235372.7	+	8	5495	c.4639C>T	c.(4639-4641)Ccc>Tcc	p.P1547S	PRDM2_ENST00000311066.5_Missense_Mutation_p.P1547S|PRDM2_ENST00000413440.1_Missense_Mutation_p.P1346S|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.P1346S	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1547					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P1547S(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AGTCCCACTTCCCTCCTCATC	0.547																																							uc001avi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4639-4641)CCC>TCC		retinoblastoma protein-binding zinc finger							62.0	68.0	66.0					1																	14108929		2203	4300	6503	SO:0001583	missense	7799					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:14108929C>T	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4639C>T	1.37:g.14108929C>T	ENSP00000235372:p.Pro1547Ser		Somatic				PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.P1547S|PRDM2_uc001avj.2_Intron|PRDM2_uc001avk.2_Missense_Mutation_p.P1346S|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	p.P1547S	NM_012231	NP_036363	WXS	Illumina HiSeq	Unspecified	Q13029	PRDM2_HUMAN	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)	8	5495	+	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	1547					B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	c.4639C>T	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299265	0.60195	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.06068	3.43;3.35;4.37;4.37	5.86	5.86	0.93980	.	0.059395	0.64402	D	0.000002	T	0.25531	0.0621	M	0.71581	2.175	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.69479	0.963;0.922;0.964	T	0.00034	-1.2267	10	0.59425	D	0.04	.	18.7419	0.91777	0.0:1.0:0.0:0.0	.	1405;1547;1547	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	S	1547;1547;1547;1346;1346	ENSP00000235372:P1547S;ENSP00000312352:P1547S;ENSP00000411103:P1346S;ENSP00000341621:P1346S	ENSP00000235372:P1547S	P	+	1	0	PRDM2	13981516	0.970000	0.33590	0.910000	0.35882	0.520000	0.34377	4.042000	0.57347	2.778000	0.95560	0.591000	0.81541	CCC		0.547	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231		6	91	0	0	0	0.021553	0	6	91				
LUZP1	7798	broad.mit.edu	37	1	23418835	23418835	+	Silent	SNP	C	C	T	rs202187077		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:23418835C>T	ENST00000302291.4	-	4	2721	c.1920G>A	c.(1918-1920)ccG>ccA	p.P640P	LUZP1_ENST00000314174.5_Silent_p.P640P|LUZP1_ENST00000374623.3_Silent_p.P640P|LUZP1_ENST00000418342.1_Silent_p.P640P			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	640					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)		p.P640P(2)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		AGGCTTCATGCGGACTGCTGT	0.468																																							uc001bgk.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)		0						c.(1918-1920)CCG>CCA		leucine zipper protein 1							188.0	179.0	182.0					1																	23418835		2203	4300	6503	SO:0001819	synonymous_variant	7798					nucleus		g.chr1:23418835C>T	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.1920G>A	1.37:g.23418835C>T			Somatic				LUZP1_uc010odv.1_Silent_p.P640P|LUZP1_uc001bgl.2_Silent_p.P640P|LUZP1_uc001bgm.1_Silent_p.P640P	p.P640P	NM_033631	NP_361013	WXS	Illumina HiSeq	Unspecified	Q86V48	LUZP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)	4	2304	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)	640					Q5TH93|Q8N4X3|Q8TEH1	Silent	SNP	ENST00000302291.4	37	c.1920G>A	CCDS30628.1																																																																																				0.468	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631		5	261	0	0	0	0.014758	0	5	261				
FUCA1	2517	broad.mit.edu	37	1	24194554	24194554	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:24194554C>G	ENST00000374479.3	-	1	230	c.223G>C	c.(223-225)Gag>Cag	p.E75Q		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	75					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)	p.E75Q(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CAGAACCACTCGCTGCCCCAG	0.687																																							uc001bie.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(223-225)GAG>CAG		fucosidase, alpha-L-1, tissue precursor							19.0	23.0	22.0					1																	24194554		2200	4296	6496	SO:0001583	missense	2517				fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding	g.chr1:24194554C>G	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.223G>C	1.37:g.24194554C>G	ENSP00000363603:p.Glu75Gln		Somatic				FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	p.E75Q	NM_000147	NP_000138	WXS	Illumina HiSeq	Unspecified	P04066	FUCO_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)	1	268	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	75					B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	c.223G>C	CCDS244.2	.	.	.	.	.	.	.	.	.	.	C	35	5.538044	0.96460	.	.	ENSG00000179163	ENST00000374479	T	0.67523	-0.27	5.01	5.01	0.66863	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.047302	0.85682	D	0.000000	D	0.90239	0.6948	H	0.99379	4.54	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.94487	0.7698	10	0.87932	D	0	-6.6893	18.5115	0.90918	0.0:1.0:0.0:0.0	.	75	P04066	FUCO_HUMAN	Q	75	ENSP00000363603:E75Q	ENSP00000363603:E75Q	E	-	1	0	FUCA1	24067141	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.520000	0.67080	2.623000	0.88846	0.561000	0.74099	GAG		0.687	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147		5	21	0	0	0	0.021553	0	5	21				
RSRP1	57035	broad.mit.edu	37	1	25573111	25573111	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:25573111G>C	ENST00000243189.7	-	2	620	c.344C>G	c.(343-345)tCc>tGc	p.S115C	RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000431849.2_Missense_Mutation_p.S115C|C1orf63_ENST00000417642.2_Missense_Mutation_p.S108C	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		115	Arg/Ser-rich.							p.S115C(1)		breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTGCTACGGGACCGGGACCG	0.677																																							uc001bjw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(343-345)TCC>TGC		hypothetical protein LOC57035							49.0	44.0	45.0					1																	25573111		2203	4300	6503	SO:0001583	missense	57035							g.chr1:25573111G>C																												ENST00000243189.7:c.344C>G	1.37:g.25573111G>C	ENSP00000243189:p.Ser115Cys		Somatic					p.S115C	NM_020317	NP_064713	WXS	Illumina HiSeq	Unspecified	Q9BUV0	CA063_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	2	596	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	115			Arg-rich.		A8K917|Q49AA4|Q5TH71|Q9GZP6	Missense_Mutation	SNP	ENST00000243189.7	37	c.344C>G	CCDS260.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884511	0.72410	.	.	ENSG00000117616	ENST00000243189;ENST00000417642;ENST00000431849	T;T;T	0.59772	1.1;1.03;0.24	4.21	4.21	0.49690	.	0.596332	0.14970	N	0.287849	T	0.65801	0.2726	L	0.29908	0.895	0.47094	D	0.999312	D	0.89917	1.0	D	0.87578	0.998	T	0.67960	-0.5535	10	0.72032	D	0.01	-10.5756	14.2007	0.65703	0.0:0.0:1.0:0.0	.	115	Q9BUV0	CA063_HUMAN	C	115;108;115	ENSP00000243189:S115C;ENSP00000411631:S108C;ENSP00000391510:S115C	ENSP00000243189:S115C	S	-	2	0	C1orf63	25445698	0.161000	0.22892	0.886000	0.34754	0.051000	0.14879	1.952000	0.40343	2.328000	0.79073	0.561000	0.74099	TCC		0.677	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2			27	64	0	0	0	0.024334	0	27	64				
EYA3	2140	broad.mit.edu	37	1	28384528	28384528	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:28384528C>G	ENST00000373871.3	-	2	250	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	EYA3_ENST00000373863.3_Missense_Mutation_p.E4Q|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000545175.1_5'UTR|EYA3_ENST00000436342.2_5'UTR|EYA3_ENST00000373864.1_5'UTR|EYA3_ENST00000540618.1_Missense_Mutation_p.E4Q	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	4					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E4Q(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		AAATCTTGCTCTTCTTCCATG	0.313																																							uc001bpi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(10-12)GAG>CAG		eyes absent 3							122.0	128.0	126.0					1																	28384528		2203	4300	6503	SO:0001583	missense	2140				anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity	g.chr1:28384528C>G	U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.10G>C	1.37:g.28384528C>G	ENSP00000362978:p.Glu4Gln		Somatic				EYA3_uc010ofs.1_5'UTR|EYA3_uc010oft.1_Missense_Mutation_p.E4Q|EYA3_uc001bpj.2_Missense_Mutation_p.E4Q|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	p.E4Q	NM_001990	NP_001981	WXS	Illumina HiSeq	Unspecified	Q99504	EYA3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)	2	175	-		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	4					A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Missense_Mutation	SNP	ENST00000373871.3	37	c.10G>C	CCDS316.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811911	0.32053	.	.	ENSG00000158161	ENST00000373871;ENST00000540618;ENST00000373863	D;D;D	0.91894	-2.93;-2.89;-2.8	5.28	5.28	0.74379	.	0.373734	0.29722	N	0.011369	D	0.84142	0.5407	N	0.14661	0.345	0.80722	D	1	B;P;B	0.40476	0.255;0.718;0.34	B;B;B	0.38500	0.032;0.275;0.069	T	0.83200	-0.0079	10	0.21540	T	0.41	-12.3609	13.9117	0.63871	0.0:0.8359:0.1641:0.0	.	4;4;4	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	Q	4	ENSP00000362978:E4Q;ENSP00000442558:E4Q;ENSP00000362970:E4Q	ENSP00000362970:E4Q	E	-	1	0	EYA3	28257115	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.016000	0.49607	2.453000	0.82957	0.650000	0.86243	GAG		0.313	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1	NM_001990		21	203	0	0	0	0.024334	0	21	203				
YTHDF2	51441	broad.mit.edu	37	1	29069903	29069903	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:29069903C>T	ENST00000373812.3	+	4	1483	c.1121C>T	c.(1120-1122)tCt>tTt	p.S374F	YTHDF2_ENST00000541996.1_Missense_Mutation_p.S324F|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000542507.1_Missense_Mutation_p.S374F	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	374	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.S374F(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GTAGGACAGTCTCAGGCTGGT	0.527																																							uc001brc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1120-1122)TCT>TTT		high glucose-regulated protein 8							108.0	106.0	107.0					1																	29069903		1974	4150	6124	SO:0001583	missense	51441				humoral immune response			g.chr1:29069903C>T	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.1121C>T	1.37:g.29069903C>T	ENSP00000362918:p.Ser374Phe		Somatic				YTHDF2_uc001brd.2_Missense_Mutation_p.S371F|YTHDF2_uc010ofx.1_Missense_Mutation_p.S324F|YTHDF2_uc001bre.2_Missense_Mutation_p.S324F	p.S374F	NM_016258	NP_057342	WXS	Illumina HiSeq	Unspecified	Q9Y5A9	YTHD2_HUMAN		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)	4	1618	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	374					A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	ENST00000373812.3	37	c.1121C>T	CCDS41296.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764275	0.31228	.	.	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.24538	1.85;1.85;1.85	5.91	5.91	0.95273	.	0.259165	0.38005	N	0.001854	T	0.17450	0.0419	N	0.22421	0.69	0.51012	D	0.999905	B;B	0.21381	0.055;0.001	B;B	0.20577	0.03;0.002	T	0.09143	-1.0688	9	.	.	.	.	12.4068	0.55445	0.0:0.9225:0.0:0.0775	.	374;374	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	F	374;374;324;374	ENSP00000444660:S374F;ENSP00000362918:S374F;ENSP00000439394:S324F	.	S	+	2	0	YTHDF2	28942490	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.492000	0.66893	2.802000	0.96397	0.655000	0.94253	TCT		0.527	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258		37	78	0	0	0	0.017118	0	37	78				
MYCL	4610	broad.mit.edu	37	1	40363105	40363105	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:40363105C>G	ENST00000372816.2	-	2	1481	c.1034G>C	c.(1033-1035)aGa>aCa	p.R345T	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Missense_Mutation_p.R375T			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	345	Leucine-zipper.					nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R375T(1)									TCGGAGCTGTCTTTTCTCTGT	0.522																																							uc001cer.1		NA								A							small cell lung 		1	Substitution - Missense(1)		lung(1)	lung(1)|liver(1)	2						c.(1033-1035)AGA>ACA		l-myc-1 proto-oncogene isoform 1							70.0	77.0	75.0					1																	40363105		2203	4300	6503	SO:0001583	missense	4610					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:40363105C>G		CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.1034G>C	1.37:g.40363105C>G	ENSP00000361903:p.Arg345Thr		Somatic				MYCL1_uc001ces.1_Missense_Mutation_p.R345T	p.R345T	NM_001033082	NP_001028254	WXS	Illumina HiSeq	Unspecified	P12524	MYCL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.51e-19)|Epithelial(16;3.36e-18)|all cancers(16;8.43e-17)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		3	1251	-	all_cancers(7;1.73e-14)|all_lung(5;2.77e-17)|all_epithelial(6;6.81e-17)|Lung SC(1;2.85e-13)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	345			Leucine-zipper.		A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Missense_Mutation	SNP	ENST00000372816.2	37	c.1034G>C	CCDS30682.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200128	0.38905	.	.	ENSG00000116990	ENST00000397332;ENST00000372816	D;D	0.88124	-2.34;-2.34	5.37	5.37	0.77165	Helix-loop-helix DNA-binding (2);	0.178252	0.53938	D	0.000057	D	0.87645	0.6229	L	0.58101	1.795	0.80722	D	1	D	0.54207	0.965	P	0.52598	0.703	D	0.86970	0.2097	10	0.48119	T	0.1	5.8025	8.4801	0.33038	0.1538:0.7692:0.0:0.077	.	345	P12524	MYCL1_HUMAN	T	375;345	ENSP00000380494:R375T;ENSP00000361903:R345T	ENSP00000361903:R345T	R	-	2	0	MYCL1	40135692	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.444000	0.44890	2.500000	0.84329	0.655000	0.94253	AGA		0.522	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1	NM_001033082		60	98	0	0	0	0.01441	0	60	98				
EIF2B3	8891	broad.mit.edu	37	1	45347297	45347297	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:45347297C>T	ENST00000360403.2	-	7	897	c.771G>A	c.(769-771)gaG>gaA	p.E257E	EIF2B3_ENST00000372183.3_Silent_p.E257E	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	257					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)	p.E257E(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					AGGACTTCAGCTCCTTTTTCT	0.468																																					Colon(26;357 658 2581 11857 12657)	Colon(26;357 658 2581 11857 12657)	uc001cmt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(769-771)GAG>GAA		eukaryotic translation initiation factor 2B,							251.0	234.0	240.0					1																	45347297		2203	4300	6503	SO:0001819	synonymous_variant	8891				negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity	g.chr1:45347297C>T	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.771G>A	1.37:g.45347297C>T			Somatic				EIF2B3_uc001cmu.1_Silent_p.E257E|EIF2B3_uc001cmv.1_Silent_p.E257E|EIF2B3_uc001cmw.2_Silent_p.E257E	p.E257E	NM_020365	NP_065098	WXS	Illumina HiSeq	Unspecified	Q9NR50	EI2BG_HUMAN			7	898	-	Acute lymphoblastic leukemia(166;0.155)		257					B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	ENST00000360403.2	37	c.771G>A	CCDS517.1	.	.	.	.	.	.	.	.	.	.	C	1.054	-0.675029	0.03378	.	.	ENSG00000070785	ENST00000439363	.	.	.	6.08	-4.55	0.03441	.	.	.	.	.	T	0.38321	0.1036	.	.	.	0.49582	D	0.999806	.	.	.	.	.	.	T	0.39881	-0.9592	4	.	.	.	-1.2251	2.1405	0.03774	0.1753:0.2413:0.1204:0.4629	.	.	.	.	N	78	.	.	S	-	2	0	EIF2B3	45119884	0.060000	0.20803	0.337000	0.25536	0.410000	0.31052	-1.256000	0.02869	-0.479000	0.06813	-0.274000	0.10170	AGC		0.468	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365		63	173	0	0	0	0.01441	0	63	173				
MYSM1	114803	broad.mit.edu	37	1	59139252	59139252	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:59139252G>A	ENST00000472487.1	-	11	1604	c.1565C>T	c.(1564-1566)aCg>aTg	p.T522M	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	522					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T522M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					TACCTCAAACGTTTGTCCTTC	0.383																																							uc009wab.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1564-1566)ACG>ATG		Myb-like, SWIRM and MPN domains 1							84.0	82.0	83.0					1																	59139252		1880	4110	5990	SO:0001583	missense	114803				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:59139252G>A	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.1565C>T	1.37:g.59139252G>A	ENSP00000418734:p.Thr522Met		Somatic				MYSM1_uc001czc.2_RNA	p.T522M	NM_001085487	NP_001078956	WXS	Illumina HiSeq	Unspecified	Q5VVJ2	MYSM1_HUMAN			11	1588	-	all_cancers(7;9.36e-06)		522					A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	37	c.1565C>T	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782782	0.90282	.	.	ENSG00000162601	ENST00000472487	T	0.36878	1.23	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.61198	0.2328	M	0.69823	2.125	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.63152	-0.6701	10	0.72032	D	0.01	-14.3749	18.091	0.89475	0.0:0.0:1.0:0.0	.	522	Q5VVJ2	MYSM1_HUMAN	M	522	ENSP00000418734:T522M	ENSP00000418734:T522M	T	-	2	0	MYSM1	58911840	1.000000	0.71417	0.846000	0.33378	0.991000	0.79684	9.263000	0.95617	2.821000	0.97095	0.650000	0.86243	ACG		0.383	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481		4	69	0	0	0	0.014758	0	4	69				
DOCK7	85440	broad.mit.edu	37	1	63113915	63113915	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:63113915C>G	ENST00000340370.5	-	6	611	c.594G>C	c.(592-594)ttG>ttC	p.L198F	DOCK7_ENST00000404627.2_Missense_Mutation_p.L198F|DOCK7_ENST00000251157.5_Missense_Mutation_p.L198F	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	198					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.L198F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GTGAATTTTTCAAGTCAAAGA	0.383																																							uc001daq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(592-594)TTG>TTC		dedicator of cytokinesis 7							81.0	84.0	83.0					1																	63113915		2203	4300	6503	SO:0001583	missense	85440				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding	g.chr1:63113915C>G		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.594G>C	1.37:g.63113915C>G	ENSP00000340742:p.Leu198Phe		Somatic				DOCK7_uc001dan.2_Missense_Mutation_p.L90F|DOCK7_uc001dao.2_Missense_Mutation_p.L90F|DOCK7_uc001dap.2_Missense_Mutation_p.L198F|DOCK7_uc009wah.1_Missense_Mutation_p.L198F	p.L198F	NM_033407	NP_212132	WXS	Illumina HiSeq	Unspecified	Q96N67	DOCK7_HUMAN			6	628	-			198					Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	c.594G>C	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139237	0.56936	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.21543	2.0;2.0;2.0	4.88	3.01	0.34805	.	0.000000	0.64402	D	0.000001	T	0.35480	0.0933	M	0.89287	3.02	0.53005	D	0.999961	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	T	0.26849	-1.0091	10	0.87932	D	0	.	6.0907	0.19993	0.0:0.5555:0.2792:0.1653	.	198;198;198;198;198	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	F	198	ENSP00000251157:L198F;ENSP00000340742:L198F;ENSP00000384446:L198F	ENSP00000251157:L198F	L	-	3	2	DOCK7	62886503	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.520000	0.35899	0.635000	0.30488	-0.253000	0.11424	TTG		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407		42	66	0	0	0	0.010771	0	42	66				
LRRC40	55631	broad.mit.edu	37	1	70611554	70611554	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:70611554G>T	ENST00000370952.3	-	15	1817	c.1738C>A	c.(1738-1740)Cct>Act	p.P580T		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	580						membrane (GO:0016020)		p.P580T(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						GCTGCTCGAGGAACTCGGAAT	0.348																																							uc001der.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1738-1740)CCT>ACT		leucine rich repeat containing 40							77.0	75.0	76.0					1																	70611554		2203	4300	6503	SO:0001583	missense	55631							g.chr1:70611554G>T		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1738C>A	1.37:g.70611554G>T	ENSP00000359990:p.Pro580Thr		Somatic					p.P580T	NM_017768	NP_060238	WXS	Illumina HiSeq	Unspecified	Q9H9A6	LRC40_HUMAN			15	1790	-			580			LRR 20.		Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	c.1738C>A	CCDS646.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470059	0.84533	.	.	ENSG00000066557	ENST00000370952	T	0.39787	1.06	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.71787	0.3381	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81185	-0.1048	10	0.62326	D	0.03	.	18.1907	0.89806	0.0:0.0:1.0:0.0	.	580	Q9H9A6	LRC40_HUMAN	T	580	ENSP00000359990:P580T	ENSP00000359990:P580T	P	-	1	0	LRRC40	70384142	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.911000	0.87458	2.367000	0.80283	0.655000	0.94253	CCT		0.348	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768		9	60	1	0	2.74318e-10	0.006214	3.12335e-10	9	60				
CLCA4	22802	broad.mit.edu	37	1	87031004	87031004	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:87031004G>A	ENST00000370563.3	+	5	647	c.605G>A	c.(604-606)gGa>gAa	p.G202E	CLCA4_ENST00000263723.5_Intron	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	202					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.G202E(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AAGTGTCAAGGAGGCAGCTGT	0.358																																							uc009wcs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(604-606)GGA>GAA		chloride channel accessory 4							101.0	101.0	101.0					1																	87031004		2031	4200	6231	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87031004G>A	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.605G>A	1.37:g.87031004G>A	ENSP00000359594:p.Gly202Glu		Somatic				CLCA4_uc009wct.2_5'UTR|CLCA4_uc009wcu.2_Missense_Mutation_p.G22E	p.G202E	NM_012128	NP_036260	WXS	Illumina HiSeq	Unspecified	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	5	649	+		Lung NSC(277;0.238)	202					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.605G>A	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158296	0.78114	.	.	ENSG00000016602	ENST00000370563	T	0.12672	2.66	5.96	5.96	0.96718	Chloride channel calcium-activated (1);	0.067261	0.64402	D	0.000014	T	0.34978	0.0916	M	0.88640	2.97	0.80722	D	1	P	0.46457	0.878	P	0.57324	0.818	T	0.11991	-1.0565	10	0.62326	D	0.03	-26.0922	19.167	0.93561	0.0:0.0:1.0:0.0	.	202	Q14CN2	CLCA4_HUMAN	E	202	ENSP00000359594:G202E	ENSP00000359594:G202E	G	+	2	0	CLCA4	86803592	0.999000	0.42202	0.957000	0.39632	0.884000	0.51177	2.773000	0.47686	2.830000	0.97506	0.655000	0.94253	GGA		0.358	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		4	87	0	0	0	0.009096	0	4	87				
RPL5	6125	broad.mit.edu	37	1	93306114	93306114	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:93306114G>T	ENST00000370321.3	+	7	802	c.712G>T	c.(712-714)Gag>Tag	p.E238*	SNORA66_ENST00000515986.1_RNA|SNORA66_ENST00000384792.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	238					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E238*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TCAGATGGAGGAGATGTATAA	0.363																																							uc001doz.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(712-714)GAG>TAG		ribosomal protein L5							143.0	146.0	145.0					1																	93306114		2203	4300	6503	SO:0001587	stop_gained	6125				endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome	g.chr1:93306114G>T	U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.712G>T	1.37:g.93306114G>T	ENSP00000359345:p.Glu238*		Somatic				FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_Nonsense_Mutation_p.E188*|RPL5_uc001dpd.2_Nonsense_Mutation_p.E39*|SNORA66_uc009wdi.1_5'Flank	p.E238*	NM_000969	NP_000960	WXS	Illumina HiSeq	Unspecified	P46777	RL5_HUMAN		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)	7	790	+		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)	238					Q32LZ3|Q53HH6|Q9H3F4	Nonsense_Mutation	SNP	ENST00000370321.3	37	c.712G>T	CCDS741.1	.	.	.	.	.	.	.	.	.	.	G	37	6.175400	0.97348	.	.	ENSG00000122406	ENST00000432788;ENST00000370321	.	.	.	5.36	5.36	0.76844	.	0.104529	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	19.4592	0.94910	0.0:0.0:1.0:0.0	.	.	.	.	X	188;238	.	ENSP00000359345:E238X	E	+	1	0	RPL5	93078702	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.956000	0.87863	2.656000	0.90262	0.655000	0.94253	GAG		0.363	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030058.2	NM_000969		34	99	1	0	6.53348e-20	0.017118	7.93486e-20	34	99				
ABCA4	24	broad.mit.edu	37	1	94508894	94508894	+	Nonsense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:94508894G>C	ENST00000370225.3	-	21	3274	c.3188C>G	c.(3187-3189)tCa>tGa	p.S1063*		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1063	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		S -> P (in STGD1). {ECO:0000269|PubMed:10958763}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.S1063*(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGAGCACCTGATAGGTCCTG	0.592																																							uc001dqh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12						c.(3187-3189)TCA>TGA		ATP-binding cassette, sub-family A member 4							93.0	81.0	85.0					1																	94508894		2203	4300	6503	SO:0001587	stop_gained	24				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr1:94508894G>C	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3188C>G	1.37:g.94508894G>C	ENSP00000359245:p.Ser1063*		Somatic					p.S1063*	NM_000350	NP_000341	WXS	Illumina HiSeq	Unspecified	P78363	ABCA4_HUMAN		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)	21	3292	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	1063		S -> P (in STGD1).	Cytoplasmic.|ABC transporter 1.		O15112|O60438|O60915|Q0QD48|Q4LE31	Nonsense_Mutation	SNP	ENST00000370225.3	37	c.3188C>G	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	43	10.353123	0.99389	.	.	ENSG00000198691	ENST00000370225	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1252	0.97977	0.0:0.0:1.0:0.0	.	.	.	.	X	1063	.	ENSP00000359245:S1063X	S	-	2	0	ABCA4	94281482	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	9.728000	0.98792	2.758000	0.94735	0.591000	0.81541	TCA		0.592	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		10	60	0	0	0	0.008291	0	10	60				
RTCA	8634	broad.mit.edu	37	1	100757055	100757055	+	Silent	SNP	C	C	T	rs372455648		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:100757055C>T	ENST00000370128.4	+	11	1265	c.1096C>T	c.(1096-1098)Cta>Tta	p.L366L	RTCA_ENST00000260563.4_Silent_p.L379L	NM_003729.3	NP_003720.1	O00442	RTCA_HUMAN	RNA 3'-terminal phosphate cyclase	366					RNA processing (GO:0006396)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA-3'-phosphate cyclase activity (GO:0003963)	p.L366L(1)									AAATCCAAATCTATAGAGTAT	0.303																																							uc001dtc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1096-1098)CTA>TTA		RNA terminal phosphate cyclase domain 1 isoform							82.0	95.0	90.0					1																	100757055		2201	4299	6500	SO:0001819	synonymous_variant	8634				RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity	g.chr1:100757055C>T	Y11651	CCDS768.1, CCDS44178.1	1p13.3	2012-03-30	2012-03-30	2012-03-30	ENSG00000137996	ENSG00000137996	6.5.1.4		17981	protein-coding gene	gene with protein product		611286	"""RTC domain containing 1"", ""RNA terminal phosphate cyclase domain 1"""	RTCD1		9184239	Standard	NM_003729		Approved	RPC, RTC1	uc001dtd.3	O00442	OTTHUMG00000010920	ENST00000370128.4:c.1096C>T	1.37:g.100757055C>T			Somatic				RTCD1_uc001dtd.2_Silent_p.L379L	p.L366L	NM_003729	NP_003720	WXS	Illumina HiSeq	Unspecified	O00442	RTC1_HUMAN		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	11	1314	+		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)	366					Q5VVL5|Q5VVL6|Q96E99	Silent	SNP	ENST00000370128.4	37	c.1096C>T	CCDS768.1																																																																																				0.303	RTCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030098.2			8	252	0	0	0	0.00308	0	8	252				
VCAM1	7412	broad.mit.edu	37	1	101186146	101186146	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:101186146G>A	ENST00000294728.2	+	2	280	c.179G>A	c.(178-180)aGa>aAa	p.R60K	VCAM1_ENST00000370119.4_Intron|VCAM1_ENST00000347652.2_Missense_Mutation_p.R60K|VCAM1_ENST00000370115.1_Missense_Mutation_p.R60K	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	60	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.R60K(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TTCTCTTGGAGAACCCAGATA	0.478																																							uc001dti.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(178-180)AGA>AAA		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						80.0	74.0	76.0					1																	101186146		2203	4300	6503	SO:0001583	missense	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101186146G>A	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.179G>A	1.37:g.101186146G>A	ENSP00000294728:p.Arg60Lys		Somatic				VCAM1_uc001dtj.2_Missense_Mutation_p.R60K|VCAM1_uc010ouj.1_Intron	p.R60K	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	2	299	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	60			Ig-like C2-type 1.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	c.179G>A	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356364	0.82243	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	T;T;T	0.09255	3.0;3.0;3.0	5.72	4.81	0.61882	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.144158	0.64402	D	0.000010	T	0.24547	0.0595	M	0.80982	2.52	0.35102	D	0.765375	P;D	0.76494	0.946;0.999	P;D	0.91635	0.498;0.999	T	0.13388	-1.0511	9	.	.	.	-14.6127	14.8055	0.69952	0.0:0.1439:0.856:0.0	.	60;60	P19320-2;P19320	.;VCAM1_HUMAN	K	60	ENSP00000304611:R60K;ENSP00000294728:R60K;ENSP00000359133:R60K	.	R	+	2	0	VCAM1	100958734	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	4.615000	0.61190	1.398000	0.46701	0.655000	0.94253	AGA		0.478	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		22	55	0	0	0	0.010504	0	22	55				
COL11A1	1301	broad.mit.edu	37	1	103462666	103462666	+	Silent	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:103462666T>C	ENST00000370096.3	-	26	2523	c.2211A>G	c.(2209-2211)aaA>aaG	p.K737K	COL11A1_ENST00000512756.1_Silent_p.K621K|COL11A1_ENST00000353414.4_Silent_p.K698K|COL11A1_ENST00000358392.2_Silent_p.K749K	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	737	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.K737K(1)|p.K749K(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACTGGCCTTCTTTCCCAGGAT	0.328																																							uc001dul.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2209-2211)AAA>AAG		alpha 1 type XI collagen isoform A							139.0	159.0	152.0					1																	103462666		2203	4298	6501	SO:0001819	synonymous_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103462666T>C	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2211A>G	1.37:g.103462666T>C			Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Silent_p.K749K|COL11A1_uc001dun.2_Silent_p.K698K|COL11A1_uc009weh.2_Silent_p.K621K	p.K737K	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	26	2529	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	737			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	c.2211A>G	CCDS778.1																																																																																				0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		7	445	0	0	0	0.008291	0	7	445				
AMPD2	271	broad.mit.edu	37	1	110172893	110172893	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:110172893C>T	ENST00000256578.3	+	16	2544	c.2184C>T	c.(2182-2184)atC>atT	p.I728I	AMPD2_ENST00000528454.1_Silent_p.I610I|AMPD2_ENST00000393688.3_Silent_p.I609I|AMPD2_ENST00000358729.4_Silent_p.I653I|AMPD2_ENST00000528667.1_Silent_p.I728I|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Silent_p.I647I	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	728					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.I728I(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGGCCCAGATCGGCATCGCCA	0.652																																							uc009wfh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(2182-2184)ATC>ATT		adenosine monophosphate deaminase 2 (isoform L)							127.0	131.0	130.0					1																	110172893		2203	4300	6503	SO:0001819	synonymous_variant	271				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:110172893C>T	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2184C>T	1.37:g.110172893C>T			Somatic				AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Silent_p.I647I|AMPD2_uc001dyc.1_Silent_p.I728I|AMPD2_uc010ovr.1_Silent_p.I653I|AMPD2_uc001dyd.1_Silent_p.I609I|AMPD2_uc001dye.1_5'UTR	p.I728I	NM_004037	NP_004028	WXS	Illumina HiSeq	Unspecified	Q01433	AMPD2_HUMAN		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)	17	2726	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	728					B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Silent	SNP	ENST00000256578.3	37	c.2184C>T	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.767|4.767	0.142535|0.142535	0.09083|0.09083	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000476688	.|.	.|.	.|.	4.66|4.66	-9.32|-9.32	0.00643|0.00643	.|.	.|.	.|.	.|.	.|.	T|T	0.30696|0.30696	0.0773|0.0773	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.56366|0.56366	-0.7991|-0.7991	4|4	.|.	.|.	.|.	-8.6198|-8.6198	9.8764|9.8764	0.41207|0.41207	0.1775:0.5036:0.0:0.319|0.1775:0.5036:0.0:0.319	.|.	.|.	.|.	.|.	W|L	699|117	.|.	.|.	R|S	+|+	1|2	2|0	AMPD2|AMPD2	109974416|109974416	0.000000|0.000000	0.05858|0.05858	0.331000|0.331000	0.25455|0.25455	0.508000|0.508000	0.34012|0.34012	-5.514000|-5.514000	0.00116|0.00116	-2.938000|-2.938000	0.00298|0.00298	-2.634000|-2.634000	0.00153|0.00153	CGG|TCG		0.652	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			65	129	0	0	0	0.01441	0	65	129				
SYCP1	6847	broad.mit.edu	37	1	115456644	115456644	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:115456644C>G	ENST00000369522.3	+	20	1936	c.1696C>G	c.(1696-1698)Caa>Gaa	p.Q566E	SYCP1_ENST00000369518.1_Missense_Mutation_p.Q566E	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	566					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.Q566E(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAAATCTTCAAGAAACAGA	0.239																																							uc001efr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1696-1698)CAA>GAA		synaptonemal complex protein 1							36.0	38.0	37.0					1																	115456644		2198	4268	6466	SO:0001583	missense	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115456644C>G	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1696C>G	1.37:g.115456644C>G	ENSP00000358535:p.Gln566Glu		Somatic				SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.Q566E|SYCP1_uc009wgw.2_Missense_Mutation_p.Q566E	p.Q566E	NM_003176	NP_003167	WXS	Illumina HiSeq	Unspecified	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	20	1905	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	566			Potential.		O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	c.1696C>G	CCDS879.1	.	.	.	.	.	.	.	.	.	.	C	0.331	-0.956344	0.02267	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.39406	1.08;1.08;1.08	5.34	2.36	0.29203	.	0.166761	0.51477	N	0.000099	T	0.01835	0.0058	N	0.00128	-2.045	0.09310	N	0.999991	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47674	-0.9099	10	0.02654	T	1	-3.0477	8.1392	0.31073	0.0834:0.3005:0.6162:0.0	.	566;566	B7ZLS9;Q15431	.;SYCP1_HUMAN	E	566	ENSP00000358535:Q566E;ENSP00000410011:Q566E;ENSP00000358531:Q566E	ENSP00000358531:Q566E	Q	+	1	0	SYCP1	115258167	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.692000	0.37731	0.296000	0.22592	-0.204000	0.12730	CAA		0.239	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		18	36	0	0	0	0.007413	0	18	36				
NBPF10	100132406	broad.mit.edu	37	1	145302756	145302756	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:145302756C>T	ENST00000369339.3	+	5	634	c.381C>T	c.(379-381)ctC>ctT	p.L127L	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Silent_p.L127L|NBPF10_ENST00000342960.5_Silent_p.L398L			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	398						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L398L(1)|p.L127L(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGAGCATCTCCAGGCCCTCC	0.552																																							uc001end.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1192-1194)CTC>CTT		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145302756C>T	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.381C>T	1.37:g.145302756C>T			Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Silent_p.L127L	p.L398L	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	8	1229	+	all_hematologic(923;0.032)		Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000369339.3	37	c.1194C>T																																																																																					0.552	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		12	344	0	0	0	0.013537	0	12	344				
POLR3C	10623	broad.mit.edu	37	1	145598609	145598609	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:145598609C>T	ENST00000334163.3	-	8	1044	c.884G>A	c.(883-885)aGa>aAa	p.R295K	POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Missense_Mutation_p.R295K	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	295					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.R295K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			AGGTAGGGATCTGAAGATCTA	0.408																																							uc001eoh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(883-885)AGA>AAA		polymerase (RNA) III (DNA directed) polypeptide							120.0	118.0	119.0					1																	145598609		2203	4300	6503	SO:0001583	missense	10623				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr1:145598609C>T	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.884G>A	1.37:g.145598609C>T	ENSP00000334564:p.Arg295Lys		Somatic				NBPF10_uc001emp.3_Intron|POLR3C_uc001eog.2_Missense_Mutation_p.R308K|POLR3C_uc001eoi.2_RNA|POLR3C_uc009wix.2_Missense_Mutation_p.R295K	p.R295K	NM_006468	NP_006459	WXS	Illumina HiSeq	Unspecified	Q9BUI4	RPC3_HUMAN	Epithelial(2;7.55e-13)		8	1045	-	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		295					O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	37	c.884G>A	CCDS921.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606384	0.87157	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.49432	0.78;0.78	6.17	6.17	0.99709	RNA polymerase III Rpc82, C -terminal (1);	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	L	0.59436	1.845	0.80722	D	1	B;B;B	0.31769	0.024;0.339;0.261	B;B;B	0.33339	0.031;0.093;0.162	T	0.15321	-1.0441	10	0.10902	T	0.67	-19.2162	18.3732	0.90420	0.0:1.0:0.0:0.0	.	295;295;295	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	K	295	ENSP00000334564:R295K;ENSP00000358300:R295K	ENSP00000334564:R295K	R	-	2	0	POLR3C	144309966	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.891000	0.75639	2.941000	0.99782	0.655000	0.94253	AGA		0.408	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468		42	139	0	0	0	0.009718	0	42	139				
MTMR11	10903	broad.mit.edu	37	1	149901597	149901597	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:149901597G>A	ENST00000439741.2	-	16	2109	c.1859C>T	c.(1858-1860)cCa>cTa	p.P620L	MTMR11_ENST00000369140.3_Missense_Mutation_p.P548L|MTMR11_ENST00000406732.3_3'UTR|SF3B4_ENST00000271628.8_5'Flank|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000361405.6_3'UTR	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	620	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)	p.P620L(1)|p.P548L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAGCAGCCCTGGAGGTAAAGG	0.587																																							uc001etl.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(1858-1860)CCA>CTA		myotubularin related protein 11 isoform a							76.0	81.0	80.0					1																	149901597		2203	4300	6503	SO:0001583	missense	10903						phosphatase activity	g.chr1:149901597G>A	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1859C>T	1.37:g.149901597G>A	ENSP00000391668:p.Pro620Leu		Somatic				SF3B4_uc001etj.1_5'Flank|SF3B4_uc001etk.1_5'Flank|SF3B4_uc009wll.1_5'Flank|MTMR11_uc001etm.1_Missense_Mutation_p.P548L	p.P620L	NM_001145862	NP_001139334	WXS	Illumina HiSeq	Unspecified	A4FU01	MTMRB_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		16	2110	-	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		620			Myotubularin phosphatase.		B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	ENST00000439741.2	37	c.1859C>T	CCDS53360.1	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014922	0.19355	.	.	ENSG00000014914	ENST00000369140;ENST00000439741	T;T	0.40756	1.02;1.02	5.02	5.02	0.67125	Myotubularin phosphatase domain (1);	0.399988	0.24124	N	0.041323	T	0.16981	0.0408	N	0.19112	0.55	0.41309	D	0.987098	B;B	0.16603	0.015;0.018	B;B	0.21546	0.02;0.035	T	0.05566	-1.0877	10	0.56958	D	0.05	.	11.5456	0.50693	0.0:0.18:0.8199:0.0	.	548;620	A4FU01-4;A4FU01	.;MTMRB_HUMAN	L	548;620	ENSP00000358136:P548L;ENSP00000391668:P620L	ENSP00000358136:P548L	P	-	2	0	MTMR11	148168221	0.039000	0.19947	0.563000	0.28383	0.984000	0.73092	0.486000	0.22340	2.607000	0.88179	0.655000	0.94253	CCA		0.587	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873		35	170	0	0	0	0.013726	0	35	170				
RFX5	5993	broad.mit.edu	37	1	151314991	151314991	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:151314991C>T	ENST00000290524.4	-	11	1700	c.1522G>A	c.(1522-1524)Gaa>Aaa	p.E508K	RFX5_ENST00000368870.2_Missense_Mutation_p.E508K|RFX5_ENST00000452513.2_Missense_Mutation_p.E468K|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Missense_Mutation_p.E508K	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	508					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E508K(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GAGTTGCCTTCCCCTCCTGAG	0.577																																							uc001exv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1522-1524)GAA>AAA		regulatory factor X, 5							102.0	108.0	106.0					1																	151314991		2203	4300	6503	SO:0001583	missense	5993					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:151314991C>T		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1522G>A	1.37:g.151314991C>T	ENSP00000290524:p.Glu508Lys		Somatic				RFX5_uc001exw.1_Missense_Mutation_p.E508K|RFX5_uc009wmr.1_Missense_Mutation_p.E508K|RFX5_uc010pcx.1_Missense_Mutation_p.E468K	p.E508K	NM_001025603	NP_001020774	WXS	Illumina HiSeq	Unspecified	P48382	RFX5_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		11	1736	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		508					B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	37	c.1522G>A	CCDS994.1	.	.	.	.	.	.	.	.	.	.	C	8.714	0.912679	0.17907	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513;ENST00000392746	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.36	2.51	0.30379	.	0.732533	0.12707	N	0.445857	T	0.18341	0.0440	L	0.53249	1.67	0.09310	N	1	B;P	0.34522	0.0;0.455	B;B	0.37198	0.001;0.243	T	0.16928	-1.0386	10	0.33940	T	0.23	-1.0974	6.3768	0.21511	0.0:0.6868:0.1507:0.1625	.	468;508	B7Z848;P48382	.;RFX5_HUMAN	K	508;508;508;468;508	ENSP00000290524:E508K;ENSP00000357864:E508K;ENSP00000389130:E508K;ENSP00000398388:E468K;ENSP00000376502:E508K	ENSP00000290524:E508K	E	-	1	0	RFX5	149581615	0.001000	0.12720	0.001000	0.08648	0.019000	0.09904	0.471000	0.22100	0.411000	0.25702	0.591000	0.81541	GAA		0.577	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449		72	210	0	0	0	0.01441	0	72	210				
CD1A	909	broad.mit.edu	37	1	158225933	158225933	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:158225933G>T	ENST00000289429.5	+	3	998	c.465G>T	c.(463-465)ggG>ggT	p.G155G		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	155					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)		p.G155G(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CAGTGGCTGGGAATATGGCCA	0.443																																							uc001frt.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|skin(1)	3						c.(463-465)GGG>GGT		CD1A antigen precursor	Antithymocyte globulin(DB00098)						111.0	98.0	102.0					1																	158225933		2203	4300	6503	SO:0001819	synonymous_variant	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158225933G>T	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.465G>T	1.37:g.158225933G>T			Somatic					p.G155G	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			3	998	+	all_hematologic(112;0.0378)		155			Extracellular (Potential).		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	ENST00000289429.5	37	c.465G>T	CCDS1174.1																																																																																				0.443	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763		33	90	1	0	1.22384e-17	0.013726	1.46511e-17	33	90				
OR10R2	343406	broad.mit.edu	37	1	158450025	158450025	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:158450025C>T	ENST00000368152.1	+	1	358	c.358C>T	c.(358-360)Caa>Taa	p.Q120*	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q120*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TTGTGCTCTTCAAATGTTCTT	0.453																																							uc010pik.1		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(358-360)CAA>TAA		olfactory receptor, family 10, subfamily R,							401.0	334.0	356.0					1																	158450025		2203	4300	6503	SO:0001587	stop_gained	343406				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158450025C>T	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.358C>T	1.37:g.158450025C>T	ENSP00000357134:p.Gln120*		Somatic				uc001fso.1_RNA	p.Q120*	NM_001004472	NP_001004472	WXS	Illumina HiSeq	Unspecified	Q8NGX6	O10R2_HUMAN			1	358	+	all_hematologic(112;0.0378)		120			Helical; Name=3; (Potential).		Q5VWM8|Q6IFS1|Q96R61	Nonsense_Mutation	SNP	ENST00000368152.1	37	c.358C>T	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	c	24.4	4.524624	0.85600	.	.	ENSG00000198965	ENST00000368152	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.0834	0.81020	0.0:1.0:0.0:0.0	.	.	.	.	X	120	.	ENSP00000357134:Q120X	Q	+	1	0	OR10R2	156716649	1.000000	0.71417	0.879000	0.34478	0.837000	0.47467	6.967000	0.76079	2.278000	0.76064	0.655000	0.94253	CAA		0.453	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472		121	354	0	0	0	0.01441	0	121	354				
SPTA1	6708	broad.mit.edu	37	1	158596652	158596652	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:158596652G>T	ENST00000368147.4	-	41	5990	c.5810C>A	c.(5809-5811)gCt>gAt	p.A1937D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1937					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.A1937D(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TACCACATCAGCCTTCCAGTT	0.463																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(5809-5811)GCT>GAT		spectrin, alpha, erythrocytic 1							147.0	146.0	146.0					1																	158596652		1878	4114	5992	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158596652G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5810C>A	1.37:g.158596652G>T	ENSP00000357129:p.Ala1937Asp		Somatic					p.A1937D	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			41	6009	-	all_hematologic(112;0.0378)		1937			Spectrin 19.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.5810C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403928	0.83230	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.60299	0.2;0.2	5.41	2.58	0.30949	.	0.266796	0.19926	N	0.102966	T	0.65026	0.2652	M	0.77313	2.365	0.47009	D	0.999287	D	0.76494	0.999	D	0.78314	0.991	T	0.68123	-0.5492	10	0.87932	D	0	.	9.7727	0.40601	0.223:0.0:0.777:0.0	.	1937	P02549	SPTA1_HUMAN	D	1937;1934	ENSP00000357130:A1937D;ENSP00000357129:A1934D	ENSP00000357129:A1934D	A	-	2	0	SPTA1	156863276	1.000000	0.71417	0.979000	0.43373	0.950000	0.60333	4.253000	0.58791	0.430000	0.26230	0.563000	0.77884	GCT		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		15	274	1	0	1.3612e-06	0.024245	1.48527e-06	15	274				
MNDA	4332	broad.mit.edu	37	1	158815572	158815572	+	Silent	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:158815572T>C	ENST00000368141.4	+	5	1027	c.766T>C	c.(766-768)Ttg>Ctg	p.L256L		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	256	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L256L(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CGACATCAACTTGAAAGAGAA	0.363																																							uc001fsz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(766-768)TTG>CTG		myeloid cell nuclear differentiation antigen							85.0	87.0	87.0					1																	158815572		2203	4300	6503	SO:0001819	synonymous_variant	4332				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:158815572T>C	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.766T>C	1.37:g.158815572T>C			Somatic					p.L256L	NM_002432	NP_002423	WXS	Illumina HiSeq	Unspecified	P41218	MNDA_HUMAN			5	966	+	all_hematologic(112;0.0378)		256			HIN-200.			Silent	SNP	ENST00000368141.4	37	c.766T>C	CCDS1177.1																																																																																				0.363	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		6	59	0	0	0	0.021553	0	6	59				
IFI16	3428	broad.mit.edu	37	1	159019381	159019381	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:159019381T>G	ENST00000295809.7	+	9	1912	c.1657T>G	c.(1657-1659)Tta>Gta	p.L553V	IFI16_ENST00000340979.6_Intron|IFI16_ENST00000368132.3_Missense_Mutation_p.L497V|IFI16_ENST00000448393.2_Intron|IFI16_ENST00000359709.3_Missense_Mutation_p.L497V|IFI16_ENST00000430894.2_Missense_Mutation_p.L501V|IFI16_ENST00000368131.4_Intron			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	553					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					CAGCAGTTTCTTAACCACGGT	0.498																																							uc001ftg.2		NA																	0				ovary(1)	1						c.(1489-1491)TTA>GTA		interferon, gamma-inducible protein 16							82.0	82.0	82.0					1																	159019381		692	1591	2283	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:159019381T>G	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1657T>G	1.37:g.159019381T>G	ENSP00000295809:p.Leu553Val		Somatic				IFI16_uc010pis.1_Missense_Mutation_p.L497V|IFI16_uc001fth.2_Intron|IFI16_uc010pit.1_Intron	p.L497V	NM_005531	NP_005522	WXS	Illumina HiSeq	Unspecified	Q16666	IF16_HUMAN			8	1779	+	all_hematologic(112;0.0429)		497					B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.1489T>G		.	.	.	.	.	.	.	.	.	.	T	5.925	0.354737	0.11239	.	.	ENSG00000163565	ENST00000295809;ENST00000368132;ENST00000430894	T;T;T	0.05081	3.5;3.55;3.5	2.4	-0.0545	0.13813	.	.	.	.	.	T	0.01061	0.0035	N	0.22421	0.69	0.09310	N	1	B;P	0.45474	0.447;0.859	B;B	0.41236	0.087;0.351	T	0.36311	-0.9753	9	0.13853	T	0.58	.	2.9267	0.05786	0.0:0.1505:0.2612:0.5883	.	501;497	E7EPR3;Q16666-2	.;.	V	553;497;501	ENSP00000295809:L553V;ENSP00000357114:L497V;ENSP00000394935:L501V	ENSP00000295809:L553V	L	+	1	2	IFI16	157286005	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.133000	0.10451	-0.027000	0.13873	-0.368000	0.07277	TTA		0.498	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		37	248	0	0	0	0.01441	0	37	248				
FCER1A	2205	broad.mit.edu	37	1	159277622	159277622	+	Nonsense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:159277622C>G	ENST00000368115.1	+	6	773	c.674C>G	c.(673-675)tCa>tGa	p.S225*	FCER1A_ENST00000368114.1_Nonsense_Mutation_p.S192*	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	225					activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)	p.S225*(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TTATTTATCTCAACTCAGCAG	0.438																																							uc001ftq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|skin(2)|prostate(1)	5						c.(673-675)TCA>TGA		Fc fragment of IgE, high affinity I, receptor	Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)						123.0	114.0	117.0					1																	159277622		2203	4300	6503	SO:0001587	stop_gained	2205					integral to plasma membrane		g.chr1:159277622C>G	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.674C>G	1.37:g.159277622C>G	ENSP00000357097:p.Ser225*		Somatic					p.S225*	NM_002001	NP_001992	WXS	Illumina HiSeq	Unspecified	P12319	FCERA_HUMAN			6	773	+	all_hematologic(112;0.0429)		225			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000368115.1	37	c.674C>G	CCDS1184.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139136	0.77775	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	.	.	.	5.37	1.24	0.21308	.	11.231800	0.00166	N	0.000000	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.4215	0.21746	0.0:0.5963:0.0:0.4037	.	.	.	.	X	225;192	.	ENSP00000357096:S192X	S	+	2	0	FCER1A	157544246	0.002000	0.14202	0.030000	0.17652	0.519000	0.34347	-0.142000	0.10311	0.413000	0.25759	0.650000	0.86243	TCA		0.438	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001		30	80	0	0	0	0.008361	0	30	80				
DUSP27	92235	broad.mit.edu	37	1	167097297	167097297	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:167097297A>G	ENST00000361200.2	+	6	3095	c.2929A>G	c.(2929-2931)Agt>Ggt	p.S977G	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.S977G|DUSP27_ENST00000443333.1_Missense_Mutation_p.S977G			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	977	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S977G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TAAATCCTCCAGTTACAAGTT	0.498																																							uc001geb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2929-2931)AGT>GGT		dual specificity phosphatase 27							73.0	68.0	69.0					1																	167097297		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097297A>G	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2929A>G	1.37:g.167097297A>G	ENSP00000354483:p.Ser977Gly		Somatic					p.S977G	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	2929	+			977			Ser-rich.		A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.2929A>G	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	10.23	1.292073	0.23564	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03831	3.79;3.79;3.79	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000013	T	0.02304	0.0071	L	0.50919	1.6	0.35229	D	0.776738	B	0.29936	0.262	B	0.30401	0.115	T	0.45556	-0.9253	10	0.27785	T	0.31	-17.9803	9.9116	0.41408	0.9239:0.0:0.0761:0.0	.	977	Q5VZP5	DUS27_HUMAN	G	977	ENSP00000354483:S977G;ENSP00000271385:S977G;ENSP00000404874:S977G	ENSP00000271385:S977G	S	+	1	0	DUSP27	165363921	1.000000	0.71417	0.855000	0.33649	0.443000	0.32047	4.370000	0.59517	2.047000	0.60756	0.523000	0.50628	AGT		0.498	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		20	75	0	0	0	0.008871	0	20	75				
SELE	6401	broad.mit.edu	37	1	169697307	169697307	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:169697307C>G	ENST00000333360.7	-	8	1310	c.1171G>C	c.(1171-1173)Ggg>Cgg	p.G391R	SELE_ENST00000367774.1_Intron|SELE_ENST00000367777.1_Missense_Mutation_p.G391R|SELE_ENST00000367780.4_Intron|SELE_ENST00000367782.4_Missense_Mutation_p.G391R|SELE_ENST00000367775.1_Intron|SELE_ENST00000367779.4_Intron|SELE_ENST00000367776.1_Intron|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367781.4_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	391	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.G391R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CAGCTGGACCCATAACGGAAA	0.532																																							uc001ggm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1171-1173)GGG>CGG		selectin E precursor							123.0	122.0	123.0					1																	169697307		2203	4300	6503	SO:0001583	missense	6401				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity	g.chr1:169697307C>G	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1171G>C	1.37:g.169697307C>G	ENSP00000331736:p.Gly391Arg		Somatic				C1orf112_uc001ggj.2_Intron	p.G391R	NM_000450	NP_000441	WXS	Illumina HiSeq	Unspecified	P16581	LYAM2_HUMAN			8	1328	-	all_hematologic(923;0.208)		391			Sushi 4.|Extracellular (Potential).		A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	c.1171G>C	CCDS1283.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.449129	0.26074	.	.	ENSG00000007908	ENST00000367782;ENST00000333360;ENST00000367777	T;T;T	0.71698	-0.59;-0.59;-0.59	5.58	0.519	0.17035	Complement control module (2);Sushi/SCR/CCP (3);	0.362099	0.20371	N	0.093657	T	0.37237	0.0996	L	0.42529	1.33	0.09310	N	1	B	0.24258	0.1	B	0.28916	0.096	T	0.38650	-0.9651	10	0.15066	T	0.55	-7.3884	9.6606	0.39952	0.0:0.4897:0.0:0.5103	.	391	P16581	LYAM2_HUMAN	R	391	ENSP00000356756:G391R;ENSP00000331736:G391R;ENSP00000356751:G391R	ENSP00000331736:G391R	G	-	1	0	SELE	167963931	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.337000	0.07852	0.063000	0.16370	0.655000	0.94253	GGG		0.532	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450		29	143	0	0	0	0.009535	0	29	143				
PRRX1	5396	broad.mit.edu	37	1	170695456	170695456	+	Silent	SNP	C	C	T	rs374262561		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:170695456C>T	ENST00000239461.6	+	3	826	c.513C>T	c.(511-513)gaC>gaT	p.D171D	PRRX1_ENST00000476867.2_3'UTR|PRRX1_ENST00000497230.2_Silent_p.D171D|PRRX1_ENST00000367760.3_Silent_p.D171D	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	171					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.D171D(2)		large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ACTCAGGAGACGTGACTGCTG	0.557																																							uc001ghf.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(511-513)GAC>GAT		paired mesoderm homeobox 1 isoform pmx-1b		C	,	0,4406		0,0,2203	104.0	92.0	96.0		513,513	-4.8	1.0	1		96	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PRRX1	NM_006902.3,NM_022716.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	171/218,171/246	170695456	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5396					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr1:170695456C>T	M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.513C>T	1.37:g.170695456C>T			Somatic				PRRX1_uc001ghe.2_Silent_p.D171D	p.D171D	NM_022716	NP_073207	WXS	Illumina HiSeq	Unspecified	P54821	PRRX1_HUMAN			3	560	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		171					B5BUM7|O60807	Silent	SNP	ENST00000239461.6	37	c.513C>T	CCDS1290.1																																																																																				0.557	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085236.3	NM_006902		10	52	0	0	0	0.006214	0	10	52				
MROH9	80133	broad.mit.edu	37	1	170934337	170934337	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:170934337A>G	ENST00000367758.3	+	7	520	c.421A>G	c.(421-423)Aga>Gga	p.R141G	MROH9_ENST00000367759.4_Missense_Mutation_p.R141G	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	141								p.R141G(2)									TCTGCAAGAGAGAATAATGGT	0.363																																							uc001ghg.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(421-423)AGA>GGA		hypothetical protein LOC80133 isoform 2							156.0	147.0	150.0					1																	170934337		1885	4109	5994	SO:0001583	missense	80133						binding	g.chr1:170934337A>G	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.421A>G	1.37:g.170934337A>G	ENSP00000356732:p.Arg141Gly		Somatic				C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Missense_Mutation_p.R141G	p.R141G	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			7	551	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		141					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	c.421A>G	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.063531	0.36373	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.66638	-0.22;1.45	5.54	-0.0317	0.13908	Armadillo-like helical (1);	0.447530	0.20606	N	0.089061	T	0.61664	0.2365	M	0.65975	2.015	0.09310	N	1	D;D	0.76494	0.996;0.999	P;D	0.65443	0.866;0.935	T	0.54403	-0.8299	10	0.87932	D	0	-12.5343	5.5273	0.16964	0.5179:0.3074:0.1746:0.0	.	141;141	F5GWX6;Q5TGP6	.;CA129_HUMAN	G	141	ENSP00000356733:R141G;ENSP00000356732:R141G	ENSP00000356732:R141G	R	+	1	2	C1orf129	169200961	0.000000	0.05858	0.001000	0.08648	0.197000	0.23852	0.140000	0.16056	0.073000	0.16731	0.374000	0.22700	AGA		0.363	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		30	151	0	0	0	0.017118	0	30	151				
SLC9C2	284525	broad.mit.edu	37	1	173472449	173472449	+	Silent	SNP	G	G	A	rs538975028		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:173472449G>A	ENST00000367714.3	-	27	3749	c.3327C>T	c.(3325-3327)gtC>gtT	p.V1109V	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	1109					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.V1109V(1)									GTTGTTCAAAGACCGTGTTGA	0.294																																							uc001giz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(3325-3327)GTC>GTT		solute carrier family 9, member 11							122.0	110.0	114.0					1																	173472449		2203	4300	6503	SO:0001819	synonymous_variant	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173472449G>A	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.3327C>T	1.37:g.173472449G>A			Somatic				SLC9A11_uc009wwe.2_Silent_p.V667V	p.V1109V	NM_178527	NP_848622	WXS	Illumina HiSeq	Unspecified	Q5TAH2	S9A11_HUMAN			27	3750	-			1109					Q86UF3	Silent	SNP	ENST00000367714.3	37	c.3327C>T	CCDS1308.1																																																																																				0.294	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		16	60	0	0	0	0.028581	0	16	60				
ASTN1	460	broad.mit.edu	37	1	176853571	176853571	+	Nonsense_Mutation	SNP	C	C	A	rs201898410		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:176853571C>A	ENST00000367654.3	-	19	3365	c.3154G>T	c.(3154-3156)Gaa>Taa	p.E1052*	ASTN1_ENST00000361833.2_Nonsense_Mutation_p.E1044*|ASTN1_ENST00000424564.2_Nonsense_Mutation_p.E1044*|ASTN1_ENST00000367657.3_Nonsense_Mutation_p.E1044*	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1052	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.E1044*(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCTGAGTGTTCCCACTCCAGG	0.537																																							uc001glc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(3130-3132)GAA>TAA		astrotactin isoform 1							134.0	118.0	124.0					1																	176853571		2203	4300	6503	SO:0001587	stop_gained	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176853571C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3154G>T	1.37:g.176853571C>A	ENSP00000356626:p.Glu1052*		Somatic				ASTN1_uc001glb.1_Nonsense_Mutation_p.E1044*|ASTN1_uc001gld.1_Nonsense_Mutation_p.E1044*	p.E1044*	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			19	3342	-			1052			Fibronectin type-III 1.		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Nonsense_Mutation	SNP	ENST00000367654.3	37	c.3130G>T		.	.	.	.	.	.	.	.	.	.	C	40	8.519691	0.98845	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	.	.	.	5.79	5.79	0.91817	.	0.354898	0.34507	N	0.003901	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-11.3474	15.1592	0.72767	0.0:0.8592:0.1408:0.0	.	.	.	.	X	1044;1044;1052;1044;1044	.	ENSP00000354536:E1044X	E	-	1	0	ASTN1	175120194	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	4.245000	0.58734	2.733000	0.93635	0.655000	0.94253	GAA		0.537	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		16	106	1	0	3.41278e-10	0.00499	3.85433e-10	16	106				
BRINP3	339479	broad.mit.edu	37	1	190424018	190424018	+	Start_Codon_SNP	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:190424018C>G	ENST00000367462.3	-	2	234	c.3G>C	c.(1-3)atG>atC	p.M1I	BRINP3_ENST00000534846.1_5'UTR	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	1					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.M1I(1)									TTCGCCATATCATGCTTCCAC	0.463																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(1-3)ATG>ATC		family with sequence similarity 5, member C							63.0	65.0	64.0					1																	190424018		2203	4300	6503	SO:0001582	initiator_codon_variant	339479					extracellular region		g.chr1:190424018C>G	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.3G>C	1.37:g.190424018C>G	ENSP00000356432:p.Met1Ile		Somatic				FAM5C_uc010pot.1_5'UTR	p.M1I	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			2	235	-	Prostate(682;0.198)		1					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.3G>C	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.746400	0.49257	.	.	ENSG00000162670	ENST00000367462;ENST00000445957	T;T	0.44083	2.61;0.93	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000003	T	0.38983	0.1061	.	.	.	0.80722	D	1	B	0.25105	0.118	B	0.17098	0.017	T	0.24476	-1.0159	9	0.87932	D	0	.	17.0468	0.86505	0.0:1.0:0.0:0.0	.	1	Q76B58	FAM5C_HUMAN	I	1	ENSP00000356432:M1I;ENSP00000393441:M1I	ENSP00000356432:M1I	M	-	3	0	FAM5C	188690641	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.489000	0.66875	2.621000	0.88768	0.655000	0.94253	ATG		0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	Missense_Mutation	10	34	0	0	0	0.008291	0	10	34				
KCNT2	343450	broad.mit.edu	37	1	196309587	196309587	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:196309587G>T	ENST00000294725.9	-	16	2582	c.1667C>A	c.(1666-1668)aCc>aAc	p.T556N	KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.T506N|KCNT2_ENST00000451324.2_Missense_Mutation_p.T167N|KCNT2_ENST00000367433.5_Missense_Mutation_p.T556N|KCNT2_ENST00000367431.4_Missense_Mutation_p.T506N			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	556					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.T556N(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CTCTTCTTTGGTAATATTAAT	0.358																																							uc001gtd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(1666-1668)ACC>AAC		potassium channel, subfamily T, member 2							86.0	84.0	85.0					1																	196309587		2203	4300	6503	SO:0001583	missense	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196309587G>T	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1667C>A	1.37:g.196309587G>T	ENSP00000294725:p.Thr556Asn		Somatic				KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.T506N|KCNT2_uc001gtf.1_Missense_Mutation_p.T556N|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.T556N|KCNT2_uc001gth.1_Missense_Mutation_p.T77N	p.T556N	NM_198503	NP_940905	WXS	Illumina HiSeq	Unspecified	Q6UVM3	KCNT2_HUMAN			16	1727	-			556			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	c.1667C>A	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945642	0.73672	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T;T	0.35236	2.03;1.79;1.32;2.29	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000003	T	0.65954	0.2741	M	0.87547	2.89	0.80722	D	1	D;D;P;P;D	0.62365	0.991;0.975;0.68;0.648;0.991	D;P;B;P;D	0.64506	0.926;0.743;0.345;0.523;0.926	T	0.67169	-0.5738	10	0.45353	T	0.12	-17.9416	20.13	0.97997	0.0:0.0:1.0:0.0	.	556;538;556;506;556	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	N	556;506;377;167;556	ENSP00000356403:T556N;ENSP00000356401:T506N;ENSP00000405474:T167N;ENSP00000294725:T556N	ENSP00000294725:T556N	T	-	2	0	KCNT2	194576210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.806000	0.99153	2.751000	0.94390	0.650000	0.86243	ACC		0.358	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		5	136	1	0	1.23904e-05	0.014758	1.34497e-05	5	136				
CENPF	1063	broad.mit.edu	37	1	214830338	214830338	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:214830338C>T	ENST00000366955.3	+	18	8716	c.8548C>T	c.(8548-8550)Ctt>Ttt	p.L2850F		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2946	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.L2850F(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAAAGAAACTCTTGAAGAAAA	0.368																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(8548-8550)CTT>TTT		centromere protein F							83.0	82.0	83.0					1																	214830338		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214830338C>T	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8548C>T	1.37:g.214830338C>T	ENSP00000355922:p.Leu2850Phe		Somatic					p.L2850F	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	18	8722	+			2946			Potential.|Sufficient for nuclear localization.|Sufficient for centromere localization.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.8548C>T	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	6.540	0.467840	0.12402	.	.	ENSG00000117724	ENST00000366955	T	0.06449	3.3	5.23	2.19	0.27852	.	0.000000	0.26688	N	0.023007	T	0.04227	0.0117	L	0.33485	1.01	0.09310	N	1	B	0.33280	0.405	B	0.35278	0.199	T	0.31971	-0.9924	10	0.27082	T	0.32	.	1.627	0.02725	0.2243:0.4367:0.12:0.219	.	2946	P49454	CENPF_HUMAN	F	2850	ENSP00000355922:L2850F	ENSP00000355922:L2850F	L	+	1	0	CENPF	212896961	0.000000	0.05858	0.058000	0.19502	0.011000	0.07611	-0.109000	0.10840	1.348000	0.45733	-0.258000	0.10820	CTT		0.368	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		15	62	0	0	0	0.024245	0	15	62				
USH2A	7399	broad.mit.edu	37	1	216371906	216371906	+	Missense_Mutation	SNP	G	G	C	rs201537953		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:216371906G>C	ENST00000307340.3	-	18	4218	c.3832C>G	c.(3832-3834)Cta>Gta	p.L1278V	USH2A_ENST00000366942.3_Missense_Mutation_p.L1278V|USH2A_ENST00000366943.2_Missense_Mutation_p.L1278V|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1278	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L1278V(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCATGTATAGTTCATATCTT	0.388										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3832-3834)CTA>GTA		usherin isoform B							59.0	61.0	60.0					1																	216371906		2202	4300	6502	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216371906G>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3832C>G	1.37:g.216371906G>C	ENSP00000305941:p.Leu1278Val	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.L1278V	p.L1278V	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	18	4219	-			1278			Fibronectin type-III 3.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3832C>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025422	0.54683	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.43294	0.95;0.95;0.95	5.81	2.36	0.29203	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.36854	N	0.002375	T	0.37865	0.1019	L	0.41710	1.295	0.41778	D	0.989801	P;P	0.52692	0.955;0.905	P;P	0.51453	0.47;0.67	T	0.10268	-1.0637	10	0.22706	T	0.39	.	6.8867	0.24206	0.1902:0.134:0.6758:0.0	.	1278;1278	O75445-2;O75445	.;USH2A_HUMAN	V	1278	ENSP00000305941:L1278V;ENSP00000355910:L1278V;ENSP00000355909:L1278V	ENSP00000305941:L1278V	L	-	1	2	USH2A	214438529	1.000000	0.71417	0.567000	0.28434	0.798000	0.45092	1.218000	0.32467	0.169000	0.19679	0.650000	0.86243	CTA		0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		13	50	0	0	0	0.028581	0	13	50				
LEFTY2	7044	broad.mit.edu	37	1	226125264	226125264	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:226125264C>A	ENST00000366820.5	-	4	1326	c.978G>T	c.(976-978)atG>atT	p.M326I	RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'Flank|LEFTY2_ENST00000420304.2_Missense_Mutation_p.M292I	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	326					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)		p.M326I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					TGCTGACGATCATGGGCAGCG	0.662																																					Colon(172;116 2643 9098 43333)	Colon(172;116 2643 9098 43333)	uc001hpt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(976-978)ATG>ATT		endometrial bleeding associated factor							41.0	40.0	40.0					1																	226125264		2203	4300	6503	SO:0001583	missense	7044				cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226125264C>A	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.978G>T	1.37:g.226125264C>A	ENSP00000355785:p.Met326Ile		Somatic				LEFTY2_uc010pvk.1_Missense_Mutation_p.M292I|LEFTY2_uc009xek.1_3'UTR	p.M326I	NM_003240	NP_003231	WXS	Illumina HiSeq	Unspecified	O00292	LFTY2_HUMAN			4	1058	-	Breast(184;0.197)		326					B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	ENST00000366820.5	37	c.978G>T	CCDS1549.1	.	.	.	.	.	.	.	.	.	.	c	6.877	0.531256	0.13127	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.62232	0.04;0.04	5.1	3.05	0.35203	Transforming growth factor-beta, C-terminal (2);	0.523669	0.24635	N	0.036852	T	0.50257	0.1605	L	0.33668	1.02	0.37267	D	0.907252	B;B	0.18610	0.029;0.021	B;B	0.26969	0.055;0.075	T	0.54221	-0.8326	10	0.45353	T	0.12	.	10.4672	0.44616	0.1217:0.5878:0.2905:0.0	.	292;326	E9PDM4;O00292	.;LFTY2_HUMAN	I	292;326	ENSP00000388009:M292I;ENSP00000355785:M326I	ENSP00000355785:M326I	M	-	3	0	LEFTY2	224191887	1.000000	0.71417	0.683000	0.30040	0.375000	0.29983	1.957000	0.40392	1.246000	0.43901	0.561000	0.74099	ATG		0.662	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240		15	49	1	0	1.3612e-06	0.024245	1.48527e-06	15	49				
MTR	4548	broad.mit.edu	37	1	237057846	237057846	+	Missense_Mutation	SNP	C	C	T	rs201991154		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:237057846C>T	ENST00000366577.5	+	30	3788	c.3394C>T	c.(3394-3396)Cgg>Tgg	p.R1132W	MTR_ENST00000535889.1_Missense_Mutation_p.R1081W|MTR_ENST00000470570.1_3'UTR	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1132	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.R1132W(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GCTGGGGGACCGGCTGGCAGA	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		16670	0.0		0.001	False		,,,				2504	0.0						uc001hyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(3394-3396)CGG>TGG		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						69.0	62.0	65.0					1																	237057846		2203	4300	6503	SO:0001583	missense	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237057846C>T	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3394C>T	1.37:g.237057846C>T	ENSP00000355536:p.Arg1132Trp		Somatic				MTR_uc010pxw.1_Missense_Mutation_p.R725W|MTR_uc010pxx.1_Missense_Mutation_p.R1081W|MTR_uc010pxy.1_Missense_Mutation_p.R986W	p.R1132W	NM_000254	NP_000245	WXS	Illumina HiSeq	Unspecified	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	30	3817	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	1132			AdoMet activation.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	c.3394C>T	CCDS1614.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	23.1	4.379354	0.82682	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;T	0.79749	-1.3;-1.3;-1.3	5.57	2.36	0.29203	Vitamin B12-dependent methionine synthase, activation domain (4);	0.000000	0.85682	D	0.000000	D	0.92126	0.7504	H	0.95611	3.695	0.50467	D	0.999877	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94152	0.7406	10	0.87932	D	0	-16.1662	14.9063	0.70721	0.3939:0.6061:0.0:0.0	.	1132;1081;1132	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	W	986;1132;1081;686	ENSP00000355536:R1132W;ENSP00000441845:R1081W;ENSP00000355535:R686W	ENSP00000355535:R686W	R	+	1	2	MTR	235124469	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.138000	0.42140	0.742000	0.32697	0.655000	0.94253	CGG		0.612	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		10	82	0	0	0	0.006214	0	10	82				
RYR2	6262	broad.mit.edu	37	1	237806644	237806644	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:237806644G>C	ENST00000366574.2	+	48	7556	c.7239G>C	c.(7237-7239)aaG>aaC	p.K2413N	RYR2_ENST00000360064.6_Missense_Mutation_p.K2411N|RYR2_ENST00000542537.1_Missense_Mutation_p.K2397N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2413	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.K2411N(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGCCGGGAAGGGAGAAGCCA	0.413																																							uc001hyl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(7237-7239)AAG>AAC		cardiac muscle ryanodine receptor							195.0	183.0	187.0					1																	237806644		1870	4094	5964	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237806644G>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7239G>C	1.37:g.237806644G>C	ENSP00000355533:p.Lys2413Asn		Somatic					p.K2413N	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		48	7359	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2413			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.7239G>C	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352804	0.61293	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98313	-4.86;-4.86;-4.86	5.6	0.516	0.17019	.	0.000000	0.64402	D	0.000004	D	0.98598	0.9531	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98164	1.0448	10	0.87932	D	0	-14.667	9.2498	0.37549	0.5682:0.0:0.4318:0.0	.	2413	Q92736	RYR2_HUMAN	N	2413;2411;2397	ENSP00000355533:K2413N;ENSP00000353174:K2411N;ENSP00000443798:K2397N	ENSP00000353174:K2411N	K	+	3	2	RYR2	235873267	1.000000	0.71417	0.945000	0.38365	0.917000	0.54804	1.537000	0.36083	0.138000	0.18790	-0.145000	0.13849	AAG		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		65	223	0	0	0	0.01441	0	65	223				
RYR2	6262	broad.mit.edu	37	1	237947171	237947171	+	Missense_Mutation	SNP	G	G	C	rs41267517		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:237947171G>C	ENST00000366574.2	+	90	12476	c.12159G>C	c.(12157-12159)gaG>gaC	p.E4053D	RYR2_ENST00000360064.6_Missense_Mutation_p.E4059D|RYR2_ENST00000542537.1_Missense_Mutation_p.E4037D|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4053					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E4051D(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGCGATGGAGAGCCATAAGC	0.448																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12157-12159)GAG>GAC		cardiac muscle ryanodine receptor							45.0	44.0	44.0					1																	237947171		1963	4155	6118	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947171G>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12159G>C	1.37:g.237947171G>C	ENSP00000355533:p.Glu4053Asp		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.E468D	p.E4053D	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12279	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4053			EF-hand.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12159G>C	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980436	0.53827	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.82526	-1.62;-1.62;-1.62	6.07	4.21	0.49690	EF-hand-like domain (1);	0.000000	0.64402	D	0.000005	D	0.83571	0.5283	L	0.33668	1.02	0.80722	D	1	D;B	0.71674	0.998;0.031	D;B	0.83275	0.996;0.019	T	0.80745	-0.1245	10	0.38643	T	0.18	.	6.6132	0.22763	0.2195:0.1304:0.65:0.0	.	1027;4053	B4DGV4;Q92736	.;RYR2_HUMAN	D	4053;4059;4037;1027	ENSP00000355533:E4053D;ENSP00000353174:E4059D;ENSP00000443798:E4037D	ENSP00000353174:E4059D	E	+	3	2	RYR2	236013794	0.999000	0.42202	1.000000	0.80357	0.972000	0.66771	0.510000	0.22723	0.905000	0.36596	0.655000	0.94253	GAG		0.448	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		4	40	0	0	0	0.009096	0	4	40				
SCCPDH	51097	broad.mit.edu	37	1	246922379	246922379	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:246922379C>G	ENST00000366510.3	+	7	1115	c.739C>G	c.(739-741)Cct>Gct	p.P247A		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	247						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.P247A(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		TTATTCCATTCCTTTTATGGG	0.363																																							uc001ibr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(739-741)CCT>GCT		saccharopine dehydrogenase (putative)							226.0	222.0	223.0					1																	246922379		2203	4300	6503	SO:0001583	missense	51097					midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity	g.chr1:246922379C>G		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.739C>G	1.37:g.246922379C>G	ENSP00000355467:p.Pro247Ala		Somatic					p.P247A	NM_016002	NP_057086	WXS	Illumina HiSeq	Unspecified	Q8NBX0	SCPDH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)	7	1086	+	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	247					Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	c.739C>G	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491141	0.64074	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.38401	1.14	6.16	6.16	0.99307	.	0.045006	0.85682	D	0.000000	T	0.67202	0.2868	M	0.91038	3.17	0.80722	D	1	D	0.69078	0.997	D	0.71414	0.973	T	0.71616	-0.4539	10	0.52906	T	0.07	.	15.1689	0.72854	0.1755:0.8245:0.0:0.0	.	247	Q8NBX0	SCPDL_HUMAN	A	247;78	ENSP00000355467:P247A	ENSP00000355466:P78A	P	+	1	0	SCCPDH	244989002	1.000000	0.71417	0.987000	0.45799	0.510000	0.34073	2.868000	0.48436	2.937000	0.99478	0.650000	0.86243	CCT		0.363	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002		41	172	0	0	0	0.011902	0	41	172				
AHCTF1	25909	broad.mit.edu	37	1	247068858	247068858	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:247068858T>C	ENST00000391829.2	-	6	989	c.866A>G	c.(865-867)cAg>cGg	p.Q289R	AHCTF1_ENST00000366508.1_Missense_Mutation_p.Q324R|AHCTF1_ENST00000326225.3_Missense_Mutation_p.Q298R			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	289	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q289R(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTGTGTAGACTGAACAGCCCA	0.408																																					Colon(145;197 1800 4745 15099 26333)	Colon(145;197 1800 4745 15099 26333)	uc001ibu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)	7						c.(865-867)CAG>CGG		transcription factor ELYS							108.0	99.0	102.0					1																	247068858		2203	4300	6503	SO:0001583	missense	25909				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding	g.chr1:247068858T>C		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.866A>G	1.37:g.247068858T>C	ENSP00000375705:p.Gln289Arg		Somatic				AHCTF1_uc001ibv.1_Missense_Mutation_p.Q298R	p.Q289R	NM_015446	NP_056261	WXS	Illumina HiSeq	Unspecified	Q8WYP5	ELYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00271)		5	873	-	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	289			Necessary for cytoplasmic localization (By similarity).		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37	c.866A>G		.	.	.	.	.	.	.	.	.	.	T	22.2	4.257994	0.80246	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.22134	1.97;1.97;1.97	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	N	0.24115	0.695	0.58432	D	0.999993	D;D	0.76494	0.998;0.999	D;D	0.81914	0.994;0.995	T	0.05370	-1.0889	10	0.22109	T	0.4	-9.2026	15.4321	0.75108	0.0:0.0:0.0:1.0	.	324;289	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	R	324;298;289	ENSP00000355464:Q324R;ENSP00000355465:Q298R;ENSP00000375705:Q289R	ENSP00000355465:Q298R	Q	-	2	0	AHCTF1	245135481	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.655000	0.83696	2.098000	0.63641	0.454000	0.30748	CAG		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446		29	73	0	0	0	0.012213	0	29	73				
OR1C1	26188	broad.mit.edu	37	1	247921160	247921160	+	Silent	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:247921160A>G	ENST00000408896.2	-	1	822	c.549T>C	c.(547-549)ccT>ccC	p.P183P		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	183					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GCTGCAGGAGAGGATTGAGAT	0.468																																							uc010pza.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(547-549)CCT>CCC		olfactory receptor, family 1, subfamily C,							61.0	61.0	61.0					1																	247921160		2109	4245	6354	SO:0001819	synonymous_variant	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921160A>G	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.549T>C	1.37:g.247921160A>G			Somatic					p.P183P	NM_012353	NP_036485	WXS	Illumina HiSeq	Unspecified	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	549	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	183			Extracellular (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Silent	SNP	ENST00000408896.2	37	c.549T>C	CCDS41481.1																																																																																				0.468	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			13	36	0	0	0	0.028581	0	13	36				
OR2M4	26245	broad.mit.edu	37	1	248402282	248402282	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:248402282T>G	ENST00000306687.1	+	1	52	c.52T>G	c.(52-54)Ttc>Gtc	p.F18V		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	18					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F18V(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCTGGGAATCTTCAATCACAG	0.438																																							uc010pzh.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(52-54)TTC>GTC		olfactory receptor, family 2, subfamily M,							126.0	125.0	125.0					1																	248402282		2203	4300	6503	SO:0001583	missense	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402282T>G	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.52T>G	1.37:g.248402282T>G	ENSP00000306688:p.Phe18Val		Somatic					p.F18V	NM_017504	NP_059974	WXS	Illumina HiSeq	Unspecified	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	52	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		18			Extracellular (Potential).		Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	37	c.52T>G	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	t	11.99	1.802782	0.31869	.	.	ENSG00000171180	ENST00000306687	T	0.00316	8.13	3.08	1.79	0.24919	.	0.000000	0.41001	D	0.000979	T	0.00300	0.0009	L	0.61036	1.89	0.09310	N	1	P	0.44816	0.844	P	0.50860	0.652	T	0.42849	-0.9427	10	0.87932	D	0	.	3.4146	0.07371	0.2018:0.1236:0.0:0.6746	.	18	Q96R27	OR2M4_HUMAN	V	18	ENSP00000306688:F18V	ENSP00000306688:F18V	F	+	1	0	OR2M4	246468905	0.000000	0.05858	0.753000	0.31225	0.370000	0.29829	-1.083000	0.03397	1.393000	0.46605	0.443000	0.29094	TTC		0.438	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		15	177	0	0	0	0.007413	0	15	177				
OR2T2	401992	broad.mit.edu	37	1	248616758	248616758	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:248616758G>A	ENST00000342927.3	+	1	682	c.660G>A	c.(658-660)acG>acA	p.T220T		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T220T(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTCCTACACGCACATCCTCC	0.527																																							uc001iek.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(658-660)ACG>ACA		olfactory receptor, family 2, subfamily T,							208.0	142.0	164.0					1																	248616758		2188	4264	6452	SO:0001819	synonymous_variant	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616758G>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.660G>A	1.37:g.248616758G>A			Somatic					p.T220T	NM_001004136	NP_001004136	WXS	Illumina HiSeq	Unspecified	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	660	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		220			Helical; Name=5; (Potential).		B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	c.660G>A	CCDS31116.1																																																																																				0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		31	17	0	0	0	0.007291	0	31	17				
OR2T10	127069	broad.mit.edu	37	1	248756476	248756476	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:248756476G>A	ENST00000330500.2	-	1	624	c.594C>T	c.(592-594)ttC>ttT	p.F198F	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F198F(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACAAGTACATGAAAATCTTGT	0.448																																							uc010pzn.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(592-594)TTC>TTT		olfactory receptor, family 2, subfamily T,							76.0	81.0	79.0					1																	248756476		2046	4241	6287	SO:0001819	synonymous_variant	127069				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248756476G>A		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.594C>T	1.37:g.248756476G>A			Somatic					p.F198F	NM_001004693	NP_001004693	WXS	Illumina HiSeq	Unspecified	Q8NGZ9	O2T10_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	594	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		198			Helical; Name=5; (Potential).		B2RNK7	Silent	SNP	ENST00000330500.2	37	c.594C>T	CCDS31121.1																																																																																				0.448	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693		20	92	0	0	0	0.007413	0	20	92				
LARP4B	23185	broad.mit.edu	37	10	875438	875438	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:875438C>T	ENST00000316157.3	-	10	1052	c.1012G>A	c.(1012-1014)Gcg>Acg	p.A338T		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	338					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.A338T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						AACGACGTCGCGTAGCGCTGC	0.532																																							uc001ifs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1012-1014)GCG>ACG		La ribonucleoprotein domain family, member 4B							105.0	82.0	90.0					10																	875438		2203	4300	6503	SO:0001583	missense	23185						nucleotide binding|RNA binding	g.chr10:875438C>T	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1012G>A	10.37:g.875438C>T	ENSP00000326128:p.Ala338Thr		Somatic					p.A338T	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			10	1053	-			338					A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	c.1012G>A	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	C	3.058	-0.193983	0.06259	.	.	ENSG00000107929	ENST00000316157	T	0.33865	1.39	5.4	1.82	0.25136	.	0.142341	0.64402	N	0.000006	T	0.14874	0.0359	N	0.05306	-0.075	0.36611	D	0.875222	B	0.06786	0.001	B	0.04013	0.001	T	0.16958	-1.0385	10	0.12766	T	0.61	-22.5716	8.7108	0.34382	0.0:0.2225:0.0:0.7775	.	338	Q92615	LAR4B_HUMAN	T	338	ENSP00000326128:A338T	ENSP00000326128:A338T	A	-	1	0	LARP4B	865438	0.995000	0.38212	0.003000	0.11579	0.001000	0.01503	1.959000	0.40412	0.121000	0.18284	-0.793000	0.03317	GCG		0.532	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155		5	52	0	0	0	0.014758	0	5	52				
KLF6	1316	broad.mit.edu	37	10	3822298	3822298	+	Splice_Site	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:3822298C>A	ENST00000497571.1	-	3	1060	c.800G>T	c.(799-801)aGg>aTg	p.R267M	KLF6_ENST00000173785.4_5'UTR|KLF6_ENST00000542957.1_Intron	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	267					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R267M(1)		breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		AGGCACGTACCTGTCACAGTG	0.552																																							uc001iha.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(1)	4						c.(799-801)AGG>ATG		Kruppel-like factor 6 isoform A							147.0	113.0	124.0					10																	3822298		2203	4300	6503	SO:0001630	splice_region_variant	1316				B cell differentiation	nucleus	zinc ion binding	g.chr10:3822298C>A	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.800+1G>T	10.37:g.3822298C>A			Somatic				KLF6_uc010qaj.1_Intron|KLF6_uc010qak.1_RNA|KLF6_uc010qal.1_Missense_Mutation_p.R225M	p.R267M	NM_001300	NP_001291	WXS	Illumina HiSeq	Unspecified	Q99612	KLF6_HUMAN		Colorectal(1;0.238)	3	1067	-			267			C2H2-type 3.		B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	ENST00000497571.1	37	c.800G>T	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288413	0.95517	.	.	ENSG00000067082	ENST00000497571	T	0.35973	1.28	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.044773	0.85682	D	0.000000	T	0.55893	0.1949	L	0.52364	1.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.986;0.992	T	0.48364	-0.9042	9	.	.	.	.	18.7705	0.91890	0.0:1.0:0.0:0.0	.	225;267	D3GC14;Q99612	.;KLF6_HUMAN	M	267	ENSP00000419923:R267M	.	R	-	2	0	KLF6	3812298	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.702000	0.84576	2.677000	0.91161	0.561000	0.74099	AGG		0.552	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		Missense_Mutation	12	33	1	0	1.5842e-08	0.016723	1.77008e-08	12	33				
DCLRE1C	64421	broad.mit.edu	37	10	14987175	14987175	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:14987175G>C	ENST00000378278.2	-	3	212	c.175C>G	c.(175-177)Cta>Gta	p.L59V	DCLRE1C_ENST00000378255.1_De_novo_Start_InFrame|DCLRE1C_ENST00000378249.1_De_novo_Start_InFrame|DCLRE1C_ENST00000378258.1_De_novo_Start_OutOfFrame|DCLRE1C_ENST00000396817.2_De_novo_Start_InFrame|DCLRE1C_ENST00000453695.2_De_novo_Start_OutOfFrame|DCLRE1C_ENST00000378246.2_De_novo_Start_InFrame|DCLRE1C_ENST00000378254.1_De_novo_Start_OutOfFrame|DCLRE1C_ENST00000357717.2_Intron|DCLRE1C_ENST00000378289.4_Missense_Mutation_p.L59V			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	59					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.L59V(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						GAACAGTATAGATAAACCTTC	0.303								Non-homologous end-joining																															uc001inn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(175-177)CTA>GTA	Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ	artemis protein isoform a							47.0	48.0	47.0					10																	14987175		2203	4300	6503	SO:0001583	missense	64421				DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity	g.chr10:14987175G>C	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.175C>G	10.37:g.14987175G>C	ENSP00000367527:p.Leu59Val		Somatic				DCLRE1C_uc010qbx.1_Missense_Mutation_p.L59V|DCLRE1C_uc001inl.2_Translation_Start_Site|DCLRE1C_uc009xji.2_Translation_Start_Site|DCLRE1C_uc001inm.2_Translation_Start_Site|DCLRE1C_uc001ino.2_Translation_Start_Site|DCLRE1C_uc009xjh.2_RNA|DCLRE1C_uc001inp.2_Translation_Start_Site|DCLRE1C_uc001inq.2_Translation_Start_Site|DCLRE1C_uc001inr.2_Intron	p.L59V	NM_001033855	NP_001029027	WXS	Illumina HiSeq	Unspecified	Q96SD1	DCR1C_HUMAN			3	260	-			59					D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	ENST00000378278.2	37	c.175C>G	CCDS31149.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.349122	0.41599	.	.	ENSG00000152457	ENST00000378289;ENST00000378278	T;T	0.69926	-0.44;-0.44	5.19	0.0311	0.14169	Beta-lactamase-like (1);	0.000000	0.85682	D	0.000000	T	0.65883	0.2734	N	0.26042	0.785	0.80722	D	1	P;D	0.61080	0.938;0.989	P;D	0.66084	0.833;0.941	T	0.64257	-0.6450	10	0.59425	D	0.04	.	10.1666	0.42884	0.4785:0.0:0.5215:0.0	.	59;59	Q96SD1-4;Q96SD1	.;DCR1C_HUMAN	V	59	ENSP00000367538:L59V;ENSP00000367527:L59V	ENSP00000367527:L59V	L	-	1	2	DCLRE1C	15027181	0.889000	0.30405	0.195000	0.23364	0.818000	0.46254	1.244000	0.32778	0.047000	0.15862	-0.509000	0.04479	CTA		0.303	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487		23	27	0	0	0	0.00632	0	23	27				
CUBN	8029	broad.mit.edu	37	10	16994356	16994356	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:16994356C>T	ENST00000377833.4	-	33	4953	c.4888G>A	c.(4888-4890)Gat>Aat	p.D1630N		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1630	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.D1630N(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAACAGTATCAAATGAGCTG	0.433																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(4888-4890)GAT>AAT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						165.0	154.0	158.0					10																	16994356		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16994356C>T	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4888G>A	10.37:g.16994356C>T	ENSP00000367064:p.Asp1630Asn		Somatic					p.D1630N	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			33	4940	-			1630			CUB 11.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.4888G>A	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074909	0.76415	.	.	ENSG00000107611	ENST00000377833	T	0.34072	1.38	5.75	4.84	0.62591	CUB (5);	0.854684	0.09804	N	0.753673	T	0.39064	0.1064	L	0.34521	1.04	0.80722	D	1	P	0.48589	0.912	P	0.45794	0.493	T	0.22347	-1.0219	10	0.54805	T	0.06	.	16.9109	0.86139	0.0:0.872:0.128:0.0	.	1630	O60494	CUBN_HUMAN	N	1630	ENSP00000367064:D1630N	ENSP00000367064:D1630N	D	-	1	0	CUBN	17034362	1.000000	0.71417	0.009000	0.14445	0.036000	0.12997	6.799000	0.75160	1.416000	0.47057	0.655000	0.94253	GAT		0.433	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		21	106	0	0	0	0.010504	0	21	106				
KIAA1217	56243	broad.mit.edu	37	10	24762918	24762918	+	Silent	SNP	C	C	T	rs34150424		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:24762918C>T	ENST00000376454.3	+	6	1638	c.1608C>T	c.(1606-1608)ctC>ctT	p.L536L	KIAA1217_ENST00000376451.2_Silent_p.L254L|KIAA1217_ENST00000307544.6_Silent_p.L254L|KIAA1217_ENST00000396445.1_Silent_p.L254L|KIAA1217_ENST00000376452.3_Silent_p.L536L|KIAA1217_ENST00000376462.1_Silent_p.L456L|KIAA1217_ENST00000430453.2_Silent_p.L457L|KIAA1217_ENST00000396446.1_Silent_p.L254L|KIAA1217_ENST00000458595.1_Silent_p.L536L	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	536					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.L536L(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TTGTAGACCTCGGCCCTCCTC	0.557																																							uc001iru.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(2)	7						c.(1606-1608)CTC>CTT		sickle tail isoform 1							78.0	73.0	74.0					10																	24762918		2202	4300	6502	SO:0001819	synonymous_variant	56243				embryonic skeletal system development	cytoplasm		g.chr10:24762918C>T	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1608C>T	10.37:g.24762918C>T			Somatic				KIAA1217_uc001irs.2_Silent_p.L456L|KIAA1217_uc001irt.3_Silent_p.L536L|KIAA1217_uc010qcy.1_Silent_p.L536L|KIAA1217_uc010qcz.1_Silent_p.L536L|KIAA1217_uc001irv.1_Silent_p.L386L|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Silent_p.L254L|KIAA1217_uc001irz.2_Silent_p.L254L|KIAA1217_uc001irx.2_Silent_p.L254L|KIAA1217_uc001iry.2_Silent_p.L254L	p.L536L	NM_019590	NP_062536	WXS	Illumina HiSeq	Unspecified	Q5T5P2	SKT_HUMAN			6	2011	+			536					A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	c.1608C>T	CCDS31165.1																																																																																				0.557	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		7	78	0	0	0	0.004482	0	7	78				
KIAA1217	56243	broad.mit.edu	37	10	24762928	24762928	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:24762928C>G	ENST00000376454.3	+	6	1648	c.1618C>G	c.(1618-1620)Cta>Gta	p.L540V	KIAA1217_ENST00000376451.2_Missense_Mutation_p.L258V|KIAA1217_ENST00000307544.6_Missense_Mutation_p.L258V|KIAA1217_ENST00000396445.1_Missense_Mutation_p.L258V|KIAA1217_ENST00000376452.3_Missense_Mutation_p.L540V|KIAA1217_ENST00000376462.1_Missense_Mutation_p.L460V|KIAA1217_ENST00000430453.2_Missense_Mutation_p.L461V|KIAA1217_ENST00000396446.1_Missense_Mutation_p.L258V|KIAA1217_ENST00000458595.1_Missense_Mutation_p.L540V	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	540					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.L540V(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGGCCCTCCTCTAATGGAGAA	0.552																																							uc001iru.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)	7						c.(1618-1620)CTA>GTA		sickle tail isoform 1							77.0	72.0	73.0					10																	24762928		2202	4296	6498	SO:0001583	missense	56243				embryonic skeletal system development	cytoplasm		g.chr10:24762928C>G	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1618C>G	10.37:g.24762928C>G	ENSP00000365637:p.Leu540Val		Somatic				KIAA1217_uc001irs.2_Missense_Mutation_p.L460V|KIAA1217_uc001irt.3_Missense_Mutation_p.L540V|KIAA1217_uc010qcy.1_Missense_Mutation_p.L540V|KIAA1217_uc010qcz.1_Missense_Mutation_p.L540V|KIAA1217_uc001irv.1_Missense_Mutation_p.L390V|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Missense_Mutation_p.L258V|KIAA1217_uc001irz.2_Missense_Mutation_p.L258V|KIAA1217_uc001irx.2_Missense_Mutation_p.L258V|KIAA1217_uc001iry.2_Missense_Mutation_p.L258V	p.L540V	NM_019590	NP_062536	WXS	Illumina HiSeq	Unspecified	Q5T5P2	SKT_HUMAN			6	2021	+			540					A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	c.1618C>G	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	0.230	-1.021946	0.02061	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.51071	0.94;0.72;0.72;0.94;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.56	4.6	0.57074	.	0.349510	0.30365	N	0.009796	T	0.53578	0.1805	L	0.33485	1.01	0.21416	N	0.999691	B;B;B;B;B;B;P;D	0.61697	0.256;0.047;0.107;0.107;0.423;0.256;0.885;0.99	B;B;B;B;B;B;P;D	0.72982	0.058;0.012;0.061;0.023;0.209;0.034;0.58;0.979	T	0.40720	-0.9548	10	0.40728	T	0.16	.	10.4996	0.44798	0.0:0.6933:0.2343:0.0724	.	540;540;258;258;258;258;540;540	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	V	460;540;540;258;540;540;390;461;258;258;258;258;258	ENSP00000365645:L460V;ENSP00000365639:L540V;ENSP00000392625:L540V;ENSP00000365637:L540V;ENSP00000365635:L540V;ENSP00000404798:L390V;ENSP00000389680:L461V;ENSP00000302343:L258V;ENSP00000379722:L258V;ENSP00000365634:L258V;ENSP00000379723:L258V	ENSP00000302343:L258V	L	+	1	2	KIAA1217	24802934	0.030000	0.19436	0.963000	0.40424	0.918000	0.54935	0.442000	0.21628	2.624000	0.88883	0.591000	0.81541	CTA		0.552	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		5	76	0	0	0	0.001984	0	5	76				
BMS1P5	399761	broad.mit.edu	37	10	48902261	48902261	+	IGR	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:48902261C>T								PTPN20B (74327 upstream) : BMS1P5 (25111 downstream)																							TGGTGCTTTTCTTCTTTAGGT	0.527																																							uc009xnv.2		NA																	0					NA						c.(610-612)AAG>AAA		ArfGAP with GTPase domain, ankyrin repeat and PH																																				SO:0001628	intergenic_variant	0							g.chr10:48902261C>T																													10.37:g.48902261C>T			Somatic					p.K204K	NM_001077686	NP_001071154	WXS	Illumina HiSeq	Unspecified					3	718	-									Silent	SNP		37	c.612G>A																																																																																				0	0.527									22	26	0	0	0	0.010818	0	22	26				
MYOZ1	58529	broad.mit.edu	37	10	75391780	75391780	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:75391780G>C	ENST00000359322.4	-	6	1172	c.808C>G	c.(808-810)Cga>Gga	p.R270G	RP11-464F9.22_ENST00000609434.1_lincRNA	NM_021245.3	NP_067068.1			myozenin 1									p.R270G(1)		central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					ATAGGGGTTCGATTGAAAGAA	0.537																																							uc001jur.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(808-810)CGA>GGA		myozenin 1							102.0	102.0	102.0					10																	75391780		2203	4300	6503	SO:0001583	missense	58529				myofibril assembly	nucleus|pseudopodium	FATZ binding	g.chr10:75391780G>C	AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.808C>G	10.37:g.75391780G>C	ENSP00000352272:p.Arg270Gly		Somatic					p.R270G	NM_021245	NP_067068	WXS	Illumina HiSeq	Unspecified	Q9NP98	MYOZ1_HUMAN			6	1173	-	Prostate(51;0.0112)		270						Missense_Mutation	SNP	ENST00000359322.4	37	c.808C>G	CCDS7330.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600504	0.66332	.	.	ENSG00000177791	ENST00000359322	T	0.74842	-0.88	6.06	4.13	0.48395	.	0.056907	0.64402	D	0.000002	D	0.85204	0.5643	M	0.82823	2.61	0.58432	D	0.999996	D	0.69078	0.997	P	0.62014	0.897	D	0.87012	0.2123	10	0.87932	D	0	-7.4441	14.3298	0.66548	0.0:0.0:0.4107:0.5893	.	270	Q9NP98	MYOZ1_HUMAN	G	270	ENSP00000352272:R270G	ENSP00000352272:R270G	R	-	1	2	MYOZ1	75061786	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.371000	0.52379	0.798000	0.33994	0.655000	0.94253	CGA		0.537	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1			21	33	0	0	0	0.010504	0	21	33				
VWA2	340706	broad.mit.edu	37	10	116045881	116045881	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:116045881C>T	ENST00000392982.3	+	11	1431	c.1181C>T	c.(1180-1182)gCg>gTg	p.A394V	VWA2_ENST00000603594.1_Missense_Mutation_p.A394V			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	394	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)	p.A394V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CTGCTGGTGGCGGTGCCTGTG	0.667																																							uc001lbl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(1180-1182)GCG>GTG		von Willebrand factor A domain containing 2							77.0	74.0	75.0					10																	116045881		2203	4300	6503	SO:0001583	missense	340706					extracellular region		g.chr10:116045881C>T	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1181C>T	10.37:g.116045881C>T	ENSP00000376708:p.Ala394Val		Somatic				VWA2_uc001lbk.1_Missense_Mutation_p.A394V|VWA2_uc009xyf.1_Missense_Mutation_p.A90V	p.A394V	NM_198496	NP_940898	WXS	Illumina HiSeq	Unspecified	Q5GFL6	VWA2_HUMAN		Epithelial(162;0.036)|all cancers(201;0.0793)	11	1502	+			394			VWFA 2.		A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37	c.1181C>T		.	.	.	.	.	.	.	.	.	.	C	0.018	-1.467083	0.01053	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	D	0.81908	-1.55	5.6	0.665	0.17896	von Willebrand factor, type A (3);	0.341528	0.32068	N	0.006639	T	0.71787	0.3381	L	0.31926	0.97	0.19775	N	0.999953	B;B;B	0.15473	0.013;0.009;0.007	B;B;B	0.14578	0.01;0.011;0.006	T	0.62927	-0.6750	10	0.66056	D	0.02	.	9.0765	0.36525	0.0:0.5714:0.0:0.4286	.	90;394;394	Q5GFL6-3;Q5GFL6;Q5GFL6-2	.;VWA2_HUMAN;.	V	394	ENSP00000376708:A394V	ENSP00000298715:A394V	A	+	2	0	VWA2	116035871	0.982000	0.34865	0.237000	0.24090	0.051000	0.14879	2.573000	0.46007	0.065000	0.16485	-0.986000	0.02555	GCG		0.667	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496		9	97	0	0	0	0.006214	0	9	97				
KNDC1	85442	broad.mit.edu	37	10	135038376	135038376	+	Missense_Mutation	SNP	G	G	A	rs141333921		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:135038376G>A	ENST00000304613.3	+	30	5253	c.5232G>A	c.(5230-5232)atG>atA	p.M1744I	KNDC1_ENST00000368572.2_Missense_Mutation_p.M1746I			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1744					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.M1744I(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TACGGAGGATGAAGGCTACAT	0.612																																							uc001llz.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(5230-5232)ATG>ATA		kinase non-catalytic C-lobe domain (KIND)		G	ILE/MET	1,4405	2.1+/-5.4	0,1,2202	47.0	43.0	44.0		5232	4.2	0.8	10	dbSNP_134	44	0,8600		0,0,4300	no	missense	KNDC1	NM_152643.6	10	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	1744/1750	135038376	1,13005	2203	4300	6503	SO:0001583	missense	85442				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction			g.chr10:135038376G>A	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.5232G>A	10.37:g.135038376G>A	ENSP00000304437:p.Met1744Ile		Somatic					p.M1744I	NM_152643	NP_689856	WXS	Illumina HiSeq	Unspecified	Q76NI1	VKIND_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)	30	5233	+		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)	1744					B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	c.5232G>A	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624816	0.66901	2.27E-4	0.0	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.13307	2.6;2.6	4.23	4.23	0.50019	.	0.114258	0.64402	U	0.000019	T	0.15912	0.0383	L	0.34521	1.04	0.48288	D	0.999626	P	0.47762	0.9	P	0.46825	0.528	T	0.01920	-1.1247	10	0.62326	D	0.03	-37.2441	14.4583	0.67431	0.0:0.0:1.0:0.0	.	1744	Q76NI1	VKIND_HUMAN	I	1744;1746	ENSP00000304437:M1744I;ENSP00000357561:M1746I	ENSP00000304437:M1744I	M	+	3	0	KNDC1	134888366	1.000000	0.71417	0.778000	0.31720	0.865000	0.49528	1.853000	0.39358	2.062000	0.61559	0.650000	0.86243	ATG		0.612	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643		3	19	0	0	0	0.004672	0	3	19				
MUC2	4583	broad.mit.edu	37	11	1096391	1096391	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:1096391G>A	ENST00000441003.2	+	34	6443	c.6416G>A	c.(6415-6417)gGc>gAc	p.G2139D	MUC2_ENST00000361558.6_Missense_Mutation_p.G277D	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4501					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.G2139D(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGCTACCAGGGCAACTGCACC	0.602																																							uc001lsx.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(13501-13503)GGC>GAC		mucin 2 precursor	Pranlukast(DB01411)						85.0	96.0	92.0					11																	1096391		2170	4271	6441	SO:0001583	missense	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1096391G>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6416G>A	11.37:g.1096391G>A	ENSP00000415183:p.Gly2139Asp		Somatic					p.G4501D	NM_002457	NP_002448	WXS	Illumina HiSeq	Unspecified	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	37	13529	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	4501			VWFD 4.		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37	c.13502G>A		.	.	.	.	.	.	.	.	.	.	g	7.091	0.572217	0.13623	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.65364	-0.15;-0.15	3.95	0.854	0.19007	.	.	.	.	.	T	0.58779	0.2146	M	0.75264	2.295	0.31135	N	0.707296	B	0.33103	0.397	B	0.35859	0.212	T	0.56811	-0.7917	9	0.20519	T	0.43	.	9.5511	0.39310	0.2449:0.0:0.7551:0.0	.	2139	E7EUV1	.	D	2139;277	ENSP00000415183:G2139D;ENSP00000354885:G277D	ENSP00000354885:G277D	G	+	2	0	MUC2	1086391	1.000000	0.71417	0.978000	0.43139	0.799000	0.45148	3.188000	0.50958	0.308000	0.22923	0.479000	0.44913	GGC		0.602	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		3	55	0	0	0	0.004672	0	3	55				
SLC22A18	5002	broad.mit.edu	37	11	2929522	2929522	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:2929522C>T	ENST00000380574.1	+	3	635	c.204C>T	c.(202-204)ttC>ttT	p.F68F	SLC22A18_ENST00000449793.2_Silent_p.F68F|SLC22A18_ENST00000312221.5_Silent_p.F68F|SLC22A18_ENST00000347936.2_Silent_p.F68F			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	68					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)	p.F68F(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		AAACCACCTTCGGGGTGCTGC	0.627																																							uc001lwx.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(202-204)TTC>TTT		tumor suppressing subtransferable candidate 5							75.0	72.0	73.0					11																	2929522		2202	4299	6501	SO:0001819	synonymous_variant	5002				excretion|organic cation transport	apical plasma membrane|cytoplasmic part|integral to membrane|nuclear envelope	drug:hydrogen antiporter activity|symporter activity|ubiquitin protein ligase binding	g.chr11:2929522C>T	AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.204C>T	11.37:g.2929522C>T			Somatic				SLC22A18_uc001lwy.2_Silent_p.F68F|SLC22A18_uc001lwz.2_Silent_p.F68F	p.F68F	NM_183233	NP_899056	WXS	Illumina HiSeq	Unspecified	Q96BI1	S22AI_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)	3	422	+		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)	68			Helical; (Potential).		O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Silent	SNP	ENST00000380574.1	37	c.204C>T	CCDS7740.1																																																																																				0.627	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027770.1	NM_183233		7	46	0	0	0	0.008291	0	7	46				
OR52R1	119695	broad.mit.edu	37	11	4825130	4825130	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:4825130G>T	ENST00000356069.2	-	1	480	c.481C>A	c.(481-483)Ccc>Acc	p.P161T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.P240T	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P160T(1)|p.P240T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGCAGAAGGGGCTCACCCAC	0.562																																							uc010qym.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(718-720)CCC>ACC		olfactory receptor, family 52, subfamily R,							117.0	98.0	104.0					11																	4825130		2201	4298	6499	SO:0001583	missense	119695				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4825130G>T	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.481C>A	11.37:g.4825130G>T	ENSP00000348368:p.Pro161Thr		Somatic					p.P240T	NM_001005177	NP_001005177	WXS	Illumina HiSeq	Unspecified	Q8NGF1	O52R1_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	718	-		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)	161			Helical; Name=4; (Potential).		Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	c.718C>A	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737486	0.69304	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.50001	0.76;0.76	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000155	T	0.74884	0.3775	M	0.88842	2.985	0.36612	D	0.875246	D	0.89917	1.0	D	0.97110	1.0	T	0.81899	-0.0721	10	0.87932	D	0	.	18.291	0.90130	0.0:0.0:1.0:0.0	.	161	Q8NGF1	O52R1_HUMAN	T	161;240	ENSP00000348368:P161T;ENSP00000369742:P240T	ENSP00000348368:P161T	P	-	1	0	OR52R1	4781706	0.860000	0.29831	1.000000	0.80357	0.758000	0.43043	2.290000	0.43531	2.902000	0.99343	0.650000	0.86243	CCC		0.562	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177		18	62	1	0	3.41278e-10	0.00499	3.85433e-10	18	62				
OR51A4	401666	broad.mit.edu	37	11	4967632	4967632	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:4967632C>A	ENST00000380373.2	-	1	724	c.699G>T	c.(697-699)aaG>aaT	p.K233N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K233N(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAAGCTGCTCCTTTTTGGATG	0.468																																							uc010qys.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(697-699)AAG>AAT		olfactory receptor, family 51, subfamily A,							130.0	118.0	122.0					11																	4967632		2201	4298	6499	SO:0001583	missense	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4967632C>A	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.699G>T	11.37:g.4967632C>A	ENSP00000369731:p.Lys233Asn		Somatic					p.K233N	NM_001005329	NP_001005329	WXS	Illumina HiSeq	Unspecified	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	699	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	233			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000380373.2	37	c.699G>T	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	C	7.680	0.688839	0.14973	.	.	ENSG00000205497	ENST00000380373	T	0.37752	1.18	3.44	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.26702	0.0653	L	0.42632	1.34	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.30880	-0.9963	9	0.66056	D	0.02	.	3.0076	0.06033	0.1819:0.538:0.177:0.1031	.	233	Q8NGJ6	O51A4_HUMAN	N	233	ENSP00000369731:K233N	ENSP00000369731:K233N	K	-	3	2	OR51A4	4924208	0.000000	0.05858	0.010000	0.14722	0.871000	0.50021	-2.719000	0.00812	0.265000	0.21872	0.479000	0.44913	AAG		0.468	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		33	50	1	0	8.16721e-17	0.010818	9.66684e-17	33	50				
OR2D2	120776	broad.mit.edu	37	11	6913260	6913260	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:6913260C>A	ENST00000299459.2	-	1	570	c.472G>T	c.(472-474)Gta>Tta	p.V158L		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	158					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V158L(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGGTGTCTACCACAGACACC	0.498																																							uc010rau.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(472-474)GTA>TTA		olfactory receptor, family 2, subfamily D,							124.0	94.0	104.0					11																	6913260		2201	4296	6497	SO:0001583	missense	120776				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6913260C>A	AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.472G>T	11.37:g.6913260C>A	ENSP00000299459:p.Val158Leu		Somatic					p.V158L	NM_003700	NP_003691	WXS	Illumina HiSeq	Unspecified	Q9H210	OR2D2_HUMAN		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	472	-		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	158			Helical; Name=4; (Potential).		B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	ENST00000299459.2	37	c.472G>T	CCDS31416.1	.	.	.	.	.	.	.	.	.	.	c	14.40	2.525440	0.44969	.	.	ENSG00000166368	ENST00000299459	T	0.35421	1.31	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	0.152816	0.30492	N	0.009505	T	0.30008	0.0751	L	0.29908	0.895	0.33655	D	0.6089	B	0.22480	0.07	B	0.27796	0.083	T	0.26849	-1.0091	10	0.25106	T	0.35	-19.968	16.4873	0.84188	0.0:1.0:0.0:0.0	.	158	Q9H210	OR2D2_HUMAN	L	158	ENSP00000299459:V158L	ENSP00000299459:V158L	V	-	1	0	OR2D2	6869836	0.000000	0.05858	0.991000	0.47740	0.985000	0.73830	0.313000	0.19415	2.840000	0.97914	0.645000	0.84053	GTA		0.498	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385986.1	NM_003700		19	51	1	0	1.67942e-08	0.006122	1.87148e-08	19	51				
TPH1	7166	broad.mit.edu	37	11	18057575	18057575	+	Missense_Mutation	SNP	G	G	C	rs146455709	byFrequency	TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:18057575G>C	ENST00000250018.2	-	2	794	c.232C>G	c.(232-234)Cat>Gat	p.H78D	TPH1_ENST00000341556.2_Missense_Mutation_p.H78D	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	78	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.H78D(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TTCAGCAGATGAAAAATATCA	0.323																																							uc001mnp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(232-234)CAT>GAT		tryptophan hydroxylase 1	L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)						112.0	108.0	110.0					11																	18057575		2200	4293	6493	SO:0001583	missense	7166				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr11:18057575G>C	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.232C>G	11.37:g.18057575G>C	ENSP00000250018:p.His78Asp		Somatic				TPH1_uc009yhe.2_RNA	p.H78D	NM_004179	NP_004170	WXS	Illumina HiSeq	Unspecified	P17752	TPH1_HUMAN			2	258	-			78			ACT.		D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	c.232C>G	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349312	0.24426	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.98105	-4.72;-4.72;-4.72	5.51	3.5	0.40072	.	0.262209	0.47455	D	0.000238	D	0.90253	0.6952	N	0.02202	-0.64	0.36988	D	0.894628	B	0.02656	0.0	B	0.04013	0.001	D	0.87048	0.2145	10	0.12430	T	0.62	-12.5628	12.9828	0.58575	0.0:0.1233:0.7487:0.1279	.	78	P17752	TPH1_HUMAN	D	78;78;88	ENSP00000250018:H78D;ENSP00000343550:H78D;ENSP00000436081:H88D	ENSP00000250018:H78D	H	-	1	0	TPH1	18014151	1.000000	0.71417	0.976000	0.42696	0.563000	0.35712	6.596000	0.74113	1.427000	0.47276	0.655000	0.94253	CAT		0.323	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179		4	76	0	0	0	0.014758	0	4	76				
NAV2	89797	broad.mit.edu	37	11	19970312	19970312	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:19970312G>T	ENST00000396087.3	+	11	2499	c.2400G>T	c.(2398-2400)agG>agT	p.R800S	NAV2_ENST00000540292.1_Missense_Mutation_p.R731S|NAV2_ENST00000360655.4_Missense_Mutation_p.R713S|NAV2_ENST00000349880.4_Missense_Mutation_p.R777S|NAV2_ENST00000527559.2_Missense_Mutation_p.R729S|NAV2_ENST00000396085.1_Missense_Mutation_p.R777S	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	800					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.R800S(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TGACAGGGAGGCCCACACCTC	0.572																																							uc010rdm.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)|pancreas(1)	6						c.(2398-2400)AGG>AGT		neuron navigator 2 isoform 2							71.0	62.0	65.0					11																	19970312		2199	4293	6492	SO:0001583	missense	89797					nucleus	ATP binding|helicase activity	g.chr11:19970312G>T	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2400G>T	11.37:g.19970312G>T	ENSP00000379396:p.Arg800Ser		Somatic				NAV2_uc001mpp.2_Missense_Mutation_p.R713S|NAV2_uc001mpr.3_Missense_Mutation_p.R777S	p.R800S	NM_145117	NP_660093	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			11	2761	+			800					A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	c.2400G>T	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408851	0.62399	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55	5.01	-0.919	0.10478	.	0.000000	0.64402	D	0.000004	T	0.30198	0.0757	M	0.70595	2.14	0.80722	D	1	D;B	0.89917	1.0;0.022	D;B	0.81914	0.995;0.021	T	0.02326	-1.1176	9	.	.	.	.	11.4294	0.50032	0.4797:0.0:0.5203:0.0	.	777;713	Q8IVL1-3;Q8IVL1-4	.;.	S	713;777;777;800;729;731	ENSP00000353871:R713S;ENSP00000379394:R777S;ENSP00000309577:R777S;ENSP00000379396:R800S;ENSP00000435395:R729S;ENSP00000443489:R731S	.	R	+	3	2	NAV2	19926888	0.885000	0.30320	0.964000	0.40570	0.818000	0.46254	0.021000	0.13489	-0.011000	0.14247	0.563000	0.77884	AGG		0.572	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		11	60	1	0	3.07112e-06	0.010729	3.34233e-06	11	60				
PAMR1	25891	broad.mit.edu	37	11	35453913	35453913	+	Silent	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:35453913A>G	ENST00000378880.2	-	11	2599	c.2154T>C	c.(2152-2154)aaT>aaC	p.N718N	PAMR1_ENST00000378878.3_Silent_p.N607N|PAMR1_ENST00000278360.3_Silent_p.N735N|PAMR1_ENST00000532848.1_Silent_p.N678N	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	718	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.N735N(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TTCATTTCATATTTCTTTCAA	0.463																																							uc001mwg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2152-2154)AAT>AAC		regeneration associated muscle protease isoform							114.0	107.0	109.0					11																	35453913		2202	4298	6500	SO:0001819	synonymous_variant	25891				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr11:35453913A>G		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.2154T>C	11.37:g.35453913A>G			Somatic				PAMR1_uc001mwf.2_Silent_p.N735N|PAMR1_uc010rew.1_Silent_p.N607N|PAMR1_uc010rex.1_Silent_p.N678N	p.N718N	NM_001001991	NP_001001991	WXS	Illumina HiSeq	Unspecified	Q6UXH9	PAMR1_HUMAN			11	2197	-			718			Peptidase S1.		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Silent	SNP	ENST00000378880.2	37	c.2154T>C	CCDS31460.1																																																																																				0.463	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430		6	61	0	0	0	0.001984	0	6	61				
LDLRAD3	143458	broad.mit.edu	37	11	36103258	36103258	+	Silent	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:36103258T>C	ENST00000315571.5	+	3	270	c.249T>C	c.(247-249)caT>caC	p.H83H	LDLRAD3_ENST00000528989.1_Silent_p.H34H|LDLRAD3_ENST00000524419.1_Silent_p.H34H	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	83	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.H83H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				GCGGCATCCATTGCATCATTG	0.517																																							uc001mwk.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(247-249)CAT>CAC		low density lipoprotein receptor class A domain							164.0	133.0	144.0					11																	36103258		2202	4298	6500	SO:0001819	synonymous_variant	143458					integral to membrane	receptor activity	g.chr11:36103258T>C	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.249T>C	11.37:g.36103258T>C			Somatic				LDLRAD3_uc010rey.1_Silent_p.H34H|LDLRAD3_uc010rez.1_5'UTR	p.H83H	NM_174902	NP_777562	WXS	Illumina HiSeq	Unspecified	Q86YD5	LRAD3_HUMAN			3	286	+	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)	83			Extracellular (Potential).|LDL-receptor class A 2.		B7Z1U3|B9EG81|Q8NBJ0	Silent	SNP	ENST00000315571.5	37	c.249T>C	CCDS31462.1																																																																																				0.517	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902		8	110	0	0	0	0.00308	0	8	110				
OR5L2	26338	broad.mit.edu	37	11	55594902	55594902	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:55594902G>A	ENST00000378397.1	+	1	208	c.208G>A	c.(208-210)Gat>Aat	p.D70N		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D70N(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GTCCTTTGTAGATTTCTGCTA	0.463										HNSCC(27;0.073)																													uc001nhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(208-210)GAT>AAT		olfactory receptor, family 5, subfamily L,							225.0	208.0	214.0					11																	55594902		2200	4296	6496	SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594902G>A	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.208G>A	11.37:g.55594902G>A	ENSP00000367650:p.Asp70Asn	HNSCC(27;0.073)	Somatic					p.D70N	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	208	+		all_epithelial(135;0.208)	70			Helical; Name=2; (Potential).		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.208G>A	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	33	5.231493	0.95207	.	.	ENSG00000205030	ENST00000378397	T	0.01165	5.24	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000108	T	0.10594	0.0259	M	0.92784	3.345	0.52501	D	0.99995	D	0.89917	1.0	D	0.70227	0.968	T	0.00557	-1.1672	10	0.87932	D	0	-31.1031	17.8871	0.88858	0.0:0.0:1.0:0.0	.	70	Q8NGL0	OR5L2_HUMAN	N	70	ENSP00000367650:D70N	ENSP00000367650:D70N	D	+	1	0	OR5L2	55351478	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.139000	0.71728	2.634000	0.89283	0.626000	0.83405	GAT		0.463	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		91	194	0	0	0	0.01441	0	91	194				
OR5I1	10798	broad.mit.edu	37	11	55703807	55703807	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:55703807C>T	ENST00000301532.3	-	1	69	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	24					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E24K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ATCTGCAGTTCAGGGCGAGTT	0.378																																							uc010ris.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(70-72)GAA>AAA		olfactory receptor, family 5, subfamily I,							63.0	60.0	61.0					11																	55703807		2201	4295	6496	SO:0001583	missense	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703807C>T	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.70G>A	11.37:g.55703807C>T	ENSP00000301532:p.Glu24Lys		Somatic					p.E24K	NM_006637	NP_006628	WXS	Illumina HiSeq	Unspecified	Q13606	OR5I1_HUMAN			1	70	-			24			Extracellular (Potential).		Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	c.70G>A	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361404	0.41801	.	.	ENSG00000167825	ENST00000301532	T	0.00441	7.41	5.05	4.13	0.48395	.	0.282787	0.25324	N	0.031487	T	0.00300	0.0009	L	0.38733	1.17	0.09310	N	0.999998	P	0.39665	0.682	B	0.36378	0.223	T	0.54430	-0.8295	10	0.54805	T	0.06	.	7.066	0.25151	0.0:0.8112:0.0:0.1888	.	24	Q13606	OR5I1_HUMAN	K	24	ENSP00000301532:E24K	ENSP00000301532:E24K	E	-	1	0	OR5I1	55460383	0.000000	0.05858	0.582000	0.28627	0.807000	0.45602	-1.767000	0.01795	2.496000	0.84212	0.637000	0.83480	GAA		0.378	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		4	30	0	0	0	0.021553	0	4	30				
OR8J3	81168	broad.mit.edu	37	11	55904846	55904846	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:55904846C>A	ENST00000301529.1	-	1	348	c.349G>T	c.(349-351)Gtg>Ttg	p.V117L		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V117L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TAGGCCATCACAGCCAGCATC	0.488																																							uc010riz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(349-351)GTG>TTG		olfactory receptor, family 8, subfamily J,							153.0	140.0	144.0					11																	55904846		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904846C>A		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.349G>T	11.37:g.55904846C>A	ENSP00000301529:p.Val117Leu		Somatic					p.V117L	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	349	-	Esophageal squamous(21;0.00693)		117			Helical; Name=3; (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.349G>T	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859621	0.32884	.	.	ENSG00000167822	ENST00000301529	T	0.05139	3.49	3.26	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.346051	0.24859	N	0.035024	T	0.07098	0.0180	L	0.45470	1.425	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.20306	-1.0279	10	0.62326	D	0.03	.	9.9085	0.41390	0.0:0.891:0.0:0.109	.	117	Q8NGG0	OR8J3_HUMAN	L	117	ENSP00000301529:V117L	ENSP00000301529:V117L	V	-	1	0	OR8J3	55661422	0.000000	0.05858	0.904000	0.35570	0.944000	0.59088	0.301000	0.19174	1.548000	0.49413	0.289000	0.19496	GTG		0.488	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		37	93	1	0	5.43694e-19	0.023175	6.58404e-19	37	93				
OR5T1	390155	broad.mit.edu	37	11	56043714	56043714	+	Silent	SNP	T	T	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:56043714T>A	ENST00000313033.2	+	1	686	c.600T>A	c.(598-600)tcT>tcA	p.S200S		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S200S(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TTGCTATTTCTTGTTCTGACA	0.398																																							uc001nio.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(598-600)TCT>TCA		olfactory receptor, family 5, subfamily T,							236.0	224.0	228.0					11																	56043714		2201	4296	6497	SO:0001819	synonymous_variant	390155				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56043714T>A	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.600T>A	11.37:g.56043714T>A			Somatic					p.S200S	NM_001004745	NP_001004745	WXS	Illumina HiSeq	Unspecified	Q8NG75	OR5T1_HUMAN			1	600	+	Esophageal squamous(21;0.00448)		200			Extracellular (Potential).		B2RNM9	Silent	SNP	ENST00000313033.2	37	c.600T>A	CCDS31525.1																																																																																				0.398	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		19	242	0	0	0	0.008871	0	19	242				
OR5M3	219482	broad.mit.edu	37	11	56237502	56237502	+	Missense_Mutation	SNP	T	T	G	rs148100298	byFrequency	TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:56237502T>G	ENST00000312240.2	-	1	512	c.472A>C	c.(472-474)Aca>Cca	p.T158P		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T158A(1)|p.T158P(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GTCCATAATGTTGCTGCCAGA	0.428																																							uc010rjk.1		NA																	2	Substitution - Missense(2)	p.T158A(1)	ovary(1)|lung(1)	ovary(2)	2						c.(472-474)ACA>CCA		olfactory receptor, family 5, subfamily M,							122.0	112.0	115.0					11																	56237502		2201	4295	6496	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237502T>G	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.472A>C	11.37:g.56237502T>G	ENSP00000312208:p.Thr158Pro		Somatic					p.T158P	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	472	-	Esophageal squamous(21;0.00448)		158			Helical; Name=4; (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.472A>C	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269813	0.40095	.	.	ENSG00000174937	ENST00000312240	T	0.00277	8.34	5.22	4.07	0.47477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000173	T	0.00875	0.0029	M	0.94101	3.495	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18745	-1.0327	10	0.87932	D	0	-6.2895	10.3656	0.44021	0.1471:0.0:0.0:0.8529	.	158	Q8NGP4	OR5M3_HUMAN	P	158	ENSP00000312208:T158P	ENSP00000312208:T158P	T	-	1	0	OR5M3	55994078	0.000000	0.05858	0.015000	0.15790	0.560000	0.35617	0.095000	0.15127	0.796000	0.33947	0.448000	0.29417	ACA		0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		4	143	0	0	0	0.009096	0	4	143				
SLC15A3	51296	broad.mit.edu	37	11	60714087	60714087	+	Silent	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:60714087G>C	ENST00000227880.3	-	2	998	c.765C>G	c.(763-765)ccC>ccG	p.P255P		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	255					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)	p.P255P(1)		central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						TGCCCATCGGGGGCTTGGTGA	0.587																																							uc001nqn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(763-765)CCC>CCG		solute carrier family 15, member 3							66.0	69.0	68.0					11																	60714087		2203	4299	6502	SO:0001819	synonymous_variant	51296				oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity	g.chr11:60714087G>C	AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.765C>G	11.37:g.60714087G>C			Somatic				SLC15A3_uc001nqo.2_Silent_p.P255P	p.P255P	NM_016582	NP_057666	WXS	Illumina HiSeq	Unspecified	Q8IY34	S15A3_HUMAN			2	999	-			255					Q9P2X9	Silent	SNP	ENST00000227880.3	37	c.765C>G	CCDS7998.1	.	.	.	.	.	.	.	.	.	.	G	3.993	-0.004057	0.07773	.	.	ENSG00000110446	ENST00000442626	.	.	.	4.81	1.89	0.25635	.	0.000000	0.52532	D	0.000079	T	0.55986	0.1955	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53201	-0.8472	6	0.59425	D	0.04	-36.5448	3.3469	0.07139	0.2517:0.0:0.4367:0.3115	.	.	.	.	R	255	.	ENSP00000403318:P255R	P	-	2	0	SLC15A3	60470663	1.000000	0.71417	0.974000	0.42286	0.472000	0.32918	0.677000	0.25262	0.338000	0.23692	-0.229000	0.12294	CCC		0.587	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396366.1	NM_016582		23	59	0	0	0	0.01892	0	23	59				
RBM14	10432	broad.mit.edu	37	11	66391877	66391877	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:66391877G>A	ENST00000310137.4	+	2	669	c.530G>A	c.(529-531)gGa>gAa	p.G177E	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000443702.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM14_ENST00000393979.3_Intron|RBM14_ENST00000461478.1_3'UTR|RBM14_ENST00000409738.4_Intron|RBM14_ENST00000409372.1_3'UTR|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	177					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.G177E(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GCCTTCCCTGGAACTGGTGGC	0.597																																							uc001oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(529-531)GGA>GAA		RNA binding motif protein 14							56.0	59.0	58.0					11																	66391877		2200	4295	6495	SO:0001583	missense	10432				DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity	g.chr11:66391877G>A	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.530G>A	11.37:g.66391877G>A	ENSP00000311747:p.Gly177Glu		Somatic				RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Intron|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	p.G177E	NM_006328	NP_006319	WXS	Illumina HiSeq	Unspecified	Q96PK6	RBM14_HUMAN			2	669	+			177					B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	c.530G>A	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076040	0.55646	.	.	ENSG00000239306	ENST00000310137	D	0.83506	-1.73	5.83	4.91	0.64330	.	0.237418	0.34853	N	0.003633	T	0.65688	0.2715	N	0.14661	0.345	0.80722	D	1	P	0.37330	0.59	B	0.31191	0.125	T	0.67003	-0.5780	10	0.48119	T	0.1	-1.5408	8.2887	0.31943	0.0814:0.1586:0.76:0.0	.	177	Q96PK6	RBM14_HUMAN	E	177	ENSP00000311747:G177E	ENSP00000311747:G177E	G	+	2	0	RBM14	66148453	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.742000	0.38248	1.460000	0.47911	-0.176000	0.13171	GGA		0.597	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328		21	33	0	0	0	0.012319	0	21	33				
CCND1	595	broad.mit.edu	37	11	69458698	69458699	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:69458698_69458699GG>TA	ENST00000227507.2	+	3	740_741	c.513_514GG>TA	c.(511-516)gcGGag>gcTAag	p.E172K	CCND1_ENST00000536559.1_Intron	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1	172					canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.E172K(1)		NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	TGCCAGAGGCGGAGGAGAACAA	0.589			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)																											Pancreas(65;393 884 2788 21700 24360 27795 36895)	Pancreas(65;393 884 2788 21700 24360 27795 36895)	uc001opa.2		NA		Dom	yes		11	11q13	595	T	cyclin D1			"""L, E"""	IGH@|FSTL3		CLL|B-ALL|breast		1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(511-516)GCGGAG>GCTAAG		cyclin D1	Arsenic trioxide(DB01169)																																			SO:0001583	missense	595				cell division|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|mitotic cell cycle G1/S transition DNA damage checkpoint|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation|response to drug|response to UV-A|S phase of mitotic cell cycle	cyclin-dependent protein kinase holoenzyme complex|cytosol|membrane|nucleoplasm	protein kinase binding	g.chr11:69458698_69458699GG>TA	Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877	Exception_encountered	11.37:g.69458698_69458699delinsTA	ENSP00000227507:p.Glu172Lys	Multiple Myeloma(6;0.086)	Somatic					p.E172K	NM_053056	NP_444284	WXS	Illumina HiSeq	Unspecified	P24385	CCND1_HUMAN	Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		3	722_723	+	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		172					Q6LEF0	Missense_Mutation	DNP	ENST00000227507.2	37	c.513_514GG>TA	CCDS8191.1																																																																																				0.589	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396775.2	NM_053056		27	36	0	0	0	0.004672	0	27	36				
RNF121	55298	broad.mit.edu	37	11	71701662	71701662	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:71701662A>G	ENST00000361756.3	+	6	887	c.526A>G	c.(526-528)Atg>Gtg	p.M176V	RNF121_ENST00000393713.3_Missense_Mutation_p.M144V|RNF121_ENST00000490867.1_3'UTR|RNF121_ENST00000530137.1_Missense_Mutation_p.M144V|RNF121_ENST00000545854.1_Missense_Mutation_p.M95V|RNF121_ENST00000533380.1_Intron	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	176						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.M176V(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						AGAAGATGCCATGGACTTTGG	0.473																																							uc001ora.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)ATG>GTG		ring finger protein 121							151.0	149.0	150.0					11																	71701662		2200	4293	6493	SO:0001583	missense	55298					integral to membrane	zinc ion binding	g.chr11:71701662A>G	AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.526A>G	11.37:g.71701662A>G	ENSP00000354571:p.Met176Val		Somatic				RNF121_uc001ord.2_Missense_Mutation_p.M95V|RNF121_uc001orb.2_Missense_Mutation_p.M144V|RNF121_uc009yst.2_Missense_Mutation_p.M144V	p.M176V	NM_018320	NP_060790	WXS	Illumina HiSeq	Unspecified	Q9H920	RN121_HUMAN			6	866	+			176			Helical; (Potential).		B3KSW8|Q6IA57|Q6P449|Q96DB4	Missense_Mutation	SNP	ENST00000361756.3	37	c.526A>G	CCDS8203.1	.	.	.	.	.	.	.	.	.	.	A	17.55	3.417420	0.62622	.	.	ENSG00000137522	ENST00000361756;ENST00000393713;ENST00000545854;ENST00000530137	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.31167	0.0788	M	0.75777	2.31	0.80722	D	1	P;B;P	0.45827	0.841;0.029;0.867	B;B;B	0.44108	0.441;0.027;0.214	T	0.15122	-1.0448	10	0.62326	D	0.03	.	14.2666	0.66123	1.0:0.0:0.0:0.0	.	144;144;176	C9JQY5;G3V148;Q9H920	.;.;RN121_HUMAN	V	176;144;95;144	ENSP00000354571:M176V;ENSP00000377316:M144V;ENSP00000443799:M95V;ENSP00000431286:M144V	ENSP00000354571:M176V	M	+	1	0	RNF121	71379310	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.479000	0.90431	2.199000	0.70637	0.533000	0.62120	ATG		0.473	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347132.1	NM_018320		53	119	0	0	0	0.01441	0	53	119				
NUMA1	4926	broad.mit.edu	37	11	71727042	71727042	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:71727042G>A	ENST00000393695.3	-	15	1838	c.1507C>T	c.(1507-1509)Ctg>Ttg	p.L503L	NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Silent_p.L503L	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.L503L(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TCAGAGGTCAGAGAGGCCACC	0.612			T	RARA	APL						OREG0021187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001orl.1		NA		Dom	yes		11	11q13	4926	T	nuclear mitotic apparatus protein 1			L	RARA		APL		1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(1507-1509)CTG>TTG		nuclear mitotic apparatus protein 1							87.0	86.0	86.0					11																	71727042		2200	4293	6493	SO:0001819	synonymous_variant	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71727042G>A	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.1507C>T	11.37:g.71727042G>A			Somatic	OREG0021187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1132	NUMA1_uc009ysw.1_Silent_p.L66L|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Silent_p.L503L|NUMA1_uc001orn.2_Silent_p.L66L|NUMA1_uc009ysx.1_Silent_p.L503L|NUMA1_uc001oro.1_Silent_p.L503L	p.L503L	NM_006185	NP_006176	WXS	Illumina HiSeq	Unspecified	Q14980	NUMA1_HUMAN			15	1679	-			503			Potential.			Silent	SNP	ENST00000393695.3	37	c.1507C>T	CCDS31633.1																																																																																				0.612	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			16	116	0	0	0	0.028581	0	16	116				
ARHGEF17	9828	broad.mit.edu	37	11	73075516	73075516	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:73075516G>C	ENST00000263674.3	+	18	5771	c.5421G>C	c.(5419-5421)caG>caC	p.Q1807H		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1807					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q1807H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GGGACCCCCAGAACTTCAAAT	0.532																																							uc001otu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(5419-5421)CAG>CAC		Rho guanine nucleotide exchange factor (GEF) 17							58.0	64.0	62.0					11																	73075516		2200	4293	6493	SO:0001583	missense	9828				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr11:73075516G>C	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5421G>C	11.37:g.73075516G>C	ENSP00000263674:p.Gln1807His		Somatic					p.Q1807H	NM_014786	NP_055601	WXS	Illumina HiSeq	Unspecified	Q96PE2	ARHGH_HUMAN			18	5442	+			1807					B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	c.5421G>C	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412331	0.42817	.	.	ENSG00000110237	ENST00000263674	T	0.68331	-0.32	5.8	3.93	0.45458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.215096	0.43579	N	0.000548	T	0.60327	0.2260	M	0.64997	1.995	0.48632	D	0.999682	B	0.19583	0.037	B	0.20184	0.028	T	0.58962	-0.7543	10	0.87932	D	0	-10.7141	6.4137	0.21705	0.1499:0.0:0.7015:0.1486	.	1807	Q96PE2	ARHGH_HUMAN	H	1807	ENSP00000263674:Q1807H	ENSP00000263674:Q1807H	Q	+	3	2	ARHGEF17	72753164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.463000	0.45058	0.784000	0.33661	0.655000	0.94253	CAG		0.532	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		25	86	0	0	0	0.01892	0	25	86				
RSF1	51773	broad.mit.edu	37	11	77388035	77388035	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:77388035C>T	ENST00000308488.6	-	13	3445	c.3143G>A	c.(3142-3144)cGa>cAa	p.R1048Q	RSF1_ENST00000360355.2_Missense_Mutation_p.R1017Q|RSF1_ENST00000480887.1_Missense_Mutation_p.R796Q			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1048					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.R1048Q(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			ATCTTTTCCTCGGCCAACTCC	0.418																																							uc001oyn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(3142-3144)CGA>CAA		remodeling and spacing factor 1							67.0	71.0	70.0					11																	77388035		2200	4292	6492	SO:0001583	missense	51773				CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding	g.chr11:77388035C>T	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3143G>A	11.37:g.77388035C>T	ENSP00000311513:p.Arg1048Gln		Somatic				RSF1_uc001oym.2_Missense_Mutation_p.R796Q	p.R1048Q	NM_016578	NP_057662	WXS	Illumina HiSeq	Unspecified	Q96T23	RSF1_HUMAN	Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)		13	3263	-	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		1048					Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	37	c.3143G>A	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684081	0.88639	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000531026	T;D;T;T	0.93547	0.53;-3.24;0.53;0.53	4.65	4.65	0.58169	.	0.000000	0.39687	N	0.001290	D	0.93769	0.8008	L	0.55213	1.73	0.50467	D	0.999872	D	0.76494	0.999	P	0.55615	0.78	D	0.93783	0.7085	10	0.72032	D	0.01	-6.0518	12.2179	0.54416	0.0:0.9162:0.0:0.0838	.	1048	Q96T23	RSF1_HUMAN	Q	1048;796;1017;157	ENSP00000311513:R1048Q;ENSP00000434509:R796Q;ENSP00000353511:R1017Q;ENSP00000433603:R157Q	ENSP00000311513:R1048Q	R	-	2	0	RSF1	77065683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.161000	0.64935	2.589000	0.87451	0.655000	0.94253	CGA		0.418	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578		7	117	0	0	0	0.00308	0	7	117				
DDI1	414301	broad.mit.edu	37	11	103908057	103908057	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:103908057A>C	ENST00000302259.3	+	1	750	c.507A>C	c.(505-507)gaA>gaC	p.E169D	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	169							aspartic-type endopeptidase activity (GO:0004190)	p.E169D(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CCTTGGCGGAAGCCCTGCTCA	0.602																																							uc001phr.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(505-507)GAA>GAC		DDI1, DNA-damage inducible 1, homolog 1							64.0	63.0	63.0					11																	103908057		2202	4299	6501	SO:0001583	missense	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103908057A>C		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.507A>C	11.37:g.103908057A>C	ENSP00000302805:p.Glu169Asp		Somatic				PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.E169D	NM_001001711	NP_001001711	WXS	Illumina HiSeq	Unspecified	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	750	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	169					Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	c.507A>C	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	A	5.865	0.343736	0.11126	.	.	ENSG00000170967	ENST00000302259	T	0.25085	1.82	5.02	-10.0	0.00425	.	0.049889	0.85682	N	0.000000	T	0.11410	0.0278	L	0.45228	1.405	0.43076	D	0.994724	B	0.20988	0.05	B	0.27380	0.079	T	0.38478	-0.9659	10	0.13470	T	0.59	-34.5941	2.2355	0.04007	0.1874:0.1015:0.3596:0.3515	.	169	Q8WTU0	DDI1_HUMAN	D	169	ENSP00000302805:E169D	ENSP00000302805:E169D	E	+	3	2	DDI1	103413267	0.982000	0.34865	0.140000	0.22221	0.056000	0.15407	0.170000	0.16663	-2.053000	0.00901	-1.063000	0.02288	GAA		0.602	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		6	67	0	0	0	0.021553	0	6	67				
GUCY1A2	2977	broad.mit.edu	37	11	106558341	106558341	+	Silent	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:106558341A>C	ENST00000526355.2	-	8	2601	c.2133T>G	c.(2131-2133)tcT>tcG	p.S711S	GUCY1A2_ENST00000347596.2_Silent_p.S732S|GUCY1A2_ENST00000282249.2_Silent_p.S742S	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	711					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.S711S(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TTCTCGACGAAGAAAGAGAAG	0.478																																							uc001pjg.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(2131-2133)TCT>TCG		guanylate cyclase 1, soluble, alpha 2							166.0	163.0	164.0					11																	106558341		2201	4298	6499	SO:0001819	synonymous_variant	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106558341A>C	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.2133T>G	11.37:g.106558341A>C			Somatic				GUCY1A2_uc010rvo.1_Silent_p.S732S|GUCY1A2_uc009yxn.1_Silent_p.S742S	p.S711S	NM_000855	NP_000846	WXS	Illumina HiSeq	Unspecified	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	8	2523	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	711					A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	37	c.2133T>G	CCDS8335.1																																																																																				0.478	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			14	214	0	0	0	0.020292	0	14	214				
USP28	57646	broad.mit.edu	37	11	113675628	113675628	+	Silent	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:113675628C>A	ENST00000003302.4	-	20	2609	c.2541G>T	c.(2539-2541)ctG>ctT	p.L847L	USP28_ENST00000260188.5_Silent_p.L815L|USP28_ENST00000545540.1_Silent_p.L690L|USP28_ENST00000544967.1_Silent_p.L523L	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	847					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L847L(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CAAACTGTTCCAGAAGGGTTC	0.448																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	uc001poh.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7						c.(2539-2541)CTG>CTT		ubiquitin specific protease 28							116.0	110.0	112.0					11																	113675628		2201	4296	6497	SO:0001819	synonymous_variant	57646				cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr11:113675628C>A	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2541G>T	11.37:g.113675628C>A			Somatic				USP28_uc001pog.2_Silent_p.L523L|USP28_uc010rwy.1_Silent_p.L690L|USP28_uc001poi.2_Silent_p.L170L	p.L847L	NM_020886	NP_065937	WXS	Illumina HiSeq	Unspecified	Q96RU2	UBP28_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)	20	2574	-		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	847					B0YJC0|B0YJC1|Q9P213	Silent	SNP	ENST00000003302.4	37	c.2541G>T	CCDS31680.1																																																																																				0.448	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1			25	53	1	0	1.64293e-13	0.01892	1.9069e-13	25	53				
TM7SF3	51768	broad.mit.edu	37	12	27128447	27128447	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:27128447C>T	ENST00000343028.4	-	11	1657	c.1432G>A	c.(1432-1434)Gtg>Atg	p.V478M	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	478						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V478M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					TGAAAAGGCACATTTGTGAAA	0.433																																							uc010sjl.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)	2						c.(1432-1434)GTG>ATG		transmembrane 7 superfamily member 3 precursor							123.0	118.0	120.0					12																	27128447		2203	4300	6503	SO:0001583	missense	51768					integral to membrane|plasma membrane		g.chr12:27128447C>T	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1432G>A	12.37:g.27128447C>T	ENSP00000342322:p.Val478Met		Somatic					p.V478M	NM_016551	NP_057635	WXS	Illumina HiSeq	Unspecified	Q9NS93	TM7S3_HUMAN			11	1670	-	Colorectal(261;0.0847)		478					B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	37	c.1432G>A	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530889	0.85706	.	.	ENSG00000064115	ENST00000343028;ENST00000545344	T	0.34667	1.35	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.60143	0.2246	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.56968	-0.7891	10	0.51188	T	0.08	-17.8684	20.0609	0.97674	0.0:1.0:0.0:0.0	.	478	Q9NS93	TM7S3_HUMAN	M	478;192	ENSP00000342322:V478M	ENSP00000342322:V478M	V	-	1	0	TM7SF3	27019714	1.000000	0.71417	0.995000	0.50966	0.938000	0.57974	5.734000	0.68580	2.824000	0.97209	0.655000	0.94253	GTG		0.433	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551		21	56	0	0	0	0.008871	0	21	56				
OVCH1	341350	broad.mit.edu	37	12	29617518	29617518	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:29617518C>A	ENST00000318184.5	-	18	2046	c.2047G>T	c.(2047-2049)Gta>Tta	p.V683L	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	683	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V683L(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GGGAGACATACTGGCCTCACC	0.463																																							uc001rix.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(2047-2049)GTA>TTA		ovochymase 1 precursor							101.0	102.0	102.0					12																	29617518		1944	4158	6102	SO:0001583	missense	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29617518C>A	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2047G>T	12.37:g.29617518C>A	ENSP00000326708:p.Val683Leu		Somatic					p.V683L	NM_183378	NP_899234	WXS	Illumina HiSeq	Unspecified	Q7RTY7	OVCH1_HUMAN			18	2047	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		683			Peptidase S1 2.			Missense_Mutation	SNP	ENST00000318184.5	37	c.2047G>T		.	.	.	.	.	.	.	.	.	.	C	11.50	1.658190	0.29425	.	.	ENSG00000187950	ENST00000318184	T	0.61392	0.11	2.97	-0.94	0.10405	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.48660	0.1512	L	0.52206	1.635	0.09310	N	1	P	0.43169	0.8	B	0.41271	0.352	T	0.41627	-0.9498	9	0.62326	D	0.03	.	7.4787	0.27391	0.0:0.5768:0.0:0.4232	.	683	Q7RTY7	OVCH1_HUMAN	L	683	ENSP00000326708:V683L	ENSP00000326708:V683L	V	-	1	0	OVCH1	29508785	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.127000	0.15790	-0.243000	0.09653	0.655000	0.94253	GTA		0.463	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		22	49	1	0	2.89027e-11	0.014323	3.32698e-11	22	49				
TUBA1A	7846	broad.mit.edu	37	12	49578828	49578828	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:49578828C>G	ENST00000295766.5	-	4	1800	c.1321G>C	c.(1321-1323)Gaa>Caa	p.E441Q	TUBA1A_ENST00000301071.7_Missense_Mutation_p.E441Q|TUBA1A_ENST00000550767.1_Missense_Mutation_p.E406Q	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	441					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E441Q(1)		stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	CCCTCTCCTTCAACAGAATCC	0.463																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	uc009zlf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1321-1323)GAA>CAA		tubulin, alpha 1a							171.0	173.0	173.0					12																	49578828		2203	4300	6503	SO:0001583	missense	7846				'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr12:49578828C>G	AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.1321G>C	12.37:g.49578828C>G	ENSP00000439020:p.Glu441Gln		Somatic				TUBA1B_uc001rto.2_Intron|TUBA1A_uc001rtp.2_Missense_Mutation_p.E441Q|TUBA1A_uc001rtq.2_Missense_Mutation_p.E288Q|TUBA1A_uc001rtr.2_Missense_Mutation_p.E288Q|TUBA1A_uc009zlg.2_Missense_Mutation_p.E288Q	p.E441Q	NM_006009	NP_006000	WXS	Illumina HiSeq	Unspecified	Q71U36	TBA1A_HUMAN			4	1593	-			441					A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	ENST00000295766.5	37	c.1321G>C	CCDS58227.1	.	.	.	.	.	.	.	.	.	.	c	11.58	1.681224	0.29872	.	.	ENSG00000167552	ENST00000301071;ENST00000552597;ENST00000548405;ENST00000295766;ENST00000550767	T;T;T	0.79454	-1.17;-1.17;-1.27	5.51	4.62	0.57501	.	0.000000	0.64402	D	0.000001	T	0.76292	0.3967	M	0.66297	2.02	0.80722	D	1	B	0.30482	0.281	B	0.28305	0.088	T	0.76748	-0.2845	10	0.72032	D	0.01	.	15.3005	0.73945	0.0:0.8591:0.1409:0.0	.	441	Q71U36	TBA1A_HUMAN	Q	441;172;288;441;406	ENSP00000301071:E441Q;ENSP00000439020:E441Q;ENSP00000446637:E406Q	ENSP00000439020:E441Q	E	-	1	0	TUBA1A	47865095	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.418000	0.80167	1.308000	0.44962	0.655000	0.94253	GAA		0.463	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404547.2	NM_006009		11	242	0	0	0	0.010729	0	11	242				
TROAP	10024	broad.mit.edu	37	12	49724414	49724414	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:49724414G>A	ENST00000257909.3	+	13	1862	c.1786G>A	c.(1786-1788)Gag>Aag	p.E596K	TROAP_ENST00000547923.1_Intron|TROAP_ENST00000551245.1_Missense_Mutation_p.E596K	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	596	4 X 33 AA approximate tandem repeats.|Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.E596K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CTGTAGGATTGAGCCTGAGAT	0.627																																							uc001rtx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1786-1788)GAG>AAG		tastin isoform 1							74.0	71.0	72.0					12																	49724414		2203	4300	6503	SO:0001583	missense	10024				cell adhesion	cytoplasm		g.chr12:49724414G>A	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1786G>A	12.37:g.49724414G>A	ENSP00000257909:p.Glu596Lys		Somatic				TROAP_uc009zlh.2_Missense_Mutation_p.E596K|TROAP_uc001rty.2_Intron	p.E596K	NM_005480	NP_005471	WXS	Illumina HiSeq	Unspecified	Q12815	TROAP_HUMAN			13	1953	+			596			Cys-rich.|4 X 33 AA approximate tandem repeats.|3.		F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	c.1786G>A	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.906124	0.52333	.	.	ENSG00000135451	ENST00000551245;ENST00000257909	.	.	.	3.73	1.69	0.24217	.	0.215516	0.31936	N	0.006822	T	0.22781	0.0550	L	0.43923	1.385	0.09310	N	0.999999	P;B	0.40180	0.705;0.206	B;B	0.38327	0.271;0.058	T	0.07888	-1.0749	9	0.16420	T	0.52	-1.483	4.4291	0.11518	0.2332:0.1893:0.5775:0.0	.	596;596	F8W130;Q12815	.;TROAP_HUMAN	K	596	.	ENSP00000257909:E596K	E	+	1	0	TROAP	48010681	0.825000	0.29262	0.019000	0.16419	0.086000	0.17979	0.937000	0.28951	0.691000	0.31592	0.491000	0.48974	GAG		0.627	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480		8	88	0	0	0	0.006214	0	8	88				
ZC3H10	84872	broad.mit.edu	37	12	56514975	56514975	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:56514975G>A	ENST00000257940.2	+	3	905	c.629G>A	c.(628-630)cGg>cAg	p.R210Q	RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA	NM_032786.1	NP_116175.1	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10	210							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R210Q(2)		breast(1)|endometrium(4)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	11			OV - Ovarian serous cystadenocarcinoma(18;0.12)			CCAAAACGCCGGCGAGGTGGA	0.557																																							uc001sjp.1		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)		0						c.(628-630)CGG>CAG		zinc finger CCCH-type containing 10							37.0	42.0	40.0					12																	56514975		2203	4300	6503	SO:0001583	missense	84872						nucleic acid binding|zinc ion binding	g.chr12:56514975G>A	BC018708	CCDS8903.1	12q13.2	2012-07-05	2005-06-02	2005-06-02		ENSG00000135482		"""Zinc fingers, CCCH-type domain containing"""	25893	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 10"""	ZC3HDC10		12477932	Standard	NM_032786		Approved	FLJ14451	uc001sjp.1	Q96K80		ENST00000257940.2:c.629G>A	12.37:g.56514975G>A	ENSP00000257940:p.Arg210Gln		Somatic					p.R210Q	NM_032786	NP_116175	WXS	Illumina HiSeq	Unspecified	Q96K80	ZC3HA_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.12)		3	818	+			210						Missense_Mutation	SNP	ENST00000257940.2	37	c.629G>A	CCDS8903.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005235	0.54254	.	.	ENSG00000135482	ENST00000257940	.	.	.	4.59	4.59	0.56863	.	0.162280	0.40302	N	0.001126	T	0.32971	0.0847	N	0.08118	0	0.80722	D	1	D	0.59357	0.985	P	0.44647	0.456	T	0.29941	-0.9995	9	0.42905	T	0.14	-8.4828	16.7031	0.85364	0.0:0.0:1.0:0.0	.	210	Q96K80	ZC3HA_HUMAN	Q	210	.	ENSP00000257940:R210Q	R	+	2	0	ZC3H10	54801242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.751000	0.68720	2.552000	0.86080	0.563000	0.77884	CGG		0.557	ZC3H10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407826.1	NM_032786		4	68	0	0	0	0.009096	0	4	68				
CNPY2	10330	broad.mit.edu	37	12	56708678	56708678	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:56708678C>A	ENST00000273308.4	-	3	701	c.161G>T	c.(160-162)gGa>gTa	p.G54V	RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.11_ENST00000549860.1_RNA|CNPY2_ENST00000551720.1_5'UTR|PAN2_ENST00000549090.1_5'Flank|RP11-977G19.10_ENST00000549318.1_Missense_Mutation_p.G54V	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	54	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)		p.G54V(1)		large_intestine(2)|lung(2)	4						CCGGAAAGATCCCATCTGAAT	0.507																																							uc001sku.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(160-162)GGA>GTA		canopy 2 homolog precursor							121.0	109.0	113.0					12																	56708678		2203	4300	6503	SO:0001583	missense	10330					endoplasmic reticulum|integral to plasma membrane	protein binding	g.chr12:56708678C>A	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.161G>T	12.37:g.56708678C>A	ENSP00000273308:p.Gly54Val		Somatic				CNPY2_uc001skv.2_Missense_Mutation_p.G54V	p.G54V	NM_014255	NP_055070	WXS	Illumina HiSeq	Unspecified	Q9Y2B0	CNPY2_HUMAN			3	702	-			54			Saposin B-type.		B2R7B9|Q9UHE9	Missense_Mutation	SNP	ENST00000273308.4	37	c.161G>T	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	C	32	5.137364	0.94517	.	.	ENSG00000144785;ENSG00000144785;ENSG00000144785;ENSG00000257727;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000547423;ENST00000548360;ENST00000273308;ENST00000551475;ENST00000551286	T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23	5.51	5.51	0.81932	Saposin B (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69837	-0.5037	10	0.62326	D	0.03	-17.3325	18.5772	0.91159	0.0:1.0:0.0:0.0	.	54;54	Q9Y2B0-2;Q9Y2B0	.;CNPY2_HUMAN	V	54;54;54;54;54;2	ENSP00000446743:G54V;ENSP00000446506:G54V;ENSP00000447042:G54V;ENSP00000273308:G54V;ENSP00000448809:G54V;ENSP00000446784:G2V	ENSP00000273308:G54V	G	-	2	0	RP11-977G19.10;CNPY2	54994945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.858000	0.69532	2.764000	0.94973	0.655000	0.94253	GGA		0.507	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255		46	87	1	0	1.19451e-25	0.01441	1.48077e-25	46	87				
OSBPL8	114882	broad.mit.edu	37	12	76763494	76763494	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:76763494T>A	ENST00000261183.3	-	20	2642	c.2163A>T	c.(2161-2163)aaA>aaT	p.K721N	OSBPL8_ENST00000393250.4_Missense_Mutation_p.K679N|OSBPL8_ENST00000393249.2_Missense_Mutation_p.K679N	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	721					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)	p.K721N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						CATTTTTTGTTTTCCGATCCC	0.388																																							uc001sye.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2161-2163)AAA>AAT		oxysterol-binding protein-like protein 8 isoform							157.0	129.0	139.0					12																	76763494		2202	4300	6502	SO:0001583	missense	114882				lipid transport		lipid binding	g.chr12:76763494T>A	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.2163A>T	12.37:g.76763494T>A	ENSP00000261183:p.Lys721Asn		Somatic				OSBPL8_uc001syf.1_Missense_Mutation_p.K679N|OSBPL8_uc001syg.1_Missense_Mutation_p.K679N|OSBPL8_uc001syh.1_Missense_Mutation_p.K696N	p.K721N	NM_020841	NP_065892	WXS	Illumina HiSeq	Unspecified	Q9BZF1	OSBL8_HUMAN			20	2643	-			721					A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	ENST00000261183.3	37	c.2163A>T	CCDS31862.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898325	0.72639	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.33	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	L	0.55743	1.74	0.46954	D	0.999264	D	0.63046	0.992	D	0.67900	0.954	T	0.42378	-0.9455	10	0.37606	T	0.19	-21.2774	11.3021	0.49311	0.0:0.0722:0.0:0.9278	.	721	Q9BZF1	OSBL8_HUMAN	N	679;721;706;679;721;721	ENSP00000376939:K679N;ENSP00000261183:K721N;ENSP00000376940:K679N;ENSP00000450238:K721N	ENSP00000261183:K721N	K	-	3	2	OSBPL8	75287625	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.277000	0.43417	0.961000	0.38030	-0.256000	0.11100	AAA		0.388	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	NM_020841		13	78	0	0	0	0.024245	0	13	78				
TSPAN19	144448	broad.mit.edu	37	12	85411261	85411261	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:85411261C>T	ENST00000532498.2	-	7	648	c.568G>A	c.(568-570)Gag>Aag	p.E190K	TSPAN19_ENST00000547403.2_5'Flank	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	190						integral component of membrane (GO:0016021)		p.E190K(1)		ovary(1)	1						TTCAGTGGCTCATCACAAAAC	0.318																																							uc009zsj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(568-570)GAG>AAG		tetraspanin 19							91.0	86.0	88.0					12																	85411261		1842	4095	5937	SO:0001583	missense	144448					integral to membrane		g.chr12:85411261C>T		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.568G>A	12.37:g.85411261C>T	ENSP00000433816:p.Glu190Lys		Somatic					p.E190K	NM_001100917	NP_001094387	WXS	Illumina HiSeq	Unspecified	P0C672	TSN19_HUMAN			7	669	-			190						Missense_Mutation	SNP	ENST00000532498.2	37	c.568G>A	CCDS44949.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.237|9.237	1.037321|1.037321	0.19669|0.19669	.|.	.|.	ENSG00000231738|ENSG00000231738	ENST00000532498|ENST00000525452	T|.	0.78924|.	-1.22|.	4.77|4.77	4.77|4.77	0.60923|0.60923	Tetraspanin, EC2 domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.23572|0.23572	0.0570|0.0570	N|N	0.08118|0.08118	0|0	0.24630|0.24630	N|N	0.993629|0.993629	P|.	0.42078|.	0.77|.	B|.	0.43508|.	0.422|.	T|T	0.14117|0.14117	-1.0484|-1.0484	9|5	0.06891|.	T|.	0.86|.	.|.	14.0889|14.0889	0.64977|0.64977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	190|.	P0C672|.	TSN19_HUMAN|.	K|I	190|38	ENSP00000433816:E190K|.	ENSP00000433816:E190K|.	E|M	-|-	1|3	0|0	TSPAN19|TSPAN19	83935392|83935392	0.821000|0.821000	0.29204|0.29204	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	1.326000|1.326000	0.33735|0.33735	2.604000|2.604000	0.88044|0.88044	0.644000|0.644000	0.83932|0.83932	GAG|ATG		0.318	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388240.2	NM_001100917		8	17	0	0	0	0.004482	0	8	17				
ATP2B1	490	broad.mit.edu	37	12	89992965	89992965	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:89992965C>T	ENST00000428670.3	-	20	3736	c.3280G>A	c.(3280-3282)Gat>Aat	p.D1094N	ATP2B1_ENST00000393164.2_Missense_Mutation_p.D837N|ATP2B1_ENST00000348959.3_Missense_Mutation_p.D1058N|ATP2B1_ENST00000359142.3_Missense_Mutation_p.D1094N|ATP2B1_ENST00000261173.2_Missense_Mutation_p.D1094N			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1094					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.D1094N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TCAGCGTGATCAATCTCTTCA	0.453																																							uc001tbh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(3280-3282)GAT>AAT		plasma membrane calcium ATPase 1 isoform 1b							151.0	129.0	137.0					12																	89992965		2203	4300	6503	SO:0001583	missense	490				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr12:89992965C>T	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.3280G>A	12.37:g.89992965C>T	ENSP00000392043:p.Asp1094Asn		Somatic				ATP2B1_uc001tbg.2_Missense_Mutation_p.D1094N|ATP2B1_uc009zsr.2_RNA|ATP2B1_uc001tbf.2_Missense_Mutation_p.D728N	p.D1094N	NM_001682	NP_001673	WXS	Illumina HiSeq	Unspecified	P20020	AT2B1_HUMAN			19	3461	-			1094			Cytoplasmic (Potential).		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	c.3280G>A	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523968	0.64747	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.94931	-3.29;-3.56;-3.29;-3.29;-3.47	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	D	0.96291	0.8790	M	0.73962	2.25	0.80722	D	1	P;B;B	0.48589	0.912;0.28;0.426	P;B;P	0.52454	0.678;0.138;0.699	D	0.95903	0.8917	10	0.62326	D	0.03	-21.995	20.4777	0.99188	0.0:1.0:0.0:0.0	.	1094;1094;1058	P20020-3;P20020-2;P20020-6	.;.;.	N	1094;1058;1094;1094;837	ENSP00000261173:D1094N;ENSP00000343599:D1058N;ENSP00000352054:D1094N;ENSP00000392043:D1094N;ENSP00000376869:D837N	ENSP00000261173:D1094N	D	-	1	0	ATP2B1	88517096	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	GAT		0.453	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682		30	102	0	0	0	0.007291	0	30	102				
USP44	84101	broad.mit.edu	37	12	95927518	95927518	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:95927518C>T	ENST00000258499.3	-	2	803	c.515G>A	c.(514-516)gGa>gAa	p.G172E	USP44_ENST00000552440.1_Missense_Mutation_p.G172E|USP44_ENST00000537435.2_Missense_Mutation_p.G172E|USP44_ENST00000393091.2_Missense_Mutation_p.G172E	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	172					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.G172E(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						CTTTTTTCTTCCAATGGGTGA	0.363																																							uc001teg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|central_nervous_system(1)	3						c.(514-516)GGA>GAA		ubiquitin thiolesterase 44							94.0	94.0	94.0					12																	95927518		2203	4300	6503	SO:0001583	missense	84101				anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr12:95927518C>T	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.515G>A	12.37:g.95927518C>T	ENSP00000258499:p.Gly172Glu		Somatic				USP44_uc001teh.2_Missense_Mutation_p.G172E|USP44_uc009zte.2_Missense_Mutation_p.G169E	p.G172E	NM_001042403	NP_001035862	WXS	Illumina HiSeq	Unspecified	Q9H0E7	UBP44_HUMAN			2	659	-			172					B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	37	c.515G>A	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411658	0.42817	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435	T;T;T;T	0.14144	3.81;3.81;2.53;3.81	5.0	4.08	0.47627	.	0.270143	0.41294	D	0.000912	T	0.27629	0.0679	M	0.74881	2.28	0.80722	D	1	P	0.51653	0.947	P	0.52598	0.703	T	0.07462	-1.0771	10	0.23302	T	0.38	.	15.4996	0.75687	0.0:0.8609:0.139:0.0	.	172	Q9H0E7	UBP44_HUMAN	E	172	ENSP00000258499:G172E;ENSP00000376806:G172E;ENSP00000448670:G172E;ENSP00000442629:G172E	ENSP00000258499:G172E	G	-	2	0	USP44	94451649	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.296000	0.59055	1.186000	0.42985	0.561000	0.74099	GGA		0.363	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147		30	78	0	0	0	0.013726	0	30	78				
GOLGA2P5	55592	broad.mit.edu	37	12	100551822	100551822	+	RNA	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:100551822G>A	ENST00000397112.4	-	0	1633				RN7SL176P_ENST00000580352.1_RNA|AC010203.1_ENST00000408843.1_RNA	NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)		p.Q11*(1)		large_intestine(1)|lung(3)	4						GGCATGGGCTGAGGCACCTCC	0.642																																							uc001tgs.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(31-33)CAG>TAG		golgi autoantigen, golgin subfamily a, 2-like 1							105.0	76.0	86.0					12																	100551822		2203	4300	6503			55592							g.chr12:100551822G>A																													12.37:g.100551822G>A			Somatic				GOLGA2B_uc001tgt.2_RNA|GOLGA2B_uc001tgu.2_Nonsense_Mutation_p.Q11*	p.Q11*	NM_017600	NP_060070	WXS	Illumina HiSeq	Unspecified					3	475	-								Q9NSV2	Nonsense_Mutation	SNP	ENST00000397112.4	37	c.31C>T																																																																																					0.642	GOLGA2B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000396439.2			10	32	0	0	0	0.006214	0	10	32				
DRAM1	55332	broad.mit.edu	37	12	102302092	102302092	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:102302092C>T	ENST00000258534.8	+	4	910	c.471C>T	c.(469-471)tgC>tgT	p.C157C	DRAM1_ENST00000544152.1_Intron	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	157					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.C51C(1)|p.C157C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						TCTCGACATGCCACATACGGA	0.483																																							uc001tix.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(469-471)TGC>TGT		DNA-damage regulated autophagy modulator 1							183.0	180.0	181.0					12																	102302092		2070	4211	6281	SO:0001819	synonymous_variant	55332				apoptosis|autophagy	integral to membrane|lysosomal membrane		g.chr12:102302092C>T	BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.471C>T	12.37:g.102302092C>T			Somatic				DRAM1_uc010svv.1_Intron	p.C157C	NM_018370	NP_060840	WXS	Illumina HiSeq	Unspecified	Q8N682	DRAM1_HUMAN			4	934	+			157					B7Z4T0|Q7L3E3|Q9NUN1	Silent	SNP	ENST00000258534.8	37	c.471C>T	CCDS41823.1	.	.	.	.	.	.	.	.	.	.	C	1.430	-0.570574	0.03910	.	.	ENSG00000136048	ENST00000549066	.	.	.	5.64	3.64	0.41730	.	.	.	.	.	T	0.58736	0.2143	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52895	-0.8514	4	.	.	.	.	8.7927	0.34861	0.0:0.6825:0.0:0.3175	.	.	.	.	S	1	.	.	P	+	1	0	DRAM1	100826223	0.993000	0.37304	0.653000	0.29593	0.033000	0.12548	0.590000	0.23954	0.621000	0.30232	-0.148000	0.13756	CCA		0.483	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409195.1	NM_018370		4	164	0	0	0	0.009096	0	4	164				
IFT81	28981	broad.mit.edu	37	12	110618328	110618328	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:110618328G>A	ENST00000242591.5	+	12	1796	c.1290G>A	c.(1288-1290)agG>agA	p.R430R	IFT81_ENST00000552912.1_Silent_p.R430R	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	430					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)	p.R430R(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						TTTTGCAGAGGACTGAAGAAC	0.343																																							uc001tqi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1288-1290)AGG>AGA		intraflagellar transport 81-like isoform 1							86.0	78.0	80.0					12																	110618328		1832	4086	5918	SO:0001819	synonymous_variant	28981				cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum		g.chr12:110618328G>A	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.1290G>A	12.37:g.110618328G>A			Somatic				IFT81_uc001tqh.2_Silent_p.R430R|IFT81_uc001tqj.2_RNA	p.R430R	NM_001143779	NP_001137251	WXS	Illumina HiSeq	Unspecified	Q8WYA0	IFT81_HUMAN			12	1420	+			430			Potential.		Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Silent	SNP	ENST00000242591.5	37	c.1290G>A	CCDS41831.1																																																																																				0.343	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055		10	50	0	0	0	0.013537	0	10	50				
SDS	10993	broad.mit.edu	37	12	113830941	113830941	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:113830941G>T	ENST00000257549.4	-	8	914	c.792C>A	c.(790-792)atC>atA	p.I264I		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	264					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.I264I(1)		large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	GCTCCACCAGGATCTTCTCAT	0.632																																							uc001tvg.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(790-792)ATC>ATA		serine dehydratase	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						47.0	51.0	50.0					12																	113830941		2203	4300	6503	SO:0001819	synonymous_variant	10993				gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding	g.chr12:113830941G>T	J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.792C>A	12.37:g.113830941G>T			Somatic					p.I264I	NM_006843	NP_006834	WXS	Illumina HiSeq	Unspecified	P20132	SDHL_HUMAN			8	914	-			264					A8K9P5	Silent	SNP	ENST00000257549.4	37	c.792C>A	CCDS9169.1																																																																																				0.632	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404790.1	NM_006843		36	72	1	0	3.66082e-28	0.023175	4.56513e-28	36	72				
RBM19	9904	broad.mit.edu	37	12	114397877	114397877	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:114397877G>A	ENST00000545145.2	-	3	404	c.326C>T	c.(325-327)cCa>cTa	p.P109L	RBM19_ENST00000261741.5_Missense_Mutation_p.P109L|RBM19_ENST00000392561.3_Missense_Mutation_p.P109L	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	109					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P109L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CTTAATTTCTGGAGTAGTAGA	0.532																																							uc009zwi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6						c.(325-327)CCA>CTA		RNA binding motif protein 19							108.0	109.0	109.0					12																	114397877		2203	4300	6503	SO:0001583	missense	9904				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding	g.chr12:114397877G>A	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.326C>T	12.37:g.114397877G>A	ENSP00000442053:p.Pro109Leu		Somatic				RBM19_uc001tvn.3_Missense_Mutation_p.P109L|RBM19_uc001tvm.2_Missense_Mutation_p.P109L	p.P109L	NM_001146699	NP_001140171	WXS	Illumina HiSeq	Unspecified	Q9Y4C8	RBM19_HUMAN			3	470	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		109					A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	37	c.326C>T	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828115	0.50845	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.05447	3.44;3.44;3.44	4.86	1.95	0.26073	.	1.194130	0.05934	N	0.635663	T	0.05914	0.0154	N	0.24115	0.695	0.29277	N	0.870257	B	0.18610	0.029	B	0.16722	0.016	T	0.43605	-0.9381	10	0.27082	T	0.32	1.9087	10.0197	0.42035	0.0714:0.2594:0.6692:0.0	.	109	Q9Y4C8	RBM19_HUMAN	L	109	ENSP00000442053:P109L;ENSP00000376344:P109L;ENSP00000261741:P109L	ENSP00000261741:P109L	P	-	2	0	RBM19	112882260	0.446000	0.25665	0.069000	0.20011	0.678000	0.39670	3.785000	0.55424	0.219000	0.20840	0.557000	0.71058	CCA		0.532	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196		30	87	0	0	0	0.009535	0	30	87				
TESC	54997	broad.mit.edu	37	12	117513112	117513112	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:117513112C>A	ENST00000335209.7	-	2	278	c.92G>T	c.(91-93)aGa>aTa	p.R31I	TESC_ENST00000541210.1_Missense_Mutation_p.R31I|TESC_ENST00000392545.4_Missense_Mutation_p.R84I			Q96BS2	CHP3_HUMAN	tescalcin	31					cell differentiation (GO:0030154)|cellular response to retinoic acid (GO:0071300)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell proliferation (GO:0008285)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of sodium:proton antiporter activity (GO:0032417)|positive regulation of transcription, DNA-templated (GO:0045893)|protein maturation (GO:0051604)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of cell adhesion mediated by integrin (GO:0033628)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphatase inhibitor activity (GO:0019212)|protein homodimerization activity (GO:0042803)|protein kinase inhibitor activity (GO:0004860)	p.R84I(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)		CTGCTTAAATCTCCGATGGAG	0.498																																							uc001twh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)AGA>ATA		tescalcin							81.0	78.0	79.0					12																	117513112		2203	4300	6503	SO:0001583	missense	54997				negative regulation of cell proliferation|positive regulation of megakaryocyte differentiation|positive regulation of transcription, DNA-dependent|regulation of cell adhesion mediated by integrin	cytoplasm|lamellipodium|nucleus|plasma membrane|ruffle	calcium ion binding|magnesium ion binding|phosphatase inhibitor activity|protein binding	g.chr12:117513112C>A	AF443207	CCDS9183.2, CCDS9183.3, CCDS53835.1	12q24.22	2013-01-10			ENSG00000088992	ENSG00000088992		"""EF-hand domain containing"""	26065	protein-coding gene	gene with protein product	"""calcineurin-like EF hand protein 3"""	611585				11145610, 11696366, 12809501, 14661968	Standard	NM_017899		Approved	TSC, FLJ20607, CHP3	uc001twh.3	Q96BS2	OTTHUMG00000144168	ENST00000335209.7:c.92G>T	12.37:g.117513112C>A	ENSP00000334785:p.Arg31Ile		Somatic				TESC_uc001twi.2_RNA	p.R84I	NM_017899	NP_060369	WXS	Illumina HiSeq	Unspecified	Q96BS2	TESC_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0297)	2	256	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		31					F5H1Y5|Q9NWT9	Missense_Mutation	SNP	ENST00000335209.7	37	c.251G>T	CCDS9183.3	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643075	0.87859	.	.	ENSG00000088992	ENST00000335209;ENST00000392545;ENST00000541210	T;T;T	0.46819	0.86;0.86;1.32	5.0	5.0	0.66597	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.79752	-0.1671	10	0.87932	D	0	-35.2894	13.6865	0.62520	0.0:1.0:0.0:0.0	.	31	Q96BS2	TESC_HUMAN	I	31;84;31	ENSP00000334785:R31I;ENSP00000376328:R84I;ENSP00000445689:R31I	ENSP00000334785:R31I	R	-	2	0	TESC	115997495	0.999000	0.42202	0.987000	0.45799	0.980000	0.70556	4.223000	0.58587	2.608000	0.88229	0.561000	0.74099	AGA		0.498	TESC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291363.2	NM_017899		29	70	1	0	3.76114e-14	0.019004	4.402e-14	29	70				
CCDC60	160777	broad.mit.edu	37	12	119909847	119909847	+	Silent	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:119909847G>C	ENST00000327554.2	+	3	684	c.219G>C	c.(217-219)ctG>ctC	p.L73L	CCDC60_ENST00000546345.1_3'UTR|RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	73								p.L73L(1)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TTGCTATTCTGAGGGAAGAGA	0.463																																							uc001txe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(217-219)CTG>CTC		coiled-coil domain containing 60							103.0	102.0	102.0					12																	119909847		2203	4300	6503	SO:0001819	synonymous_variant	160777							g.chr12:119909847G>C	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.219G>C	12.37:g.119909847G>C			Somatic				uc001txf.2_Intron	p.L73L	NM_178499	NP_848594	WXS	Illumina HiSeq	Unspecified	Q8IWA6	CCD60_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.207)	3	684	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		73			Potential.			Silent	SNP	ENST00000327554.2	37	c.219G>C	CCDS9190.1																																																																																				0.463	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499		50	105	0	0	0	0.01441	0	50	105				
GOLGA3	2802	broad.mit.edu	37	12	133353279	133353279	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr12:133353279G>A	ENST00000450791.2	-	20	4102	c.3919C>T	c.(3919-3921)Ctg>Ttg	p.L1307L	GOLGA3_ENST00000204726.3_Silent_p.L1307L|GOLGA3_ENST00000456883.2_Silent_p.L1307L			Q08378	GOGA3_HUMAN	golgin A3	1307	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.L1307L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GTCAAGTCCAGCTGCTGCTTC	0.527																																							uc001ukz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3919-3921)CTG>TTG		Golgi autoantigen, golgin subfamily a, 3							104.0	96.0	99.0					12																	133353279		2203	4300	6503	SO:0001819	synonymous_variant	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133353279G>A	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3919C>T	12.37:g.133353279G>A			Somatic				GOLGA3_uc001ula.1_Silent_p.L1307L	p.L1307L	NM_005895	NP_005886	WXS	Illumina HiSeq	Unspecified	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	21	4478	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	1307			Potential.|Gln-rich.		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	37	c.3919C>T	CCDS9281.1																																																																																				0.527	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		43	77	0	0	0	0.013114	0	43	77				
IFT88	8100	broad.mit.edu	37	13	21265279	21265279	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:21265279G>C	ENST00000319980.6	+	28	2794	c.2467G>C	c.(2467-2469)Gat>Cat	p.D823H	IFT88_ENST00000382778.4_3'UTR|IFT88_ENST00000351808.5_Missense_Mutation_p.D814H|IFT88_ENST00000537103.1_Missense_Mutation_p.D795H	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	823					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.D823H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TGATTTTGCTGATGAAGAATT	0.373																																							uc001unh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2467-2469)GAT>CAT		intraflagellar transport 88 homolog isoform 1							82.0	85.0	84.0					13																	21265279		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21265279G>C	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2467G>C	13.37:g.21265279G>C	ENSP00000323580:p.Asp823His		Somatic				IFT88_uc001uni.2_Missense_Mutation_p.D814H|IFT88_uc001unj.2_Missense_Mutation_p.D813H|IFT88_uc010tcq.1_Missense_Mutation_p.D794H	p.D823H	NM_175605	NP_783195	WXS	Illumina HiSeq	Unspecified	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	28	2863	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	823					A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.2467G>C	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649081	0.87958	.	.	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.78816	-1.21;-1.21;-1.21	5.56	5.56	0.83823	.	0.103434	0.64402	D	0.000005	D	0.89777	0.6813	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.991;0.997	D	0.90943	0.4799	10	0.87932	D	0	-28.4105	19.1155	0.93336	0.0:0.0:1.0:0.0	.	795;823	F5H6C2;Q13099	.;IFT88_HUMAN	H	814;823;795	ENSP00000261632:D814H;ENSP00000323580:D823H;ENSP00000437719:D795H	ENSP00000323580:D823H	D	+	1	0	IFT88	20163279	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.949000	0.93012	2.598000	0.87819	0.655000	0.94253	GAT		0.373	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		29	61	0	0	0	0.027356	0	29	61				
ATP8A2	51761	broad.mit.edu	37	13	26043143	26043143	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:26043143G>A	ENST00000381655.2	+	2	247	c.105G>A	c.(103-105)aaG>aaA	p.K35K	ATP8A2_ENST00000255283.8_5'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	0					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.K35K(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TGGGCTATAAGAAGGCAGAGG	0.582																																							uc001uqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(103-105)AAG>AAA		ATPase, aminophospholipid transporter-like,							76.0	84.0	82.0					13																	26043143		2025	4182	6207	SO:0001819	synonymous_variant	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26043143G>A	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.105G>A	13.37:g.26043143G>A			Somatic				ATP8A2_uc010tdi.1_5'UTR|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_5'UTR	p.K35K	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	2	247	+		Breast(139;0.0201)|Lung SC(185;0.0225)	Error:Variant_position_missing_in_Q9NTI2_after_alignment					Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	c.105G>A	CCDS41873.1																																																																																				0.582	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		9	76	0	0	0	0.004482	0	9	76				
ATP8A2	51761	broad.mit.edu	37	13	26436463	26436463	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:26436463A>C	ENST00000381655.2	+	33	3242	c.3100A>C	c.(3100-3102)Agc>Cgc	p.S1034R	ATP8A2_ENST00000491840.1_3'UTR|ATP8A2_ENST00000255283.8_Missense_Mutation_p.S969R	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	994					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S1034R(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TGTCTGGGGAAGCATGCTGAC	0.527																																							uc001uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(3100-3102)AGC>CGC		ATPase, aminophospholipid transporter-like,							156.0	147.0	150.0					13																	26436463		2025	4180	6205	SO:0001583	missense	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26436463A>C	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3100A>C	13.37:g.26436463A>C	ENSP00000371070:p.Ser1034Arg		Somatic				ATP8A2_uc010tdi.1_Missense_Mutation_p.S969R|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.S584R	p.S1034R	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	33	3242	+		Breast(139;0.0201)|Lung SC(185;0.0225)	994			Helical; (Potential).		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	c.3100A>C	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.938363	0.73557	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.63255	-0.03;-0.03	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.82384	0.5025	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79784	0.984;0.993;0.984	D	0.86308	0.1684	10	0.87932	D	0	.	14.6326	0.68666	1.0:0.0:0.0:0.0	.	969;814;994	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	R	1034;969;814	ENSP00000371070:S1034R;ENSP00000255283:S969R	ENSP00000255283:S969R	S	+	1	0	ATP8A2	25334463	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	8.525000	0.90583	2.091000	0.63221	0.533000	0.62120	AGC		0.527	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		10	84	0	0	0	0.010729	0	10	84				
USPL1	10208	broad.mit.edu	37	13	31232310	31232310	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:31232310A>T	ENST00000255304.4	+	9	2438	c.2096A>T	c.(2095-2097)gAc>gTc	p.D699V		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	699					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)	p.D699V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		ATTGAGAAGGACGCTCAGTTA	0.348																																					Ovarian(60;318 1180 1554 28110 31601)	Ovarian(60;318 1180 1554 28110 31601)	uc001utc.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(2095-2097)GAC>GTC		ubiquitin specific peptidase like 1							53.0	53.0	53.0					13																	31232310		2203	4300	6503	SO:0001583	missense	10208				ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity	g.chr13:31232310A>T	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.2096A>T	13.37:g.31232310A>T	ENSP00000255304:p.Asp699Val		Somatic				USPL1_uc001utd.2_Missense_Mutation_p.D370V|USPL1_uc001ute.1_Missense_Mutation_p.D370V	p.D699V	NM_005800	NP_005791	WXS	Illumina HiSeq	Unspecified	Q5W0Q7	USPL1_HUMAN		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)	9	2528	+		Lung SC(185;0.0257)|Breast(139;0.203)	699					Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	c.2096A>T	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.703163	0.48412	.	.	ENSG00000132952	ENST00000255304	T	0.15603	2.41	4.81	0.772	0.18510	.	1.105560	0.06765	N	0.782473	T	0.20700	0.0498	L	0.54323	1.7	0.09310	N	0.999997	P	0.43701	0.815	P	0.45681	0.49	T	0.24977	-1.0145	10	0.72032	D	0.01	-0.4546	4.0246	0.09682	0.5274:0.1813:0.2913:0.0	.	699	Q5W0Q7	USPL1_HUMAN	V	699	ENSP00000255304:D699V	ENSP00000255304:D699V	D	+	2	0	USPL1	30130310	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	0.055000	0.14229	0.311000	0.23014	0.459000	0.35465	GAC		0.348	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800		13	33	0	0	0	0.016723	0	13	33				
DCLK1	9201	broad.mit.edu	37	13	36379850	36379850	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:36379850G>A	ENST00000360631.3	-	15	2141	c.1930C>T	c.(1930-1932)Cat>Tat	p.H644Y	DCLK1_ENST00000255448.4_Missense_Mutation_p.H644Y|DCLK1_ENST00000379893.1_Missense_Mutation_p.H337Y			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	644	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.H644Y(2)|p.H337Y(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ACCCAGGGATGCTCAAGTACT	0.408																																							uc001uvf.2		NA																	3	Substitution - Missense(3)		lung(3)	stomach(6)|ovary(2)|skin(1)	9						c.(1930-1932)CAT>TAT		doublecortin-like kinase 1							194.0	172.0	179.0					13																	36379850		2203	4300	6503	SO:0001583	missense	9201				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chr13:36379850G>A	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1930C>T	13.37:g.36379850G>A	ENSP00000353846:p.His644Tyr		Somatic				DCLK1_uc001uve.3_Missense_Mutation_p.H337Y|DCLK1_uc010teh.1_Missense_Mutation_p.H337Y|DCLK1_uc010abk.2_Missense_Mutation_p.H164Y	p.H644Y	NM_004734	NP_004725	WXS	Illumina HiSeq	Unspecified	O15075	DCLK1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)	15	2163	-		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	644			Protein kinase.		B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37	c.1930C>T		.	.	.	.	.	.	.	.	.	.	G	18.31	3.594932	0.66219	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893	T;T;T	0.54279	0.58;0.58;0.58	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79587	0.4471	M	0.91717	3.235	0.80722	D	1	P;D;D;P	0.65815	0.875;0.993;0.995;0.929	P;D;D;P	0.69654	0.577;0.965;0.941;0.668	T	0.82944	-0.0206	10	0.87932	D	0	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	337;644;644;337	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	Y	336;644;644;337	ENSP00000255448:H644Y;ENSP00000353846:H644Y;ENSP00000369223:H337Y	ENSP00000255448:H644Y	H	-	1	0	DCLK1	35277850	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	9.659000	0.98597	2.885000	0.99019	0.655000	0.94253	CAT		0.408	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734		53	119	0	0	0	0.01441	0	53	119				
ENOX1	55068	broad.mit.edu	37	13	43788178	43788178	+	Missense_Mutation	SNP	G	G	A	rs374338452		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:43788178G>A	ENST00000261488.6	-	17	2457	c.1880C>T	c.(1879-1881)aCg>aTg	p.T627M	ENOX1_ENST00000412891.1_Missense_Mutation_p.T627M	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	627					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.T627M(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TTTTTCCAGCGTGGCTCCCAC	0.438																																							uc001uza.3		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)|skin(1)	2						c.(1879-1881)ACG>ATG		ecto-NOX disulfide-thiol exchanger 1		G	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	123.0	115.0	118.0		1880,1880,1880	6.2	0.8	13		118	1,8599		0,1,4299	no	missense,missense,missense	ENOX1	NM_001127615.1,NM_001242863.1,NM_017993.3	81,81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	627/644,627/644,627/644	43788178	1,13005	2203	4300	6503	SO:0001583	missense	55068				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity	g.chr13:43788178G>A	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1880C>T	13.37:g.43788178G>A	ENSP00000261488:p.Thr627Met		Somatic				ENOX1_uc001uzb.3_Missense_Mutation_p.T627M|ENOX1_uc001uzc.3_Missense_Mutation_p.T627M|ENOX1_uc001uyz.3_Missense_Mutation_p.T236M	p.T627M	NM_001127615	NP_001121087	WXS	Illumina HiSeq	Unspecified	Q8TC92	ENOX1_HUMAN		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)	17	2180	-		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)	627					A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	c.1880C>T	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	.	17.80	3.479331	0.63849	0.0	1.16E-4	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.46819	0.86;0.86	6.16	6.16	0.99307	.	0.054517	0.64402	D	0.000001	T	0.60261	0.2255	L	0.42245	1.32	0.80722	D	1	D	0.71674	0.998	P	0.57324	0.818	T	0.59107	-0.7516	10	0.87932	D	0	-19.8488	20.8598	0.99761	0.0:0.0:1.0:0.0	.	627	Q8TC92	ENOX1_HUMAN	M	627	ENSP00000261488:T627M;ENSP00000415054:T627M	ENSP00000261488:T627M	T	-	2	0	ENOX1	42686178	1.000000	0.71417	0.813000	0.32504	0.895000	0.52256	6.498000	0.73679	2.937000	0.99478	0.650000	0.86243	ACG		0.438	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993		33	79	0	0	0	0.012213	0	33	79				
FNDC3A	22862	broad.mit.edu	37	13	49752734	49752734	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:49752734G>C	ENST00000492622.2	+	14	1866	c.1561G>C	c.(1561-1563)Gaa>Caa	p.E521Q	FNDC3A_ENST00000398316.3_Missense_Mutation_p.E465Q|FNDC3A_ENST00000541916.1_Missense_Mutation_p.E521Q	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	521	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.E521Q(1)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ATATGATGGAGAAGATCTTGC	0.323																																							uc001vcm.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1561-1563)GAA>CAA		fibronectin type III domain containing 3A							116.0	117.0	117.0					13																	49752734		2203	4300	6503	SO:0001583	missense	22862					Golgi membrane|integral to membrane		g.chr13:49752734G>C	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.1561G>C	13.37:g.49752734G>C	ENSP00000417257:p.Glu521Gln		Somatic				FNDC3A_uc001vcn.2_Missense_Mutation_p.E521Q|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Missense_Mutation_p.E447Q|FNDC3A_uc001vcq.2_Missense_Mutation_p.E465Q	p.E521Q	NM_001079673	NP_001073141	WXS	Illumina HiSeq	Unspecified	Q9Y2H6	FND3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)	14	1866	+		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	521			Fibronectin type-III 3.		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	c.1561G>C	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.421301	0.62622	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.56444	0.46;0.46;0.46	5.79	5.79	0.91817	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.182576	0.37857	N	0.001912	T	0.62768	0.2455	M	0.81802	2.56	0.58432	D	0.999998	B;B;B	0.33549	0.051;0.106;0.417	B;B;B	0.39935	0.067;0.062;0.314	T	0.60286	-0.7293	10	0.30078	T	0.28	-37.1896	19.0122	0.92877	0.0:0.0:1.0:0.0	.	465;521;521	Q9Y2H6-2;G5E9X3;Q9Y2H6	.;.;FND3A_HUMAN	Q	521;457;521;465	ENSP00000417257:E521Q;ENSP00000441831:E521Q;ENSP00000381362:E465Q	ENSP00000338579:E457Q	E	+	1	0	FNDC3A	48650735	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	9.195000	0.94971	2.718000	0.92993	0.655000	0.94253	GAA		0.323	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923		30	77	0	0	0	0.012213	0	30	77				
NALCN	259232	broad.mit.edu	37	13	101910917	101910917	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:101910917C>A	ENST00000251127.6	-	11	1224	c.1143G>T	c.(1141-1143)atG>atT	p.M381I	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.M381I	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	381					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.M381I(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CGGATGACCGCATCATTTTCT	0.463																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(1141-1143)ATG>ATT		voltage gated channel like 1							61.0	54.0	56.0					13																	101910917		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101910917C>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1143G>T	13.37:g.101910917C>A	ENSP00000251127:p.Met381Ile		Somatic				NALCN_uc001voy.2_Missense_Mutation_p.M96I|NALCN_uc001voz.2_Missense_Mutation_p.M381I|NALCN_uc001vpa.2_Missense_Mutation_p.M381I	p.M381I	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			11	1332	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		381			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.1143G>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.348688	0.61183	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98105	-4.31;-4.72	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.93061	0.7791	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.16802	0.011;0.019;0.011	B;B;B	0.14578	0.011;0.007;0.004	D	0.87835	0.2647	10	0.41790	T	0.15	.	19.4154	0.94694	0.0:1.0:0.0:0.0	.	381;381;381	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	I	381	ENSP00000251127:M381I;ENSP00000365367:M381I	ENSP00000251127:M381I	M	-	3	0	NALCN	100708918	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.350000	0.79385	2.884000	0.98904	0.655000	0.94253	ATG		0.463	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		4	47	1	0	0.00909568	0.009096	0.00964833	4	47				
GRK1	6011	broad.mit.edu	37	13	114322111	114322111	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr13:114322111G>A	ENST00000335678.6	+	1	642	c.410G>A	c.(409-411)gGg>gAg	p.G137E		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	137	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)	p.G137E(1)		ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			TTTAAGGAGGGGCCTGTGGAG	0.637																																							uc010tkf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(409-411)GGG>GAG		rhodopsin kinase precursor							35.0	36.0	36.0					13																	114322111		1904	4125	6029	SO:0001583	missense	6011				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity	g.chr13:114322111G>A			13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.410G>A	13.37:g.114322111G>A	ENSP00000334876:p.Gly137Glu		Somatic					p.G137E	NM_002929	NP_002920	WXS	Illumina HiSeq	Unspecified	Q15835	RK_HUMAN	all cancers(43;0.234)		1	518	+	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	137			RGS.|N-terminal.		Q53X14	Missense_Mutation	SNP	ENST00000335678.6	37	c.410G>A		.	.	.	.	.	.	.	.	.	.	G	0.245	-1.010455	0.02095	.	.	ENSG00000185974	ENST00000335678	T	0.01821	4.62	5.02	-1.04	0.10068	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.484319	0.23870	N	0.043750	T	0.00815	0.0027	.	.	.	0.19945	N	0.999942	B	0.06786	0.001	B	0.04013	0.001	T	0.47222	-0.9134	9	0.10377	T	0.69	-16.8848	2.5596	0.04769	0.1667:0.1132:0.4523:0.2678	.	137	Q15835	RK_HUMAN	E	137	ENSP00000334876:G137E	ENSP00000334876:G137E	G	+	2	0	GRK1	113370112	0.705000	0.27846	0.001000	0.08648	0.028000	0.11728	1.204000	0.32296	-0.147000	0.11254	0.561000	0.74099	GGG		0.637	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929		4	11	0	0	0	0.009096	0	4	11				
RNASE10	338879	broad.mit.edu	37	14	20978765	20978765	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:20978765G>T	ENST00000328444.5	+	1	154	c.135G>T	c.(133-135)tgG>tgT	p.W45C	RNASE10_ENST00000430083.1_Missense_Mutation_p.W73C	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	45					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.W45C(1)		endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		ATGAATTTTGGTCCAGTGACT	0.552																																							uc010tlj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(133-135)TGG>TGT		ribonuclease, RNase A family, 10 (non-active)							131.0	132.0	131.0					14																	20978765		2203	4300	6503	SO:0001583	missense	338879					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:20978765G>T		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.135G>T	14.37:g.20978765G>T	ENSP00000333358:p.Trp45Cys		Somatic				RNASE10_uc001vxp.2_Missense_Mutation_p.W73C	p.W45C	NM_001012975	NP_001012993	WXS	Illumina HiSeq	Unspecified	Q5GAN6	RNS10_HUMAN	Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)	1	135	+	all_cancers(95;0.00123)		45					A2RUQ3|B4DKY4	Missense_Mutation	SNP	ENST00000328444.5	37	c.135G>T	CCDS32035.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044743	0.55110	.	.	ENSG00000182545	ENST00000430083;ENST00000328444	T;T	0.26660	1.72;1.8	4.29	3.38	0.38709	.	0.170607	0.28766	N	0.014201	T	0.18800	0.0451	L	0.29908	0.895	0.46376	D	0.999019	B;B	0.25007	0.044;0.116	B;B	0.23852	0.029;0.049	T	0.07347	-1.0777	10	0.87932	D	0	-16.4856	10.2717	0.43487	0.0:0.2001:0.7999:0.0	.	45;73	Q5GAN6;B4DKY4	RNS10_HUMAN;.	C	73;45	ENSP00000392996:W73C;ENSP00000333358:W45C	ENSP00000333358:W45C	W	+	3	0	RNASE10	20048605	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.161000	0.58170	1.375000	0.46248	0.655000	0.94253	TGG		0.552	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411088.1	XM_292225		57	85	1	0	6.75472e-32	0.01441	8.49919e-32	57	85				
DACT1	51339	broad.mit.edu	37	14	59105173	59105173	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:59105173C>T	ENST00000335867.4	+	1	277	c.253C>T	c.(253-255)Cgc>Tgc	p.R85C	DACT1_ENST00000541264.2_5'Flank|DACT1_ENST00000555845.1_Intron|DACT1_ENST00000395153.3_Missense_Mutation_p.R85C|DACT1_ENST00000556859.1_Intron			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	85					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.R85C(1)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						cgctgcgccccgcgcTGGGGA	0.701																																							uc001xdw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|lung(2)|ovary(1)	5						c.(253-255)CGC>TGC		dapper 1 isoform 1							11.0	12.0	12.0					14																	59105173		1776	3972	5748	SO:0001583	missense	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59105173C>T	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.253C>T	14.37:g.59105173C>T	ENSP00000337439:p.Arg85Cys		Somatic				DACT1_uc010trv.1_Intron|DACT1_uc001xdx.2_Missense_Mutation_p.R85C|DACT1_uc010trw.1_5'Flank	p.R85C	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			1	417	+			85					A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	c.253C>T	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587412	0.46110	.	.	ENSG00000165617	ENST00000395153;ENST00000335867	T;T	0.44083	0.93;0.93	3.39	3.39	0.38822	.	0.327695	0.25807	N	0.028167	T	0.52403	0.1732	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.52351	-0.8587	10	0.49607	T	0.09	-11.3144	11.7675	0.51939	0.0:0.8206:0.1794:0.0	.	85;85	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	C	85	ENSP00000378582:R85C;ENSP00000337439:R85C	ENSP00000337439:R85C	R	+	1	0	DACT1	58174926	.	.	0.849000	0.33467	0.268000	0.26511	.	.	1.718000	0.51419	0.313000	0.20887	CGC		0.701	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		6	6	0	0	0	0.001984	0	6	6				
RGS6	9628	broad.mit.edu	37	14	72945014	72945014	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:72945014G>C	ENST00000553530.1	+	12	1038	c.831G>C	c.(829-831)ttG>ttC	p.L277F	RGS6_ENST00000343854.6_Missense_Mutation_p.L277F|RGS6_ENST00000554782.1_Missense_Mutation_p.L138F|RGS6_ENST00000402788.2_Missense_Mutation_p.L277F|RGS6_ENST00000406236.4_Missense_Mutation_p.L277F|RGS6_ENST00000553525.1_Missense_Mutation_p.L277F|RGS6_ENST00000555571.1_Missense_Mutation_p.L277F|RGS6_ENST00000434263.2_Missense_Mutation_p.L208F|RGS6_ENST00000407322.4_Missense_Mutation_p.L277F|RGS6_ENST00000355512.6_Missense_Mutation_p.L277F|RGS6_ENST00000404301.2_Missense_Mutation_p.L277F|RGS6_ENST00000556437.1_Missense_Mutation_p.L277F	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	277	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.L277F(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		GACATTGTTTGAAAATGTCCA	0.338																																					Ovarian(143;1926 2468 21071 48641)	Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(829-831)TTG>TTC		regulator of G-protein signalling 6							122.0	119.0	120.0					14																	72945014		2203	4299	6502	SO:0001583	missense	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72945014G>C	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.831G>C	14.37:g.72945014G>C	ENSP00000452331:p.Leu277Phe		Somatic				RGS6_uc010ttn.1_Missense_Mutation_p.L277F|RGS6_uc001xmx.3_Missense_Mutation_p.L277F|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.L277F|RGS6_uc010ttp.1_Missense_Mutation_p.L208F|RGS6_uc001xmz.1_Missense_Mutation_p.L138F	p.L277F	NM_004296	NP_004287	WXS	Illumina HiSeq	Unspecified	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	12	1354	+			277			G protein gamma.		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	c.831G>C	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932149	0.73442	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.32515	1.79;1.79;1.79;1.79;1.79;1.79;1.79;1.79;1.79;1.45;1.79;1.79	5.56	2.37	0.29283	G-protein gamma domain (4);	0.053772	0.85682	D	0.000000	T	0.46560	0.1399	M	0.77103	2.36	0.47214	D	0.999359	D;P;D;P	0.76494	0.999;0.83;0.992;0.919	D;P;D;P	0.76071	0.987;0.586;0.939;0.783	T	0.49234	-0.8961	10	0.14252	T	0.57	-1.299	6.1908	0.20524	0.5648:0.0:0.4352:0.0	.	208;277;282;277	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	F	277;277;277;277;277;277;277;277;277;277;249;208;138;138	ENSP00000451030:L277F;ENSP00000450936:L277F;ENSP00000452331:L277F;ENSP00000451855:L277F;ENSP00000347699:L277F;ENSP00000385243:L277F;ENSP00000384218:L277F;ENSP00000384612:L277F;ENSP00000383953:L277F;ENSP00000341199:L277F;ENSP00000412144:L208F;ENSP00000451912:L138F	ENSP00000341199:L277F	L	+	3	2	RGS6	72014767	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.226000	0.58606	0.560000	0.29169	0.561000	0.74099	TTG		0.338	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			6	34	0	0	0	0.021553	0	6	34				
DNAL1	83544	broad.mit.edu	37	14	74154042	74154042	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:74154042G>A	ENST00000553645.2	+	6	386	c.345G>A	c.(343-345)aaG>aaA	p.K115K	DNAL1_ENST00000540526.1_Silent_p.K76K|DNAL1_ENST00000554339.1_Silent_p.K28K|DNAL1_ENST00000554871.1_Silent_p.K76K|DNAL1_ENST00000311089.3_Silent_p.K2K	NM_031427.3	NP_113615.2	Q4LDG9	DNAL1_HUMAN	dynein, axonemal, light chain 1	115								p.K115K(2)		kidney(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		ACATAATGAAGAAATTGAAGA	0.388																																							uc001xoq.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(343-345)AAG>AAA		axonemal dynein light chain 1							76.0	74.0	75.0					14																	74154042		1845	4097	5942	SO:0001819	synonymous_variant	83544							g.chr14:74154042G>A	BC005343	CCDS45134.1, CCDS55928.1	14q24.3	2012-05-03	2006-09-04	2006-09-04	ENSG00000119661	ENSG00000119661			23247	protein-coding gene	gene with protein product		610062	"""chromosome 14 open reading frame 168"""	C14orf168		15845866	Standard	NM_031427		Approved	MGC12435, 1700010H15RiK, CILD16	uc001xoq.4	Q4LDG9		ENST00000553645.2:c.345G>A	14.37:g.74154042G>A			Somatic				DNAL1_uc010aru.2_Silent_p.K76K|DNAL1_uc010arv.2_RNA	p.K115K	NM_031427	NP_113615	WXS	Illumina HiSeq	Unspecified	Q4LDG9	DNAL1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)	6	510	+			115			LRR 3.		B2RD38|Q5JPB7|Q9BS43	Silent	SNP	ENST00000553645.2	37	c.345G>A	CCDS45134.1																																																																																				0.388	DNAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414565.2	NM_031427		17	35	0	0	0	0.028581	0	17	35				
NRXN3	9369	broad.mit.edu	37	14	79175708	79175708	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:79175708A>C	ENST00000554719.1	+	4	742	c.251A>C	c.(250-252)tAc>tCc	p.Y84S	NRXN3_ENST00000335750.5_Missense_Mutation_p.Y84S|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.Y84S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCAGAGGCTTACATCAGCTTG	0.502																																							uc001xun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(250-252)TAC>TCC		neurexin 3 isoform 1 precursor							126.0	112.0	117.0					14																	79175708		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79175708A>C	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.251A>C	14.37:g.79175708A>C	ENSP00000451648:p.Tyr84Ser		Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.Y218S	p.Y84S	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	4	742	+		Renal(4;0.00876)	457			Extracellular (Potential).|Laminin G-like 3.		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	c.251A>C	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.280937	0.59758	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000553631;ENST00000554719;ENST00000335750;ENST00000557081	T;D;D;T	0.81739	-1.29;-1.53;-1.53;-1.29	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.138825	0.50627	D	0.000118	D	0.87822	0.6274	M	0.75150	2.29	0.50467	D	0.999877	D;D	0.60160	0.978;0.987	P;P	0.61275	0.719;0.886	D	0.88167	0.2861	9	.	.	.	.	15.3852	0.74691	1.0:0.0:0.0:0.0	.	457;84	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	S	457;455;28;84;84;28	ENSP00000451947:Y28S;ENSP00000451648:Y84S;ENSP00000338349:Y84S;ENSP00000450462:Y28S	.	Y	+	2	0	NRXN3	78245461	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.009000	0.63998	2.037000	0.60232	0.460000	0.39030	TAC		0.502	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		3	71	0	0	0	0.004672	0	3	71				
BAG5	9529	broad.mit.edu	37	14	104026973	104026973	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:104026973C>T	ENST00000445922.2	-	2	775	c.529G>A	c.(529-531)Gag>Aag	p.E177K	RP11-73M18.2_ENST00000472726.2_5'Flank|RP11-894P9.2_ENST00000556332.1_RNA|BAG5_ENST00000337322.4_Missense_Mutation_p.E218K|APOPT1_ENST00000556253.2_5'Flank|APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.E177K	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	177					negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.E177K(1)|p.E177*(1)		endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TGTGCATCCTCGGAAAGCGGC	0.493																																					NSCLC(171;1832 2055 18950 31566 41632)	NSCLC(171;1832 2055 18950 31566 41632)	uc001yni.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(2)	2						c.(529-531)GAG>AAG		BCL2-associated athanogene 5 isoform b							111.0	109.0	109.0					14																	104026973		2203	4300	6503	SO:0001583	missense	9529				apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding	g.chr14:104026973C>T	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.529G>A	14.37:g.104026973C>T	ENSP00000391713:p.Glu177Lys		Somatic				KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Missense_Mutation_p.E218K|BAG5_uc001ynj.1_Missense_Mutation_p.E177K|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	p.E177K	NM_004873	NP_004864	WXS	Illumina HiSeq	Unspecified	Q9UL15	BAG5_HUMAN	Epithelial(46;0.144)		2	763	-		Melanoma(154;0.155)	177					O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	37	c.529G>A	CCDS9982.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150322	0.37923	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322;ENST00000557666	T;T;T;T	0.81247	-1.41;-1.41;-1.43;-1.47	5.55	3.74	0.42951	.	0.327155	0.32430	N	0.006115	T	0.66548	0.2800	N	0.19112	0.55	0.31037	N	0.716718	B;B	0.24132	0.013;0.098	B;B	0.17722	0.002;0.019	T	0.65245	-0.6215	10	0.56958	D	0.05	-36.3634	10.2859	0.43566	0.0:0.7708:0.0:0.2292	.	177;218	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	K	177;177;218;177	ENSP00000299204:E177K;ENSP00000391713:E177K;ENSP00000338814:E218K;ENSP00000450497:E177K	ENSP00000299204:E177K	E	-	1	0	BAG5	103096726	0.927000	0.31430	0.174000	0.22961	0.589000	0.36550	3.230000	0.51286	0.721000	0.32231	0.655000	0.94253	GAG		0.493	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1			22	84	0	0	0	0.014323	0	22	84				
GJD2	57369	broad.mit.edu	37	15	35044898	35044898	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:35044898C>G	ENST00000290374.4	-	2	1223	c.747G>C	c.(745-747)gaG>gaC	p.E249D	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	249					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)	p.E249D(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		AGACAGTCTTCTCAGTTGGCC	0.493																																							uc001zis.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(745-747)GAG>GAC		gap junction protein, delta 2, 36kDa							144.0	113.0	123.0					15																	35044898		2201	4298	6499	SO:0001583	missense	57369				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity	g.chr15:35044898C>G	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.747G>C	15.37:g.35044898C>G	ENSP00000290374:p.Glu249Asp		Somatic				uc001zit.1_5'Flank	p.E249D	NM_020660	NP_065711	WXS	Illumina HiSeq	Unspecified	Q9UKL4	CXD2_HUMAN		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)	2	747	-		all_lung(180;9.67e-07)	249			Extracellular (Potential).		Q2M241|Q9P2R0	Missense_Mutation	SNP	ENST00000290374.4	37	c.747G>C	CCDS10040.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542986	0.65198	.	.	ENSG00000159248	ENST00000290374	D	0.99186	-5.53	5.86	4.91	0.64330	Gap junction protein, cysteine-rich domain (1);	0.000000	0.64402	D	0.000001	D	0.99513	0.9826	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98134	1.0432	10	0.87932	D	0	.	13.0196	0.58779	0.0:0.9185:0.0:0.0815	.	249	Q9UKL4	CXD2_HUMAN	D	249	ENSP00000290374:E249D	ENSP00000290374:E249D	E	-	3	2	GJD2	32832190	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.236000	0.43052	1.390000	0.46547	0.650000	0.86243	GAG		0.493	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251875.2			21	51	0	0	0	0.008871	0	21	51				
PLA2G4D	283748	broad.mit.edu	37	15	42378515	42378515	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:42378515C>T	ENST00000290472.3	-	4	377	c.283G>A	c.(283-285)Gag>Aag	p.E95K		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	95	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.E95K(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		ACTGAGTCCTCATCATAGATG	0.493																																							uc001zox.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(283-285)GAG>AAG		phospholipase A2, group IVD							118.0	101.0	107.0					15																	42378515		2203	4299	6502	SO:0001583	missense	283748				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity	g.chr15:42378515C>T	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.283G>A	15.37:g.42378515C>T	ENSP00000290472:p.Glu95Lys		Somatic					p.E95K	NM_178034	NP_828848	WXS	Illumina HiSeq	Unspecified	Q86XP0	PA24D_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)	4	378	-		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)	95			C2.		Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	c.283G>A	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721317	0.68959	.	.	ENSG00000159337	ENST00000290472	T	0.69306	-0.39	4.73	3.8	0.43715	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.078695	0.47455	D	0.000227	T	0.55737	0.1939	L	0.32530	0.975	0.39441	D	0.967248	B	0.25719	0.132	B	0.29663	0.105	T	0.55749	-0.8092	10	0.40728	T	0.16	-13.23	12.0872	0.53704	0.0:0.9148:0.0:0.0852	.	95	Q86XP0	PA24D_HUMAN	K	95	ENSP00000290472:E95K	ENSP00000290472:E95K	E	-	1	0	PLA2G4D	40165807	0.737000	0.28175	0.917000	0.36280	0.620000	0.37586	0.856000	0.27818	1.205000	0.43262	0.655000	0.94253	GAG		0.493	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034		8	114	0	0	0	0.004482	0	8	114				
C15orf43	145645	broad.mit.edu	37	15	45270711	45270711	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:45270711A>G	ENST00000340827.3	+	7	565	c.548A>G	c.(547-549)aAg>aGg	p.K183R		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	183								p.K183R(1)		NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GATGCCATGAAGAAATTCCTT	0.294																																							uc001zuk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(547-549)AAG>AGG		hypothetical protein LOC145645							51.0	53.0	52.0					15																	45270711		2196	4288	6484	SO:0001583	missense	145645							g.chr15:45270711A>G	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.548A>G	15.37:g.45270711A>G	ENSP00000340644:p.Lys183Arg		Somatic					p.K183R	NM_152448	NP_689661	WXS	Illumina HiSeq	Unspecified	Q8NHR7	CO043_HUMAN		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)	7	565	+		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)	183						Missense_Mutation	SNP	ENST00000340827.3	37	c.548A>G	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	A	8.913	0.959178	0.18507	.	.	ENSG00000167014	ENST00000340827	T	0.42900	0.96	4.05	4.05	0.47172	.	0.174732	0.35870	N	0.002933	T	0.21962	0.0529	N	0.14661	0.345	0.23180	N	0.99816	P	0.37330	0.59	B	0.35353	0.201	T	0.11743	-1.0575	10	0.13853	T	0.58	.	9.7089	0.40233	1.0:0.0:0.0:0.0	.	183	Q8NHR7	CO043_HUMAN	R	183	ENSP00000340644:K183R	ENSP00000340644:K183R	K	+	2	0	C15orf43	43058003	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	2.987000	0.49378	1.611000	0.50210	0.248000	0.18094	AAG		0.294	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448		24	78	0	0	0	0.024334	0	24	78				
MYEF2	50804	broad.mit.edu	37	15	48446077	48446078	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:48446077_48446078GC>AA	ENST00000324324.7	-	10	1277_1278	c.998_999GC>TT	c.(997-999)gGC>gTT	p.G333V	MYEF2_ENST00000267836.6_Missense_Mutation_p.G333V	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	333	Gly-rich.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G333V(1)		endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CCATCCCAATGCCTCCAAGACC	0.386																																							uc001zwi.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(997-999)GGC>GTT		myelin expression factor 2																																				SO:0001583	missense	50804				transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding	g.chr15:48446077_48446078GC>AA	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.998_999delinsAA	15.37:g.48446077_48446078delinsAA	ENSP00000316950:p.Gly333Val		Somatic				MYEF2_uc001zwh.3_5'Flank|MYEF2_uc001zwj.3_Missense_Mutation_p.G333V|MYEF2_uc001zwl.2_Missense_Mutation_p.G173V	p.G333V	NM_016132	NP_057216	WXS	Illumina HiSeq	Unspecified	Q9P2K5	MYEF2_HUMAN		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)	10	1122_1123	-		all_lung(180;0.00217)	333			Gly-rich.		A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	DNP	ENST00000324324.7	37	c.998_999GC>TT	CCDS32230.1																																																																																				0.386	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132		4	23	0	0	0	0.004672	0	4	23				
ACAN	176	broad.mit.edu	37	15	89399981	89399981	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:89399981G>C	ENST00000561243.1	+	11	4165	c.4165G>C	c.(4165-4167)Gag>Cag	p.E1389Q	ACAN_ENST00000439576.2_Missense_Mutation_p.E1389Q|ACAN_ENST00000559004.1_Missense_Mutation_p.E1389Q|ACAN_ENST00000352105.7_Missense_Mutation_p.E1389Q			P16112	PGCA_HUMAN	aggrecan	1389	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.E1275Q(2)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCCTGGAGTAGAGGACATCAG	0.542																																							uc010upo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(4165-4167)GAG>CAG		aggrecan isoform 2 precursor							29.0	25.0	26.0					15																	89399981		1649	3352	5001	SO:0001583	missense	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89399981G>C	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4165G>C	15.37:g.89399981G>C	ENSP00000453342:p.Glu1389Gln		Somatic				ACAN_uc010upp.1_Missense_Mutation_p.E1389Q|ACAN_uc002bna.2_RNA	p.E1389Q	NM_013227	NP_037359	WXS	Illumina HiSeq	Unspecified	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		12	4539	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		1389					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	c.4165G>C	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	-	8.659	0.900000	0.17686	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.96265	-3.96;-3.96	3.52	-1.25	0.09405	.	.	.	.	.	D	0.96383	0.8820	M	0.80982	2.52	0.09310	N	1	D;D	0.63046	0.992;0.992	P;P	0.62885	0.908;0.908	D	0.89099	0.3488	9	0.13853	T	0.58	.	4.4096	0.11427	0.0942:0.4082:0.3593:0.1383	.	1389;1389	E7ENV9;E7EX88	.;.	Q	1389;1389;1275	ENSP00000387356:E1389Q;ENSP00000341615:E1389Q	ENSP00000268134:E1275Q	E	+	1	0	ACAN	87200985	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.036000	0.12185	-0.072000	0.12864	0.491000	0.48974	GAG		0.542	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		6	222	0	0	0	0.016723	0	6	222				
POLG	5428	broad.mit.edu	37	15	89862318	89862318	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:89862318C>G	ENST00000268124.5	-	20	3450	c.3117G>C	c.(3115-3117)aaG>aaC	p.K1039N	POLG_ENST00000442287.2_Missense_Mutation_p.K1039N	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	1039					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.K1039N(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CCTCCCACTTCTTCCACTGTG	0.502								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	Colon(73;648 1203 11348 18386 27782)	uc002bns.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(3115-3117)AAG>AAC	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase gamma							113.0	103.0	106.0					15																	89862318		2200	4299	6499	SO:0001583	missense	5428				base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding	g.chr15:89862318C>G	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.3117G>C	15.37:g.89862318C>G	ENSP00000268124:p.Lys1039Asn		Somatic				POLG_uc002bnr.3_Missense_Mutation_p.K1039N	p.K1039N	NM_002693	NP_002684	WXS	Illumina HiSeq	Unspecified	P54098	DPOG1_HUMAN	STAD - Stomach adenocarcinoma(125;0.165)		20	3399	-	Lung NSC(78;0.0472)|all_lung(78;0.089)		1039					Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	c.3117G>C	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605774	0.46527	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.98381	-4.9;-4.9	5.12	3.19	0.36642	DNA-directed DNA polymerase, family A, palm domain (2);	0.044204	0.85682	D	0.000000	D	0.96999	0.9020	L	0.56199	1.76	0.52501	D	0.999955	P	0.38582	0.638	P	0.47015	0.534	D	0.95357	0.8452	10	0.36615	T	0.2	-37.1797	9.1841	0.37160	0.0:0.7747:0.0:0.2253	.	1039	P54098	DPOG1_HUMAN	N	1039	ENSP00000268124:K1039N;ENSP00000399851:K1039N	ENSP00000268124:K1039N	K	-	3	2	POLG	87663322	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	0.966000	0.29331	1.388000	0.46506	0.561000	0.74099	AAG		0.502	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693		27	70	0	0	0	0.007291	0	27	70				
MCTP2	55784	broad.mit.edu	37	15	94858848	94858848	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:94858848G>T	ENST00000357742.4	+	3	619	c.619G>T	c.(619-621)Gtt>Ttt	p.V207F	MCTP2_ENST00000543482.1_Missense_Mutation_p.V207F|MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000451018.3_Missense_Mutation_p.V207F	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	207	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.V207F(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CCGGAACCTGGTTGTCCGAGA	0.527																																							uc002btj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(619-621)GTT>TTT		multiple C2 domains, transmembrane 2 isoform 1							162.0	137.0	145.0					15																	94858848		2197	4298	6495	SO:0001583	missense	55784				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding	g.chr15:94858848G>T	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.619G>T	15.37:g.94858848G>T	ENSP00000350377:p.Val207Phe		Somatic				MCTP2_uc010urg.1_Missense_Mutation_p.V207F|MCTP2_uc002bti.2_Missense_Mutation_p.V207F|MCTP2_uc010boj.2_5'UTR|MCTP2_uc010bok.2_Missense_Mutation_p.V207F|MCTP2_uc002btg.3_Missense_Mutation_p.V207F|MCTP2_uc002bth.3_Missense_Mutation_p.V207F	p.V207F	NM_018349	NP_060819	WXS	Illumina HiSeq	Unspecified	Q6DN12	MCTP2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)		3	684	+	Lung NSC(78;0.0821)|all_lung(78;0.148)		207			C2 1.		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	c.619G>T	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789100	0.70337	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.69306	-0.39;-0.39;-0.39	6.07	6.07	0.98685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83064	0.5173	M	0.80028	2.48	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.964;0.998;0.998;0.999	D	0.83396	0.0020	10	0.56958	D	0.05	.	17.5607	0.87906	0.0:0.0:1.0:0.0	.	207;207;207;207;207	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	F	207	ENSP00000438521:V207F;ENSP00000395109:V207F;ENSP00000350377:V207F	ENSP00000350377:V207F	V	+	1	0	MCTP2	92659852	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	5.513000	0.67037	2.884000	0.98904	0.655000	0.94253	GTT		0.527	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349		14	32	1	0	6.31663e-08	0.024245	6.98329e-08	14	32				
LRRK1	79705	broad.mit.edu	37	15	101593183	101593183	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr15:101593183G>A	ENST00000388948.3	+	25	4105	c.3746G>A	c.(3745-3747)gGc>gAc	p.G1249D	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Missense_Mutation_p.G1246D	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.G1249D(1)|p.G1261D(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGCGTCCTGGGCCAGGGCGGC	0.632																																							uc002bwr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(3745-3747)GGC>GAC		leucine-rich repeat kinase 1							34.0	45.0	41.0					15																	101593183		2176	4284	6460	SO:0001583	missense	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101593183G>A	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3746G>A	15.37:g.101593183G>A	ENSP00000373600:p.Gly1249Asp		Somatic				LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_5'Flank	p.G1249D	NM_024652	NP_078928	WXS	Illumina HiSeq	Unspecified	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		25	4065	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		1249			ATP (By similarity).|Protein kinase.			Missense_Mutation	SNP	ENST00000388948.3	37	c.3746G>A	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	31	5.061888	0.93846	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	D;D	0.82893	-1.66;-1.66	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93436	0.7906	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94807	0.7975	10	0.87932	D	0	.	18.911	0.92485	0.0:0.0:1.0:0.0	.	1249	Q38SD2	LRRK1_HUMAN	D	1249;1246	ENSP00000373600:G1249D;ENSP00000284395:G1246D	ENSP00000284395:G1246D	G	+	2	0	LRRK1	99410706	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.583000	0.98217	2.526000	0.85167	0.650000	0.86243	GGC		0.632	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		25	44	0	0	0	0.00632	0	25	44				
TELO2	9894	broad.mit.edu	37	16	1555456	1555456	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:1555456G>T	ENST00000262319.6	+	16	2167	c.1888G>T	c.(1888-1890)Ggg>Tgg	p.G630W	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	630					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)	p.G630W(1)		NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				TGGGTGCCTCGGGAGGACTCC	0.677																																							uc002cly.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1888-1890)GGG>TGG		TEL2, telomere maintenance 2, homolog							40.0	45.0	43.0					16																	1555456		2199	4298	6497	SO:0001583	missense	9894					chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding	g.chr16:1555456G>T	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1888G>T	16.37:g.1555456G>T	ENSP00000262319:p.Gly630Trp		Somatic					p.G630W	NM_016111	NP_057195	WXS	Illumina HiSeq	Unspecified	Q9Y4R8	TELO2_HUMAN			16	2179	+		Hepatocellular(780;0.219)	630					D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	c.1888G>T	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762577	0.49574	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	T	0.15017	2.46	5.23	-7.54	0.01332	.	1.434800	0.03816	N	0.266743	T	0.18635	0.0447	L	0.51422	1.61	0.09310	N	1	D	0.58620	0.983	P	0.46659	0.523	T	0.45101	-0.9284	10	0.66056	D	0.02	-4.6555	8.8018	0.34914	0.3538:0.4385:0.2077:0.0	.	630	Q9Y4R8	TELO2_HUMAN	W	153;630	ENSP00000262319:G630W	ENSP00000262319:G630W	G	+	1	0	TELO2	1495457	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.411000	0.07142	-1.972000	0.01001	-0.693000	0.03709	GGG		0.677	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111		23	19	1	0	7.41877e-09	0.012319	8.31141e-09	23	19				
CIITA	4261	broad.mit.edu	37	16	10996625	10996625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:10996625G>T	ENST00000324288.8	+	8	872	c.739G>T	c.(739-741)Gga>Tga	p.G247*	CIITA_ENST00000381835.5_Nonsense_Mutation_p.G198*|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	247					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.G247*(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CTCTGAGGCTGGAACAGGGGT	0.592			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																		uc002dai.3		NA		Dom	yes		16	16p13	4261	T	"""class II, major histocompatibility complex, transactivator"""			L	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75		PMBL|Hodgkin Lymphona|		1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(739-741)GGA>TGA		class II transactivator							100.0	95.0	97.0					16																	10996625		2197	4300	6497	SO:0001587	stop_gained	4261				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding	g.chr16:10996625G>T	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.739G>T	16.37:g.10996625G>T	ENSP00000316328:p.Gly247*		Somatic				CIITA_uc002daj.3_Nonsense_Mutation_p.G248*|CIITA_uc002dak.3_Nonsense_Mutation_p.G198*|CIITA_uc002dag.2_Nonsense_Mutation_p.G247*|CIITA_uc002dah.2_Nonsense_Mutation_p.G199*|CIITA_uc010bup.1_Nonsense_Mutation_p.G247*	p.G247*	NM_000246	NP_000237	WXS	Illumina HiSeq	Unspecified	P33076	C2TA_HUMAN			8	872	+			247					A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Nonsense_Mutation	SNP	ENST00000324288.8	37	c.739G>T	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.839872	0.51057	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	.	.	.	4.86	4.86	0.63082	.	0.000000	0.43110	D	0.000618	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.5057	0.61483	0.0:0.0:1.0:0.0	.	.	.	.	X	247;198;199;247	.	ENSP00000316328:G247X	G	+	1	0	CIITA	10904126	0.788000	0.28762	0.188000	0.23233	0.018000	0.09664	4.072000	0.57563	2.238000	0.73509	0.563000	0.77884	GGA		0.592	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246		26	45	1	0	1.85244e-09	0.01892	2.08089e-09	26	45				
PRKCB	5579	broad.mit.edu	37	16	23847514	23847514	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:23847514G>T	ENST00000321728.7	+	1	193	c.18G>T	c.(16-18)gcG>gcT	p.A6A	PRKCB_ENST00000303531.7_Silent_p.A6A|PRKCB_ENST00000498058.1_Silent_p.A6A	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	6					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.A6A(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ACCCGGCTGCGGGGCCGCCGC	0.751																																							uc002dmd.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9						c.(16-18)GCG>GCT		protein kinase C, beta isoform 1	Vitamin E(DB00163)						19.0	19.0	19.0					16																	23847514		2189	4290	6479	SO:0001819	synonymous_variant	5579				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding	g.chr16:23847514G>T	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.18G>T	16.37:g.23847514G>T			Somatic				PRKCB_uc002dme.2_Silent_p.A6A	p.A6A	NM_212535	NP_997700	WXS	Illumina HiSeq	Unspecified	P05771	KPCB_HUMAN			1	215	+			6					C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	ENST00000321728.7	37	c.18G>T	CCDS10618.1																																																																																				0.751	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535		5	15	1	0	5.9392e-07	0.021553	6.51446e-07	5	15				
RBBP6	5930	broad.mit.edu	37	16	24582309	24582309	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:24582309G>T	ENST00000319715.4	+	18	4354	c.3922G>T	c.(3922-3924)Gaa>Taa	p.E1308*	RBBP6_ENST00000381039.3_Nonsense_Mutation_p.E468*|RBBP6_ENST00000348022.2_Nonsense_Mutation_p.E1274*	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1308					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1308*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CGCGCCAGCTGAAGATGTTAT	0.378																																							uc002dmh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(3922-3924)GAA>TAA		retinoblastoma-binding protein 6 isoform 1							57.0	54.0	55.0					16																	24582309		2197	4300	6497	SO:0001587	stop_gained	5930				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:24582309G>T		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3922G>T	16.37:g.24582309G>T	ENSP00000317872:p.Glu1308*		Somatic				RBBP6_uc002dmi.2_Nonsense_Mutation_p.E1274*|RBBP6_uc010bxr.2_Nonsense_Mutation_p.E468*|RBBP6_uc002dmk.2_Nonsense_Mutation_p.E1141*	p.E1308*	NM_006910	NP_008841	WXS	Illumina HiSeq	Unspecified	Q7Z6E9	RBBP6_HUMAN		GBM - Glioblastoma multiforme(48;0.0518)	18	4962	+			1308					Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Nonsense_Mutation	SNP	ENST00000319715.4	37	c.3922G>T	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386731	0.82902	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-26.6648	19.5349	0.95247	0.0:0.0:1.0:0.0	.	.	.	.	X	468;1308;1274	.	ENSP00000317872:E1308X	E	+	1	0	RBBP6	24489810	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	7.519000	0.81809	2.687000	0.91594	0.563000	0.77884	GAA		0.378	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910		7	47	1	0	0.00198382	0.001984	0.00211506	7	47				
ABCC11	85320	broad.mit.edu	37	16	48201504	48201504	+	Missense_Mutation	SNP	A	A	T	rs387906296	byFrequency	TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:48201504A>T	ENST00000394747.1	-	28	4308	c.3959T>A	c.(3958-3960)aTc>aAc	p.I1320N	ABCC11_ENST00000353782.5_Missense_Mutation_p.I1282N|ABCC11_ENST00000565329.1_5'UTR|RP11-3M1.1_ENST00000563906.1_RNA|ABCC11_ENST00000394748.1_Missense_Mutation_p.I1320N|ABCC11_ENST00000356608.2_Missense_Mutation_p.I1320N	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1320	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.I1320N(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GGCTTCACGGATTGTGCGCTG	0.532																																							uc002eff.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3958-3960)ATC>AAC		ATP-binding cassette, sub-family C, member 11							179.0	155.0	163.0					16																	48201504		2201	4300	6501	SO:0001583	missense	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48201504A>T	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3959T>A	16.37:g.48201504A>T	ENSP00000378230:p.Ile1320Asn		Somatic				ABCC11_uc002efg.1_Missense_Mutation_p.I1320N|ABCC11_uc002efh.1_Missense_Mutation_p.I1282N|ABCC11_uc010cbg.1_RNA	p.I1320N	NM_033151	NP_149163	WXS	Illumina HiSeq	Unspecified	Q96J66	ABCCB_HUMAN			28	4309	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	1320			ABC transporter 2.|Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	c.3959T>A	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.810540	0.70797	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.27	4.18	0.49190	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.270733	0.34828	N	0.003653	D	0.90174	0.6929	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	0.977;1.0	P;D	0.75484	0.847;0.986	D	0.90473	0.4454	10	0.87932	D	0	-10.034	9.4398	0.38661	0.9153:0.0:0.0847:0.0	.	1282;1320	Q96J66-2;Q96J66	.;ABCCB_HUMAN	N	1282;1320;1320;1320	ENSP00000311326:I1282N;ENSP00000349017:I1320N;ENSP00000378231:I1320N;ENSP00000378230:I1320N	ENSP00000311326:I1282N	I	-	2	0	ABCC11	46759005	1.000000	0.71417	0.012000	0.15200	0.803000	0.45373	6.938000	0.75904	0.849000	0.35215	0.523000	0.50628	ATC		0.532	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		46	98	0	0	0	0.01441	0	46	98				
SALL1	6299	broad.mit.edu	37	16	51174300	51174300	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:51174300T>G	ENST00000251020.4	-	2	1866	c.1833A>C	c.(1831-1833)gaA>gaC	p.E611D	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.E514D|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	611					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E611D(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ACCCTTCGGCTTCCTCTGGGA	0.622																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(1831-1833)GAA>GAC		sal-like 1 isoform a							28.0	31.0	30.0					16																	51174300		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174300T>G	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1833A>C	16.37:g.51174300T>G	ENSP00000251020:p.Glu611Asp		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.E514D|SALL1_uc010cbv.2_Intron	p.E611D	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1864	-		all_cancers(37;0.0322)	611					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.1833A>C	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.178452	0.38511	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06528	3.29;3.3	5.22	1.72	0.24424	.	0.046892	0.85682	D	0.000000	T	0.08714	0.0216	L	0.57536	1.79	0.58432	D	0.999995	P	0.50443	0.935	P	0.45753	0.492	T	0.11817	-1.0572	10	0.54805	T	0.06	.	7.2122	0.25939	0.0:0.531:0.0:0.469	.	611	Q9NSC2	SALL1_HUMAN	D	611;514;575	ENSP00000251020:E611D;ENSP00000407914:E514D	ENSP00000251020:E611D	E	-	3	2	SALL1	49731801	0.999000	0.42202	0.970000	0.41538	0.950000	0.60333	0.660000	0.25009	0.302000	0.22762	-0.379000	0.06801	GAA		0.622	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		4	41	0	0	0	0.014758	0	4	41				
DRC7	84229	broad.mit.edu	37	16	57765098	57765098	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:57765098G>T	ENST00000360716.3	+	19	2774	c.2553G>T	c.(2551-2553)ctG>ctT	p.L851L	CCDC135_ENST00000336825.8_Silent_p.L786L|CCDC135_ENST00000394337.4_Silent_p.L851L			Q8IY82	CC135_HUMAN		851					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)		p.L851L(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						TGGCCCCACTGAAGTACCTGG	0.572																																							uc002emi.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(2551-2553)CTG>CTT		coiled-coil domain containing 135							87.0	91.0	90.0					16																	57765098		2198	4300	6498	SO:0001819	synonymous_variant	84229					cytoplasm		g.chr16:57765098G>T																												ENST00000360716.3:c.2553G>T	16.37:g.57765098G>T			Somatic				CCDC135_uc002emj.2_Silent_p.L851L|CCDC135_uc002emk.2_Silent_p.L786L	p.L851L	NM_032269	NP_115645	WXS	Illumina HiSeq	Unspecified	Q8IY82	CC135_HUMAN			18	2642	+			851					A8K943|Q8NAA0|Q9H080	Silent	SNP	ENST00000360716.3	37	c.2553G>T	CCDS10787.1																																																																																				0.572	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2			24	46	1	0	1.38267e-23	0.027356	1.69894e-23	24	46				
CDH8	1006	broad.mit.edu	37	16	61859003	61859003	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:61859003C>A	ENST00000577390.1	-	5	1702	c.748G>T	c.(748-750)Ggt>Tgt	p.G250C	CDH8_ENST00000584337.1_Missense_Mutation_p.G250C|CDH8_ENST00000299345.6_Missense_Mutation_p.G250C|CDH8_ENST00000577730.1_Missense_Mutation_p.G250C	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	250	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.G250C(2)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GAGTGTCCACCCATATCTTTG	0.448																																							uc002eog.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(2)|breast(1)	9						c.(748-750)GGT>TGT		cadherin 8, type 2 preproprotein							135.0	120.0	125.0					16																	61859003		2203	4300	6503	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61859003C>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.748G>T	16.37:g.61859003C>A	ENSP00000462701:p.Gly250Cys		Somatic				CDH8_uc002eoh.2_Missense_Mutation_p.G19C	p.G250C	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	5	1000	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	250			Extracellular (Potential).|Cadherin 2.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.748G>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	32	5.172423	0.94807	.	.	ENSG00000150394	ENST00000299345	T	0.65916	-0.18	6.02	6.02	0.97574	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.82811	0.5118	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.83462	0.0054	10	0.62326	D	0.03	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	66;250	Q3LID3;P55286	.;CADH8_HUMAN	C	250	ENSP00000299345:G250C	ENSP00000299345:G250C	G	-	1	0	CDH8	60416504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.857000	0.98124	0.650000	0.86243	GGT		0.448	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		43	60	1	0	3.05275e-18	0.013114	3.67558e-18	43	60				
SMPD3	55512	broad.mit.edu	37	16	68405584	68405584	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:68405584G>T	ENST00000219334.5	-	3	1104	c.501C>A	c.(499-501)atC>atA	p.I167I	SMPD3_ENST00000563226.1_Silent_p.I167I|SMPD3_ENST00000568373.1_Silent_p.I167I|SMPD3_ENST00000566009.1_5'Flank	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	167					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.I167I(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	TGTAAATTTTGATCTGGGGCC	0.632																																							uc002ewa.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(499-501)ATC>ATA		neutral sphingomyelin phosphodiesterase 3	Phosphatidylserine(DB00144)						33.0	40.0	37.0					16																	68405584		2198	4300	6498	SO:0001819	synonymous_variant	55512				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity	g.chr16:68405584G>T	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.501C>A	16.37:g.68405584G>T			Somatic				SMPD3_uc010cfe.2_Silent_p.I167I|SMPD3_uc010vlh.1_Silent_p.I167I	p.I167I	NM_018667	NP_061137	WXS	Illumina HiSeq	Unspecified	Q9NY59	NSMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	3	923	-		Ovarian(137;0.0563)	167			Lumenal (Potential).		B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	c.501C>A	CCDS10867.1																																																																																				0.632	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667		4	51	1	0	0.00024832	0.009096	0.000266785	4	51				
ADAMTS18	170692	broad.mit.edu	37	16	77465343	77465343	+	Missense_Mutation	SNP	G	G	A	rs145596475		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:77465343G>A	ENST00000282849.5	-	3	762	c.344C>T	c.(343-345)tCg>tTg	p.S115L	RP11-449J10.1_ENST00000564358.1_RNA|ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	115					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S115L(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CAAAATCGCCGAGGGCTTAAG	0.488																																							uc002ffc.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(343-345)TCG>TTG		ADAM metallopeptidase with thrombospondin type 1							134.0	136.0	135.0					16																	77465343		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77465343G>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.344C>T	16.37:g.77465343G>A	ENSP00000282849:p.Ser115Leu		Somatic				ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	p.S115L	NM_199355	NP_955387	WXS	Illumina HiSeq	Unspecified	Q8TE60	ATS18_HUMAN			3	763	-			115					Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.344C>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	G	33	5.268465	0.95429	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.06528	3.29;3.29	5.82	5.82	0.92795	Peptidase M12B, propeptide (1);	0.067765	0.64402	D	0.000009	T	0.27419	0.0673	M	0.80422	2.495	0.80722	D	1	D	0.61080	0.989	P	0.62740	0.906	T	0.00403	-1.1761	10	0.87932	D	0	.	19.0792	0.93175	0.0:0.0:1.0:0.0	.	115	Q8TE60	ATS18_HUMAN	L	115	ENSP00000282849:S115L;ENSP00000392540:S115L	ENSP00000282849:S115L	S	-	2	0	ADAMTS18	76022844	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.908000	0.92640	2.755000	0.94549	0.591000	0.81541	TCG		0.488	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			42	136	0	0	0	0.025465	0	42	136				
BCO1	53630	broad.mit.edu	37	16	81324006	81324006	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:81324006C>T	ENST00000258168.2	+	11	1929	c.1468C>T	c.(1468-1470)Ctc>Ttc	p.L490F	BCMO1_ENST00000425577.2_Missense_Mutation_p.L421F	NM_017429.2	NP_059125.2												p.L490F(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GCCTTTTCTGCTCATTCTGGA	0.433																																							uc002fgn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1468-1470)CTC>TTC		beta-carotene 15,15'-monooxygenase							85.0	83.0	84.0					16																	81324006		2202	4300	6502	SO:0001583	missense	53630				retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity	g.chr16:81324006C>T																												ENST00000258168.2:c.1468C>T	16.37:g.81324006C>T	ENSP00000258168:p.Leu490Phe		Somatic				BCMO1_uc010vnp.1_Missense_Mutation_p.L421F	p.L490F	NM_017429	NP_059125	WXS	Illumina HiSeq	Unspecified	Q9HAY6	BCDO1_HUMAN			11	1686	+			490						Missense_Mutation	SNP	ENST00000258168.2	37	c.1468C>T	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303250	0.81136	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.95821	-3.82;-3.82	6.14	6.14	0.99180	.	0.230239	0.38381	N	0.001714	D	0.98058	0.9360	M	0.87180	2.865	0.58432	D	0.999997	D;D	0.76494	0.999;0.998	D;D	0.72982	0.979;0.971	D	0.98175	1.0454	10	0.72032	D	0.01	-22.2768	19.6312	0.95704	0.0:1.0:0.0:0.0	.	421;490	E7EM88;Q9HAY6	.;BCDO1_HUMAN	F	490;421	ENSP00000258168:L490F;ENSP00000400586:L421F	ENSP00000258168:L490F	L	+	1	0	BCMO1	79881507	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	3.691000	0.54720	2.937000	0.99478	0.650000	0.86243	CTC		0.433	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1			37	73	0	0	0	0.007835	0	37	73				
SLC7A5	8140	broad.mit.edu	37	16	87866630	87866630	+	Splice_Site	SNP	G	G	C	rs534139169		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:87866630G>C	ENST00000261622.4	-	10	1535	c.1470C>G	c.(1468-1470)ttC>ttG	p.F490L	SLC7A5_ENST00000565644.1_Splice_Site_p.F224L	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	490					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.F490L(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	CGGTCGTGGAGACTGTCAGGA	0.657																																							uc002fkm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1468-1470)TTC>TTG		solute carrier family 7 (cationic amino acid							129.0	136.0	134.0					16																	87866630		2198	4300	6498	SO:0001630	splice_region_variant	8140				blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding	g.chr16:87866630G>C	AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.1469-1C>G	16.37:g.87866630G>C			Somatic					p.F490L	NM_003486	NP_003477	WXS	Illumina HiSeq	Unspecified	Q01650	LAT1_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.049)	10	1542	-			490					Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	ENST00000261622.4	37	c.1470C>G	CCDS10964.1	.	.	.	.	.	.	.	.	.	.	G	5.046	0.194083	0.09599	.	.	ENSG00000103257	ENST00000261622	D	0.90504	-2.68	5.2	-0.363	0.12556	.	0.114483	0.64402	D	0.000012	D	0.82870	0.5131	L	0.36672	1.1	0.47476	D	0.999438	B	0.17852	0.024	B	0.11329	0.006	T	0.70178	-0.4943	10	0.27785	T	0.31	.	10.4711	0.44638	0.3028:0.0:0.6972:0.0	.	490	Q01650	LAT1_HUMAN	L	490	ENSP00000261622:F490L	ENSP00000261622:F490L	F	-	3	2	SLC7A5	86424131	0.981000	0.34729	0.659000	0.29680	0.003000	0.03518	0.106000	0.15354	0.017000	0.15025	-0.379000	0.06801	TTC		0.657	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269110.2	NM_003486	Missense_Mutation	30	125	0	0	0	0.007291	0	30	125				
DPEP1	1800	broad.mit.edu	37	16	89703660	89703660	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr16:89703660C>T	ENST00000393092.3	+	7	931	c.640C>T	c.(640-642)Cac>Tac	p.H214Y	DPEP1_ENST00000421184.1_Missense_Mutation_p.H214Y|DPEP1_ENST00000261615.4_Missense_Mutation_p.H214Y	NM_004413.3	NP_004404.1	P16444	DPEP1_HUMAN	dipeptidase 1 (renal)	214					antibiotic metabolic process (GO:0016999)|arachidonic acid metabolic process (GO:0019369)|cellular lactam catabolic process (GO:0072340)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to nitric oxide (GO:0071732)|glutathione metabolic process (GO:0006749)|homocysteine metabolic process (GO:0050667)|leukotriene metabolic process (GO:0006691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dipeptidyl-peptidase activity (GO:0008239)|GPI anchor binding (GO:0034235)|metallodipeptidase activity (GO:0070573)|metalloexopeptidase activity (GO:0008235)|modified amino acid binding (GO:0072341)|zinc ion binding (GO:0008270)	p.H214Y(1)		large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	14		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CGACTTGGCTCACGTGTCTGT	0.662																																							uc010cin.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(640-642)CAC>TAC		dipeptidase 1 precursor	Cilastatin(DB01597)						72.0	70.0	71.0					16																	89703660		2193	4295	6488	SO:0001583	missense	1800				proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding	g.chr16:89703660C>T		CCDS10982.1	16q24	2011-07-22			ENSG00000015413	ENSG00000015413	3.4.13.19		3002	protein-coding gene	gene with protein product		179780					Standard	NM_004413		Approved		uc002fnr.4	P16444	OTTHUMG00000138052	ENST00000393092.3:c.640C>T	16.37:g.89703660C>T	ENSP00000376807:p.His214Tyr		Somatic				DPEP1_uc002fnr.3_Missense_Mutation_p.H214Y|DPEP1_uc002fns.3_Missense_Mutation_p.H214Y	p.H214Y	NM_001128141	NP_001121613	WXS	Illumina HiSeq	Unspecified	P16444	DPEP1_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0258)	7	843	+		all_lung(18;0.0054)|all_hematologic(23;0.094)	214				Zinc 2; catalytic.	D3DX80|Q96AK2	Missense_Mutation	SNP	ENST00000393092.3	37	c.640C>T	CCDS10982.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145980	0.77888	.	.	ENSG00000015413	ENST00000421184;ENST00000393092;ENST00000261615	T;T;T	0.36520	1.25;1.25;1.25	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	H	0.94264	3.515	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.79472	-0.1789	10	0.51188	T	0.08	-2.0055	18.7402	0.91770	0.0:1.0:0.0:0.0	.	214	P16444	DPEP1_HUMAN	Y	214	ENSP00000397313:H214Y;ENSP00000376807:H214Y;ENSP00000261615:H214Y	ENSP00000261615:H214Y	H	+	1	0	DPEP1	88231161	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	7.601000	0.82783	2.431000	0.82371	0.491000	0.48974	CAC		0.662	DPEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423058.1	NM_001128141		8	41	0	0	0	0.00308	0	8	41				
PRPF8	10594	broad.mit.edu	37	17	1552103	1552103	+	IGR	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:1552103G>C	ENST00000572621.1	-	0	7445				RILP_ENST00000301336.6_Missense_Mutation_p.P222R|PRPF8_ENST00000575116.1_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.P222R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CGGGTCCTCAGGGTTCCCTGG	0.711																																							uc002ftd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(664-666)CCT>CGT		Rab interacting lysosomal protein							9.0	11.0	10.0					17																	1552103		1915	4040	5955	SO:0001628	intergenic_variant	83547				endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding	g.chr17:1552103G>C	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553		17.37:g.1552103G>C			Somatic					p.P222R	NM_031430	NP_113618	WXS	Illumina HiSeq	Unspecified	Q96NA2	RILP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	4	959	-			222					O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	c.665C>G	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	g	13.72	2.321333	0.41096	.	.	ENSG00000167705	ENST00000301336	T	0.32753	1.44	3.68	2.66	0.31614	.	0.404251	0.20200	N	0.097119	T	0.19604	0.0471	L	0.32530	0.975	0.09310	N	1	P	0.41748	0.761	B	0.40199	0.322	T	0.08207	-1.0733	10	0.21014	T	0.42	-3.0482	6.0217	0.19632	0.1056:0.0:0.7076:0.1868	.	222	Q96NA2	RILP_HUMAN	R	222	ENSP00000301336:P222R	ENSP00000301336:P222R	P	-	2	0	RILP	1498853	0.006000	0.16342	0.377000	0.26055	0.257000	0.26127	0.553000	0.23391	0.655000	0.30866	0.414000	0.27820	CCT		0.711	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			3	9	0	0	0	0.004672	0	3	9				
DPH1	1801	broad.mit.edu	37	17	1936833	1936833	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:1936833C>T	ENST00000263083.6	+	2	156	c.111C>T	c.(109-111)atC>atT	p.I37I	DPH1_ENST00000570477.1_5'UTR	NM_001383.3	NP_001374.3	Q9BZG8	DPH1_HUMAN	diphthamide biosynthesis 1	37					cell proliferation (GO:0008283)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I37I(1)		endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	17						CCAATCAGATCCCCCCTGAGA	0.557																																							uc002fts.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(109-111)ATC>ATT		diptheria toxin resistance protein required for							75.0	79.0	78.0					17																	1936833		1890	4093	5983	SO:0001819	synonymous_variant	1801				peptidyl-diphthamide biosynthetic process from peptidyl-histidine|translation	cytoplasm|nucleus		g.chr17:1936833C>T	S81752	CCDS42228.1	17p13.3	2013-05-02	2013-05-02	2005-06-03	ENSG00000108963	ENSG00000108963			3003	protein-coding gene	gene with protein product	"""ovarian tumor suppressor candidate 1"""	603527	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 1 (S. cerevisiae)"", ""DPH-like 1 (S. cerevisiae)"", ""DPH1 homolog (S. cerevisiae)"""	DPH2L, DPH2L1		8603384, 15485916, 22869748	Standard	NM_001383		Approved	OVCA1	uc002fts.3	Q9BZG8	OTTHUMG00000177724	ENST00000263083.6:c.111C>T	17.37:g.1936833C>T			Somatic				DPH1_uc002ftr.1_RNA|DPH1_uc002ftt.2_Silent_p.I32I|DPH1_uc010cjx.2_5'UTR|DPH1_uc010vqs.1_Silent_p.I47I	p.I37I	NM_001383	NP_001374	WXS	Illumina HiSeq	Unspecified	Q9BZG8	DPH1_HUMAN			2	129	+			37					D3DTI3|Q16439|Q4VBA2|Q9BTW7|Q9UCY0	Silent	SNP	ENST00000263083.6	37	c.111C>T	CCDS42228.1																																																																																				0.557	DPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438660.1	NM_001383		24	68	0	0	0	0.024334	0	24	68				
GLP2R	9340	broad.mit.edu	37	17	9792772	9792772	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:9792772T>G	ENST00000262441.5	+	13	1925	c.1412T>G	c.(1411-1413)tTc>tGc	p.F471C	GLP2R_ENST00000574745.1_Missense_Mutation_p.F291C	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	471					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.F471C(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	GGGAAGGACTTCCGGTTCCTA	0.587																																							uc002gmd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1411-1413)TTC>TGC		glucagon-like peptide 2 receptor precursor	Glucagon recombinant(DB00040)						52.0	53.0	53.0					17																	9792772		2203	4300	6503	SO:0001583	missense	9340				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane		g.chr17:9792772T>G	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1412T>G	17.37:g.9792772T>G	ENSP00000262441:p.Phe471Cys		Somatic					p.F471C	NM_004246	NP_004237	WXS	Illumina HiSeq	Unspecified	O95838	GLP2R_HUMAN			13	1412	+			471			Cytoplasmic (Potential).		Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	c.1412T>G	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	T	8.418	0.845769	0.16963	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.56611	0.45	5.53	5.53	0.82687	.	0.176755	0.27686	N	0.018274	T	0.53012	0.1770	L	0.49126	1.545	0.33084	D	0.536977	P	0.51240	0.943	P	0.46718	0.525	T	0.66693	-0.5859	10	0.44086	T	0.13	.	13.4867	0.61371	0.0:0.0:0.0:1.0	.	471	O95838	GLP2R_HUMAN	C	471	ENSP00000262441:F471C	ENSP00000262441:F471C	F	+	2	0	GLP2R	9733497	1.000000	0.71417	0.961000	0.40146	0.106000	0.19336	4.423000	0.59861	2.236000	0.73375	0.533000	0.62120	TTC		0.587	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4			24	43	0	0	0	0.024334	0	24	43				
SUPT6H	6830	broad.mit.edu	37	17	27008931	27008931	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:27008931G>A	ENST00000314616.6	+	13	1813	c.1530G>A	c.(1528-1530)caG>caA	p.Q510Q	SUPT6H_ENST00000347486.4_Silent_p.Q510Q	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	510	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q510Q(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ATGAGGAGCAGAGGGGGCCTG	0.517																																							uc002hby.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1528-1530)CAG>CAA		suppressor of Ty 6 homolog							51.0	42.0	45.0					17																	27008931		2203	4300	6503	SO:0001819	synonymous_variant	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27008931G>A	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1530G>A	17.37:g.27008931G>A			Somatic				SUPT6H_uc010crt.2_Silent_p.Q510Q	p.Q510Q	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			13	1620	+	Lung NSC(42;0.00431)		510					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	c.1530G>A	CCDS32596.1																																																																																				0.517	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		5	32	0	0	0	0.014758	0	5	32				
STAT3	6774	broad.mit.edu	37	17	40498730	40498730	+	Splice_Site	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:40498730C>T	ENST00000264657.5	-	3	442	c.130G>A	c.(130-132)Gca>Aca	p.A44T	STAT3_ENST00000585517.1_Splice_Site_p.A44T|STAT3_ENST00000404395.3_Splice_Site_p.A44T|STAT3_ENST00000389272.3_5'UTR|STAT3_ENST00000588969.1_Splice_Site_p.A44T	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	44					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A44T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GCCGCATATGCCCTAGGAAAA	0.428									Hyperimmunoglobulin E Recurrent Infection Syndrome																														uc002hzl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(130-132)GCA>ACA		signal transducer and activator of transcription							149.0	148.0	149.0					17																	40498730		2203	4300	6503	SO:0001630	splice_region_variant	6774	Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding	g.chr17:40498730C>T	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.129-1G>A	17.37:g.40498730C>T			Somatic				STAT3_uc002hzk.1_Missense_Mutation_p.A44T|STAT3_uc002hzm.1_Missense_Mutation_p.A44T|STAT3_uc010wgh.1_5'UTR|STAT3_uc002hzn.1_Missense_Mutation_p.A44T	p.A44T	NM_139276	NP_644805	WXS	Illumina HiSeq	Unspecified	P40763	STAT3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.139)	3	370	-		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)	44					A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	c.130G>A	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114348	0.94339	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.50277	0.75;0.75	5.66	5.66	0.87406	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	N	0.08118	0	0.80722	D	1	D;D;D	0.69078	0.99;0.997;0.997	D;D;D	0.79108	0.935;0.992;0.992	T	0.56208	-0.8017	10	0.35671	T	0.21	-35.1935	20.1041	0.97884	0.0:1.0:0.0:0.0	.	44;44;44	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	T	44	ENSP00000264657:A44T;ENSP00000384943:A44T	ENSP00000264657:A44T	A	-	1	0	STAT3	37752256	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.944000	0.70219	2.826000	0.97356	0.655000	0.94253	GCA		0.428	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	Missense_Mutation	4	267	0	0	0	0.009096	0	4	267				
SLC25A39	51629	broad.mit.edu	37	17	42398804	42398804	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:42398804C>A	ENST00000377095.5	-	7	634	c.515G>T	c.(514-516)cGc>cTc	p.R172L	SLC25A39_ENST00000590194.1_Missense_Mutation_p.R164L|SLC25A39_ENST00000225308.8_Missense_Mutation_p.R164L|SLC25A39_ENST00000586016.1_Missense_Mutation_p.R40L|SLC25A39_ENST00000537904.2_Missense_Mutation_p.R149L	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	172					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.R164L(1)		endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		ATGCTCACGGCGGGCCAGCGC	0.632																																							uc002ign.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(514-516)CGC>CTC		solute carrier family 25, member 39 isoform a							44.0	53.0	50.0					17																	42398804		2203	4300	6503	SO:0001583	missense	51629				heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane		g.chr17:42398804C>A	BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.515G>T	17.37:g.42398804C>A	ENSP00000366299:p.Arg172Leu		Somatic				SLC25A39_uc002igm.2_Missense_Mutation_p.R164L|SLC25A39_uc002igo.2_Missense_Mutation_p.R164L|SLC25A39_uc010wiw.1_Missense_Mutation_p.R149L|SLC25A39_uc010czu.2_Missense_Mutation_p.R40L|SLC25A39_uc010wix.1_Missense_Mutation_p.R164L|SLC25A39_uc010wiy.1_Missense_Mutation_p.R157L	p.R172L	NM_001143780	NP_001137252	WXS	Illumina HiSeq	Unspecified	Q9BZJ4	S2539_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	7	669	-		Prostate(33;0.0233)	172			Solcar 2.|Helical; Name=3; (Potential).		A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	ENST00000377095.5	37	c.515G>T	CCDS45700.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288431	0.80803	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	T;T;T	0.78924	-1.22;-1.22;-1.22	5.31	5.31	0.75309	Mitochondrial carrier domain (2);	0.055226	0.64402	D	0.000001	D	0.90800	0.7111	M	0.92784	3.345	0.80722	D	1	D;P;D;D;D	0.89917	0.998;0.928;1.0;0.999;1.0	P;B;D;D;D	0.91635	0.884;0.414;0.999;0.987;0.997	D	0.92459	0.5976	10	0.72032	D	0.01	-10.5429	16.9594	0.86268	0.0:1.0:0.0:0.0	.	157;164;149;172;164	B4DVL9;B4DI93;B4DFG5;Q9BZJ4;Q9BZJ4-2	.;.;.;S2539_HUMAN;.	L	164;172;149	ENSP00000225308:R164L;ENSP00000366299:R172L;ENSP00000444540:R149L	ENSP00000225308:R164L	R	-	2	0	SLC25A39	39754330	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	6.818000	0.75257	2.758000	0.94735	0.655000	0.94253	CGC		0.632	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457745.1	NM_016016		21	48	1	0	1.28384e-07	0.012319	1.4156e-07	21	48				
KANSL1	284058	broad.mit.edu	37	17	44117133	44117133	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:44117133C>T	ENST00000262419.6	-	8	2608	c.2138G>A	c.(2137-2139)gGc>gAc	p.G713D	KANSL1_ENST00000393476.3_Missense_Mutation_p.G70D|KANSL1_ENST00000575318.1_Missense_Mutation_p.G713D|KANSL1_ENST00000572904.1_Missense_Mutation_p.G713D|KANSL1_ENST00000432791.1_Missense_Mutation_p.G713D|KANSL1_ENST00000574590.1_Missense_Mutation_p.G713D	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	713					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G713D(1)									TGGCAGACTGCCCGGCATGGG	0.502																																							uc002ikb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(2137-2139)GGC>GAC		hypothetical protein LOC284058							116.0	109.0	112.0					17																	44117133		2203	4300	6503	SO:0001583	missense	284058					MLL1 complex	protein binding	g.chr17:44117133C>T	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2138G>A	17.37:g.44117133C>T	ENSP00000262419:p.Gly713Asp		Somatic				KIAA1267_uc002ikc.2_Missense_Mutation_p.G713D|KIAA1267_uc002ikd.2_Missense_Mutation_p.G713D|KIAA1267_uc010dav.2_Missense_Mutation_p.G713D|KIAA1267_uc010wkb.1_Missense_Mutation_p.G44D|KIAA1267_uc010wkc.1_Missense_Mutation_p.G44D	p.G713D	NM_015443	NP_056258	WXS	Illumina HiSeq	Unspecified	Q7Z3B3	K1267_HUMAN			7	2223	-		Melanoma(429;0.211)	713					A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	c.2138G>A	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014481	0.35511	.	.	ENSG00000120071	ENST00000262419;ENST00000432791;ENST00000393476	T;T;T	0.24538	2.69;2.69;1.85	6.05	6.05	0.98169	.	0.326205	0.30850	N	0.008753	T	0.18551	0.0445	L	0.29908	0.895	0.37271	D	0.907416	B;P;B;B	0.35908	0.13;0.527;0.13;0.277	B;B;B;B	0.36289	0.055;0.221;0.023;0.079	T	0.07770	-1.0755	10	0.09590	T	0.72	-2.173	13.6982	0.62593	0.0:0.8459:0.1541:0.0	.	44;44;713;713	B3KT49;Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;.;K1267_HUMAN	D	713;713;70	ENSP00000262419:G713D;ENSP00000387393:G713D;ENSP00000377117:G70D	ENSP00000262419:G713D	G	-	2	0	KIAA1267	41472980	0.992000	0.36948	1.000000	0.80357	0.670000	0.39368	2.783000	0.47766	2.878000	0.98634	0.650000	0.86243	GGC		0.502	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443		5	124	0	0	0	0.014758	0	5	124				
HOXB3	3213	broad.mit.edu	37	17	46629586	46629586	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:46629586G>A	ENST00000470495.1	-	1	1698	c.251C>T	c.(250-252)tCg>tTg	p.S84L	HOXB3_ENST00000490677.1_Intron|HOXB3_ENST00000476342.1_Missense_Mutation_p.S84L|HOXB3_ENST00000472863.1_Missense_Mutation_p.S11L|HOXB3_ENST00000498678.1_Missense_Mutation_p.S84L|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000311626.4_Missense_Mutation_p.S84L|HOXB3_ENST00000485909.2_Intron|HOXB3_ENST00000489475.1_Missense_Mutation_p.S11L			P14651	HXB3_HUMAN	homeobox B3	84					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S84L(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						AGGCGGGGCCGACAGGGGCTC	0.682																																							uc002inn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)TCG>TTG		homeobox B3							33.0	43.0	39.0					17																	46629586		2201	4298	6499	SO:0001583	missense	3213				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46629586G>A		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.251C>T	17.37:g.46629586G>A	ENSP00000417207:p.Ser84Leu		Somatic				HOXB3_uc010wlm.1_Missense_Mutation_p.S11L|HOXB3_uc010dbf.2_Missense_Mutation_p.S84L|HOXB3_uc010dbg.2_Missense_Mutation_p.S84L|HOXB3_uc002ino.2_Missense_Mutation_p.S84L|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Missense_Mutation_p.S11L	p.S84L	NM_002146	NP_002137	WXS	Illumina HiSeq	Unspecified	P14651	HXB3_HUMAN			1	651	-			84					A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	37	c.251C>T	CCDS11528.1	.	.	.	.	.	.	.	.	.	.	G	8.451	0.852996	0.17106	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000489475;ENST00000476342;ENST00000471459	D;D;D;D;D;D;T	0.91295	-2.82;-2.73;-2.82;-2.82;-2.73;-2.82;1.39	4.05	3.06	0.35304	.	0.492020	0.19902	U	0.103491	D	0.83381	0.5242	L	0.28504	0.86	0.80722	D	1	B	0.21452	0.056	B	0.10450	0.005	T	0.79254	-0.1879	10	0.56958	D	0.05	.	9.3579	0.38177	0.0:0.1576:0.6792:0.1632	.	84	P14651	HXB3_HUMAN	L	84;11;84;84;11;84;11	ENSP00000417207:S84L;ENSP00000419676:S11L;ENSP00000308252:S84L;ENSP00000420595:S84L;ENSP00000418729:S11L;ENSP00000418892:S84L;ENSP00000417400:S11L	ENSP00000308252:S84L	S	-	2	0	HOXB3	43984585	0.977000	0.34250	0.875000	0.34327	0.016000	0.09150	1.544000	0.36158	1.034000	0.39945	-0.304000	0.09214	TCG		0.682	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1			36	70	0	0	0	0.015359	0	36	70				
NME2	4831	broad.mit.edu	37	17	49245626	49245626	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:49245626G>A	ENST00000393193.2	+	6	572	c.495G>A	c.(493-495)caG>caA	p.Q165Q	NME1-NME2_ENST00000393185.1_5'UTR|NME1-NME2_ENST00000608447.1_Silent_p.Q190Q|NME1-NME2_ENST00000513177.1_Silent_p.Q50Q|NME1-NME2_ENST00000512737.1_Silent_p.Q50Q|NME1-NME2_ENST00000393198.3_Silent_p.Q165Q|NME1-NME2_ENST00000503064.1_Silent_p.Q50Q|NME2_ENST00000376392.6_Silent_p.Q165Q|NME1-NME2_ENST00000514264.2_Silent_p.Q50Q|NME1-NME2_ENST00000393183.3_5'UTR|NME1-NME2_ENST00000393190.1_Silent_p.Q50Q|NME2_ENST00000555572.1_Silent_p.Q190Q			P22392	NDKB_HUMAN	NME/NM23 nucleoside diphosphate kinase 2	50					cell adhesion (GO:0007155)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of apoptotic process (GO:0043066)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside triphosphate biosynthetic process (GO:0009142)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|UTP biosynthetic process (GO:0006228)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)|protein histidine kinase activity (GO:0004673)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q165Q(1)|p.Q50Q(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		Adefovir Dipivoxil(DB00718)|Lamivudine(DB00709)|Tenofovir(DB00300)	ACCTGAAGCAGCACTACATTG	0.542																																					Esophageal Squamous(49;809 1203 4404 15246)		uc002itk.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(568-570)CAG>CAA		nucleoside diphosphate kinase B							133.0	110.0	118.0					17																	49245626		2203	4300	6503	SO:0001819	synonymous_variant	654364				cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity	g.chr17:49245626G>A	X58965	CCDS11580.1, CCDS74107.1	17q21.33	2013-04-29	2012-05-18		ENSG00000011052	ENSG00000011052			7850	protein-coding gene	gene with protein product		156491	"""non-metastatic cells 2, protein (NM23B) expressed in"""			1988104, 19852809	Standard	NM_001018137		Approved	NM23-H2, NDPKB		P22392	OTTHUMG00000154062	ENST00000393193.2:c.495G>A	17.37:g.49245626G>A			Somatic				NME1-NME2_uc002itj.2_Silent_p.Q165Q|NME2_uc002itl.2_Silent_p.Q50Q|NME2_uc002itm.2_Silent_p.Q50Q|NME2_uc002itn.2_Silent_p.Q50Q|NME2_uc002ito.2_Silent_p.Q50Q	p.Q190Q	NM_002512	NP_002503	WXS	Illumina HiSeq	Unspecified	P22392	NDKB_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		7	823	+			50			Interaction with AKAP13.		A8MWA3|Q1WM23|Q6LCT6	Silent	SNP	ENST00000393193.2	37	c.570G>A	CCDS32682.1																																																																																				0.542	NME2-001	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000268664.2	NM_002512		6	110	0	0	0	0.001984	0	6	110				
KIF2B	84643	broad.mit.edu	37	17	51901606	51901606	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:51901606G>T	ENST00000268919.4	+	1	1368	c.1212G>T	c.(1210-1212)gtG>gtT	p.V404V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	404	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V404V(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGAACCTGGTGGAAATAGGGA	0.522																																							uc002iua.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)	8						c.(1210-1212)GTG>GTT		kinesin family member 2B							125.0	91.0	103.0					17																	51901606		2203	4300	6503	SO:0001819	synonymous_variant	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901606G>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1212G>T	17.37:g.51901606G>T			Somatic				uc010wna.1_RNA	p.V404V	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	1368	+			404			Kinesin-motor.		Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	c.1212G>T	CCDS32685.1																																																																																				0.522	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		26	60	1	0	4.59853e-10	0.027356	5.17953e-10	26	60				
ARMC7	79637	broad.mit.edu	37	17	73125037	73125037	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:73125037C>T	ENST00000245543.1	+	3	803	c.501C>T	c.(499-501)ttC>ttT	p.F167F	NT5C_ENST00000579082.1_5'Flank|ARMC7_ENST00000579096.1_3'UTR|ARMC7_ENST00000581078.1_3'UTR	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	167						cytoplasm (GO:0005737)		p.F167F(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			TGGAGGACTTCTGCTCCCCCC	0.701																																							uc002jmw.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(499-501)TTC>TTT		armadillo repeat containing 7							16.0	16.0	16.0					17																	73125037		2203	4298	6501	SO:0001819	synonymous_variant	79637						binding	g.chr17:73125037C>T	AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.501C>T	17.37:g.73125037C>T			Somatic				ARMC7_uc010wru.1_3'UTR|ARMC7_uc010dga.1_RNA	p.F167F	NM_024585	NP_078861	WXS	Illumina HiSeq	Unspecified	Q9H6L4	ARMC7_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		3	803	+	all_lung(278;0.14)|Lung NSC(278;0.168)		167					B4DVA4	Silent	SNP	ENST00000245543.1	37	c.501C>T	CCDS11714.1																																																																																				0.701	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445846.1	NM_024585		5	14	0	0	0	0.014758	0	5	14				
RNF213	57674	broad.mit.edu	37	17	78321478	78321478	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:78321478G>A	ENST00000582970.1	+	29	9486	c.9343G>A	c.(9343-9345)Gca>Aca	p.A3115T	RNF213_ENST00000336301.6_Missense_Mutation_p.A1188T|RNF213_ENST00000508628.2_Missense_Mutation_p.A3164T	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3115					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A3164T(2)|p.A1188T(2)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCTCTACGACGCACTCAACCA	0.562																																							uc002jyh.1		NA																	4	Substitution - Missense(4)		large_intestine(2)|lung(2)	ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(3562-3564)GCA>ACA		ring finger protein 213							82.0	83.0	83.0					17																	78321478		2203	4300	6503	SO:0001583	missense	57674							g.chr17:78321478G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9343G>A	17.37:g.78321478G>A	ENSP00000464087:p.Ala3115Thr		Somatic					p.A1188T	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	3785	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	c.3562G>A	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268061	0.59540	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.26223	1.75	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.85859	2.78	0.52501	D	0.999956	D	0.69078	0.997	D	0.68353	0.957	T	0.63994	-0.6511	10	0.72032	D	0.01	.	18.9568	0.92661	0.0:0.0:1.0:0.0	.	1188	Q63HN8	RN213_HUMAN	T	3115;3164;1188	ENSP00000338218:A1188T	ENSP00000338218:A1188T	A	+	1	0	RNF213	75936073	1.000000	0.71417	0.948000	0.38648	0.959000	0.62525	9.671000	0.98627	2.542000	0.85734	0.563000	0.77884	GCA		0.562	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		22	65	0	0	0	0.012319	0	22	65				
PIEZO2	63895	broad.mit.edu	37	18	10691237	10691237	+	Silent	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:10691237G>C	ENST00000503781.3	-	44	6995	c.6996C>G	c.(6994-6996)ctC>ctG	p.L2332L	PIEZO2_ENST00000538948.1_Silent_p.L289L|PIEZO2_ENST00000302079.6_Silent_p.L2332L|PIEZO2_ENST00000285141.4_Silent_p.L187L|PIEZO2_ENST00000580640.1_Silent_p.L2357L	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2332					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.L2332L(1)|p.L187L(1)									GGAATAAGAAGAGGTTGACGT	0.498																																							uc002kor.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(865-867)CTC>CTG		family with sequence similarity 38, member B							142.0	125.0	131.0					18																	10691237		2203	4300	6503	SO:0001819	synonymous_variant	63895					integral to membrane	ion channel activity	g.chr18:10691237G>C	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6996C>G	18.37:g.10691237G>C			Somatic				FAM38B_uc002koq.2_Silent_p.L187L	p.L289L	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			6	1007	-			2332			Helical; (Potential).		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	ENST00000503781.3	37	c.867C>G																																																																																					0.498	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		43	75	0	0	0	0.01441	0	43	75				
CEP76	79959	broad.mit.edu	37	18	12695285	12695285	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:12695285G>C	ENST00000262127.2	-	6	997	c.772C>G	c.(772-774)Caa>Gaa	p.Q258E	PSMG2_ENST00000585331.2_Intron|CEP76_ENST00000423709.2_Missense_Mutation_p.Q183E	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	258					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)		p.Q258E(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GATAACGTTTGATTGAGTGGT	0.299																																							uc002kri.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(772-774)CAA>GAA		centrosomal protein 76kDa							81.0	78.0	79.0					18																	12695285		2198	4294	6492	SO:0001583	missense	79959				G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding	g.chr18:12695285G>C	BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.772C>G	18.37:g.12695285G>C	ENSP00000262127:p.Gln258Glu		Somatic				PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Missense_Mutation_p.Q80E|CEP76_uc010wzz.1_Missense_Mutation_p.Q183E|CEP76_uc010xaa.1_Missense_Mutation_p.Q80E	p.Q258E	NM_024899	NP_079175	WXS	Illumina HiSeq	Unspecified	Q8TAP6	CEP76_HUMAN			6	928	-			258					B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Missense_Mutation	SNP	ENST00000262127.2	37	c.772C>G	CCDS11861.1	.	.	.	.	.	.	.	.	.	.	G	2.449	-0.326848	0.05350	.	.	ENSG00000101624	ENST00000262127;ENST00000423709	T;T	0.78595	-1.19;-1.18	5.46	5.46	0.80206	.	0.222920	0.46145	D	0.000311	T	0.41558	0.1164	N	0.00436	-1.5	0.31774	N	0.631758	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.46062	-0.9218	10	0.02654	T	1	-15.8001	12.434	0.55588	0.0:0.0:0.7174:0.2826	.	183;258;80	Q8TAP6-2;Q8TAP6;Q8TAP6-3	.;CEP76_HUMAN;.	E	258;183	ENSP00000262127:Q258E;ENSP00000403074:Q183E	ENSP00000262127:Q258E	Q	-	1	0	CEP76	12685285	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	3.876000	0.56115	2.545000	0.85829	0.563000	0.77884	CAA		0.299	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254611.1	NM_024899		4	18	0	0	0	0.009096	0	4	18				
LAMA3	3909	broad.mit.edu	37	18	21526203	21526203	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:21526203C>T	ENST00000313654.9	+	70	9547	c.9306C>T	c.(9304-9306)atC>atT	p.I3102I	LAMA3_ENST00000587184.1_Silent_p.I1437I|LAMA3_ENST00000269217.6_Silent_p.I1493I|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000399516.3_Silent_p.I3046I	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3102	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.I1493I(1)|p.I3102I(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CCATCAGCATCAGAGCGCCAG	0.502																																							uc002kuq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|skin(2)|central_nervous_system(1)	11						c.(9304-9306)ATC>ATT		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						110.0	89.0	96.0					18																	21526203		2203	4300	6503	SO:0001819	synonymous_variant	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21526203C>T	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9306C>T	18.37:g.21526203C>T			Somatic				LAMA3_uc002kur.2_Silent_p.I3046I|LAMA3_uc002kus.3_Silent_p.I1493I|LAMA3_uc002kut.3_Silent_p.I1437I	p.I3102I	NM_198129	NP_937762	WXS	Illumina HiSeq	Unspecified	Q16787	LAMA3_HUMAN			70	9392	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		3102			Laminin G-like 4.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	c.9306C>T	CCDS42419.1																																																																																				0.502	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		11	73	0	0	0	0.010729	0	11	73				
ZNF521	25925	broad.mit.edu	37	18	22806029	22806029	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:22806029T>G	ENST00000361524.3	-	4	2001	c.1853A>C	c.(1852-1854)aAg>aCg	p.K618T	ZNF521_ENST00000584787.1_Missense_Mutation_p.K398T|ZNF521_ENST00000538137.2_Missense_Mutation_p.K618T|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	618					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.K618T(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTGCATCATCTTAAGAGATGT	0.468			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)	7						c.(1852-1854)AAG>ACG		zinc finger protein 521							109.0	103.0	105.0					18																	22806029		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806029T>G	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1853A>C	18.37:g.22806029T>G	ENSP00000354794:p.Lys618Thr		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.K618T|ZNF521_uc002kvl.2_Missense_Mutation_p.K398T	p.K618T	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	2100	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		618					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.1853A>C	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	T	9.267	1.044652	0.19748	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.10005	2.92;2.94	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.20577	0.0495	L	0.27053	0.805	0.37796	D	0.927523	D	0.76494	0.999	D	0.87578	0.998	T	0.17107	-1.0380	10	0.15499	T	0.54	-30.9741	16.8061	0.85666	0.0:0.0:0.0:1.0	.	618	Q96K83	ZN521_HUMAN	T	618;652;618	ENSP00000354794:K618T;ENSP00000382352:K618T	ENSP00000354794:K618T	K	-	2	0	ZNF521	21060027	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.833000	0.69349	2.367000	0.80283	0.528000	0.53228	AAG		0.468	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		12	55	0	0	0	0.013537	0	12	55				
DSC2	1824	broad.mit.edu	37	18	28660165	28660165	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:28660165G>T	ENST00000280904.6	-	10	1860	c.1417C>A	c.(1417-1419)Cct>Act	p.P473T	DSC2_ENST00000251081.6_Missense_Mutation_p.P473T	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	473	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P473T(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TGTATTGGAGGGTTACACTCA	0.443																																							uc002kwl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1417-1419)CCT>ACT		desmocollin 2 isoform Dsc2a preproprotein							200.0	171.0	181.0					18																	28660165		2203	4300	6503	SO:0001583	missense	1824				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28660165G>T	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1417C>A	18.37:g.28660165G>T	ENSP00000280904:p.Pro473Thr		Somatic				DSC2_uc002kwk.3_Missense_Mutation_p.P473T	p.P473T	NM_024422	NP_077740	WXS	Illumina HiSeq	Unspecified	Q02487	DSC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0241)		10	1871	-			473			Extracellular (Potential).|Cadherin 4.			Missense_Mutation	SNP	ENST00000280904.6	37	c.1417C>A	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819249	0.90873	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.61274	0.12;0.12	5.92	5.92	0.95590	Cadherin (3);Cadherin-like (1);	0.000000	0.32147	N	0.006504	T	0.80874	0.4707	M	0.87827	2.91	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.82321	-0.0515	10	0.62326	D	0.03	.	19.9157	0.97061	0.0:0.0:1.0:0.0	.	473;473	Q02487;Q02487-2	DSC2_HUMAN;.	T	473;473;239;486	ENSP00000251081:P473T;ENSP00000280904:P473T	ENSP00000251081:P473T	P	-	1	0	DSC2	26914163	1.000000	0.71417	0.124000	0.21820	0.634000	0.38068	3.291000	0.51764	2.809000	0.96659	0.655000	0.94253	CCT		0.443	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		24	126	1	0	7.76418e-22	0.027356	9.48453e-22	24	126				
ASXL3	80816	broad.mit.edu	37	18	31323324	31323324	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:31323324A>T	ENST00000269197.5	+	12	3512	c.3512A>T	c.(3511-3513)aAg>aTg	p.K1171M		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K1171M(1)|p.K878M(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCTAGCAACAAGTCTGCCCAC	0.458																																							uc010dmg.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(3511-3513)AAG>ATG		additional sex combs like 3							47.0	45.0	46.0					18																	31323324		1923	4137	6060	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323324A>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3512A>T	18.37:g.31323324A>T	ENSP00000269197:p.Lys1171Met		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.K878M	p.K1171M	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	3567	+			1171					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3512A>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.666802	0.67814	.	.	ENSG00000141431	ENST00000269197	T	0.54866	0.55	5.91	5.91	0.95273	.	1.091830	0.06901	N	0.805962	T	0.68100	0.2964	L	0.32530	0.975	0.45762	D	0.998656	D	0.89917	1.0	D	0.87578	0.998	T	0.57004	-0.7885	10	0.72032	D	0.01	.	16.3453	0.83126	1.0:0.0:0.0:0.0	.	1171	Q9C0F0	ASXL3_HUMAN	M	1171	ENSP00000269197:K1171M	ENSP00000269197:K1171M	K	+	2	0	ASXL3	29577322	1.000000	0.71417	0.983000	0.44433	0.977000	0.68977	4.483000	0.60264	2.261000	0.74972	0.533000	0.62120	AAG		0.458	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			5	36	0	0	0	0.014758	0	5	36				
RIT2	6014	broad.mit.edu	37	18	40323480	40323480	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:40323480T>G	ENST00000326695.5	-	5	803	c.632A>C	c.(631-633)aAg>aCg	p.K211T	RIT2_ENST00000590910.1_3'UTR|RIT2_ENST00000589109.1_3'UTR	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	211					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K211T(1)		endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTCTCTCTTCTTCTTCAAAGA	0.388																																							uc002lav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(631-633)AAG>ACG		Ras-like without CAAX 2							127.0	130.0	129.0					18																	40323480		2203	4300	6503	SO:0001583	missense	6014				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr18:40323480T>G	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.632A>C	18.37:g.40323480T>G	ENSP00000321805:p.Lys211Thr		Somatic				RIT2_uc010dnf.2_3'UTR	p.K211T	NM_002930	NP_002921	WXS	Illumina HiSeq	Unspecified	Q99578	RIT2_HUMAN			5	805	-			211					B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	ENST00000326695.5	37	c.632A>C	CCDS11921.1	.	.	.	.	.	.	.	.	.	.	t	15.70	2.910164	0.52439	.	.	ENSG00000152214	ENST00000326695	T	0.80123	-1.34	5.46	5.46	0.80206	.	0.182541	0.37809	N	0.001926	T	0.63640	0.2528	N	0.08118	0	0.80722	D	1	P	0.47409	0.895	B	0.41332	0.354	T	0.70605	-0.4826	10	0.72032	D	0.01	.	9.9688	0.41741	0.0:0.0758:0.0:0.9242	.	211	Q99578	RIT2_HUMAN	T	211	ENSP00000321805:K211T	ENSP00000321805:K211T	K	-	2	0	RIT2	38577478	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.387000	0.44389	2.086000	0.62901	0.529000	0.55759	AAG		0.388	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930		15	108	0	0	0	0.024245	0	15	108				
ZNF532	55205	broad.mit.edu	37	18	56648817	56648817	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:56648817G>T	ENST00000336078.4	+	10	4155	c.3379G>T	c.(3379-3381)Gag>Tag	p.E1127*	ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000589288.1_Nonsense_Mutation_p.E1127*|ZNF532_ENST00000591808.1_Nonsense_Mutation_p.E1127*|ZNF532_ENST00000591083.1_Nonsense_Mutation_p.E1127*|ZNF532_ENST00000591230.1_Nonsense_Mutation_p.E1127*	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1127*(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						TGCCACCAATGAGGAGGAAAC	0.418																																							uc002lho.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)|skin(1)	2						c.(3379-3381)GAG>TAG		zinc finger protein 532							64.0	64.0	64.0					18																	56648817		2203	4300	6503	SO:0001587	stop_gained	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56648817G>T	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3379G>T	18.37:g.56648817G>T	ENSP00000338217:p.Glu1127*		Somatic				ZNF532_uc002lhp.2_Nonsense_Mutation_p.E1125*|ZNF532_uc010xeg.1_Nonsense_Mutation_p.E1125*|ZNF532_uc002lhr.2_Nonsense_Mutation_p.E1125*|ZNF532_uc002lhs.2_Nonsense_Mutation_p.E1125*|ZNF532_uc010xeh.1_Nonsense_Mutation_p.E215*	p.E1127*	NM_018181	NP_060651	WXS	Illumina HiSeq	Unspecified	Q9HCE3	ZN532_HUMAN			10	3926	+			1127					Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Nonsense_Mutation	SNP	ENST00000336078.4	37	c.3379G>T	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	G	45	11.290169	0.99542	.	.	ENSG00000074657	ENST00000336078	.	.	.	5.4	5.4	0.78164	.	0.624967	0.17378	N	0.176395	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-1.5152	9.6276	0.39761	0.0779:0.1446:0.7775:0.0	.	.	.	.	X	1127	.	ENSP00000338217:E1127X	E	+	1	0	ZNF532	54799797	0.934000	0.31675	0.991000	0.47740	0.035000	0.12851	1.400000	0.34577	2.548000	0.85928	0.655000	0.94253	GAG		0.418	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		32	45	1	0	8.16721e-17	0.010818	9.66684e-17	32	45				
CDH19	28513	broad.mit.edu	37	18	64218487	64218487	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr18:64218487T>C	ENST00000540086.1	-	5	865	c.619A>G	c.(619-621)Aga>Gga	p.R207G	CDH19_ENST00000262150.2_Missense_Mutation_p.R207G	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	315	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R207G(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GAAGATATTCTTATGACTCCT	0.313																																							uc002lkc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(619-621)AGA>GGA		cadherin 19, type 2 preproprotein							57.0	62.0	60.0					18																	64218487		2202	4299	6501	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64218487T>C	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.619A>G	18.37:g.64218487T>C	ENSP00000439593:p.Arg207Gly		Somatic				CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.R207G|CDH19_uc002lkd.2_Missense_Mutation_p.R207G	p.R207G	NM_021153	NP_066976	WXS	Illumina HiSeq	Unspecified	Q9H159	CAD19_HUMAN			5	757	-		Esophageal squamous(42;0.0132)	207			Cadherin 2.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000540086.1	37	c.619A>G	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.346259	0.24426	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.52983	0.64;0.64	5.83	0.0549	0.14312	Cadherin (4);Cadherin-like (1);	0.169682	0.52532	D	0.000078	T	0.65291	0.2677	M	0.86097	2.795	0.40584	D	0.981422	D;D	0.89917	1.0;0.998	D;D	0.70935	0.971;0.959	T	0.68622	-0.5360	10	0.87932	D	0	.	9.0029	0.36092	0.1155:0.0:0.355:0.5295	.	207;207	F5H1K0;Q9H159	.;CAD19_HUMAN	G	207;207;152	ENSP00000262150:R207G;ENSP00000439593:R207G	ENSP00000262150:R207G	R	-	1	2	CDH19	62369467	0.996000	0.38824	1.000000	0.80357	0.917000	0.54804	1.581000	0.36558	0.429000	0.26202	-0.481000	0.04817	AGA		0.313	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153		22	77	0	0	0	0.010504	0	22	77				
SAFB	6294	broad.mit.edu	37	19	5651059	5651059	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:5651059G>C	ENST00000292123.5	+	9	1376	c.1269G>C	c.(1267-1269)aaG>aaC	p.K423N	SAFB_ENST00000592224.1_Missense_Mutation_p.K423N|SAFB_ENST00000586934.1_3'UTR|SAFB_ENST00000588852.1_Missense_Mutation_p.K423N|SAFB_ENST00000433404.1_Missense_Mutation_p.K253N|SAFB_ENST00000538656.1_Missense_Mutation_p.K266N|SAFB_ENST00000454510.1_Missense_Mutation_p.K354N	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	423	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K423N(1)		breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CAGATTTGAAGAATCTTTTCA	0.423																																					Colon(88;338 1345 6184 8214 20897)	Colon(88;338 1345 6184 8214 20897)	uc002mcf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|liver(1)|skin(1)	3						c.(1267-1269)AAG>AAC		scaffold attachment factor B							100.0	99.0	99.0					19																	5651059		2203	4300	6503	SO:0001583	missense	6294				chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding	g.chr19:5651059G>C	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1269G>C	19.37:g.5651059G>C	ENSP00000292123:p.Lys423Asn		Somatic				SAFB_uc002mcg.2_Missense_Mutation_p.K423N|SAFB_uc002mce.3_Missense_Mutation_p.K423N|SAFB_uc010xir.1_Missense_Mutation_p.K423N|SAFB_uc010xis.1_Missense_Mutation_p.K354N|SAFB_uc010xit.1_Missense_Mutation_p.K266N|SAFB_uc010xiu.1_Missense_Mutation_p.K222N	p.K423N	NM_002967	NP_002958	WXS	Illumina HiSeq	Unspecified	Q15424	SAFB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)	9	1322	+			423			RRM.		A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	37	c.1269G>C	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391612	0.62066	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	4.94	4.94	0.65067	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	D	0.000024	D	0.87771	0.6261	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.976;1.0;0.989;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.928;0.998;0.952;0.998	D	0.89146	0.3520	10	0.87932	D	0	-39.3905	18.533	0.90999	0.0:0.0:1.0:0.0	.	222;266;354;423;423;423;423	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	N	354;318;253;423;266	ENSP00000415895:K354N;ENSP00000404545:K253N;ENSP00000292123:K423N;ENSP00000438880:K266N	ENSP00000292123:K423N	K	+	3	2	SAFB	5602059	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.780000	0.62382	2.449000	0.82847	0.563000	0.77884	AAG		0.423	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2			14	40	0	0	0	0.016723	0	14	40				
DNMT1	1786	broad.mit.edu	37	19	10287991	10287991	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:10287991G>A	ENST00000340748.4	-	5	733	c.498C>T	c.(496-498)acC>acT	p.T166T	DNMT1_ENST00000540357.1_Silent_p.T166T|DNMT1_ENST00000359526.4_Silent_p.T182T			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	166	Interaction with DNMT3B.|Interaction with PCNA.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T166T(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GAGATGTGATGGTGGTTTGCC	0.443																																							uc002mng.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6						c.(496-498)ACC>ACT		DNA (cytosine-5-)-methyltransferase 1 isoform b	Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)						163.0	145.0	151.0					19																	10287991		2203	4300	6503	SO:0001819	synonymous_variant	1786				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding	g.chr19:10287991G>A	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.498C>T	19.37:g.10287991G>A			Somatic				DNMT1_uc010xlc.1_Silent_p.T182T|DNMT1_uc002mnh.2_Silent_p.T61T|DNMT1_uc010xld.1_Silent_p.T166T|DNMT1_uc010dxb.1_RNA	p.T166T	NM_001379	NP_001370	WXS	Illumina HiSeq	Unspecified	P26358	DNMT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		5	678	-			166	T->A: Abolishes interaction with PCNA.		Interaction with PCNA.|Interaction with DNMT3B.|Interaction with the PRC2/EED-EZH2 complex (By similarity).		A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	37	c.498C>T	CCDS12228.1																																																																																				0.443	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379		5	30	0	0	0	0.014758	0	5	30				
KEAP1	9817	broad.mit.edu	37	19	10602775	10602775	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:10602775A>G	ENST00000171111.5	-	3	1350	c.803T>C	c.(802-804)cTg>cCg	p.L268P	KEAP1_ENST00000393623.2_Missense_Mutation_p.L268P|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	268	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.L268P(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CACGGCCCGCAGCAGCGCCTG	0.627																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(802-804)CTG>CCG		kelch-like ECH-associated protein 1							58.0	57.0	57.0					19																	10602775		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602775A>G	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.803T>C	19.37:g.10602775A>G	ENSP00000171111:p.Leu268Pro		Somatic				KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.L268P	p.L268P	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	959	-			268			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.803T>C	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950959	0.73787	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.78595	-1.19;-1.19	5.61	4.59	0.56863	BTB/Kelch-associated (2);	0.066577	0.64402	D	0.000010	D	0.90484	0.7019	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.91568	0.5269	10	0.87932	D	0	.	11.1026	0.48184	0.8448:0.1552:0.0:0.0	.	268	Q14145	KEAP1_HUMAN	P	268	ENSP00000171111:L268P;ENSP00000377245:L268P	ENSP00000171111:L268P	L	-	2	0	KEAP1	10463775	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	8.985000	0.93487	0.949000	0.37715	0.459000	0.35465	CTG		0.627	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		9	33	0	0	0	0.008291	0	9	33				
SMARCA4	6597	broad.mit.edu	37	19	11168983	11168983	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:11168983G>T	ENST00000429416.3	+	32	4758	c.4477G>T	c.(4477-4479)Gag>Tag	p.E1493*	SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.E1463*|SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.E1460*|SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.E1525*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.E1462*|SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.E1493*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.E1459*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.E1462*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.E1463*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1493	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E1525*(1)|p.E1493*(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTCGCGAAAGGAGCTGCCCGA	0.637			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		3	Substitution - Nonsense(2)|Unknown(1)		lung(3)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(4477-4479)GAG>TAG		SWI/SNF-related matrix-associated							66.0	57.0	60.0					19																	11168983		2203	4300	6503	SO:0001587	stop_gained	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11168983G>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.4477G>T	19.37:g.11168983G>T	ENSP00000395654:p.Glu1493*		Somatic				SMARCA4_uc010dxp.2_Nonsense_Mutation_p.E1493*|SMARCA4_uc010dxo.2_Nonsense_Mutation_p.E1525*|SMARCA4_uc010dxq.2_Nonsense_Mutation_p.E1460*|SMARCA4_uc010dxr.2_Nonsense_Mutation_p.E1459*|SMARCA4_uc002mqj.3_Nonsense_Mutation_p.E1463*|SMARCA4_uc010dxs.2_Nonsense_Mutation_p.E1462*|SMARCA4_uc002mqh.3_Nonsense_Mutation_p.E583*	p.E1493*	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			31	4761	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	1493			Bromo.		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	ENST00000429416.3	37	c.4477G>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	43	9.833454	0.99275	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.72	3.69	0.42338	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-24.3746	11.6863	0.51487	0.0875:0.0:0.9125:0.0	.	.	.	.	X	1493;1525;1527;1493;1460;1459;1462;1463	.	ENSP00000343896:E1493X	E	+	1	0	SMARCA4	11029983	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	6.502000	0.73695	1.214000	0.43395	0.561000	0.74099	GAG		0.637	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		13	15	1	0	0.000219431	0.020292	0.000236963	13	15				
ZNF98	148198	broad.mit.edu	37	19	22574557	22574557	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:22574557C>G	ENST00000357774.5	-	4	1601	c.1480G>C	c.(1480-1482)Gaa>Caa	p.E494Q		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E494Q(2)|p.E494*(2)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TTGCCACATTCTTCACATTTG	0.403																																							uc002nqt.2		NA																	4	Substitution - Missense(2)|Substitution - Nonsense(2)		prostate(2)|lung(2)	ovary(1)|skin(1)	2						c.(1480-1482)GAA>CAA		zinc finger protein 98							81.0	72.0	75.0					19																	22574557		2188	4282	6470	SO:0001583	missense	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22574557C>G		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1480G>C	19.37:g.22574557C>G	ENSP00000350418:p.Glu494Gln		Somatic					p.E494Q	NM_001098626	NP_001092096	WXS	Illumina HiSeq	Unspecified	A6NK75	ZNF98_HUMAN			4	1602	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	494			C2H2-type 12.			Missense_Mutation	SNP	ENST00000357774.5	37	c.1480G>C	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	4.355	0.065424	0.08388	.	.	ENSG00000197360	ENST00000357774	T	0.07444	3.19	1.26	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06917	0.0176	N	0.05574	-0.02	0.09310	N	1	B	0.34329	0.449	P	0.49252	0.604	T	0.47509	-0.9112	9	0.48119	T	0.1	.	4.6413	0.12550	0.0:0.4205:0.4069:0.1726	.	494	A6NK75	ZNF98_HUMAN	Q	494	ENSP00000350418:E494Q	ENSP00000350418:E494Q	E	-	1	0	ZNF98	22366397	0.000000	0.05858	0.004000	0.12327	0.051000	0.14879	-1.056000	0.03489	-0.229000	0.09854	0.289000	0.19496	GAA		0.403	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		4	74	0	0	0	0.009096	0	4	74				
PSG7	5676	broad.mit.edu	37	19	43430044	43430044	+	RNA	SNP	G	G	C	rs192816757		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:43430044G>C	ENST00000406070.2	-	0	1220				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				CTTTTGTCCTGATAGCTGAAA	0.463																																							uc002ovl.3		NA																	0					0						c.(1123-1125)TCA>TGA		pregnancy specific beta-1-glycoprotein 7							190.0	199.0	196.0					19																	43430044		2201	4300	6501			5676				female pregnancy	extracellular region		g.chr19:43430044G>C			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430044G>C			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Nonsense_Mutation_p.S288*|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Nonsense_Mutation_p.S101*|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Nonsense_Mutation_p.S288*|PSG7_uc010xwl.1_Nonsense_Mutation_p.S253*	p.S375*	NM_002783	NP_002774	WXS	Illumina HiSeq	Unspecified	Q13046	PSG7_HUMAN			6	1226	-		Prostate(69;0.00682)	375			Ig-like C2-type 3.		Q15232	Nonsense_Mutation	SNP	ENST00000406070.2	37	c.1124C>G																																																																																					0.463	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		102	252	0	0	0	0.01441	0	102	252				
IRGC	56269	broad.mit.edu	37	19	44223520	44223520	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:44223520C>T	ENST00000244314.5	+	2	1009	c.810C>T	c.(808-810)acC>acT	p.T270T		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	270						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)	p.T270T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TCCTCAAGACCGCCCTGGTGT	0.657																																					Colon(189;350 2037 11447 13433 38914)	Colon(189;350 2037 11447 13433 38914)	uc002oxh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(808-810)ACC>ACT		immunity-related GTPase family, cinema							52.0	49.0	50.0					19																	44223520		2202	4300	6502	SO:0001819	synonymous_variant	56269					membrane	GTP binding|hydrolase activity, acting on acid anhydrides	g.chr19:44223520C>T	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.810C>T	19.37:g.44223520C>T			Somatic					p.T270T	NM_019612	NP_062558	WXS	Illumina HiSeq	Unspecified	Q6NXR0	IIGP5_HUMAN			2	957	+		Prostate(69;0.0435)	270					Q05BR8	Silent	SNP	ENST00000244314.5	37	c.810C>T	CCDS12629.1																																																																																				0.657	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612		6	49	0	0	0	0.00308	0	6	49				
ZNF283	284349	broad.mit.edu	37	19	44351997	44351997	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:44351997G>T	ENST00000324461.7	+	7	1541	c.1244G>T	c.(1243-1245)gGa>gTa	p.G415V	ZNF283_ENST00000588797.1_Missense_Mutation_p.G276V	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G415V(1)		endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TTTAATTGCGGATCAAGTCTT	0.388																																							uc002oxr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1243-1245)GGA>GTA		zinc finger protein 283							73.0	84.0	80.0					19																	44351997		2192	4295	6487	SO:0001583	missense	284349				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44351997G>T	AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1244G>T	19.37:g.44351997G>T	ENSP00000327314:p.Gly415Val		Somatic				ZNF283_uc002oxp.3_Missense_Mutation_p.G276V	p.G415V	NM_181845	NP_862828	WXS	Illumina HiSeq	Unspecified	Q8N7M2	ZN283_HUMAN			7	1512	+		Prostate(69;0.0352)	415			C2H2-type 8.		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	ENST00000324461.7	37	c.1244G>T	CCDS46097.1	.	.	.	.	.	.	.	.	.	.	G	1.607	-0.524922	0.04141	.	.	ENSG00000167637	ENST00000324461	T	0.07021	3.23	3.05	3.05	0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02767	0.0083	N	0.03115	-0.41	0.09310	N	0.999999	B	0.33694	0.421	B	0.26969	0.075	T	0.39292	-0.9621	9	0.16896	T	0.51	.	5.0341	0.14424	0.2601:0.0:0.7399:0.0	.	415	Q8N7M2	ZN283_HUMAN	V	415	ENSP00000327314:G415V	ENSP00000327314:G415V	G	+	2	0	ZNF283	49043837	0.000000	0.05858	0.070000	0.20053	0.654000	0.38779	0.307000	0.19296	1.711000	0.51337	0.462000	0.41574	GGA		0.388	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459909.1	NM_181845		45	104	1	0	1.7489e-18	0.011902	2.11179e-18	45	104				
CLASRP	11129	broad.mit.edu	37	19	45567459	45567459	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:45567459C>T	ENST00000221455.3	+	12	1193	c.1095C>T	c.(1093-1095)ccC>ccT	p.P365P	CLASRP_ENST00000544944.2_Silent_p.P365P|CLASRP_ENST00000391953.4_Silent_p.P303P	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	365					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.P365P(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						CTGGCGGCCCCGCCCCGGGAC	0.756																																							uc002pak.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1093-1095)CCC>CCT		splicing factor, arginine/serine-rich 16							6.0	8.0	7.0					19																	45567459		2074	4099	6173	SO:0001819	synonymous_variant	11129				mRNA processing|RNA splicing	nucleus		g.chr19:45567459C>T	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1095C>T	19.37:g.45567459C>T			Somatic				SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Silent_p.P303P|SFRS16_uc002pam.2_Silent_p.P365P|SFRS16_uc002pan.1_RNA	p.P365P	NM_007056	NP_008987	WXS	Illumina HiSeq	Unspecified	Q8N2M8	CLASR_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	12	1193	+		Ovarian(192;0.0728)|all_neural(266;0.112)	365					B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Silent	SNP	ENST00000221455.3	37	c.1095C>T	CCDS12652.2																																																																																				0.756	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056		7	7	0	0	0	0.001984	0	7	7				
SYMPK	8189	broad.mit.edu	37	19	46319126	46319126	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:46319126C>G	ENST00000245934.7	-	26	3914	c.3670G>C	c.(3670-3672)Gag>Cag	p.E1224Q	RSPH6A_ENST00000221538.3_5'Flank|RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1224					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E1224Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		AGGGGGCCCTCGAGACTAGAG	0.672																																							uc002pdn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3670-3672)GAG>CAG		symplekin							13.0	15.0	14.0					19																	46319126		2189	4270	6459	SO:0001583	missense	8189				cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding	g.chr19:46319126C>G	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3670G>C	19.37:g.46319126C>G	ENSP00000245934:p.Glu1224Gln		Somatic				RSPH6A_uc002pdm.2_5'Flank	p.E1224Q	NM_004819	NP_004810	WXS	Illumina HiSeq	Unspecified	Q92797	SYMPK_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)	26	3915	-		all_neural(266;0.0299)|Ovarian(192;0.0308)	1224					O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	c.3670G>C	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	C	17.27	3.348132	0.61183	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.24	4.24	0.50183	.	0.087569	0.44902	D	0.000415	T	0.56292	0.1975	N	0.24115	0.695	0.38259	D	0.94181	D	0.56968	0.978	D	0.69142	0.962	T	0.62859	-0.6765	9	0.59425	D	0.04	.	12.0579	0.53546	0.0:1.0:0.0:0.0	.	1224	Q92797	SYMPK_HUMAN	Q	1224	.	ENSP00000245934:E1224Q	E	-	1	0	SYMPK	51010966	0.995000	0.38212	0.989000	0.46669	0.370000	0.29829	4.382000	0.59594	2.211000	0.71520	0.289000	0.19496	GAG		0.672	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819		4	16	0	0	0	0.009096	0	4	16				
IGFL2	147920	broad.mit.edu	37	19	46663876	46663876	+	Missense_Mutation	SNP	G	G	T	rs572431190		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:46663876G>T	ENST00000377693.4	+	3	115	c.79G>T	c.(79-81)Gct>Tct	p.A27S	IGFL2_ENST00000434646.2_Missense_Mutation_p.A38S|IGFL2_ENST00000600243.1_3'UTR|AC007193.6_ENST00000597989.1_lincRNA	NM_001135113.1	NP_001128585.1	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2	27						extracellular region (GO:0005576)		p.A38S(1)		cervix(1)|lung(5)	6		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		TCCAGCTCCCGCTGGCTCAGA	0.572																																							uc010xxv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(79-81)GCT>TCT		IGF-like family member 2 isoform b							121.0	133.0	129.0					19																	46663876		2189	4293	6482	SO:0001583	missense	147920					extracellular region	protein binding	g.chr19:46663876G>T	AY672112	CCDS46121.1, CCDS46122.1	19q13.32	2006-07-14							32929	protein-coding gene	gene with protein product		610545				14702039	Standard	NM_001002915		Approved	UNQ645	uc010xxv.2	Q6UWQ7		ENST00000377693.4:c.79G>T	19.37:g.46663876G>T	ENSP00000366922:p.Ala27Ser		Somatic				IGFL2_uc002peb.2_Missense_Mutation_p.A38S	p.A27S	NM_001135113	NP_001128585	WXS	Illumina HiSeq	Unspecified	Q6UWQ7	IGFL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)	3	115	+		Ovarian(192;0.0908)|all_neural(266;0.113)	27					E9PAV1|Q6B9Z3	Missense_Mutation	SNP	ENST00000377693.4	37	c.79G>T	CCDS46121.1	.	.	.	.	.	.	.	.	.	.	G	1.395	-0.579797	0.03854	.	.	ENSG00000204866	ENST00000434646;ENST00000377693	T;T	0.22134	1.97;1.97	2.69	-5.38	0.02673	.	.	.	.	.	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B;B	0.34372	0.288;0.451	B;B	0.30716	0.067;0.119	T	0.25710	-1.0124	9	0.09338	T	0.73	1.1223	1.2248	0.01931	0.2089:0.2457:0.3733:0.1721	.	27;38	Q6UWQ7;Q6UWQ7-2	IGFL2_HUMAN;.	S	38;27	ENSP00000395219:A38S;ENSP00000366922:A27S	ENSP00000366922:A27S	A	+	1	0	IGFL2	51355716	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.725000	0.04942	-2.400000	0.00579	0.194000	0.17425	GCT		0.572	IGFL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000461705.1	NM_001002915		74	85	1	0	1.62783e-20	0.01441	1.98273e-20	74	85				
PNMAL1	55228	broad.mit.edu	37	19	46973432	46973432	+	Silent	SNP	C	C	T	rs377335947		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:46973432C>T	ENST00000313683.10	-	2	1166	c.861G>A	c.(859-861)ccG>ccA	p.P287P	PNMAL1_ENST00000438932.2_Silent_p.P287P|PNMAL1_ENST00000602246.1_Intron	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	287										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TGCCCTTGATCGGCTCTGAGA	0.537																																							uc002peq.3		NA																	0					0						c.(859-861)CCG>CCA		PNMA-like 1 isoform a		C	,	0,4406		0,0,2203	105.0	106.0	106.0		861,861	-4.9	0.0	19		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PNMAL1	NM_001103149.1,NM_018215.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	287/379,287/440	46973432	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55228							g.chr19:46973432C>T	BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.861G>A	19.37:g.46973432C>T			Somatic				PNMAL1_uc002per.3_Silent_p.P287P	p.P287P	NM_018215	NP_060685	WXS	Illumina HiSeq	Unspecified	Q86V59	PNML1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)	2	1167	-		Ovarian(192;0.00965)|all_neural(266;0.0459)	287					A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Silent	SNP	ENST00000313683.10	37	c.861G>A	CCDS33059.1																																																																																				0.537	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215		76	68	0	0	0	0.01441	0	76	68				
PNMAL1	55228	broad.mit.edu	37	19	46974056	46974056	+	Silent	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:46974056C>G	ENST00000313683.10	-	2	542	c.237G>C	c.(235-237)ctG>ctC	p.L79L	PNMAL1_ENST00000438932.2_Silent_p.L79L|PNMAL1_ENST00000602246.1_Intron	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	79								p.L79L(2)		cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		ggatggtgctcagattcacac	0.507																																							uc002peq.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(235-237)CTG>CTC		PNMA-like 1 isoform a							60.0	48.0	52.0					19																	46974056		2203	4300	6503	SO:0001819	synonymous_variant	55228							g.chr19:46974056C>G	BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.237G>C	19.37:g.46974056C>G			Somatic				PNMAL1_uc002per.3_Silent_p.L79L	p.L79L	NM_018215	NP_060685	WXS	Illumina HiSeq	Unspecified	Q86V59	PNML1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)	2	543	-		Ovarian(192;0.00965)|all_neural(266;0.0459)	79					A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Silent	SNP	ENST00000313683.10	37	c.237G>C	CCDS33059.1																																																																																				0.507	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215		8	20	0	0	0	0.00308	0	8	20				
GLTSCR2	29997	broad.mit.edu	37	19	48255844	48255844	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:48255844C>G	ENST00000246802.5	+	6	783	c.745C>G	c.(745-747)Cca>Gca	p.P249A	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	249						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.P249A(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		TTCCTACAATCCATCCTTTGA	0.652																																					Colon(58;613 1041 9473 10089 15241)	Colon(58;613 1041 9473 10089 15241)	uc002phm.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(745-747)CCA>GCA		glioma tumor suppressor candidate region gene 2							96.0	83.0	87.0					19																	48255844		2203	4300	6503	SO:0001583	missense	29997					nucleolus		g.chr19:48255844C>G	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.745C>G	19.37:g.48255844C>G	ENSP00000246802:p.Pro249Ala		Somatic				GLTSCR2_uc002phk.2_Missense_Mutation_p.P249A|GLTSCR2_uc002phl.2_Missense_Mutation_p.P249A|GLTSCR2_uc010elj.2_Missense_Mutation_p.P249A|GLTSCR2_uc010elk.1_RNA	p.P249A	NM_015710	NP_056525	WXS	Illumina HiSeq	Unspecified	Q9NZM5	GSCR2_HUMAN		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)	6	769	+		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)	249					Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	c.745C>G	CCDS12705.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744455	0.49151	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.72394	-0.65	4.08	4.08	0.47627	.	0.000000	0.85682	D	0.000000	D	0.83917	0.5358	M	0.87827	2.91	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68943	0.961;0.946;0.961	D	0.86560	0.1840	10	0.87932	D	0	-16.6866	11.9726	0.53071	0.0:1.0:0.0:0.0	.	249;249;247	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	A	249	ENSP00000246802:P249A	ENSP00000246802:P249A	P	+	1	0	GLTSCR2	52947656	1.000000	0.71417	0.991000	0.47740	0.097000	0.18754	5.573000	0.67417	2.279000	0.76181	0.462000	0.41574	CCA		0.652	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710		6	22	0	0	0	0.001984	0	6	22				
SLC8A1	6546	broad.mit.edu	37	2	40655729	40655729	+	Silent	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:40655729A>G	ENST00000403092.1	-	2	1725	c.1692T>C	c.(1690-1692)tcT>tcC	p.S564S	SLC8A1_ENST00000405269.1_Silent_p.S564S|SLC8A1_ENST00000406785.2_Silent_p.S564S|SLC8A1_ENST00000408028.2_Silent_p.S564S|SLC8A1_ENST00000405901.3_Silent_p.S564S|SLC8A1_ENST00000406391.2_Silent_p.S564S|SLC8A1_ENST00000332839.4_Silent_p.S564S|SLC8A1_ENST00000542756.1_Silent_p.S564S|SLC8A1_ENST00000402441.1_Silent_p.S564S|SLC8A1_ENST00000542024.1_Silent_p.S564S			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	564	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.S564S(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CTCGAGCTCCAGATGTTCTCA	0.458																																							uc002rrx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1690-1692)TCT>TCC		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						141.0	143.0	142.0					2																	40655729		2203	4300	6503	SO:0001819	synonymous_variant	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40655729A>G		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1692T>C	2.37:g.40655729A>G			Somatic				SLC8A1_uc002rry.2_Silent_p.S564S|SLC8A1_uc002rrz.2_Silent_p.S564S|SLC8A1_uc002rsa.2_Silent_p.S564S|SLC8A1_uc002rsd.3_Silent_p.S564S|SLC8A1_uc002rsb.1_Silent_p.S564S|SLC8A1_uc010fan.1_Silent_p.S564S|SLC8A1_uc002rsc.1_Silent_p.S564S	p.S564S	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	1716	-			564			Calx-beta 2.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	c.1692T>C	CCDS1806.1																																																																																				0.458	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		11	201	0	0	0	0.010729	0	11	201				
THADA	63892	broad.mit.edu	37	2	43519314	43519314	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:43519314C>G	ENST00000405006.4	-	33	5217	c.4866G>C	c.(4864-4866)caG>caC	p.Q1622H	THADA_ENST00000415080.2_Missense_Mutation_p.Q1303H|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Missense_Mutation_p.Q1622H	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1622								p.Q1622H(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGTGCTCCGTCTGGGGAAGCC	0.478																																							uc002rsw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(4864-4866)CAG>CAC		thyroid adenoma associated							49.0	52.0	51.0					2																	43519314		1951	4135	6086	SO:0001583	missense	63892						binding	g.chr2:43519314C>G	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4866G>C	2.37:g.43519314C>G	ENSP00000385995:p.Gln1622His		Somatic				THADA_uc010far.2_Missense_Mutation_p.Q817H|THADA_uc002rsx.3_Missense_Mutation_p.Q1622H|THADA_uc002rsy.3_RNA	p.Q1622H	NM_001083953	NP_001077422	WXS	Illumina HiSeq	Unspecified	Q6YHU6	THADA_HUMAN			33	5218	-		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)	1622					A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	c.4866G>C	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.124|8.124	0.781582|0.781582	0.16120|0.16120	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.12255|.	2.9;2.7;2.9|.	5.33|5.33	-0.245|-0.245	0.13027|0.13027	.|.	1.345640|.	0.04620|.	N|.	0.401778|.	T|T	0.28300|0.28300	0.0699|0.0699	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	B;B|.	0.25272|.	0.122;0.001|.	B;B|.	0.22386|.	0.039;0.002|.	T|T	0.27365|0.27365	-1.0076|-1.0076	10|5	0.12103|.	T|.	0.63|.	.|.	12.1372|12.1372	0.53979|0.53979	0.0:0.2667:0.6552:0.0781|0.0:0.2667:0.6552:0.0781	.|.	1549;1622|.	B6ZDQ0;Q6YHU6|.	.;THADA_HUMAN|.	H|T	1622;1549;1303;1622|862	ENSP00000386088:Q1622H;ENSP00000416048:Q1303H;ENSP00000385995:Q1622H|.	ENSP00000349464:Q1549H|.	Q|R	-|-	3|2	2|0	THADA|THADA	43372818|43372818	0.126000|0.126000	0.22350|0.22350	0.456000|0.456000	0.27044|0.27044	0.407000|0.407000	0.30961|0.30961	-0.346000|-0.346000	0.07760|0.07760	-0.049000|-0.049000	0.13379|0.13379	0.644000|0.644000	0.83932|0.83932	CAG|AGA		0.478	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		7	23	0	0	0	0.004482	0	7	23				
ADD2	119	broad.mit.edu	37	2	70933523	70933523	+	Silent	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:70933523G>T	ENST00000264436.4	-	3	462	c.18C>A	c.(16-18)gtC>gtA	p.V6V	ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000413157.2_Silent_p.V6V|ADD2_ENST00000407644.2_Silent_p.V6V|ADD2_ENST00000355733.3_Silent_p.V6V|ADD2_ENST00000430656.1_Silent_p.V22V	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	6					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.V6V(2)|p.V22V(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CAGCCTCGGGGACCGTCTCTT	0.647																																							uc002sgz.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)|pancreas(1)	3						c.(16-18)GTC>GTA		adducin 2 isoform a							47.0	49.0	48.0					2																	70933523		2202	4300	6502	SO:0001819	synonymous_variant	119				actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding	g.chr2:70933523G>T	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.18C>A	2.37:g.70933523G>T			Somatic				ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Silent_p.V6V|ADD2_uc002sha.2_Silent_p.V6V|ADD2_uc002sgx.2_Silent_p.V6V|ADD2_uc010fdt.1_Silent_p.V6V|ADD2_uc002shc.1_Silent_p.V6V|ADD2_uc002shd.1_Silent_p.V6V|ADD2_uc010fdu.1_Silent_p.V22V	p.V6V	NM_001617	NP_001608	WXS	Illumina HiSeq	Unspecified	P35612	ADDB_HUMAN			3	483	-			6					A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	37	c.18C>A	CCDS1906.1																																																																																				0.647	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617		27	70	1	0	9.39395e-14	0.00632	1.0964e-13	27	70				
SNRNP200	23020	broad.mit.edu	37	2	96944390	96944390	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:96944390C>A	ENST00000323853.5	-	38	5460	c.5383G>T	c.(5383-5385)Gac>Tac	p.D1795Y	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1795					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.D1795Y(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TGCTCCAGGTCACTCAGGGTC	0.567																																							uc002svu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|large_intestine(1)	10						c.(5383-5385)GAC>TAC		activating signal cointegrator 1 complex subunit							96.0	91.0	93.0					2																	96944390		2203	4300	6503	SO:0001583	missense	23020					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr2:96944390C>A	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5383G>T	2.37:g.96944390C>A	ENSP00000317123:p.Asp1795Tyr		Somatic				SNRNP200_uc002svt.2_Missense_Mutation_p.D405Y|SNRNP200_uc010yuj.1_RNA	p.D1795Y	NM_014014	NP_054733	WXS	Illumina HiSeq	Unspecified	O75643	U520_HUMAN			38	5469	-			1795					O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	c.5383G>T	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238046	0.79800	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	T	0.40476	1.03	5.77	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	H	0.96889	3.9	0.80722	D	1	P	0.46457	0.878	P	0.45577	0.486	T	0.76260	-0.3024	10	0.87932	D	0	-23.4521	13.5245	0.61586	0.0:0.9236:0.0:0.0764	.	1795	O75643	U520_HUMAN	Y	1795;254;378	ENSP00000317123:D1795Y	ENSP00000317123:D1795Y	D	-	1	0	SNRNP200	96308117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.707000	0.61852	2.884000	0.98904	0.655000	0.94253	GAC		0.567	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		25	55	1	0	1.64293e-13	0.01892	1.9069e-13	25	55				
POTEF	728378	broad.mit.edu	37	2	130877669	130877669	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:130877669C>T	ENST00000409914.2	-	3	819	c.420G>A	c.(418-420)ctG>ctA	p.L140L	POTEF_ENST00000360967.5_Silent_p.L140L|POTEF_ENST00000357462.5_Silent_p.L140L|POTEF_ENST00000361163.4_Silent_p.L140L	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	140					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.L140L(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GGAGCTTGTCCAGATCTTCTC	0.572																																							uc010fmh.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|ovary(2)	5						c.(418-420)CTG>CTA		prostate, ovary, testis expressed protein on							43.0	52.0	49.0					2																	130877669		2200	4295	6495	SO:0001819	synonymous_variant	728378					cell cortex	ATP binding	g.chr2:130877669C>T	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.420G>A	2.37:g.130877669C>T			Somatic					p.L140L	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			3	820	-			140					A6NC34	Silent	SNP	ENST00000409914.2	37	c.420G>A	CCDS46409.1																																																																																				0.572	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		31	101	0	0	0	0.027894	0	31	101				
POTEE	445582	broad.mit.edu	37	2	131976395	131976395	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:131976395G>A	ENST00000356920.5	+	1	514	c.420G>A	c.(418-420)ctG>ctA	p.L140L	PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_Silent_p.L140L|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	140					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.L140L(2)									GAGAAGATCTGGACAAGCTCC	0.577																																							uc002tsn.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(418-420)CTG>CTA		protein expressed in prostate, ovary, testis,							49.0	53.0	51.0					2																	131976395		2202	4297	6499	SO:0001819	synonymous_variant	445582						ATP binding	g.chr2:131976395G>A	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.420G>A	2.37:g.131976395G>A			Somatic				PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	p.L140L	NM_001083538	NP_001077007	WXS	Illumina HiSeq	Unspecified	Q6S8J3	POTEE_HUMAN			1	472	+			140					Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	c.420G>A	CCDS46414.1																																																																																				0.577	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		6	139	0	0	0	0.016723	0	6	139				
LRP1B	53353	broad.mit.edu	37	2	141081555	141081555	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:141081555G>C	ENST00000389484.3	-	81	13392	c.12421C>G	c.(12421-12423)Caa>Gaa	p.Q4141E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4141					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Q4141E(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCAAATTTTTGAACTCGAAAT	0.308										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12421-12423)CAA>GAA		low density lipoprotein-related protein 1B							67.0	75.0	72.0					2																	141081555		2203	4286	6489	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141081555G>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12421C>G	2.37:g.141081555G>C	ENSP00000374135:p.Gln4141Glu	TSP Lung(27;0.18)	Somatic					p.Q4141E	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	81	13393	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4141			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12421C>G	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.71|16.71	3.199982|3.199982	0.58126|0.58126	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977|ENST00000389484;ENST00000544579	.|D	.|0.90732	.|-2.72	5.67|5.67	4.74|4.74	0.60224|0.60224	.|Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.|0.210963	.|0.39210	.|N	.|0.001438	D|D	0.83243|0.83243	0.5212|0.5212	N|N	0.12961|0.12961	0.28|0.28	0.34768|0.34768	D|D	0.733422|0.733422	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	D|D	0.83367|0.83367	0.0005|0.0005	5|10	.|0.52906	.|T	.|0.07	.|.	16.0963|16.0963	0.81127|0.81127	0.0:0.1337:0.8662:0.0|0.0:0.1337:0.8662:0.0	.|.	.|4141	.|Q9NZR2	.|LRP1B_HUMAN	L|E	372|4141;4079	.|ENSP00000374135:Q4141E	.|ENSP00000374135:Q4141E	F|Q	-|-	3|1	2|0	LRP1B|LRP1B	140798025|140798025	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.368000|4.368000	0.59505|0.59505	2.679000|2.679000	0.91253|0.91253	0.655000|0.655000	0.94253|0.94253	TTC|CAA		0.308	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		31	137	0	0	0	0.009535	0	31	137				
LY75	4065	broad.mit.edu	37	2	160661621	160661621	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:160661621G>A	ENST00000263636.4	-	35	5130	c.5103C>T	c.(5101-5103)ttC>ttT	p.F1701F	LY75-CD302_ENST00000504764.1_Intron|LY75-CD302_ENST00000505052.1_Intron|LY75_ENST00000554112.1_Intron|LY75_ENST00000553424.1_Intron	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1701					endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.F1701F(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GAACTGATGAGAAACCCGCCA	0.408																																							uc002ubc.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(5101-5103)TTC>TTT		lymphocyte antigen 75 precursor							91.0	86.0	88.0					2																	160661621		2203	4300	6503	SO:0001819	synonymous_variant	4065				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding	g.chr2:160661621G>A	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.5103C>T	2.37:g.160661621G>A			Somatic				LY75_uc002ubb.3_Intron|LY75_uc010fos.2_Intron	p.F1701F	NM_002349	NP_002340	WXS	Illumina HiSeq	Unspecified	O60449	LY75_HUMAN		COAD - Colon adenocarcinoma(177;0.132)	35	5172	-			1701			Cytoplasmic (Potential).		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	ENST00000263636.4	37	c.5103C>T	CCDS2211.1																																																																																				0.408	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			19	50	0	0	0	0.008871	0	19	50				
PLA2R1	22925	broad.mit.edu	37	2	160884750	160884750	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:160884750G>A	ENST00000283243.7	-	6	1284	c.1078C>T	c.(1078-1080)Cac>Tac	p.H360Y	PLA2R1_ENST00000392771.1_Missense_Mutation_p.H360Y	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	360					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.H360Y(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TGATCAATGTGGTTTAGATAT	0.343																																							uc002ube.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1078-1080)CAC>TAC		phospholipase A2 receptor 1 isoform 1 precursor							105.0	115.0	112.0					2																	160884750		2203	4300	6503	SO:0001583	missense	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160884750G>A	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1078C>T	2.37:g.160884750G>A	ENSP00000283243:p.His360Tyr		Somatic				PLA2R1_uc010zcp.1_Missense_Mutation_p.H360Y|PLA2R1_uc002ubf.2_Missense_Mutation_p.H360Y	p.H360Y	NM_007366	NP_031392	WXS	Illumina HiSeq	Unspecified	Q13018	PLA2R_HUMAN			6	1285	-			360			Extracellular (Potential).		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	c.1078C>T	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588480	0.28357	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.07114	3.27;3.22	5.8	2.94	0.34122	C-type lectin-like (1);	0.699358	0.15226	N	0.273669	T	0.08492	0.0211	L	0.51422	1.61	0.24581	N	0.993877	B;P;P	0.40398	0.215;0.666;0.716	B;B;B	0.34180	0.018;0.175;0.177	T	0.13469	-1.0508	10	0.59425	D	0.04	.	10.1679	0.42890	0.0:0.1326:0.5926:0.2749	.	360;360;360	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	Y	360	ENSP00000283243:H360Y;ENSP00000376524:H360Y	ENSP00000283243:H360Y	H	-	1	0	PLA2R1	160592996	0.016000	0.18221	0.832000	0.32986	0.954000	0.61252	0.630000	0.24553	0.329000	0.23460	0.655000	0.94253	CAC		0.343	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			8	105	0	0	0	0.004482	0	8	105				
SCN3A	6328	broad.mit.edu	37	2	165947525	165947525	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:165947525C>A	ENST00000360093.3	-	28	5629	c.5138G>T	c.(5137-5139)gGa>gTa	p.G1713V	SCN3A_ENST00000409101.3_Missense_Mutation_p.G1664V|SCN3A_ENST00000540861.1_Missense_Mutation_p.G196V|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Missense_Mutation_p.G1713V|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1713					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.G1664V(1)|p.G1713V(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTAGCAATCCATCCCAGCC	0.468																																							uc002ucx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(5137-5139)GGA>GTA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						167.0	167.0	167.0					2																	165947525		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165947525C>A	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5138G>T	2.37:g.165947525C>A	ENSP00000353206:p.Gly1713Val		Somatic				SCN3A_uc010zcy.1_Missense_Mutation_p.G196V|SCN3A_uc002ucy.2_Missense_Mutation_p.G1664V|SCN3A_uc002ucz.2_Missense_Mutation_p.G1664V	p.G1713V	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			28	5630	-			1713					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.5138G>T		.	.	.	.	.	.	.	.	.	.	C	15.64	2.893394	0.52121	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.95	5.07	0.68467	.	0.000000	0.64402	D	0.000006	D	0.98855	0.9613	M	0.93328	3.405	0.80722	D	1	P;D;D	0.89917	0.956;1.0;0.997	P;D;P	0.91635	0.656;0.999;0.835	D	0.99501	1.0953	10	0.87932	D	0	.	16.7798	0.85560	0.1299:0.8701:0.0:0.0	.	1664;1664;1713	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	V	1713;1713;1664;196	ENSP00000353206:G1713V;ENSP00000283254:G1713V;ENSP00000386726:G1664V;ENSP00000439920:G196V	ENSP00000283254:G1713V	G	-	2	0	SCN3A	165655771	0.987000	0.35691	0.674000	0.29902	0.933000	0.57130	4.060000	0.57477	1.532000	0.49169	0.650000	0.86243	GGA		0.468	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		75	169	1	0	1.51875e-23	0.01441	1.8607e-23	75	169				
XIRP2	129446	broad.mit.edu	37	2	168096470	168096470	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:168096470G>A	ENST00000409728.1	+	7	1152	c.1063G>A	c.(1063-1065)Gaa>Aaa	p.E355K	XIRP2_ENST00000409195.1_Missense_Mutation_p.E322K|XIRP2_ENST00000409043.1_Missense_Mutation_p.E322K|XIRP2_ENST00000409756.2_Missense_Mutation_p.E322K|XIRP2_ENST00000295237.9_Missense_Mutation_p.E322K|XIRP2_ENST00000409605.1_Missense_Mutation_p.E100K|XIRP2_ENST00000409273.1_Missense_Mutation_p.E100K|XIRP2_ENST00000420519.1_Missense_Mutation_p.E355K	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	147					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E322K(1)|p.E355K(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCATGGAACAGAAATGGTAAC	0.378																																							uc002udx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(7)|ovary(6)|pancreas(1)	14						c.(964-966)GAA>AAA		xin actin-binding repeat containing 2 isoform 1							80.0	80.0	80.0					2																	168096470		1867	4101	5968	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168096470G>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1063G>A	2.37:g.168096470G>A	ENSP00000386619:p.Glu355Lys		Somatic				XIRP2_uc010fpn.2_Missense_Mutation_p.E355K|XIRP2_uc010fpo.2_Missense_Mutation_p.E322K|XIRP2_uc010fpp.2_Missense_Mutation_p.E322K|XIRP2_uc002udy.2_Missense_Mutation_p.E147K|XIRP2_uc010fpq.2_Missense_Mutation_p.E100K|XIRP2_uc010fpr.2_Missense_Mutation_p.E100K	p.E322K	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			5	982	+			147					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	c.964G>A	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166666	0.38217	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;4.23;-1.09;-1.09;4.23;4.24;-1.08	5.17	4.28	0.50868	.	0.359578	0.29119	N	0.013093	T	0.70919	0.3279	L	0.54323	1.7	0.37281	D	0.907843	B;P;P;B;B	0.37370	0.001;0.592;0.592;0.001;0.001	B;B;B;B;B	0.34873	0.005;0.143;0.191;0.006;0.009	T	0.75811	-0.3186	10	0.52906	T	0.07	-10.8081	10.6166	0.45454	0.0921:0.0:0.9079:0.0	.	147;322;355;147;100	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	K	322;355;322;322;355;322;100;100	ENSP00000386454:E322K;ENSP00000386619:E355K;ENSP00000386840:E322K;ENSP00000386724:E322K;ENSP00000415541:E355K;ENSP00000295237:E322K;ENSP00000387255:E100K;ENSP00000386981:E100K	ENSP00000295237:E322K	E	+	1	0	XIRP2	167804716	1.000000	0.71417	1.000000	0.80357	0.146000	0.21551	2.822000	0.48073	1.488000	0.48433	0.650000	0.86243	GAA		0.378	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381		7	62	0	0	0	0.001984	0	7	62				
KIAA1715	80856	broad.mit.edu	37	2	176794750	176794750	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:176794750C>A	ENST00000272748.4	-	13	1479	c.1232G>T	c.(1231-1233)gGa>gTa	p.G411V	KIAA1715_ENST00000535310.1_3'UTR|KIAA1715_ENST00000544803.1_Missense_Mutation_p.G442V	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	411					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.G411V(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			AGAATCAGCTCCAGGAACTGT	0.433																																							uc002ukc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1231-1233)GGA>GTA		Lunapark							162.0	152.0	156.0					2																	176794750		2203	4300	6503	SO:0001583	missense	80856					integral to membrane	protein binding	g.chr2:176794750C>A	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.1232G>T	2.37:g.176794750C>A	ENSP00000272748:p.Gly411Val		Somatic				KIAA1715_uc010zer.1_Missense_Mutation_p.G442V|KIAA1715_uc010fqw.1_Missense_Mutation_p.G477V|KIAA1715_uc010zes.1_Missense_Mutation_p.G413V|KIAA1715_uc002ukd.1_Missense_Mutation_p.G288V|KIAA1715_uc010zet.1_RNA	p.G411V	NM_030650	NP_085153	WXS	Illumina HiSeq	Unspecified	Q9C0E8	LNP_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0793)		13	1425	-			411			Cytoplasmic (Potential).		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	37	c.1232G>T	CCDS33332.1	.	.	.	.	.	.	.	.	.	.	c	1.197	-0.633620	0.03584	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803	.	.	.	5.57	-0.374	0.12512	.	0.927785	0.09271	N	0.825088	T	0.15652	0.0377	N	0.08118	0	0.09310	N	0.999998	B;B;B;B	0.09022	0.002;0.001;0.0;0.0	B;B;B;B	0.06405	0.002;0.002;0.001;0.001	T	0.25328	-1.0135	9	0.87932	D	0	0.9261	0.9091	0.01291	0.1648:0.2589:0.3246:0.2516	.	413;442;408;411	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	V	411;413;288;442	.	ENSP00000272748:G411V	G	-	2	0	KIAA1715	176502996	0.001000	0.12720	0.001000	0.08648	0.169000	0.22640	0.287000	0.18920	0.062000	0.16340	0.598000	0.82781	GGA		0.433	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834		43	76	1	0	1.76056e-25	0.011902	2.17603e-25	43	76				
HOXD3	3232	broad.mit.edu	37	2	177034065	177034065	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:177034065C>A	ENST00000468418.3	+	3	2313	c.223C>A	c.(223-225)Cct>Act	p.P75T	HOXD3_ENST00000249440.3_Missense_Mutation_p.P75T|HOXD3_ENST00000410016.1_Missense_Mutation_p.P75T			P31249	HXD3_HUMAN	homeobox D3	75					anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P75T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		GAGCTCTGCCCCTCTGAGAGC	0.667																																							uc002ukt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(223-225)CCT>ACT		homeobox D3							50.0	52.0	51.0					2																	177034065		2203	4300	6503	SO:0001583	missense	3232				anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:177034065C>A		CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.223C>A	2.37:g.177034065C>A	ENSP00000424734:p.Pro75Thr		Somatic					p.P75T	NM_006898	NP_008829	WXS	Illumina HiSeq	Unspecified	P31249	HXD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)	2	399	+			75					Q99955|Q9BSC5	Missense_Mutation	SNP	ENST00000468418.3	37	c.223C>A	CCDS2270.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062562	0.55432	.	.	ENSG00000128652	ENST00000432796;ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.89196	-2.48;-2.48;-2.48	5.48	4.6	0.57074	.	0.162308	0.43747	D	0.000534	D	0.83348	0.5235	L	0.44542	1.39	0.32580	N	0.528658	B	0.09022	0.002	B	0.06405	0.002	T	0.81737	-0.0796	10	0.36615	T	0.2	.	9.8711	0.41175	0.0:0.7869:0.1389:0.0742	.	75	P31249	HXD3_HUMAN	T	75	ENSP00000424734:P75T;ENSP00000386498:P75T;ENSP00000249440:P75T	ENSP00000249440:P75T	P	+	1	0	HOXD3	176742311	0.244000	0.23889	1.000000	0.80357	0.991000	0.79684	1.874000	0.39568	1.446000	0.47643	0.655000	0.94253	CCT		0.667	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334246.4			25	58	1	0	5.35356e-11	0.016522	6.14559e-11	25	58				
RBM45	129831	broad.mit.edu	37	2	178981066	178981066	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:178981066G>A	ENST00000286070.5	+	2	470	c.378G>A	c.(376-378)atG>atA	p.M126I		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	126	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.M126I(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TCTTTGTTATGATACCAAAGT	0.373																																							uc002ulv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(376-378)ATG>ATA		RNA binding motif protein 45							135.0	136.0	135.0					2																	178981066		2203	4300	6503	SO:0001583	missense	129831				cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding	g.chr2:178981066G>A	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.378G>A	2.37:g.178981066G>A	ENSP00000286070:p.Met126Ile		Somatic					p.M126I	NM_152945	NP_694453	WXS	Illumina HiSeq	Unspecified	Q8IUH3	RBM45_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)		2	470	+			126			RRM 2.		Q6NYL0|Q8NFC9	Missense_Mutation	SNP	ENST00000286070.5	37	c.378G>A	CCDS33335.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045822	0.36085	.	.	ENSG00000155636	ENST00000286070	D	0.85556	-2.0	5.95	5.08	0.68730	.	0.077462	0.85682	D	0.000000	T	0.68302	0.2986	N	0.03016	-0.435	0.58432	D	0.999995	B	0.29301	0.241	B	0.28011	0.085	T	0.66925	-0.5800	10	0.27785	T	0.31	-13.1028	14.2905	0.66275	0.0708:0.0:0.9292:0.0	.	126	Q8IUH3-3	.	I	126	ENSP00000286070:M126I	ENSP00000286070:M126I	M	+	3	0	RBM45	178689312	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.479000	0.66813	1.531000	0.49152	-0.140000	0.14226	ATG		0.373	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945		29	159	0	0	0	0.007291	0	29	159				
TTN	7273	broad.mit.edu	37	2	179438325	179438325	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:179438325T>G	ENST00000591111.1	-	276	67835	c.67611A>C	c.(67609-67611)caA>caC	p.Q22537H	TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q15305H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q24178H|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q15113H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q21610H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q15238H			Q8WZ42	TITIN_HUMAN	titin	22537	Fibronectin type-III 63. {ECO:0000255|PROSITE-ProRule:PRU00316}.		Q -> H (in a gastric adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q15113H(2)|p.Q15305H(1)|p.Q21608H(1)|p.Q15238H(1)|p.Q21610H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTTGTTACTTGGACTTCTG	0.423																																							uc010zfg.1		NA																	6	Substitution - Missense(6)	p.Q15113H(1)	lung(5)|stomach(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(64828-64830)CAA>CAC		titin isoform N2-A							281.0	277.0	278.0					2																	179438325		1937	4134	6071	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179438325T>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67611A>C	2.37:g.179438325T>G	ENSP00000465570:p.Gln22537His		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q15305H|TTN_uc010zfi.1_Missense_Mutation_p.Q15238H|TTN_uc010zfj.1_Missense_Mutation_p.Q15113H	p.Q21610H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	65054	-			22537					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.64830A>C		.	.	.	.	.	.	.	.	.	.	T	9.969	1.224929	0.22457	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	6.08	-1.33	0.09172	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57154	0.2034	L	0.44542	1.39	0.41931	D	0.990567	D;D;D;D	0.57257	0.979;0.979;0.979;0.979	P;P;P;P	0.60345	0.873;0.873;0.873;0.873	T	0.61178	-0.7115	9	0.87932	D	0	.	11.7639	0.51920	0.0:0.4467:0.0:0.5533	.	15113;15238;15305;22537	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	21610;15113;15305;15238;15111	ENSP00000343764:Q21610H;ENSP00000434586:Q15113H;ENSP00000340554:Q15305H;ENSP00000352154:Q15238H	ENSP00000340554:Q15305H	Q	-	3	2	TTN	179146571	0.215000	0.23574	0.985000	0.45067	0.992000	0.81027	0.207000	0.17395	-0.019000	0.14055	0.533000	0.62120	CAA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	515	0	0	0	0.004482	0	9	515				
TTN	7273	broad.mit.edu	37	2	179579143	179579143	+	Silent	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:179579143A>C	ENST00000591111.1	-	89	25631	c.25407T>G	c.(25405-25407)tcT>tcG	p.S8469S	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.S8786S|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.S7542S|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	12637	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S7542S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTGAATAAGAAATCCATA	0.413																																							uc010zfg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(22624-22626)TCT>TCG		titin isoform N2-A							91.0	85.0	87.0					2																	179579143		1854	4091	5945	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179579143A>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25407T>G	2.37:g.179579143A>C			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.S4203S	p.S7542S	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		88	22850	-			8469					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.22626T>G																																																																																					0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	83	0	0	0	0.006214	0	9	83				
TTN	7273	broad.mit.edu	37	2	179579856	179579856	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:179579856C>T	ENST00000591111.1	-	88	25330	c.25106G>A	c.(25105-25107)gGc>gAc	p.G8369D	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G8686D|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G7442D|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	12543	Ig-like 66.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G7442D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACTTCTTGCCGCTCCTAAG	0.443																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(22324-22326)GGC>GAC		titin isoform N2-A							327.0	308.0	314.0					2																	179579856		1930	4126	6056	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179579856C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25106G>A	2.37:g.179579856C>T	ENSP00000465570:p.Gly8369Asp		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G4103D	p.G7442D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		87	22549	-			8369					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.22325G>A		.	.	.	.	.	.	.	.	.	.	C	16.73	3.205284	0.58234	.	.	ENSG00000155657	ENST00000342992	T	0.41400	1.0	5.62	5.62	0.85841	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39963	0.1098	N	0.25825	0.765	0.80722	D	1	B	0.29671	0.254	B	0.35770	0.21	T	0.34925	-0.9809	9	0.87932	D	0	.	19.6592	0.95857	0.0:1.0:0.0:0.0	.	8369	Q8WZ42	TITIN_HUMAN	D	7442	ENSP00000343764:G7442D	ENSP00000343764:G7442D	G	-	2	0	TTN	179288101	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.672000	0.46850	2.653000	0.90120	0.655000	0.94253	GGC		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		5	362	0	0	0	0.021553	0	5	362				
TTN	7273	broad.mit.edu	37	2	179604934	179604934	+	Silent	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:179604934T>C	ENST00000591111.1	-	46	12299	c.12075A>G	c.(12073-12075)aaA>aaG	p.K4025K	TTN_ENST00000342175.6_Silent_p.K4171K|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Silent_p.K4342K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Silent_p.K3979K|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Silent_p.K4104K			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K4104K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATGCTCTTCTTTGAGCAGTA	0.473																																							uc010zfh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12511-12513)AAA>AAG		titin isoform novex-2							100.0	98.0	99.0					2																	179604934		1900	4126	6026	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179604934T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12075A>G	2.37:g.179604934T>C			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.K4104K|TTN_uc010zfj.1_Silent_p.K3979K|TTN_uc002umz.1_Intron	p.K4171K	NM_133437	NP_597681	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	12737	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.12513A>G																																																																																					0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	156	0	0	0	0.009096	0	4	156				
DUSP19	142679	broad.mit.edu	37	2	183943759	183943759	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:183943759A>G	ENST00000354221.4	+	1	273	c.98A>G	c.(97-99)gAa>gGa	p.E33G	DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.E33G	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	33					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.E33G(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						AAAATTATAGAAACATGGAAA	0.453																																							uc002upd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(97-99)GAA>GGA		dual specificity phosphatase 19 isoform 1							126.0	128.0	127.0					2																	183943759		2203	4300	6503	SO:0001583	missense	142679				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity	g.chr2:183943759A>G	AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.98A>G	2.37:g.183943759A>G	ENSP00000346160:p.Glu33Gly		Somatic				DUSP19_uc010frp.2_Missense_Mutation_p.E33G|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_Missense_Mutation_p.E33G	p.E33G	NM_080876	NP_543152	WXS	Illumina HiSeq	Unspecified	Q8WTR2	DUS19_HUMAN			1	473	+			33					B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	c.98A>G	CCDS2289.1	.	.	.	.	.	.	.	.	.	.	A	33	5.276691	0.95459	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	T;T	0.21361	2.01;3.54	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.46034	0.1372	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.38329	-0.9666	10	0.87932	D	0	.	16.4957	0.84242	1.0:0.0:0.0:0.0	.	33;33	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	G	33	ENSP00000343905:E33G;ENSP00000346160:E33G	ENSP00000343905:E33G	E	+	2	0	DUSP19	183652004	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.233000	0.89799	2.371000	0.80710	0.533000	0.62120	GAA		0.453	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			18	35	0	0	0	0.010504	0	18	35				
ZNF804A	91752	broad.mit.edu	37	2	185802437	185802437	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:185802437C>T	ENST00000302277.6	+	4	2908	c.2314C>T	c.(2314-2316)Cgt>Tgt	p.R772C		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	772							metal ion binding (GO:0046872)	p.R772C(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CTATCGAAAACGTAGACAACA	0.343																																							uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(2314-2316)CGT>TGT		zinc finger protein 804A							54.0	56.0	55.0					2																	185802437		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185802437C>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2314C>T	2.37:g.185802437C>T	ENSP00000303252:p.Arg772Cys		Somatic					p.R772C	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2908	+			772					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.2314C>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.401501	0.62288	.	.	ENSG00000170396	ENST00000302277	T	0.17054	2.3	5.96	5.01	0.66863	.	0.000000	0.56097	D	0.000039	T	0.38374	0.1038	L	0.55481	1.735	0.48830	D	0.999714	D	0.89917	1.0	D	0.75484	0.986	T	0.06058	-1.0848	10	0.87932	D	0	-11.9814	17.0512	0.86519	0.1353:0.8647:0.0:0.0	.	772	Q7Z570	Z804A_HUMAN	C	772	ENSP00000303252:R772C	ENSP00000303252:R772C	R	+	1	0	ZNF804A	185510682	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	2.828000	0.48120	2.826000	0.97356	0.655000	0.94253	CGT		0.343	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		29	75	0	0	0	0.009535	0	29	75				
FZD7	8324	broad.mit.edu	37	2	202899457	202899457	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:202899457C>T	ENST00000286201.1	+	1	148	c.87C>T	c.(85-87)ggC>ggT	p.G29G	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	29					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G29G(1)		breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TGTCCGCGGGCGCCGGGGCGC	0.731																																							uc002uyw.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(85-87)GGC>GGT		frizzled 7 precursor							37.0	37.0	37.0					2																	202899457		2202	4299	6501	SO:0001819	synonymous_variant	8324				axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|mesenchymal to epithelial transition|negative regulation of cell-substrate adhesion|negative regulation of ectodermal cell fate specification|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent|regulation of catenin import into nucleus|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr2:202899457C>T	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.87C>T	2.37:g.202899457C>T			Somatic					p.G29G	NM_003507	NP_003498	WXS	Illumina HiSeq	Unspecified	O75084	FZD7_HUMAN			1	148	+			29					O94816|Q53S59|Q96B74	Silent	SNP	ENST00000286201.1	37	c.87C>T	CCDS2351.1																																																																																				0.731	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507		28	36	0	0	0	0.024334	0	28	36				
PARD3B	117583	broad.mit.edu	37	2	205969185	205969185	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:205969185G>C	ENST00000406610.2	+	5	747	c.540G>C	c.(538-540)ttG>ttC	p.L180F	PARD3B_ENST00000351153.1_Missense_Mutation_p.L180F|PARD3B_ENST00000462231.1_Missense_Mutation_p.L180F|PARD3B_ENST00000349953.3_Missense_Mutation_p.L180F|PARD3B_ENST00000358768.2_Missense_Mutation_p.L180F	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	180					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.L180F(2)|p.L181F(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GAGAAGTTTTGAATGGTGTAC	0.333																																							uc002var.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|ovary(1)|breast(1)	4						c.(538-540)TTG>TTC		par-3 partitioning defective 3 homolog B isoform							139.0	139.0	139.0					2																	205969185		1855	4102	5957	SO:0001583	missense	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:205969185G>C	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.540G>C	2.37:g.205969185G>C	ENSP00000385848:p.Leu180Phe		Somatic				PARD3B_uc010fub.1_Missense_Mutation_p.L180F|PARD3B_uc002vao.1_Missense_Mutation_p.L180F|PARD3B_uc002vap.1_Missense_Mutation_p.L180F|PARD3B_uc002vaq.1_Missense_Mutation_p.L180F	p.L180F	NM_152526	NP_689739	WXS	Illumina HiSeq	Unspecified	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	5	747	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)	180					E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37	c.540G>C		.	.	.	.	.	.	.	.	.	.	G	2.782	-0.253286	0.05829	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.12361	2.88;2.69;2.88;2.89	5.38	4.49	0.54785	PDZ/DHR/GLGF (1);	0.573879	0.18746	N	0.132336	T	0.07324	0.0185	N	0.08118	0	0.19945	N	0.999945	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.16867	-1.0388	10	0.54805	T	0.06	.	9.3314	0.38023	0.0966:0.0:0.9034:0.0	.	180;180;180;180;180	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	F	180	ENSP00000385848:L180F;ENSP00000351618:L180F;ENSP00000317261:L180F;ENSP00000340280:L180F	ENSP00000340280:L180F	L	+	3	2	PARD3B	205677430	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	2.074000	0.41529	2.668000	0.90789	0.591000	0.81541	TTG		0.333	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177		33	113	0	0	0	0.023175	0	33	113				
PARD3B	117583	broad.mit.edu	37	2	206036935	206036935	+	Splice_Site	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:206036935G>A	ENST00000406610.2	+	12	1828	c.1621G>A	c.(1621-1623)Gat>Aat	p.D541N	PARD3B_ENST00000351153.1_Splice_Site_p.D541N|PARD3B_ENST00000462231.1_Splice_Site_p.D541N|PARD3B_ENST00000349953.3_Splice_Site_p.D541N|PARD3B_ENST00000358768.2_Splice_Site_p.D479N	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	541	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.D480N(1)|p.D479N(1)|p.D541N(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TCTGCCTTAGGATGGTCGTCT	0.398																																							uc002var.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|ovary(1)|breast(1)	4						c.(1621-1623)GAT>AAT		par-3 partitioning defective 3 homolog B isoform							103.0	95.0	98.0					2																	206036935		1904	4123	6027	SO:0001630	splice_region_variant	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:206036935G>A	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1621-1G>A	2.37:g.206036935G>A			Somatic				PARD3B_uc010fub.1_Missense_Mutation_p.D541N|PARD3B_uc002vao.1_Missense_Mutation_p.D541N|PARD3B_uc002vap.1_Missense_Mutation_p.D479N|PARD3B_uc002vaq.1_Missense_Mutation_p.D541N	p.D541N	NM_152526	NP_689739	WXS	Illumina HiSeq	Unspecified	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	12	1828	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)	541			PDZ 3.		E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37	c.1621G>A		.	.	.	.	.	.	.	.	.	.	G	26.3	4.728291	0.89390	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.30182	1.54;2.15;1.54;1.54	5.65	5.65	0.86999	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	M	0.68952	2.095	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	T	0.51973	-0.8637	9	.	.	.	.	19.733	0.96192	0.0:0.0:1.0:0.0	.	541;541;541;479;541	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	N	541;479;541;541	ENSP00000385848:D541N;ENSP00000351618:D479N;ENSP00000317261:D541N;ENSP00000340280:D541N	.	D	+	1	0	PARD3B	205745180	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	9.476000	0.97823	2.665000	0.90641	0.585000	0.79938	GAT		0.398	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	Missense_Mutation	13	75	0	0	0	0.020292	0	13	75				
PTH2R	5746	broad.mit.edu	37	2	209355384	209355384	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:209355384C>T	ENST00000272847.2	+	12	1449	c.1236C>T	c.(1234-1236)atC>atT	p.I412I	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	412					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.I412I(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TGTCTATCATCTACTGCTACT	0.443																																							uc002vdb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(1234-1236)ATC>ATT		parathyroid hormone 2 receptor precursor							211.0	196.0	201.0					2																	209355384		2203	4300	6503	SO:0001819	synonymous_variant	5746					integral to plasma membrane	parathyroid hormone receptor activity	g.chr2:209355384C>T	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1236C>T	2.37:g.209355384C>T			Somatic				PTH2R_uc010zjb.1_Silent_p.I423I|PTH2R_uc010fuo.1_RNA	p.I412I	NM_005048	NP_005039	WXS	Illumina HiSeq	Unspecified	P49190	PTH2R_HUMAN		Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	12	1449	+			412			Helical; Name=7; (Potential).		Q8N429	Silent	SNP	ENST00000272847.2	37	c.1236C>T	CCDS2383.1																																																																																				0.443	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048		66	111	0	0	0	0.01441	0	66	111				
BARD1	580	broad.mit.edu	37	2	215646023	215646023	+	Missense_Mutation	SNP	G	G	A	rs587782482		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:215646023G>A	ENST00000260947.4	-	4	709	c.575C>T	c.(574-576)tCt>tTt	p.S192F	BARD1_ENST00000471787.1_5'UTR|BARD1_ENST00000449967.2_Missense_Mutation_p.S48F	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	192					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S192F(2)		NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCCCTCTCAGAAACATCTGC	0.383									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002veu.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)	2						c.(574-576)TCT>TTT		BRCA1 associated RING domain 1							75.0	77.0	77.0					2																	215646023		2203	4300	6503	SO:0001583	missense	580	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr2:215646023G>A		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.575C>T	2.37:g.215646023G>A	ENSP00000260947:p.Ser192Phe		Somatic				BARD1_uc010zjm.1_Missense_Mutation_p.S48F	p.S192F	NM_000465	NP_000456	WXS	Illumina HiSeq	Unspecified	Q99728	BARD1_HUMAN		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	4	710	-		Renal(323;0.0243)	192					F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	37	c.575C>T	CCDS2397.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298101	0.40694	.	.	ENSG00000138376	ENST00000260947;ENST00000449967	T;T	0.77358	-1.09;-0.31	5.64	5.64	0.86602	.	0.749928	0.13275	N	0.400250	T	0.77745	0.4176	M	0.71581	2.175	0.09310	N	1	B;B	0.26258	0.145;0.069	B;B	0.22386	0.039;0.016	T	0.70256	-0.4922	10	0.66056	D	0.02	-4.2003	14.2712	0.66154	0.0713:0.0:0.9287:0.0	.	48;192	E7EUI3;Q99728	.;BARD1_HUMAN	F	192;48	ENSP00000260947:S192F;ENSP00000406752:S48F	ENSP00000260947:S192F	S	-	2	0	BARD1	215354268	0.301000	0.24444	0.157000	0.22605	0.052000	0.14988	3.554000	0.53720	2.820000	0.97059	0.650000	0.86243	TCT		0.383	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465		42	112	0	0	0	0.011902	0	42	112				
MARCH4	57574	broad.mit.edu	37	2	217234653	217234653	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:217234653G>A	ENST00000273067.4	-	1	2097	c.331C>T	c.(331-333)Cca>Tca	p.P111S		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	111	Pro-rich.					Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P111S(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GAAGAAGGTGGCAAGGGGGGT	0.672																																							uc002vgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(331-333)CCA>TCA		membrane-associated ring finger (C3HC4) 4							15.0	15.0	15.0					2																	217234653		2203	4299	6502	SO:0001583	missense	57574					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:217234653G>A	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.331C>T	2.37:g.217234653G>A	ENSP00000273067:p.Pro111Ser		Somatic					p.P111S	NM_020814	NP_065865	WXS	Illumina HiSeq	Unspecified	Q9P2E8	MARH4_HUMAN		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)	1	2098	-		Renal(323;0.0854)	111			Pro-rich.		Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	c.331C>T	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597596	0.66332	.	.	ENSG00000144583	ENST00000273067	D	0.86097	-2.07	5.76	5.76	0.90799	.	0.468547	0.22478	N	0.059522	D	0.83949	0.5365	N	0.14661	0.345	0.42417	D	0.992625	D	0.89917	1.0	D	0.66716	0.946	T	0.79831	-0.1637	10	0.13853	T	0.58	0.5931	15.4456	0.75228	0.0:0.0:1.0:0.0	.	111	Q9P2E8	MARH4_HUMAN	S	111	ENSP00000273067:P111S	ENSP00000273067:P111S	P	-	1	0	MARCH4	216942898	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	3.828000	0.55753	2.717000	0.92951	0.585000	0.79938	CCA		0.672	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814		7	15	0	0	0	0.00308	0	7	15				
TUBA4A	7277	broad.mit.edu	37	2	220115640	220115640	+	Missense_Mutation	SNP	G	G	A	rs147946711		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr2:220115640G>A	ENST00000248437.4	-	4	954	c.781C>T	c.(781-783)Ccc>Tcc	p.P261S	TUBA4A_ENST00000392088.2_Missense_Mutation_p.P246S|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000498660.1_5'UTR	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	261					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.P261S(1)|p.P246S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	CGAGGGTAGGGCACCAGGTTG	0.562																																							uc002vkt.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(781-783)CCC>TCC		tubulin, alpha 4a							99.0	92.0	94.0					2																	220115640		2203	4300	6503	SO:0001583	missense	7277				'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|platelet activation|platelet degranulation|protein polymerization	cytosol|extracellular region|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr2:220115640G>A	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.781C>T	2.37:g.220115640G>A	ENSP00000248437:p.Pro261Ser		Somatic				TUBA4A_uc010zkz.1_Missense_Mutation_p.P246S|TUBA4B_uc002vku.2_5'Flank|TUBA4B_uc002vkv.1_5'Flank	p.P261S	NM_006000	NP_005991	WXS	Illumina HiSeq	Unspecified	P68366	TBA4A_HUMAN		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	839	-		Renal(207;0.0474)	261					A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	ENST00000248437.4	37	c.781C>T	CCDS2438.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437428	0.62955	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000398989	D;D;D	0.94897	-3.55;-3.55;-2.74	5.44	5.44	0.79542	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98413	0.9472	H	0.99058	4.415	0.80722	D	1	P	0.42973	0.796	P	0.56398	0.797	D	0.99026	1.0819	10	0.87932	D	0	.	19.4628	0.94924	0.0:0.0:1.0:0.0	.	261	P68366	TBA4A_HUMAN	S	261;246;108	ENSP00000248437:P261S;ENSP00000375938:P246S;ENSP00000396212:P108S	ENSP00000248437:P261S	P	-	1	0	TUBA4A	219823884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.510000	0.98004	2.837000	0.97791	0.655000	0.94253	CCC		0.562	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000		42	64	0	0	0	0.011902	0	42	64				
MAVS	57506	broad.mit.edu	37	20	3838387	3838387	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr20:3838387G>A	ENST00000428216.2	+	3	351	c.223G>A	c.(223-225)Gca>Aca	p.A75T	MAVS_ENST00000358134.6_Missense_Mutation_p.A75T|MAVS_ENST00000416600.2_Intron	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	75	CARD.|Required for interaction with NLRX1.				activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.A75T(1)		autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CTTCATTGCGGCACTGAGGGG	0.632																																							uc002wjw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(223-225)GCA>ACA		virus-induced signaling adapter							132.0	108.0	116.0					20																	3838387		2203	4300	6503	SO:0001583	missense	57506				activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity	g.chr20:3838387G>A	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.223G>A	20.37:g.3838387G>A	ENSP00000401980:p.Ala75Thr		Somatic				MAVS_uc002wjv.2_Missense_Mutation_p.A75T|MAVS_uc010zqn.1_Missense_Mutation_p.A75T|MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_5'UTR	p.A75T	NM_020746	NP_065797	WXS	Illumina HiSeq	Unspecified	Q7Z434	MAVS_HUMAN			3	392	+			75			Cytoplasmic (Probable).|Required for interaction with NLRX1.|CARD.		A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	37	c.223G>A	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831118	0.50845	.	.	ENSG00000088888	ENST00000428216;ENST00000358134	T;T	0.12147	2.71;2.71	4.67	4.67	0.58626	.	0.073125	0.50627	D	0.000103	T	0.36220	0.0959	M	0.79475	2.455	0.58432	D	0.999999	D;D;D	0.76494	0.996;0.999;0.999	P;D;D	0.68483	0.9;0.958;0.958	T	0.14309	-1.0477	10	0.72032	D	0.01	-13.4148	12.9462	0.58373	0.0:0.0:1.0:0.0	.	75;75;75	B2BD34;Q7Z434;Q7Z434-2	.;MAVS_HUMAN;.	T	75	ENSP00000401980:A75T;ENSP00000350852:A75T	ENSP00000350852:A75T	A	+	1	0	MAVS	3786387	0.671000	0.27521	0.338000	0.25549	0.020000	0.10135	4.206000	0.58473	2.407000	0.81776	0.609000	0.83330	GCA		0.632	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746		4	145	0	0	0	0.009096	0	4	145				
CHD6	84181	broad.mit.edu	37	20	40040832	40040832	+	Silent	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr20:40040832C>G	ENST00000373233.3	-	36	7380	c.7203G>C	c.(7201-7203)ctG>ctC	p.L2401L	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2401					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.L2401L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CTTCCCCGCTCAGGGAGCTGA	0.517																																							uc002xka.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(7201-7203)CTG>CTC		chromodomain helicase DNA binding protein 6							114.0	103.0	107.0					20																	40040832		2203	4300	6503	SO:0001819	synonymous_variant	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40040832C>G	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7203G>C	20.37:g.40040832C>G			Somatic				CHD6_uc002xjz.1_5'UTR	p.L2401L	NM_032221	NP_115597	WXS	Illumina HiSeq	Unspecified	Q8TD26	CHD6_HUMAN			36	7381	-		Myeloproliferative disorder(115;0.00425)	2401					Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	c.7203G>C	CCDS13317.1																																																																																				0.517	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			21	78	0	0	0	0.012319	0	21	78				
STX16	8675	broad.mit.edu	37	20	57243142	57243142	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr20:57243142G>A	ENST00000371141.4	+	4	1076	c.352G>A	c.(352-354)Gag>Aag	p.E118K	STX16_ENST00000496003.1_3'UTR|STX16_ENST00000371132.4_Missense_Mutation_p.E97K|STX16_ENST00000361770.5_Missense_Mutation_p.E101K|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.E118K|STX16_ENST00000359617.4_Missense_Mutation_p.E65K|STX16_ENST00000355957.5_Missense_Mutation_p.E101K|STX16_ENST00000358029.4_Missense_Mutation_p.E114K|STX16_ENST00000361830.3_Missense_Mutation_p.E118K	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	118					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.E97K(1)		breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CAGCAGCGAAGAGGAACATGC	0.483																																							uc002xzi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)GAG>AAG		syntaxin 16 isoform a							161.0	134.0	143.0					20																	57243142		2203	4300	6503	SO:0001583	missense	8675				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity	g.chr20:57243142G>A	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.352G>A	20.37:g.57243142G>A	ENSP00000360183:p.Glu118Lys		Somatic				STX16_uc010zzq.1_5'UTR|STX16_uc002xzk.2_Missense_Mutation_p.E101K|STX16_uc002xzm.2_Missense_Mutation_p.E114K|STX16_uc002xzj.2_Missense_Mutation_p.E97K|STX16_uc002xzl.2_5'UTR	p.E118K	NM_001001433	NP_001001433	WXS	Illumina HiSeq	Unspecified	O14662	STX16_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)		4	1087	+	all_lung(29;0.0175)		118			Cytoplasmic (Potential).		A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	ENST00000371141.4	37	c.352G>A	CCDS13468.1	.	.	.	.	.	.	.	.	.	.	G	31	5.076673	0.94000	.	.	ENSG00000124222	ENST00000458280;ENST00000355957;ENST00000361770;ENST00000312283;ENST00000412911;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253	T;T;T;T;T;T;T;T;T;T;T	0.44881	0.91;2.33;2.33;0.91;0.91;2.33;2.33;2.33;2.33;2.33;0.91	5.24	4.29	0.51040	t-SNARE (1);Syntaxin, N-terminal (1);	0.061581	0.64402	U	0.000006	T	0.65439	0.2691	M	0.89353	3.025	0.80722	D	1	B;P;B;B	0.35959	0.048;0.53;0.365;0.373	B;P;B;P	0.52189	0.259;0.571;0.339;0.692	T	0.69870	-0.5028	10	0.59425	D	0.04	.	13.7355	0.62815	0.0:0.199:0.801:0.0	.	114;101;97;118	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	K	65;101;101;65;65;65;118;65;97;114;118;60	ENSP00000388348:E65K;ENSP00000348229:E101K;ENSP00000355408:E101K;ENSP00000312086:E65K;ENSP00000416852:E65K;ENSP00000352634:E65K;ENSP00000360183:E118K;ENSP00000360173:E97K;ENSP00000350723:E114K;ENSP00000354445:E118K;ENSP00000401801:E60K	ENSP00000360180:E65K	E	+	1	0	STX16	56676548	1.000000	0.71417	0.979000	0.43373	0.981000	0.71138	7.373000	0.79623	1.191000	0.43056	0.585000	0.79938	GAG		0.483	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433		4	63	0	0	0	0.021553	0	4	63				
SYNJ1	8867	broad.mit.edu	37	21	34030051	34030051	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr21:34030051C>A	ENST00000322229.7	-	18	2435	c.2436G>T	c.(2434-2436)agG>agT	p.R812S	SYNJ1_ENST00000433931.2_Missense_Mutation_p.R851S|SYNJ1_ENST00000382491.3_Missense_Mutation_p.R807S|SYNJ1_ENST00000357345.3_Missense_Mutation_p.R812S|SYNJ1_ENST00000464778.1_5'UTR|SYNJ1_ENST00000382499.2_Missense_Mutation_p.R851S			O43426	SYNJ1_HUMAN	synaptojanin 1	812	Catalytic. {ECO:0000255}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.R812S(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GCCATTTCCTCCTTCTCCAAA	0.423																																							uc002yqh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(2551-2553)AGG>AGT		synaptojanin 1 isoform a							94.0	89.0	91.0					21																	34030051		2203	4300	6503	SO:0001583	missense	8867						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr21:34030051C>A	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.2436G>T	21.37:g.34030051C>A	ENSP00000322234:p.Arg812Ser		Somatic				SYNJ1_uc011ads.1_Missense_Mutation_p.R807S|SYNJ1_uc002yqf.2_Missense_Mutation_p.R812S|SYNJ1_uc002yqg.2_Missense_Mutation_p.R807S|SYNJ1_uc002yqi.2_Missense_Mutation_p.R851S	p.R851S	NM_003895	NP_003886	WXS	Illumina HiSeq	Unspecified	O43426	SYNJ1_HUMAN			19	2553	-			812			Catalytic (Potential).		O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	c.2553G>T	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358604	0.82243	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.53	-5.11	0.02901	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.72914	0.3520	N	0.16037	0.36	0.58432	D	0.999999	D;D;D;D;D	0.76494	0.976;0.987;0.999;0.987;0.997	D;D;D;D;D	0.71414	0.935;0.964;0.973;0.964;0.959	T	0.73924	-0.3829	10	0.87932	D	0	.	13.0854	0.59138	0.0:0.5102:0.0:0.4898	.	807;851;812;812;812	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	S	807;812;851;851;812	ENSP00000371931:R807S;ENSP00000349903:R812S;ENSP00000371939:R851S;ENSP00000409667:R851S;ENSP00000322234:R812S	ENSP00000322234:R812S	R	-	3	2	SYNJ1	32951922	0.950000	0.32346	0.891000	0.34965	0.967000	0.64934	0.046000	0.14035	-1.098000	0.03038	-0.440000	0.05779	AGG		0.423	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				32	55	1	0	2.42023e-17	0.015359	2.8809e-17	32	55				
MX2	4600	broad.mit.edu	37	21	42748999	42748999	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr21:42748999G>T	ENST00000330714.3	+	2	350	c.166G>T	c.(166-168)Gct>Tct	p.A56S	MX2_ENST00000543692.1_Missense_Mutation_p.A56S	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	56					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A56S(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				AGAGAAGGACGCTGCTTTCCT	0.527																																							uc002yzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(166-168)GCT>TCT		myxovirus resistance protein 2							103.0	110.0	107.0					21																	42748999		2203	4300	6503	SO:0001583	missense	4600				response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity	g.chr21:42748999G>T		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.166G>T	21.37:g.42748999G>T	ENSP00000333657:p.Ala56Ser		Somatic				MX2_uc011aer.1_RNA	p.A56S	NM_002463	NP_002454	WXS	Illumina HiSeq	Unspecified	P20592	MX2_HUMAN			2	270	+		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)	56					B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	37	c.166G>T	CCDS13672.1	.	.	.	.	.	.	.	.	.	.	G	0.070	-1.204557	0.01568	.	.	ENSG00000183486	ENST00000330714;ENST00000436410;ENST00000435611;ENST00000543692;ENST00000418103	D;D	0.91577	-2.47;-2.87	2.04	-4.08	0.03963	.	16.927700	0.00166	N	0.000014	T	0.79305	0.4423	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.66826	-0.5825	10	0.25751	T	0.34	.	2.3257	0.04222	0.2703:0.2105:0.4054:0.1138	.	56	P20592	MX2_HUMAN	S	56	ENSP00000333657:A56S;ENSP00000446017:A56S	ENSP00000333657:A56S	A	+	1	0	MX2	41670869	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.135000	0.03225	-2.088000	0.00861	-2.505000	0.00190	GCT		0.527	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463		43	96	1	0	3.61848e-18	0.007835	4.34425e-18	43	96				
KRTAP10-6	386674	broad.mit.edu	37	21	46011473	46011473	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr21:46011473C>A	ENST00000400368.1	-	1	913	c.893G>T	c.(892-894)tGc>tTc	p.C298F	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	298	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.C298F(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGAGGGTCTGCAGCAGGAGGC	0.677																																							uc002zfm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(892-894)TGC>TTC		keratin associated protein 10-6							78.0	83.0	81.0					21																	46011473		2203	4297	6500	SO:0001583	missense	386674					keratin filament		g.chr21:46011473C>A	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.893G>T	21.37:g.46011473C>A	ENSP00000383219:p.Cys298Phe		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C298F	NM_198688	NP_941961	WXS	Illumina HiSeq	Unspecified	P60371	KR106_HUMAN			1	914	-			298			29 X 5 AA repeats of C-C-X(3).|27.			Missense_Mutation	SNP	ENST00000400368.1	37	c.893G>T	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	c	8.238	0.806278	0.16467	.	.	ENSG00000188155	ENST00000400368	T	0.02606	4.23	2.7	2.7	0.31948	.	.	.	.	.	T	0.17916	0.0430	M	0.92026	3.265	0.35496	D	0.799362	D	0.69078	0.997	D	0.87578	0.998	T	0.29579	-1.0007	9	0.87932	D	0	.	11.1673	0.48550	0.0:1.0:0.0:0.0	.	298	P60371	KR106_HUMAN	F	298	ENSP00000383219:C298F	ENSP00000383219:C298F	C	-	2	0	KRTAP10-6	44835901	.	.	0.998000	0.56505	0.185000	0.23345	.	.	1.520000	0.48965	0.194000	0.17425	TGC		0.677	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688		54	75	1	0	6.3237e-29	0.01441	7.93302e-29	54	75				
MCM3AP	8888	broad.mit.edu	37	21	47663461	47663461	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr21:47663461C>T	ENST00000397708.1	-	25	5468	c.5214G>A	c.(5212-5214)gaG>gaA	p.E1738E	MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP_ENST00000291688.1_Silent_p.E1738E|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1738	Acetyltransferase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.E1738E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CCCATGGGATCTCCATGACCG	0.562																																							uc002zir.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						c.(5212-5214)GAG>GAA		minichromosome maintenance complex component 3							73.0	73.0	73.0					21																	47663461		2203	4300	6503	SO:0001819	synonymous_variant	8888				DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding	g.chr21:47663461C>T	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5214G>A	21.37:g.47663461C>T			Somatic				MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_Silent_p.E233E|MCM3AP_uc002zip.1_Silent_p.E479E|MCM3AP_uc002ziq.1_Silent_p.E665E|MCM3APAS_uc002zis.1_Intron	p.E1738E	NM_003906	NP_003897	WXS	Illumina HiSeq	Unspecified	O60318	MCM3A_HUMAN			24	5250	-	Breast(49;0.112)		1738					C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	c.5214G>A	CCDS13734.1																																																																																				0.562	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		7	108	0	0	0	0.00308	0	7	108				
THAP7	80764	broad.mit.edu	37	22	21354220	21354220	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr22:21354220C>T	ENST00000215742.4	-	4	1053	c.879G>A	c.(877-879)ctG>ctA	p.L293L	THAP7_ENST00000399133.2_Silent_p.L293L|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000436079.1_RNA|THAP7-AS1_ENST00000429962.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	293					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)	p.L293L(2)		cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATGCTCCTTCAGAGTCTGGC	0.657																																							uc002ztr.1		NA																	2	Substitution - coding silent(2)		cervix(1)|lung(1)		0						c.(877-879)CTG>CTA		THAP domain containing 7 isoform 2							31.0	32.0	32.0					22																	21354220		2201	4298	6499	SO:0001819	synonymous_variant	80764				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck	C2H2 zinc finger domain binding|DNA binding|metal ion binding|protein N-terminus binding	g.chr22:21354220C>T	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.879G>A	22.37:g.21354220C>T			Somatic				THAP7_uc002zts.1_Silent_p.L293L|FLJ39582_uc002ztt.1_5'Flank|FLJ39582_uc002ztu.1_5'Flank|FLJ39582_uc002ztv.2_5'Flank	p.L293L	NM_001008695	NP_001008695	WXS	Illumina HiSeq	Unspecified	Q9BT49	THAP7_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		5	909	-	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	293					B2RD97|D3DX40	Silent	SNP	ENST00000215742.4	37	c.879G>A	CCDS13787.1																																																																																				0.657	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320405.1	NM_030573		7	49	0	0	0	0.001984	0	7	49				
HIC2	23119	broad.mit.edu	37	22	21800810	21800810	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr22:21800810C>T	ENST00000443632.2	+	2	1998	c.1626C>T	c.(1624-1626)ttC>ttT	p.F542F	HIC2_ENST00000407464.2_Silent_p.F542F|HIC2_ENST00000407598.2_Silent_p.F542F			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	542					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.F542F(1)		NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GCAAAATGTTCACGCAGCGCG	0.632																																					NSCLC(23;437 858 2282 27947 40366)	NSCLC(23;437 858 2282 27947 40366)	uc002zur.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1624-1626)TTC>TTT		hypermethylated in cancer 2							72.0	66.0	68.0					22																	21800810		2203	4300	6503	SO:0001819	synonymous_variant	23119				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding	g.chr22:21800810C>T	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1626C>T	22.37:g.21800810C>T			Somatic				HIC2_uc002zus.3_Silent_p.F542F	p.F542F	NM_015094	NP_055909	WXS	Illumina HiSeq	Unspecified	Q96JB3	HIC2_HUMAN			3	1856	+	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)	542			C2H2-type 3.		Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Silent	SNP	ENST00000443632.2	37	c.1626C>T	CCDS13789.1																																																																																				0.632	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2			16	35	0	0	0	0.028581	0	16	35				
CACNA1I	8911	broad.mit.edu	37	22	39996548	39996548	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr22:39996548C>T	ENST00000402142.3	+	3	372	c.372C>T	c.(370-372)atC>atT	p.I124I	CACNA1I_ENST00000401624.1_Silent_p.I124I|CACNA1I_ENST00000400164.3_Silent_p.I124I|CACNA1I_ENST00000407673.1_Silent_p.I124I|CACNA1I_ENST00000404898.1_Silent_p.I124I|CACNA1I_ENST00000336649.4_Silent_p.I124I	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	124					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.I124I(2)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TCATCTTTATCTTCTTTGCCA	0.557																																							uc003ayc.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(370-372)ATC>ATT		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						86.0	84.0	85.0					22																	39996548		1962	4170	6132	SO:0001819	synonymous_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:39996548C>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.372C>T	22.37:g.39996548C>T			Somatic				CACNA1I_uc003ayd.2_Silent_p.I124I|CACNA1I_uc003aye.2_Silent_p.I39I|CACNA1I_uc003ayf.2_Silent_p.I39I	p.I124I	NM_021096	NP_066919	WXS	Illumina HiSeq	Unspecified	Q9P0X4	CAC1I_HUMAN			3	372	+	Melanoma(58;0.0749)		124			I.|Helical; Name=S2 of repeat I; (Potential).		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.372C>T	CCDS46710.1																																																																																				0.557	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		7	51	0	0	0	0.004482	0	7	51				
ZBED4	9889	broad.mit.edu	37	22	50277565	50277565	+	Silent	SNP	G	G	A	rs567666505		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr22:50277565G>A	ENST00000216268.5	+	2	732	c.255G>A	c.(253-255)gcG>gcA	p.A85A		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	85						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A85A(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		ACTATGGCGCGCTGTTCTCCC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17551	0.0		0.0	False		,,,				2504	0.001						uc003bix.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(253-255)GCG>GCA		zinc finger, BED-type containing 4							78.0	90.0	86.0					22																	50277565		2203	4300	6503	SO:0001819	synonymous_variant	9889					cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity	g.chr22:50277565G>A	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.255G>A	22.37:g.50277565G>A			Somatic					p.A85A	NM_014838	NP_055653	WXS	Illumina HiSeq	Unspecified	O75132	ZBED4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)	2	725	+		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	85					B2RZH1|Q1ECU0|Q9UGG8	Silent	SNP	ENST00000216268.5	37	c.255G>A	CCDS33677.1																																																																																				0.627	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838		21	112	0	0	0	0.012319	0	21	112				
LRRN1	57633	broad.mit.edu	37	3	3888070	3888070	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:3888070A>C	ENST00000319331.3	+	2	2506	c.1745A>C	c.(1744-1746)aAc>aCc	p.N582T	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	582	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)		p.N582T(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CATGAATACAACCTAACGCAT	0.433																																							uc003bpt.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1744-1746)AAC>ACC		leucine rich repeat neuronal 1 precursor							239.0	239.0	239.0					3																	3888070		2203	4300	6503	SO:0001583	missense	57633					integral to membrane		g.chr3:3888070A>C	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1745A>C	3.37:g.3888070A>C	ENSP00000314901:p.Asn582Thr		Somatic				SUMF1_uc003bps.1_Intron	p.N582T	NM_020873	NP_065924	WXS	Illumina HiSeq	Unspecified	Q6UXK5	LRRN1_HUMAN		Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)	2	2506	+			582			Fibronectin type-III.|Extracellular (Potential).		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	c.1745A>C	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.496621	0.64186	.	.	ENSG00000175928	ENST00000319331	T	0.44881	0.91	5.5	5.5	0.81552	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64283	0.2584	M	0.72353	2.195	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.66152	-0.5995	10	0.52906	T	0.07	.	15.9079	0.79445	1.0:0.0:0.0:0.0	.	582	Q6UXK5	LRRN1_HUMAN	T	582	ENSP00000314901:N582T	ENSP00000314901:N582T	N	+	2	0	LRRN1	3863070	1.000000	0.71417	0.993000	0.49108	0.952000	0.60782	9.210000	0.95106	2.213000	0.71641	0.528000	0.53228	AAC		0.433	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873		34	271	0	0	0	0.013726	0	34	271				
PPARG	5468	broad.mit.edu	37	3	12393098	12393098	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:12393098G>A	ENST00000287820.6	+	1	128	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	PPARG_ENST00000397026.2_Intron|PPARG_ENST00000539812.1_Intron|PPARG_ENST00000397015.2_Intron|PPARG_ENST00000309576.6_Intron|PPARG_ENST00000397010.2_Intron|PPARG_ENST00000397012.2_Intron|PPARG_ENST00000397000.1_Intron	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	3					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E3K(1)	PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	TGTTATGGGTGAAACTCTGGG	0.393			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																uc003bwx.2		NA		Dom	yes		3	3p25	5468	T	"""peroxisome proliferative activated receptor, gamma"""	yes	Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension	E	PAX8		follicular thyroid		1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(7-9)GAA>AAA		peroxisome proliferative activated receptor	Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)						129.0	120.0	123.0					3																	12393098		2203	4300	6503	SO:0001583	missense	5468				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr3:12393098G>A	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.7G>A	3.37:g.12393098G>A	ENSP00000287820:p.Glu3Lys		Somatic				PPARG_uc003bwr.2_Intron|PPARG_uc003bws.2_Intron|PPARG_uc003bwu.2_Intron|PPARG_uc003bwv.2_Intron|PPARG_uc003bwq.1_Intron|PPARG_uc010hdz.1_Intron|PPARG_uc003bwt.1_Intron|PPARG_uc003bww.1_Missense_Mutation_p.E3K	p.E3K	NM_015869	NP_056953	WXS	Illumina HiSeq	Unspecified	P37231	PPARG_HUMAN			1	98	+			3					A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	37	c.7G>A	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563827	0.45694	.	.	ENSG00000132170	ENST00000287820	D	0.93307	-3.2	6.02	2.95	0.34219	.	0.463174	0.18291	N	0.145708	D	0.85682	0.5753	N	0.24115	0.695	0.29357	N	0.864931	B	0.02656	0.0	B	0.01281	0.0	T	0.79757	-0.1669	10	0.87932	D	0	.	5.2866	0.15704	0.1926:0.1668:0.6406:0.0	.	3	P37231	PPARG_HUMAN	K	3	ENSP00000287820:E3K	ENSP00000287820:E3K	E	+	1	0	PPARG	12368098	0.999000	0.42202	0.989000	0.46669	0.931000	0.56810	1.784000	0.38674	1.478000	0.48253	0.655000	0.94253	GAA		0.393	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037		24	39	0	0	0	0.014323	0	24	39				
NEK10	152110	broad.mit.edu	37	3	27152782	27152782	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:27152782T>C	ENST00000429845.2	-	39	3862	c.3500A>G	c.(3499-3501)aAt>aGt	p.N1167S	NEK10_ENST00000383771.4_Missense_Mutation_p.N469S|NEK10_ENST00000295720.6_Missense_Mutation_p.N479S|NEK10_ENST00000383770.3_Missense_Mutation_p.N422S			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	1167					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N1120I(1)|p.N1167S(1)|p.N1120S(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGTTGGGTGATTCTTGGTCCC	0.368																																							uc010hfk.2		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)	ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(1435-1437)AAT>AGT		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							112.0	106.0	108.0					3																	27152782		2203	4300	6503	SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27152782T>C	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.3500A>G	3.37:g.27152782T>C	ENSP00000395849:p.Asn1167Ser		Somatic				NEK10_uc010hfj.2_Missense_Mutation_p.N422S	p.N479S			WXS	Illumina HiSeq	Unspecified	Q6ZWH5	NEK10_HUMAN			17	1665	-			1167					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37	c.1436A>G		.	.	.	.	.	.	.	.	.	.	T	13.92	2.380488	0.42207	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770	T;T;T	0.11821	2.74;2.78;2.97	5.73	0.47	0.16747	.	.	.	.	.	T	0.09113	0.0225	.	.	.	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.11329	0.005;0.006	T	0.17137	-1.0379	8	0.40728	T	0.16	.	5.2725	0.15632	0.0:0.1572:0.2835:0.5593	.	479;422	Q6ZWH5-5;Q6ZWH5-7	.;.	S	479;469;422	ENSP00000295720:N479S;ENSP00000373281:N469S;ENSP00000373280:N422S	ENSP00000295720:N479S	N	-	2	0	NEK10	27127786	0.984000	0.35163	0.992000	0.48379	0.955000	0.61496	0.150000	0.16263	-0.070000	0.12908	0.455000	0.32223	AAT		0.368	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		5	54	0	0	0	0.014758	0	5	54				
NEK10	152110	broad.mit.edu	37	3	27204078	27204078	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:27204078C>T	ENST00000429845.2	-	32	3246	c.2884G>A	c.(2884-2886)Gac>Aac	p.D962N	NEK10_ENST00000383771.4_Missense_Mutation_p.D274N|NEK10_ENST00000357467.2_Missense_Mutation_p.D359N|NEK10_ENST00000295720.6_Missense_Mutation_p.D274N|NEK10_ENST00000383770.3_Intron|NEK10_ENST00000498182.1_Intron			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	962					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D962N(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AGAAGCAGGTCAAGAGGCAGC	0.433																																							uc010hfk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(820-822)GAC>AAC		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							87.0	86.0	86.0					3																	27204078		2203	4300	6503	SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27204078C>T	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2884G>A	3.37:g.27204078C>T	ENSP00000395849:p.Asp962Asn		Somatic				NEK10_uc003cds.1_Missense_Mutation_p.D359N|NEK10_uc010hfj.2_Intron	p.D274N			WXS	Illumina HiSeq	Unspecified	Q6ZWH5	NEK10_HUMAN			10	1049	-			962					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37	c.820G>A		.	.	.	.	.	.	.	.	.	.	C	15.24	2.775741	0.49786	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000357467	T;T;T	0.77489	2.19;2.41;-1.1	5.59	1.72	0.24424	.	.	.	.	.	T	0.51805	0.1696	.	.	.	0.21256	N	0.999745	P;B	0.36535	0.557;0.0	B;B	0.31101	0.124;0.0	T	0.37753	-0.9692	8	0.12430	T	0.62	.	2.8208	0.05470	0.1444:0.547:0.1487:0.1599	.	274;359	Q6ZWH5-5;Q8N774	.;.	N	274;274;359	ENSP00000295720:D274N;ENSP00000373281:D274N;ENSP00000350059:D359N	ENSP00000295720:D274N	D	-	1	0	NEK10	27179082	0.995000	0.38212	0.995000	0.50966	0.998000	0.95712	0.111000	0.15458	0.032000	0.15435	0.655000	0.94253	GAC		0.433	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		6	56	0	0	0	0.021553	0	6	56				
XYLB	9942	broad.mit.edu	37	3	38401862	38401862	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:38401862G>C	ENST00000207870.3	+	3	263	c.173G>C	c.(172-174)gGg>gCg	p.G58A	XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	58					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)	p.G58A(1)		endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		CACAAGGATGGGCTGACGGTC	0.532																																							uc003cic.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(172-174)GGG>GCG		xylulokinase							262.0	206.0	225.0					3																	38401862		2203	4300	6503	SO:0001583	missense	9942				D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity	g.chr3:38401862G>C	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.173G>C	3.37:g.38401862G>C	ENSP00000207870:p.Gly58Ala		Somatic				XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_5'UTR	p.G58A	NM_005108	NP_005099	WXS	Illumina HiSeq	Unspecified	O75191	XYLB_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)	3	282	+			58					B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	37	c.173G>C	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844722	0.32606	.	.	ENSG00000093217	ENST00000207870	T	0.26223	1.75	5.32	2.08	0.27032	Carbohydrate kinase, FGGY, N-terminal (1);	0.586891	0.18197	N	0.148622	T	0.14614	0.0353	L	0.29908	0.895	0.80722	D	1	B	0.14012	0.009	B	0.16722	0.016	T	0.08166	-1.0735	10	0.15499	T	0.54	.	5.7035	0.17895	0.4387:0.0:0.5613:0.0	.	58	O75191	XYLB_HUMAN	A	58	ENSP00000207870:G58A	ENSP00000207870:G58A	G	+	2	0	XYLB	38376866	0.999000	0.42202	0.316000	0.25252	0.993000	0.82548	1.510000	0.35790	0.758000	0.33059	0.655000	0.94253	GGG		0.532	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108		36	90	0	0	0	0.00874	0	36	90				
ZNF35	7584	broad.mit.edu	37	3	44701145	44701145	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:44701145C>T	ENST00000396056.2	+	4	1525	c.1290C>T	c.(1288-1290)ctC>ctT	p.L430L	ZNF35_ENST00000542250.1_Silent_p.L270L|RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000296092.3_3'UTR	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	430				Missing (in Ref. 1; CAA30268). {ECO:0000305}.	cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L430L(1)		large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		TCAGTCAGCTCTCTTGCCTTA	0.443																																							uc003cnq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1288-1290)CTC>CTT		zinc finger protein 35							91.0	91.0	91.0					3																	44701145		2203	4300	6503	SO:0001819	synonymous_variant	7584				cellular response to retinoic acid|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44701145C>T	X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1290C>T	3.37:g.44701145C>T			Somatic				ZNF35_uc003cnr.2_Silent_p.L270L	p.L430L	NM_003420	NP_003411	WXS	Illumina HiSeq	Unspecified	P13682	ZNF35_HUMAN		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	4	1511	+		Ovarian(412;0.0228)	430	Missing (in Ref. 1; CAA30268).		C2H2-type 8.		B2RBU6|Q53Y54|Q96D01	Silent	SNP	ENST00000396056.2	37	c.1290C>T	CCDS2718.2																																																																																				0.443	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420		19	74	0	0	0	0.008871	0	19	74				
CELSR3	1951	broad.mit.edu	37	3	48686568	48686568	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:48686568C>T	ENST00000164024.4	-	17	6833	c.6553G>A	c.(6553-6555)Gag>Aag	p.E2185K	CELSR3_ENST00000544264.1_Missense_Mutation_p.E2190K	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2185					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E2185K(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGACTGAGCTCTCGAAAGGCA	0.607																																							uc003cul.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(6553-6555)GAG>AAG		cadherin EGF LAG seven-pass G-type receptor 3							62.0	62.0	62.0					3																	48686568		2198	4299	6497	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48686568C>T	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6553G>A	3.37:g.48686568C>T	ENSP00000164024:p.Glu2185Lys		Somatic				CELSR3_uc003cuf.1_Missense_Mutation_p.E2255K|CELSR3_uc010hkg.2_Missense_Mutation_p.E168K	p.E2185K	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	17	6834	-			2185			Extracellular (Potential).		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.6553G>A	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765214	0.90020	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70399	-0.46;-0.48	5.82	5.82	0.92795	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.73916	0.3648	L	0.58969	1.84	0.80722	D	1	B;P	0.52316	0.23;0.952	B;P	0.46452	0.05;0.517	T	0.73059	-0.4102	9	0.39692	T	0.17	.	20.1054	0.97890	0.0:1.0:0.0:0.0	.	2185;2255	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	K	2185;2190	ENSP00000164024:E2185K;ENSP00000445694:E2190K	ENSP00000164024:E2185K	E	-	1	0	CELSR3	48661572	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.906000	0.48735	2.757000	0.94681	0.655000	0.94253	GAG		0.607	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		7	14	0	0	0	0.004482	0	7	14				
CELSR3	1951	broad.mit.edu	37	3	48696534	48696534	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:48696534G>C	ENST00000164024.4	-	1	3814	c.3534C>G	c.(3532-3534)aaC>aaG	p.N1178K	CELSR3_ENST00000544264.1_Missense_Mutation_p.N1178K	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1178	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.N1178K(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGGATACATAGTTGTTGAAGA	0.547																																							uc003cul.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(3532-3534)AAC>AAG		cadherin EGF LAG seven-pass G-type receptor 3							137.0	135.0	136.0					3																	48696534		2203	4300	6503	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48696534G>C	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3534C>G	3.37:g.48696534G>C	ENSP00000164024:p.Asn1178Lys		Somatic				CELSR3_uc003cuf.1_Missense_Mutation_p.N1248K	p.N1178K	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	1	3815	-			1178			Extracellular (Potential).|Cadherin 9.		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.3534C>G	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.734323	0.48939	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.37411	1.2;1.2	5.44	2.7	0.31948	Cadherin-like (1);	.	.	.	.	T	0.57388	0.2050	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.963	T	0.56571	-0.7957	9	0.72032	D	0.01	.	8.8605	0.35253	0.2871:0.0:0.7129:0.0	.	1178;1248	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	K	1178	ENSP00000164024:N1178K;ENSP00000445694:N1178K	ENSP00000164024:N1178K	N	-	3	2	CELSR3	48671538	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	3.743000	0.55104	0.283000	0.22279	0.561000	0.74099	AAC		0.547	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		4	69	0	0	0	0.009096	0	4	69				
IP6K2	51447	broad.mit.edu	37	3	48725789	48725789	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:48725789C>T	ENST00000328631.5	-	6	1421	c.1198G>A	c.(1198-1200)Gag>Aag	p.E400K	NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000416649.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	400					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.E400K(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						TCCTGGCCCTCATGCACCACG	0.557																																							uc003cup.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1198-1200)GAG>AAG		inositol hexaphosphate kinase 2 isoform a							119.0	113.0	115.0					3																	48725789		2203	4300	6503	SO:0001583	missense	51447				negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity	g.chr3:48725789C>T	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.1198G>A	3.37:g.48725789C>T	ENSP00000331103:p.Glu400Lys		Somatic				NCKIPSD_uc003cum.2_5'Flank|NCKIPSD_uc003cun.2_5'Flank|NCKIPSD_uc010hkh.1_5'Flank|IP6K2_uc003cuq.2_Missense_Mutation_p.E400K	p.E400K	NM_001005909	NP_001005909	WXS	Illumina HiSeq	Unspecified	Q9UHH9	IP6K2_HUMAN			6	1442	-			400					A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	37	c.1198G>A	CCDS2777.1	.	.	.	.	.	.	.	.	.	.	c	34	5.297546	0.95574	.	.	ENSG00000068745	ENST00000328631	T	0.16897	2.31	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	L	0.58669	1.825	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.03212	-1.1060	10	0.35671	T	0.21	-16.5315	19.0699	0.93127	0.0:1.0:0.0:0.0	.	400	Q9UHH9	IP6K2_HUMAN	K	400	ENSP00000331103:E400K	ENSP00000331103:E400K	E	-	1	0	IP6K2	48700793	1.000000	0.71417	0.975000	0.42487	0.986000	0.74619	7.812000	0.86109	2.484000	0.83849	0.651000	0.88453	GAG		0.557	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291		26	40	0	0	0	0.009535	0	26	40				
ACOX2	8309	broad.mit.edu	37	3	58508312	58508312	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:58508312C>A	ENST00000302819.5	-	12	1834	c.1543G>T	c.(1543-1545)Gtg>Ttg	p.V515L	ACOX2_ENST00000481527.1_5'UTR|ACOX2_ENST00000459701.2_Missense_Mutation_p.V501L	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	515					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)	p.V515L(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AAATGCTGCACTGAGTCCTTT	0.527																																							uc003dkl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1543-1545)GTG>TTG		acyl-Coenzyme A oxidase 2							123.0	106.0	112.0					3																	58508312		2203	4300	6503	SO:0001583	missense	8309				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity	g.chr3:58508312C>A	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1543G>T	3.37:g.58508312C>A	ENSP00000307697:p.Val515Leu		Somatic					p.V515L	NM_003500	NP_003491	WXS	Illumina HiSeq	Unspecified	Q99424	ACOX2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)	12	1718	-			515					A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	37	c.1543G>T	CCDS33775.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950154	0.34377	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.43688	0.94;0.94	4.81	3.92	0.45320	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.685008	0.13166	N	0.408695	T	0.34716	0.0907	L	0.28608	0.87	0.24408	N	0.994678	B	0.12013	0.005	B	0.15870	0.014	T	0.34725	-0.9817	10	0.87932	D	0	-37.0828	14.2284	0.65875	0.0:0.9256:0.0:0.0744	.	515	Q99424	ACOX2_HUMAN	L	501;515	ENSP00000418562:V501L;ENSP00000307697:V515L	ENSP00000307697:V515L	V	-	1	0	ACOX2	58483352	0.011000	0.17503	0.306000	0.25113	0.410000	0.31052	2.551000	0.45820	1.310000	0.45006	0.655000	0.94253	GTG		0.527	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1			15	62	1	0	3.27435e-08	0.020292	3.62951e-08	15	62				
FHIT	2272	broad.mit.edu	37	3	59737985	59737985	+	Silent	SNP	T	T	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:59737985T>A	ENST00000468189.1	-	9	781	c.411A>T	c.(409-411)gcA>gcT	p.A137A	FHIT_ENST00000492590.1_Silent_p.A137A|FHIT_ENST00000466788.1_5'UTR|FHIT_ENST00000476844.1_Silent_p.A137A|FHIT_ENST00000341848.4_Silent_p.A137A			P49789	FHIT_HUMAN	fragile histidine triad	137					DNA replication (GO:0006260)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide metabolic process (GO:0009117)|purine nucleotide metabolic process (GO:0006163)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|catalytic activity (GO:0003824)|hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|ubiquitin protein ligase binding (GO:0031625)	p.A137A(2)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)	12		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		CTGCGGCTTCTGCTGCCATTT	0.517			T	HMGA2	pleomorphic salivary gland adenoma				Renal Cell Cancer associated with constitutional translocation of chromosome 3																														uc003dkx.3		NA		Dom	yes		3	3p14.2	2272	T	fragile histidine triad gene			E	HMGA2		pleomorphic salivary gland adenoma		2	Substitution - coding silent(2)		lung(2)		0						c.(409-411)GCA>GCT		fragile histidine triad gene							54.0	51.0	52.0					3																	59737985		2203	4300	6503	SO:0001819	synonymous_variant	2272	Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3	Familial Cancer Database		nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding	g.chr3:59737985T>A	BC032336	CCDS2894.1	3p14.2	2012-02-27	2012-02-27		ENSG00000189283	ENSG00000189283			3701	protein-coding gene	gene with protein product		601153	"""fragile histidine triad gene"""			8598045, 9671749	Standard	NM_002012		Approved	FRA3B, AP3Aase	uc003dky.3	P49789	OTTHUMG00000158591	ENST00000468189.1:c.411A>T	3.37:g.59737985T>A			Somatic				FHIT_uc003dky.2_Silent_p.A137A|FHIT_uc010hnn.1_Silent_p.A137A	p.A137A	NM_002012	NP_002003	WXS	Illumina HiSeq	Unspecified	P49789	FHIT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)	9	782	-		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)	137					A2IAS9|A2IAT0|A2IAT6|A8K1A9|Q45QG9|Q6IU12	Silent	SNP	ENST00000468189.1	37	c.411A>T	CCDS2894.1																																																																																				0.517	FHIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351648.1	NM_002012		6	77	0	0	0	0.004482	0	6	77				
MITF	4286	broad.mit.edu	37	3	69987181	69987181	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:69987181A>C	ENST00000448226.2	+	3	690	c.563A>C	c.(562-564)aAc>aCc	p.N188T	MITF_ENST00000314557.6_Missense_Mutation_p.N81T|MITF_ENST00000472437.1_Missense_Mutation_p.N136T|MITF_ENST00000394351.3_Missense_Mutation_p.N81T|MITF_ENST00000314589.5_Missense_Mutation_p.N172T|MITF_ENST00000394355.2_Missense_Mutation_p.N163T|MITF_ENST00000352241.4_Missense_Mutation_p.N188T|MITF_ENST00000531774.1_Intron|MITF_ENST00000328528.6_Missense_Mutation_p.N187T|MITF_ENST00000394348.1_3'UTR			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	188					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.N188T(1)|p.N81T(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CTTACGCTTAACTCCAACTGT	0.493			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)	Melanoma(29;269 969 31479 41502 42961)	uc003dnz.2		NA		Dom	yes		3	3p14.1	4286	A	microphthalmia-associated transcription factor	yes	Waardenburg syndrome type 2|Tietz syndrome	E			melanoma 		2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(562-564)AAC>ACC		microphthalmia-associated transcription factor							79.0	69.0	72.0					3																	69987181		2203	4300	6503	SO:0001583	missense	4286				melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr3:69987181A>C		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.563A>C	3.37:g.69987181A>C	ENSP00000391803:p.Asn188Thr		Somatic				MITF_uc011bgb.1_Missense_Mutation_p.N136T|MITF_uc003doa.2_Missense_Mutation_p.N187T|MITF_uc003dob.2_Missense_Mutation_p.N172T|MITF_uc003dod.2_Missense_Mutation_p.N163T|MITF_uc003doe.2_Missense_Mutation_p.N81T|MITF_uc003dof.2_Missense_Mutation_p.N81T	p.N188T	NM_198159	NP_937802	WXS	Illumina HiSeq	Unspecified	O75030	MITF_HUMAN		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)	3	679	+		Lung NSC(201;0.0384)|Prostate(884;0.0526)	188					B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37	c.563A>C		.	.	.	.	.	.	.	.	.	.	A	13.32	2.201805	0.38905	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351	T;T;T;T;T;T;T;T;T	0.22336	2.76;2.28;2.56;2.77;1.96;2.78;2.78;2.54;1.96	5.69	5.69	0.88448	.	0.259977	0.49916	D	0.000123	T	0.21550	0.0519	L	0.53249	1.67	0.45662	D	0.998585	B;P;B;B;P;B;P	0.40834	0.354;0.534;0.321;0.203;0.73;0.109;0.696	B;B;B;B;B;B;B	0.39876	0.101;0.205;0.205;0.099;0.312;0.099;0.205	T	0.02275	-1.1184	9	.	.	.	.	10.3096	0.43702	0.9267:0.0:0.0733:0.0	.	136;81;81;163;172;187;188	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	T	188;188;136;187;172;172;163;81;81	ENSP00000295600:N188T;ENSP00000391803:N188T;ENSP00000418845:N136T;ENSP00000327867:N187T;ENSP00000398639:N172T;ENSP00000324443:N172T;ENSP00000377884:N163T;ENSP00000324246:N81T;ENSP00000377880:N81T	.	N	+	2	0	MITF	70069871	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.046000	0.57376	2.147000	0.66899	0.533000	0.62120	AAC		0.493	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159		11	42	0	0	0	0.016723	0	11	42				
SENP7	57337	broad.mit.edu	37	3	101060619	101060619	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:101060619G>A	ENST00000394095.2	-	15	2164	c.2111C>T	c.(2110-2112)tCa>tTa	p.S704L	SENP7_ENST00000394094.2_Missense_Mutation_p.S639L|SENP7_ENST00000348610.3_Missense_Mutation_p.S671L|SENP7_ENST00000358203.3_Missense_Mutation_p.S540L|SENP7_ENST00000314261.7_Missense_Mutation_p.S638L|SENP7_ENST00000394091.1_Missense_Mutation_p.S540L	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	704						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.S704L(1)|p.S638L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ATCTGTGTTTGAGGGCTGACA	0.418																																							uc003dut.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)	5						c.(2110-2112)TCA>TTA		sentrin/SUMO-specific protease 7 isoform 1							81.0	69.0	73.0					3																	101060619		2203	4300	6503	SO:0001583	missense	57337				proteolysis	nucleus	cysteine-type peptidase activity	g.chr3:101060619G>A		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2111C>T	3.37:g.101060619G>A	ENSP00000377655:p.Ser704Leu		Somatic				SENP7_uc003duu.2_Missense_Mutation_p.S639L|SENP7_uc003duv.2_Missense_Mutation_p.S671L|SENP7_uc003duw.2_Missense_Mutation_p.S638L|SENP7_uc003dux.2_Missense_Mutation_p.S540L	p.S704L	NM_020654	NP_065705	WXS	Illumina HiSeq	Unspecified	Q9BQF6	SENP7_HUMAN			15	2222	-			704					A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	37	c.2111C>T	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023417	0.75390	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.24908	1.83;1.86;1.87;1.85;1.85;1.84	5.76	4.89	0.63831	.	1.180990	0.06071	N	0.660116	T	0.43344	0.1243	L	0.29908	0.895	0.26799	N	0.969247	D;D;D;D	0.76494	0.999;0.999;0.997;0.998	D;D;P;D	0.68943	0.961;0.945;0.855;0.909	T	0.48490	-0.9031	10	0.72032	D	0.01	0.0046	14.3477	0.66678	0.0716:0.0:0.9284:0.0	.	540;638;671;704	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	L	704;639;638;540;540;671	ENSP00000377655:S704L;ENSP00000377654:S639L;ENSP00000313624:S638L;ENSP00000377651:S540L;ENSP00000350936:S540L;ENSP00000342159:S671L	ENSP00000313624:S638L	S	-	2	0	SENP7	102543309	1.000000	0.71417	0.020000	0.16555	0.001000	0.01503	3.807000	0.55591	1.449000	0.47699	-0.218000	0.12543	TCA		0.418	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654		4	43	0	0	0	0.009096	0	4	43				
POLQ	10721	broad.mit.edu	37	3	121230866	121230866	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:121230866G>A	ENST00000264233.5	-	10	1607	c.1479C>T	c.(1477-1479)atC>atT	p.I493I		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	493	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.I628I(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TACAAATTAAGATACTCTCGC	0.378								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(1477-1479)ATC>ATT	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							55.0	55.0	55.0					3																	121230866		2203	4299	6502	SO:0001819	synonymous_variant	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121230866G>A	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1479C>T	3.37:g.121230866G>A			Somatic					p.I493I	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	10	1608	-			493			Helicase C-terminal.		O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	c.1479C>T	CCDS33833.1																																																																																				0.378	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		10	46	0	0	0	0.006214	0	10	46				
ABCC5	10057	broad.mit.edu	37	3	183639187	183639187	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:183639187C>T	ENST00000334444.6	-	30	4455	c.4215G>A	c.(4213-4215)gtG>gtA	p.V1405V	ABCC5_ENST00000265586.6_Silent_p.V1362V	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1405	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.V1405V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CAAACTCCACCACCTGCAAAA	0.557																																							uc003fmg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(4213-4215)GTG>GTA		ATP-binding cassette, sub-family C, member 5							75.0	82.0	80.0					3																	183639187		2080	4219	6299	SO:0001819	synonymous_variant	10057					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr3:183639187C>T	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4215G>A	3.37:g.183639187C>T			Somatic				ABCC5_uc011bqt.1_Silent_p.V933V|ABCC5_uc010hxl.2_Silent_p.V1362V	p.V1405V	NM_005688	NP_005679	WXS	Illumina HiSeq	Unspecified	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		30	4380	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		1405			ABC transporter 2.		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	37	c.4215G>A	CCDS43176.1																																																																																				0.557	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		10	39	0	0	0	0.008291	0	10	39				
EPHB3	2049	broad.mit.edu	37	3	184297342	184297342	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:184297342G>C	ENST00000330394.2	+	10	2331	c.1879G>C	c.(1879-1881)Gag>Cag	p.E627Q	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	627					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)	p.E627Q(1)		breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GTTTGCCAAGGAGATCGACGT	0.557																																							uc003foz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11						c.(1879-1881)GAG>CAG		ephrin receptor EphB3 precursor							78.0	73.0	75.0					3																	184297342		2203	4300	6503	SO:0001583	missense	2049					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:184297342G>C	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.1879G>C	3.37:g.184297342G>C	ENSP00000332118:p.Glu627Gln		Somatic					p.E627Q	NM_004443	NP_004434	WXS	Illumina HiSeq	Unspecified	P54753	EPHB3_HUMAN	Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)		10	2316	+	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		627			Cytoplasmic (Potential).		Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	c.1879G>C	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426352	0.83667	.	.	ENSG00000182580	ENST00000330394	T	0.54279	0.58	4.91	4.91	0.64330	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	H	0.94925	3.6	0.80722	D	1	P	0.50617	0.937	B	0.39840	0.311	T	0.80091	-0.1527	10	0.87932	D	0	.	17.4856	0.87687	0.0:0.0:1.0:0.0	.	627	P54753	EPHB3_HUMAN	Q	627	ENSP00000332118:E627Q	ENSP00000332118:E627Q	E	+	1	0	EPHB3	185780036	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.859000	0.99545	2.450000	0.82876	0.551000	0.68910	GAG		0.557	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443		5	57	0	0	0	0.014758	0	5	57				
ZNF721	170960	broad.mit.edu	37	4	437398	437398	+	Silent	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:437398A>G	ENST00000338977.5	-	2	870	c.822T>C	c.(820-822)ttT>ttC	p.F274F	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Silent_p.F286F			Q8TF20	ZN721_HUMAN	zinc finger protein 721	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F286F(1)|p.F56F(1)		endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TGGAAATATTAAAGGCTTTAC	0.393																																							uc003gag.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(856-858)TTT>TTC		zinc finger protein 721							58.0	63.0	61.0					4																	437398		2059	4237	6296	SO:0001819	synonymous_variant	170960					intracellular	nucleic acid binding|zinc ion binding	g.chr4:437398A>G	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.822T>C	4.37:g.437398A>G			Somatic				ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Silent_p.F318F|ZNF721_uc010ibe.2_Silent_p.F274F	p.F286F	NM_133474	NP_597731	WXS	Illumina HiSeq	Unspecified	D9N162	D9N162_HUMAN			3	1549	-			286					Q69YG7	Silent	SNP	ENST00000338977.5	37	c.858T>C																																																																																					0.393	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474		13	67	0	0	0	0.016723	0	13	67				
WFS1	7466	broad.mit.edu	37	4	6296864	6296864	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:6296864A>T	ENST00000226760.1	+	7	979	c.809A>T	c.(808-810)gAt>gTt	p.D270V	WFS1_ENST00000503569.1_Missense_Mutation_p.D270V	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	270					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)	p.D270V(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		GACGACGAAGATGATGACGAG	0.597																																							uc003giy.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(808-810)GAT>GTT		wolframin							82.0	75.0	78.0					4																	6296864		2203	4300	6503	SO:0001583	missense	7466				endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding	g.chr4:6296864A>T	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.809A>T	4.37:g.6296864A>T	ENSP00000226760:p.Asp270Val		Somatic				WFS1_uc003gix.2_Missense_Mutation_p.D270V|WFS1_uc003giz.2_Missense_Mutation_p.D88V	p.D270V	NM_001145853	NP_001139325	WXS	Illumina HiSeq	Unspecified	O76024	WFS1_HUMAN		Colorectal(103;0.0512)	7	975	+			270					B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	37	c.809A>T	CCDS3386.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.74|14.74	2.627069|2.627069	0.46840|0.46840	.|.	.|.	ENSG00000109501|ENSG00000109501	ENST00000503569;ENST00000226760|ENST00000506362	D;D|.	0.95788|.	-3.81;-3.81|.	4.35|4.35	3.14|3.14	0.36123|0.36123	.|.	0.271361|.	0.34828|.	N|.	0.003647|.	T|T	0.54127|0.54127	0.1839|0.1839	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	P|.	0.47302|.	0.893|.	B|.	0.44085|.	0.44|.	T|T	0.44034|0.44034	-0.9354|-0.9354	10|5	0.51188|.	T|.	0.08|.	-12.7198|-12.7198	9.1507|9.1507	0.36962|0.36962	0.9112:0.0:0.0888:0.0|0.9112:0.0:0.0888:0.0	.|.	270|.	O76024|.	WFS1_HUMAN|.	V|L	270|148	ENSP00000423337:D270V;ENSP00000226760:D270V|.	ENSP00000226760:D270V|.	D|M	+|+	2|1	0|0	WFS1|WFS1	6347765|6347765	1.000000|1.000000	0.71417|0.71417	0.109000|0.109000	0.21407|0.21407	0.499000|0.499000	0.33736|0.33736	6.167000|6.167000	0.71902|0.71902	0.520000|0.520000	0.28426|0.28426	0.379000|0.379000	0.24179|0.24179	GAT|ATG		0.597	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1			13	59	0	0	0	0.013537	0	13	59				
DCAF4L1	285429	broad.mit.edu	37	4	41984969	41984969	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:41984969G>A	ENST00000333141.5	+	1	1257	c.1160G>A	c.(1159-1161)cGg>cAg	p.R387Q		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	387								p.R387Q(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						ATGGCTGTCCGGCAGGACCTT	0.567																																							uc003gwk.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1159-1161)CGG>CAG		WD repeat domain 21B							37.0	39.0	38.0					4																	41984969		2203	4300	6503	SO:0001583	missense	285429							g.chr4:41984969G>A	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.1160G>A	4.37:g.41984969G>A	ENSP00000327796:p.Arg387Gln		Somatic					p.R387Q	NM_001029955	NP_001025126	WXS	Illumina HiSeq	Unspecified	Q3SXM0	DC4L1_HUMAN			1	1257	+			387					B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	37	c.1160G>A	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131062	0.56828	.	.	ENSG00000182308	ENST00000333141	T	0.26518	1.73	0.97	-0.0321	0.13906	.	0.579100	0.18356	N	0.143715	T	0.10766	0.0263	N	0.13043	0.29	0.20074	N	0.999935	B	0.17667	0.023	B	0.04013	0.001	T	0.22173	-1.0224	10	0.24483	T	0.36	.	3.7534	0.08575	0.5505:0.0:0.4495:0.0	.	387	Q3SXM0	DC4L1_HUMAN	Q	387	ENSP00000327796:R387Q	ENSP00000327796:R387Q	R	+	2	0	DCAF4L1	41679726	0.996000	0.38824	0.038000	0.18304	0.931000	0.56810	1.121000	0.31283	-0.038000	0.13624	0.313000	0.20887	CGG		0.567	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955		6	40	0	0	0	0.00308	0	6	40				
KCTD8	386617	broad.mit.edu	37	4	44449818	44449818	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:44449818G>A	ENST00000360029.3	-	1	1006	c.723C>T	c.(721-723)atC>atT	p.I241I	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	241					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.I241I(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TGGCCAGCGCGATGCGCCCGC	0.667										HNSCC(17;0.042)																													uc003gwu.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(721-723)ATC>ATT		potassium channel tetramerisation domain							33.0	27.0	29.0					4																	44449818		2202	4298	6500	SO:0001819	synonymous_variant	386617					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr4:44449818G>A	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.723C>T	4.37:g.44449818G>A		HNSCC(17;0.042)	Somatic					p.I241I	NM_198353	NP_938167	WXS	Illumina HiSeq	Unspecified	Q6ZWB6	KCTD8_HUMAN			1	1007	-			241					A2RU39	Silent	SNP	ENST00000360029.3	37	c.723C>T	CCDS3467.1																																																																																				0.667	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1			3	11	0	0	0	0.004672	0	3	11				
SPATA18	132671	broad.mit.edu	37	4	52928477	52928477	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:52928477A>C	ENST00000295213.4	+	4	775	c.401A>C	c.(400-402)cAa>cCa	p.Q134P	SPATA18_ENST00000506829.1_Intron|SPATA18_ENST00000419395.2_Missense_Mutation_p.Q134P	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	134					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.Q134P(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			ACCCGGAGTCAATGCAACCAG	0.378																																							uc003gzl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(400-402)CAA>CCA		spermatogenesis associated 18 homolog							91.0	92.0	92.0					4																	52928477		2203	4300	6503	SO:0001583	missense	132671				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding	g.chr4:52928477A>C	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.401A>C	4.37:g.52928477A>C	ENSP00000295213:p.Gln134Pro		Somatic				SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.Q134P|SPATA18_uc003gzk.1_Missense_Mutation_p.Q134P	p.Q134P	NM_145263	NP_660306	WXS	Illumina HiSeq	Unspecified	Q8TC71	MIEAP_HUMAN	GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)		4	679	+			134			Potential.		B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	c.401A>C	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.924527	0.34002	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	D;D	0.87729	-2.29;-2.29	5.05	5.05	0.67936	.	0.115266	0.64402	D	0.000012	D	0.92156	0.7513	M	0.74881	2.28	0.34001	D	0.650304	D;D;B	0.69078	0.997;0.997;0.058	D;D;B	0.78314	0.991;0.991;0.022	D	0.94929	0.8080	10	0.66056	D	0.02	-21.0905	11.1035	0.48188	1.0:0.0:0.0:0.0	.	134;134;134	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	P	134	ENSP00000295213:Q134P;ENSP00000415309:Q134P	ENSP00000295213:Q134P	Q	+	2	0	SPATA18	52623234	0.731000	0.28111	0.869000	0.34112	0.193000	0.23685	1.949000	0.40313	2.126000	0.65437	0.460000	0.39030	CAA		0.378	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		5	137	0	0	0	0.014758	0	5	137				
LPHN3	23284	broad.mit.edu	37	4	62599069	62599069	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:62599069A>T	ENST00000514591.1	+	7	1321	c.992A>T	c.(991-993)gAc>gTc	p.D331V	LPHN3_ENST00000508946.1_Missense_Mutation_p.D331V|LPHN3_ENST00000509896.1_Missense_Mutation_p.D399V|LPHN3_ENST00000511324.1_Missense_Mutation_p.D399V|LPHN3_ENST00000508693.1_Missense_Mutation_p.D399V|LPHN3_ENST00000506700.1_Missense_Mutation_p.D331V|LPHN3_ENST00000514996.1_Missense_Mutation_p.D331V|LPHN3_ENST00000512091.2_Missense_Mutation_p.D331V|LPHN3_ENST00000507164.1_Missense_Mutation_p.D399V|LPHN3_ENST00000504896.1_Missense_Mutation_p.D331V|LPHN3_ENST00000545650.1_Missense_Mutation_p.D331V|LPHN3_ENST00000514157.1_Missense_Mutation_p.D331V|LPHN3_ENST00000506720.1_Missense_Mutation_p.D399V|LPHN3_ENST00000506746.1_Missense_Mutation_p.D399V|LPHN3_ENST00000507625.1_Missense_Mutation_p.D399V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	331	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.D331V(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GAGGATGATGACAATGAGGCT	0.378																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(991-993)GAC>GTC		latrophilin 3 precursor							121.0	107.0	112.0					4																	62599069		1942	4145	6087	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62599069A>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.992A>T	4.37:g.62599069A>T	ENSP00000422533:p.Asp331Val		Somatic				LPHN3_uc003hcq.3_Missense_Mutation_p.D331V|LPHN3_uc010ihg.1_Missense_Mutation_p.D399V|LPHN3_uc003hcs.1_Missense_Mutation_p.D160V	p.D331V	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			5	1165	+			331			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.992A>T	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750815	0.49257	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3;-3.3	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.95367	0.8496	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.996	D	0.95005	0.8146	10	0.44086	T	0.13	.	14.4261	0.67218	1.0:0.0:0.0:0.0	.	331;399;331	E9PE04;E7EN28;Q9HAR2-2	.;.;.	V	331;331;399;399;331;331;331;331;331;399;399;399;331;331;331;399;399;331	ENSP00000423388:D331V;ENSP00000422533:D331V;ENSP00000423787:D399V;ENSP00000425033:D399V;ENSP00000424120:D331V;ENSP00000439831:D331V;ENSP00000421476:D399V;ENSP00000424030:D399V;ENSP00000421372:D399V;ENSP00000425201:D331V;ENSP00000423434:D331V;ENSP00000421627:D331V;ENSP00000420931:D399V;ENSP00000425884:D399V;ENSP00000424258:D331V	ENSP00000280009:D331V	D	+	2	0	LPHN3	62281664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	1.999000	0.58509	0.455000	0.32223	GAC		0.378	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			6	54	0	0	0	0.021553	0	6	54				
MUC7	4589	broad.mit.edu	37	4	71347020	71347020	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:71347020G>C	ENST00000304887.5	+	3	749	c.559G>C	c.(559-561)Gag>Cag	p.E187Q	MUC7_ENST00000456088.1_Missense_Mutation_p.E187Q|MUC7_ENST00000413702.1_Missense_Mutation_p.E187Q	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	187	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.E187Q(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			AGCTCCACCAGAGACCACAGC	0.587																																							uc011cat.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(559-561)GAG>CAG		mucin 7, secreted precursor							333.0	269.0	291.0					4																	71347020		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71347020G>C	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.559G>C	4.37:g.71347020G>C	ENSP00000302021:p.Glu187Gln		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.E187Q|MUC7_uc003hfj.2_Missense_Mutation_p.E187Q|uc011cav.1_RNA	p.E187Q	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	847	+			187			1.|Thr-rich.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.559G>C	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	G	6.182	0.401674	0.11696	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.44881	0.91;0.91;0.91	2.1	0.112	0.14623	.	.	.	.	.	T	0.20659	0.0497	N	0.24115	0.695	0.09310	N	1	B	0.28850	0.225	B	0.24269	0.052	T	0.16424	-1.0403	8	.	.	.	.	0.9536	0.01381	0.1514:0.2361:0.372:0.2405	.	187	Q8TAX7	MUC7_HUMAN	Q	187	ENSP00000407422:E187Q;ENSP00000400585:E187Q;ENSP00000302021:E187Q	.	E	+	1	0	MUC7	71381609	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.087000	0.14958	-0.001000	0.14495	-0.175000	0.13238	GAG		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		21	122	0	0	0	0.012319	0	21	122				
AFP	174	broad.mit.edu	37	4	74308075	74308075	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:74308075C>G	ENST00000395792.2	+	5	645	c.545C>G	c.(544-546)gCt>gGt	p.A182G	AFP_ENST00000226359.2_Missense_Mutation_p.A182G	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	182	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)	p.A182G(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTCTTTGGGCTGCTCGCTAT	0.378									Alpha-Fetoprotein, Hereditary Persistence of																														uc003hgz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(544-546)GCT>GGT		alpha-fetoprotein precursor							93.0	89.0	90.0					4																	74308075		2203	4300	6503	SO:0001583	missense	174	Alpha-Fetoprotein_Hereditary_Persistence_of	Familial Cancer Database	HPAFP	transport		metal ion binding	g.chr4:74308075C>G	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.545C>G	4.37:g.74308075C>G	ENSP00000379138:p.Ala182Gly		Somatic				AFP_uc003hha.1_Missense_Mutation_p.A182G|AFP_uc011cbg.1_5'UTR	p.A182G	NM_001134	NP_001125	WXS	Illumina HiSeq	Unspecified	P02771	FETA_HUMAN	Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		5	592	+	Breast(15;0.00102)		182			Albumin 1.		B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	c.545C>G	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976655	0.53720	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.77229	-1.08;-1.08	5.33	5.33	0.75918	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.075632	0.64402	D	0.000015	D	0.89051	0.6605	M	0.87547	2.89	0.27342	N	0.956481	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.83673	0.0167	10	0.87932	D	0	.	14.4645	0.67475	0.0:1.0:0.0:0.0	.	24;182	B4DMX4;P02771	.;FETA_HUMAN	G	182	ENSP00000379138:A182G;ENSP00000226359:A182G	ENSP00000226359:A182G	A	+	2	0	AFP	74526939	0.785000	0.28726	0.238000	0.24106	0.413000	0.31143	4.162000	0.58177	2.788000	0.95919	0.586000	0.80456	GCT		0.378	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3			22	38	0	0	0	0.014323	0	22	38				
SHROOM3	57619	broad.mit.edu	37	4	77660856	77660856	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:77660856G>A	ENST00000296043.6	+	5	2483	c.1530G>A	c.(1528-1530)aaG>aaA	p.K510K		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	510					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.K509K(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CATGCAACAAGATGGCTACCA	0.547																																							uc011cbx.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1528-1530)AAG>AAA		shroom family member 3 protein							116.0	117.0	117.0					4																	77660856		2203	4300	6503	SO:0001819	synonymous_variant	57619				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding	g.chr4:77660856G>A	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1530G>A	4.37:g.77660856G>A			Somatic				SHROOM3_uc011cbz.1_Silent_p.K334K|SHROOM3_uc003hkf.1_Silent_p.K385K|SHROOM3_uc003hkg.2_Silent_p.K288K	p.K510K	NM_020859	NP_065910	WXS	Illumina HiSeq	Unspecified	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)		5	2483	+			510					Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	c.1530G>A	CCDS3579.2																																																																																				0.547	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		15	109	0	0	0	0.00499	0	15	109				
EMCN	51705	broad.mit.edu	37	4	101331503	101331503	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:101331503G>C	ENST00000296420.4	-	11	939	c.761C>G	c.(760-762)tCt>tGt	p.S254C	EMCN_ENST00000305864.3_Missense_Mutation_p.S171C|EMCN_ENST00000511970.1_Missense_Mutation_p.S241C	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	254						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S254C(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		TCCTTGTGCAGAGTGCTCACC	0.378																																							uc003hvr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(760-762)TCT>TGT		endomucin isoform 1							199.0	190.0	193.0					4																	101331503		2203	4300	6503	SO:0001583	missense	51705					extracellular region|integral to membrane|plasma membrane		g.chr4:101331503G>C	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.761C>G	4.37:g.101331503G>C	ENSP00000296420:p.Ser254Cys		Somatic				EMCN_uc011cel.1_Missense_Mutation_p.S241C|EMCN_uc011cem.1_Missense_Mutation_p.S171C	p.S254C	NM_016242	NP_057326	WXS	Illumina HiSeq	Unspecified	Q9ULC0	MUCEN_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)	11	940	-			254			Cytoplasmic (Potential).		A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	ENST00000296420.4	37	c.761C>G	CCDS3655.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665597	0.47677	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000506300;ENST00000511970	.	.	.	5.02	2.28	0.28536	.	0.461379	0.16686	N	0.203722	T	0.23249	0.0562	L	0.27053	0.805	0.28750	N	0.901484	P;B;B	0.35894	0.526;0.407;0.407	B;B;B	0.34418	0.182;0.171;0.171	T	0.12041	-1.0563	9	0.87932	D	0	-3.9566	7.2641	0.26219	0.0901:0.3276:0.5823:0.0	.	171;241;254	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	C	254;171;69;241	.	ENSP00000296420:S254C	S	-	2	0	EMCN	101550526	0.995000	0.38212	0.964000	0.40570	0.899000	0.52679	1.704000	0.37857	0.224000	0.20940	0.655000	0.94253	TCT		0.378	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242		14	120	0	0	0	0.028581	0	14	120				
CISD2	493856	broad.mit.edu	37	4	103806449	103806449	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:103806449C>T	ENST00000273986.4	+	2	287	c.180C>T	c.(178-180)ctC>ctT	p.L60L	CISD2_ENST00000503643.1_Silent_p.L70L|SLC9B1_ENST00000394789.3_Missense_Mutation_p.E457K	NM_001008388.4	NP_001008389.1	Q8N5K1	CISD2_HUMAN	CDGSH iron sulfur domain 2	60					mitochondrion degradation (GO:0000422)|multicellular organismal aging (GO:0010259)|regulation of autophagy (GO:0010506)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L60L(1)		endometrium(1)|lung(3)	4				OV - Ovarian serous cystadenocarcinoma(123;1.97e-08)		GTCCATTCCTCCCGAAGAAGA	0.373																																							uc003hwu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1369-1371)GAG>AAG		Na+/H+ exchanger domain containing 1 isoform 2							115.0	101.0	106.0					4																	103806449		2203	4300	6503	SO:0001819	synonymous_variant	150159					integral to membrane	solute:hydrogen antiporter activity	g.chr4:103806449C>T	BX537971	CCDS34040.1	4q24	2009-03-25	2007-08-10	2007-08-10	ENSG00000145354	ENSG00000145354		"""CDGSH iron sulfur domain containing"""	24212	protein-coding gene	gene with protein product	"""mitoNEET related 1"", ""endoplasmic reticulum intermembrane small protein"""	611507	"""zinc finger, CDGSH-type domain 2"", ""Wolfram syndrome 2"""	ZCD2, WFS2		17376863, 17584744, 17846994	Standard	NM_001008388		Approved	Miner1, ERIS	uc003hwt.4	Q8N5K1	OTTHUMG00000161014	ENST00000273986.4:c.180C>T	4.37:g.103806449C>T			Somatic				CISD2_uc003hwt.3_Silent_p.L60L|NHEDC1_uc010ilm.2_Missense_Mutation_p.E224K|NHEDC1_uc003hwv.2_Intron	p.E457K	NM_001100874	NP_001094344	WXS	Illumina HiSeq	Unspecified	Q4ZJI4	NHDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)	12	1491	-		Hepatocellular(203;0.217)	Error:Variant_position_missing_in_Q4ZJI4_after_alignment					Q7Z3D5	Missense_Mutation	SNP	ENST00000273986.4	37	c.1369G>A	CCDS34040.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066396	0.36470	.	.	ENSG00000164037	ENST00000394789	T	0.19250	2.16	6.17	2.38	0.29361	.	.	.	.	.	T	0.09774	0.0240	.	.	.	0.80722	D	1	B;B	0.16166	0.009;0.016	B;B	0.19148	0.013;0.024	T	0.22243	-1.0222	8	0.13470	T	0.59	-0.7926	2.3497	0.04280	0.1174:0.4443:0.1145:0.3238	.	225;457	Q4ZJI4-2;Q4ZJI4-3	.;.	K	457	ENSP00000378269:E457K	ENSP00000378269:E457K	E	-	1	0	SLC9B1	104025884	0.889000	0.30405	0.088000	0.20740	0.327000	0.28475	0.294000	0.19047	0.124000	0.18369	-0.140000	0.14226	GAG		0.373	CISD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363417.2	NM_001008388		22	92	0	0	0	0.016522	0	22	92				
ARSJ	79642	broad.mit.edu	37	4	114824400	114824400	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:114824400C>A	ENST00000315366.7	-	2	1696	c.830G>T	c.(829-831)aGg>aTg	p.R277M	ARSJ_ENST00000541197.1_Missense_Mutation_p.R277M	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	277					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R277K(1)|p.R277M(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		TTCGAAATACCTGCCAGGAGC	0.423																																							uc003ibq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(829-831)AGG>ATG		arylsulfatase J precursor							117.0	107.0	110.0					4																	114824400		1954	4168	6122	SO:0001583	missense	79642					extracellular region	arylsulfatase activity|metal ion binding	g.chr4:114824400C>A		CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.830G>T	4.37:g.114824400C>A	ENSP00000320219:p.Arg277Met		Somatic				ARSJ_uc010imu.1_Missense_Mutation_p.R277M|ARSJ_uc010imv.1_Missense_Mutation_p.R105M	p.R277M	NM_024590	NP_078866	WXS	Illumina HiSeq	Unspecified	Q5FYB0	ARSJ_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00194)	2	1718	-		Ovarian(17;0.0035)|Hepatocellular(203;0.217)	277					A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	ENST00000315366.7	37	c.830G>T	CCDS43264.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.622304	0.46840	.	.	ENSG00000180801	ENST00000315366;ENST00000541197	D;D	0.96745	-4.11;-4.11	5.64	4.61	0.57282	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.262331	0.34460	N	0.003946	D	0.94039	0.8090	M	0.63208	1.945	0.29079	N	0.882798	B;B	0.14438	0.01;0.005	B;B	0.23018	0.033;0.043	D	0.88871	0.3333	10	0.66056	D	0.02	.	7.5083	0.27558	0.0:0.6684:0.1515:0.1801	.	277;277	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	M	277	ENSP00000320219:R277M;ENSP00000438836:R277M	ENSP00000320219:R277M	R	-	2	0	ARSJ	115043849	0.177000	0.23109	0.998000	0.56505	0.975000	0.68041	0.353000	0.20130	2.657000	0.90304	0.655000	0.94253	AGG		0.423	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363650.1	NM_024590		16	74	1	0	2.35188e-11	0.006122	2.71471e-11	16	74				
NDST3	9348	broad.mit.edu	37	4	118975516	118975516	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:118975516G>A	ENST00000296499.5	+	2	854	c.451G>A	c.(451-453)Gat>Aat	p.D151N	NDST3_ENST00000433996.2_Missense_Mutation_p.D151N	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	151	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.D151N(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AAGCCTTCTAGATAAATACTG	0.338																																							uc003ibx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(451-453)GAT>AAT		N-deacetylase/N-sulfotransferase (heparan							48.0	49.0	48.0					4																	118975516		2203	4298	6501	SO:0001583	missense	9348					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:118975516G>A	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.451G>A	4.37:g.118975516G>A	ENSP00000296499:p.Asp151Asn		Somatic				NDST3_uc011cgf.1_Missense_Mutation_p.D151N|NDST3_uc003ibw.2_Missense_Mutation_p.D151N	p.D151N	NM_004784	NP_004775	WXS	Illumina HiSeq	Unspecified	O95803	NDST3_HUMAN			2	854	+			151			Lumenal (Potential).|Heparan sulfate N-deacetylase 3.		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	c.451G>A	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035808	0.54896	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.53423	0.99;0.62	5.3	5.3	0.74995	.	0.049811	0.85682	D	0.000000	T	0.62134	0.2403	M	0.81341	2.54	0.47511	D	0.999446	P;P;P	0.49559	0.474;0.774;0.925	B;P;P	0.51550	0.396;0.673;0.54	T	0.67031	-0.5773	10	0.54805	T	0.06	.	15.3229	0.74135	0.0:0.14:0.86:0.0	.	151;151;151	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	N	151	ENSP00000296499:D151N;ENSP00000396625:D151N	ENSP00000296499:D151N	D	+	1	0	NDST3	119194964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.311000	0.65786	2.464000	0.83262	0.655000	0.94253	GAT		0.338	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784		8	52	0	0	0	0.006214	0	8	52				
USP53	54532	broad.mit.edu	37	4	120213799	120213799	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:120213799C>G	ENST00000274030.6	+	19	3834	c.2655C>G	c.(2653-2655)atC>atG	p.I885M	USP53_ENST00000450251.1_Missense_Mutation_p.I885M	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53									p.I884M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						AACAAAATATCATGGATCAAT	0.408																																							uc003ics.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|kidney(1)|skin(1)	4						c.(2653-2655)ATC>ATG		ubiquitin specific protease 53							83.0	76.0	78.0					4																	120213799		1884	4110	5994	SO:0001583	missense	54532				ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity	g.chr4:120213799C>G	BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.2655C>G	4.37:g.120213799C>G	ENSP00000274030:p.Ile885Met		Somatic				USP53_uc003icr.3_Missense_Mutation_p.I885M|USP53_uc003icu.3_Missense_Mutation_p.I508M	p.I885M	NM_019050	NP_061923	WXS	Illumina HiSeq	Unspecified	Q70EK8	UBP53_HUMAN			18	3721	+			885						Missense_Mutation	SNP	ENST00000274030.6	37	c.2655C>G	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.905373	0.00512	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.46451	0.87;0.87	5.26	-2.61	0.06171	.	2.040090	0.01598	N	0.021913	T	0.15305	0.0369	N	0.01482	-0.84	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.07385	-1.0775	10	0.25751	T	0.34	4.6056	2.5814	0.04819	0.1906:0.4055:0.2103:0.1936	.	885	Q70EK8	UBP53_HUMAN	M	885	ENSP00000274030:I885M;ENSP00000409906:I885M	ENSP00000274030:I885M	I	+	3	3	USP53	120433247	0.000000	0.05858	0.000000	0.03702	0.391000	0.30476	-0.304000	0.08199	-0.602000	0.05775	-1.886000	0.00541	ATC		0.408	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597		10	42	0	0	0	0.008291	0	10	42				
RAPGEF2	9693	broad.mit.edu	37	4	160266332	160266332	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr4:160266332G>T	ENST00000264431.4	+	18	3289	c.2870G>T	c.(2869-2871)cGt>cTt	p.R957L		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	957					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.R945L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AAGCGGGTACGTCGTAGTTCC	0.443																																							uc003iqg.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(2869-2871)CGT>CTT		Rap guanine nucleotide exchange factor 2							173.0	173.0	173.0					4																	160266332		1926	4138	6064	SO:0001583	missense	9693				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr4:160266332G>T	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2870G>T	4.37:g.160266332G>T	ENSP00000264431:p.Arg957Leu		Somatic					p.R957L	NM_014247	NP_055062	WXS	Illumina HiSeq	Unspecified	Q9Y4G8	RPGF2_HUMAN		COAD - Colon adenocarcinoma(41;0.0817)	18	3180	+	all_hematologic(180;0.24)		957					D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	c.2870G>T	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	G	34	5.319234	0.95682	.	.	ENSG00000109756	ENST00000264431	T	0.41758	0.99	6.07	6.07	0.98685	Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.58235	0.2108	M	0.74881	2.28	0.80722	D	1	P	0.48640	0.913	P	0.49477	0.612	T	0.60347	-0.7281	10	0.72032	D	0.01	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	957	Q9Y4G8	RPGF2_HUMAN	L	957	ENSP00000264431:R957L	ENSP00000264431:R957L	R	+	2	0	RAPGEF2	160485782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CGT		0.443	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		98	108	1	0	8.84886e-50	0.01441	1.12014e-49	98	108				
CDH6	1004	broad.mit.edu	37	5	31316422	31316422	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:31316422G>T	ENST00000265071.2	+	9	1763	c.1498G>T	c.(1498-1500)Gca>Tca	p.A500S	CDH6_ENST00000514738.1_Missense_Mutation_p.A445S	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	500	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A500S(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CTGTGAAAAAGCAAAGGCAGA	0.343																																							uc003jhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(1498-1500)GCA>TCA		cadherin 6, type 2 preproprotein							65.0	66.0	66.0					5																	31316422		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31316422G>T	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1498G>T	5.37:g.31316422G>T	ENSP00000265071:p.Ala500Ser		Somatic				CDH6_uc003jhd.1_Missense_Mutation_p.A500S	p.A500S	NM_004932	NP_004923	WXS	Illumina HiSeq	Unspecified	P55285	CADH6_HUMAN			9	1824	+			500			Extracellular (Potential).|Cadherin 5.		A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.1498G>T	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736595	0.69304	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.54479	0.57;0.57	5.25	5.25	0.73442	Cadherin (3);Cadherin-like (1);	0.211983	0.48767	D	0.000176	T	0.65831	0.2729	M	0.77313	2.365	0.51012	D	0.999903	P;P	0.41848	0.763;0.721	P;P	0.47786	0.515;0.557	T	0.66276	-0.5964	10	0.45353	T	0.12	.	19.3982	0.94617	0.0:0.0:1.0:0.0	.	500;500	P55285;P55285-2	CADH6_HUMAN;.	S	445;500	ENSP00000424843:A445S;ENSP00000265071:A500S	ENSP00000265071:A500S	A	+	1	0	CDH6	31352179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.247000	0.78257	2.894000	0.99253	0.655000	0.94253	GCA		0.343	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		25	33	1	0	1.1804e-14	0.021523	1.38929e-14	25	33				
AGXT2	64902	broad.mit.edu	37	5	35010148	35010148	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:35010148C>T	ENST00000231420.6	-	12	1495	c.1295G>A	c.(1294-1296)cGa>cAa	p.R432Q		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	432					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.R432Q(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	ACCTTTGCCTCGGACGTCTCC	0.448																																							uc003jjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1294-1296)CGA>CAA		alanine-glyoxylate aminotransferase 2 precursor	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)						130.0	115.0	120.0					5																	35010148		2203	4300	6503	SO:0001583	missense	64902				glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding	g.chr5:35010148C>T	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1295G>A	5.37:g.35010148C>T	ENSP00000231420:p.Arg432Gln		Somatic				AGXT2_uc003jje.1_Missense_Mutation_p.R85Q|AGXT2_uc011com.1_Missense_Mutation_p.R357Q	p.R432Q	NM_031900	NP_114106	WXS	Illumina HiSeq	Unspecified	Q9BYV1	AGT2_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	12	1374	-	all_lung(31;4.52e-05)		432					B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	37	c.1295G>A	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	C	32	5.157242	0.94686	.	.	ENSG00000113492	ENST00000231420	D	0.93906	-3.31	5.67	5.67	0.87782	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.97835	0.9289	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98554	1.0638	10	0.87932	D	0	-9.223	19.3681	0.94473	0.0:1.0:0.0:0.0	.	357;432	E9PDL7;Q9BYV1	.;AGT2_HUMAN	Q	432	ENSP00000231420:R432Q	ENSP00000231420:R432Q	R	-	2	0	AGXT2	35045905	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	7.102000	0.77005	2.677000	0.91161	0.655000	0.94253	CGA		0.448	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900		17	76	0	0	0	0.028581	0	17	76				
SPEF2	79925	broad.mit.edu	37	5	35771819	35771819	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:35771819G>T	ENST00000356031.3	+	27	4064	c.3910G>T	c.(3910-3912)Gag>Tag	p.E1304*	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Nonsense_Mutation_p.E1299*	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1304					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.E1304*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGTCAAAAAGGAGCCACCCAA	0.403																																							uc003jjo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(3910-3912)GAG>TAG		KPL2 protein isoform 1							54.0	57.0	56.0					5																	35771819		1811	4068	5879	SO:0001587	stop_gained	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35771819G>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3910G>T	5.37:g.35771819G>T	ENSP00000348314:p.Glu1304*		Somatic				SPEF2_uc003jjp.1_Nonsense_Mutation_p.E790*|SPEF2_uc003jjr.2_5'Flank	p.E1304*	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		27	4021	+	all_lung(31;7.56e-05)		1304					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	37	c.3910G>T	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	38	7.147800	0.98096	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	.	.	.	5.68	4.8	0.61643	.	0.379769	0.26642	N	0.023254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	13.2258	0.59914	0.0817:0.0:0.9183:0.0	.	.	.	.	X	1304;1299	.	ENSP00000348314:E1304X	E	+	1	0	SPEF2	35807576	1.000000	0.71417	0.982000	0.44146	0.119000	0.20118	3.512000	0.53407	2.847000	0.97988	0.591000	0.81541	GAG		0.403	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		18	52	1	0	3.41278e-10	0.00499	3.85433e-10	18	52				
ADAMTS6	11174	broad.mit.edu	37	5	64747409	64747409	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:64747409G>A	ENST00000536360.1	-	7	1779	c.966C>T	c.(964-966)ctC>ctT	p.L322L				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	322	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L322L(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		AGAAGCTATCGAGGGACTTGT	0.413																																							uc003jtp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(964-966)CTC>CTT		ADAM metallopeptidase with thrombospondin type 1							168.0	153.0	158.0					5																	64747409		2203	4300	6503	SO:0001819	synonymous_variant	11174				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:64747409G>A	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.966C>T	5.37:g.64747409G>A			Somatic				ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_5'UTR	p.L322L	NM_197941	NP_922932	WXS	Illumina HiSeq	Unspecified	Q9UKP5	ATS6_HUMAN		Lung(70;0.00942)	7	1780	-		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)	322			Peptidase M12B.		Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Silent	SNP	ENST00000536360.1	37	c.966C>T																																																																																					0.413	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941		28	50	0	0	0	0.00632	0	28	50				
GCNT4	51301	broad.mit.edu	37	5	74325767	74325767	+	Silent	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:74325767T>C	ENST00000322348.4	-	1	957	c.96A>G	c.(94-96)ctA>ctG	p.L32L		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	32					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.L32L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		GTCTCACATTTAGAAGCTTTA	0.363																																							uc003kdn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(94-96)CTA>CTG		core 2 beta-1,6-N-acetylglucosaminyltransferase							108.0	122.0	118.0					5																	74325767		2203	4297	6500	SO:0001819	synonymous_variant	51301				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity	g.chr5:74325767T>C	AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.96A>G	5.37:g.74325767T>C			Somatic					p.L32L	NM_016591	NP_057675	WXS	Illumina HiSeq	Unspecified	Q9P109	GCNT4_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)	1	958	-		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)	32			Helical; Signal-anchor for type II membrane protein; (Potential).			Silent	SNP	ENST00000322348.4	37	c.96A>G	CCDS4026.1																																																																																				0.363	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591		61	210	0	0	0	0.01441	0	61	210				
THBS4	7060	broad.mit.edu	37	5	79378926	79378926	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:79378926G>A	ENST00000350881.2	+	22	3038	c.2848G>A	c.(2848-2850)Gag>Aag	p.E950K	CTD-2201I18.1_ENST00000503007.1_RNA|CTD-2201I18.1_ENST00000514042.1_RNA|THBS4_ENST00000504720.1_3'UTR|THBS4_ENST00000511733.1_Missense_Mutation_p.E859K	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	950					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.E950K(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GGACTTCCAAGAGTTTCAAAC	0.502											OREG0016685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003kgh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2848-2850)GAG>AAG		thrombospondin 4 precursor							90.0	99.0	96.0					5																	79378926		2203	4300	6503	SO:0001583	missense	7060				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity	g.chr5:79378926G>A		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.2848G>A	5.37:g.79378926G>A	ENSP00000339730:p.Glu950Lys		Somatic	OREG0016685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1190	uc003kgi.3_Intron	p.E950K	NM_003248	NP_003239	WXS	Illumina HiSeq	Unspecified	P35443	TSP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)	23	3171	+		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)	950					B2R909|Q86TG2	Missense_Mutation	SNP	ENST00000350881.2	37	c.2848G>A	CCDS4049.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620492	0.66787	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	D;D	0.86562	-2.03;-2.14	5.91	5.91	0.95273	.	0.098933	0.64402	D	0.000002	T	0.77143	0.4087	N	0.12569	0.235	0.58432	D	0.999999	P	0.46395	0.877	B	0.40741	0.339	T	0.75878	-0.3162	10	0.07482	T	0.82	-29.4882	20.2904	0.98542	0.0:0.0:1.0:0.0	.	950	P35443	TSP4_HUMAN	K	950;859	ENSP00000339730:E950K;ENSP00000422298:E859K	ENSP00000339730:E950K	E	+	1	0	THBS4	79414682	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.878000	0.92393	2.796000	0.96246	0.655000	0.94253	GAG		0.502	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1			37	134	0	0	0	0.009718	0	37	134				
NR2F1	7025	broad.mit.edu	37	5	92929473	92929473	+	Silent	SNP	C	C	T	rs138827038	byFrequency	TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:92929473C>T	ENST00000327111.3	+	3	2884	c.1197C>T	c.(1195-1197)atC>atT	p.I399I	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	399					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.I399I(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		AAACCCCCATCGAAACTCTCA	0.572																																							uc003kkj.2		NA																	1	Substitution - coding silent(1)		lung(1)	urinary_tract(1)|ovary(1)|lung(1)	3						c.(1195-1197)ATC>ATT		nuclear receptor subfamily 2, group F, member 1		C		4,4402	8.1+/-20.4	0,4,2199	136.0	128.0	131.0		1197	2.0	1.0	5	dbSNP_134	131	0,8600		0,0,4300	no	coding-synonymous	NR2F1	NM_005654.4		0,4,6499	TT,TC,CC		0.0,0.0908,0.0308		399/424	92929473	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	7025				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding	g.chr5:92929473C>T	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1197C>T	5.37:g.92929473C>T			Somatic					p.I399I	NM_005654	NP_005645	WXS	Illumina HiSeq	Unspecified	P10589	COT1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)	3	2884	+		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)	399						Silent	SNP	ENST00000327111.3	37	c.1197C>T	CCDS4068.1																																																																																				0.572	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654		23	95	0	0	0	0.01892	0	23	95				
SKP1	6500	broad.mit.edu	37	5	133502893	133502893	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:133502893G>C	ENST00000353411.6	-	3	322	c.139C>G	c.(139-141)Cta>Gta	p.L47V	SKP1_ENST00000522855.1_Missense_Mutation_p.L47V|SKP1_ENST00000517625.1_Missense_Mutation_p.L47V|CTD-2410N18.5_ENST00000519718.1_Missense_Mutation_p.L81V|SKP1_ENST00000521216.1_Missense_Mutation_p.L47V|SKP1_ENST00000522552.1_Missense_Mutation_p.L47V	NM_170679.2	NP_733779.1	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H2A monoubiquitination (GO:0035518)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul7-RING ubiquitin ligase complex (GO:0031467)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-protein transferase activity (GO:0004842)	p.L47V(1)		large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACATTTGGTAGAGGAACTGGG	0.303																																							uc003kzc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)CTA>GTA		S-phase kinase-associated protein 1 isoform b							88.0	84.0	86.0					5																	133502893		2203	4300	6503	SO:0001583	missense	6500				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:133502893G>C	U33760	CCDS4171.1, CCDS4172.1	5q31	2011-11-18	2007-11-13	2007-11-13	ENSG00000113558	ENSG00000113558			10899	protein-coding gene	gene with protein product		601434	"""S-phase kinase-associated protein 1A (p19A)"""	SKP1A		7553852, 8646875	Standard	NM_006930		Approved	EMC19, OCP2, TCEB1L, MGC34403, OCP-II, p19A	uc003kzc.4	P63208	OTTHUMG00000129117	ENST00000353411.6:c.139C>G	5.37:g.133502893G>C	ENSP00000231487:p.Leu47Val		Somatic				SKP1_uc003kzd.3_Missense_Mutation_p.L47V|SKP1_uc010jdv.2_Missense_Mutation_p.L47V	p.L47V	NM_170679	NP_733779	WXS	Illumina HiSeq	Unspecified	P63208	SKP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		3	318	-			47					D3DQ97|D3DQ98|P34991|Q8TAY2	Missense_Mutation	SNP	ENST00000353411.6	37	c.139C>G	CCDS4171.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673165	0.47781	.	.	ENSG00000113558	ENST00000353411;ENST00000522552;ENST00000521216;ENST00000517625;ENST00000522855;ENST00000328392;ENST00000519321;ENST00000520417;ENST00000519718	T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.77	2.87	0.33458	BTB/POZ fold (2);SKP1 component, POZ (1);	0.000000	0.64402	U	0.000002	T	0.64283	0.2584	L	0.58428	1.81	0.58432	D	0.999999	B;B;D	0.55172	0.071;0.044;0.97	B;B;D	0.70227	0.082;0.009;0.968	T	0.59721	-0.7401	10	0.42905	T	0.14	-1.0287	10.0474	0.42195	0.2284:0.0:0.7716:0.0	.	47;47;47	E5RJR5;P63208-2;P63208	.;.;SKP1_HUMAN	V	47;47;47;47;47;47;47;47;81	ENSP00000231487:L47V;ENSP00000429472:L47V;ENSP00000431067:L47V;ENSP00000429961:L47V;ENSP00000429686:L47V;ENSP00000331708:L47V;ENSP00000429415:L47V;ENSP00000429996:L47V;ENSP00000430774:L81V	ENSP00000331708:L47V	L	-	1	2	SKP1	133530792	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.594000	0.61041	0.287000	0.22375	0.557000	0.71058	CTA		0.303	SKP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251162.2	NM_170679		29	48	0	0	0	0.010818	0	29	48				
PCDHA11	56138	broad.mit.edu	37	5	140249821	140249821	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:140249821C>T	ENST00000398640.2	+	1	1133	c.1133C>T	c.(1132-1134)tCa>tTa	p.S378L	PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	378	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S378L(1)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCGTGACTCAGGTGTCAAC	0.587																																							uc003lia.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1132-1134)TCA>TTA		protocadherin alpha 11 isoform 1 precursor							102.0	94.0	97.0					5																	140249821		2203	4300	6503	SO:0001583	missense	56138				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140249821C>T	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1133C>T	5.37:g.140249821C>T	ENSP00000381636:p.Ser378Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.S378L	p.S378L	NM_018902	NP_061725	WXS	Illumina HiSeq	Unspecified	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1991	+			378			Cadherin 4.|Extracellular (Potential).		B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	c.1133C>T	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023304	0.35701	.	.	ENSG00000249158	ENST00000398640	T	0.49432	0.78	5.85	5.85	0.93711	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.67373	0.2886	M	0.66506	2.035	0.26611	N	0.972839	D;P	0.53745	0.962;0.719	P;B	0.59948	0.866;0.367	T	0.62120	-0.6921	9	0.87932	D	0	.	19.7493	0.96261	0.0:1.0:0.0:0.0	.	378;378	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	L	378	ENSP00000381636:S378L	ENSP00000381636:S378L	S	+	2	0	PCDHA11	140230005	0.880000	0.30214	0.347000	0.25668	0.066000	0.16364	2.523000	0.45580	2.767000	0.95098	0.563000	0.77884	TCA		0.587	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		18	91	0	0	0	0.006122	0	18	91				
PCDHGA2	56113	broad.mit.edu	37	5	140719744	140719744	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:140719744C>A	ENST00000394576.2	+	1	1206	c.1206C>A	c.(1204-1206)taC>taA	p.Y402*	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	402	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y402*(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAATTACTACCGACTGGTTA	0.463																																							uc003ljk.1		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1204-1206)TAC>TAA		protocadherin gamma subfamily A, 2 isoform 1							71.0	73.0	73.0					5																	140719744		2203	4300	6503	SO:0001587	stop_gained	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140719744C>A	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1206C>A	5.37:g.140719744C>A	ENSP00000378077:p.Tyr402*		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Nonsense_Mutation_p.Y402*	p.Y402*	NM_018915	NP_061738	WXS	Illumina HiSeq	Unspecified	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1391	+			402			Cadherin 4.|Extracellular (Potential).		Q52LL6|Q9Y5D5	Nonsense_Mutation	SNP	ENST00000394576.2	37	c.1206C>A	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	11.35	1.612665	0.28712	.	.	ENSG00000081853	ENST00000394576	.	.	.	4.92	4.03	0.46877	.	0.644526	0.12668	U	0.448987	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8183	0.63306	0.0:0.9202:0.0:0.0798	.	.	.	.	X	402	.	ENSP00000378077:Y402X	Y	+	3	2	PCDHGA2	140699928	0.002000	0.14202	0.996000	0.52242	0.019000	0.09904	0.067000	0.14510	2.432000	0.82394	0.561000	0.74099	TAC		0.463	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		34	57	1	0	2.42023e-17	0.015359	2.8809e-17	34	57				
PPARGC1B	133522	broad.mit.edu	37	5	149214257	149214257	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:149214257C>A	ENST00000309241.5	+	6	1758	c.1726C>A	c.(1726-1728)Ctg>Atg	p.L576M	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.L576M|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.L537M|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.L512M	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	576					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.L576M(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GTGCCTCATGCTGGCCTTGTC	0.433											OREG0016922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003lrc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1726-1728)CTG>ATG		peroxisome proliferator-activated receptor							233.0	224.0	227.0					5																	149214257		2203	4300	6503	SO:0001583	missense	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149214257C>A	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.1726C>A	5.37:g.149214257C>A	ENSP00000312649:p.Leu576Met		Somatic	OREG0016922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1723	PPARGC1B_uc003lrb.1_Missense_Mutation_p.L576M|PPARGC1B_uc003lrd.2_Missense_Mutation_p.L537M|PPARGC1B_uc003lrf.2_Missense_Mutation_p.L555M|PPARGC1B_uc003lre.1_Missense_Mutation_p.L555M	p.L576M	NM_133263	NP_573570	WXS	Illumina HiSeq	Unspecified	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		6	1768	+			576					A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	c.1726C>A	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.16|17.16	3.319309|3.319309	0.60524|0.60524	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|T;T;T;T	.|0.21031	.|2.04;2.03;2.07;2.03	5.93|5.93	4.15|4.15	0.48705|0.48705	.|.	.|0.000000	.|0.56097	.|D	.|0.000026	T|T	0.45597|0.45597	0.1350|0.1350	M|M	0.80332|0.80332	2.49|2.49	0.29126|0.29126	N|N	0.879939|0.879939	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.91635	.|0.999;0.999;0.999;0.998;0.999	T|T	0.45086|0.45086	-0.9285|-0.9285	5|10	.|0.72032	.|D	.|0.01	-14.7706|-14.7706	9.9885|9.9885	0.41856|0.41856	0.0:0.7916:0.0:0.2084|0.0:0.7916:0.0:0.2084	.|.	.|555;555;537;576;576	.|Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.|.;.;.;PRGC2_HUMAN;.	D|M	262|537;576;576;512	.|ENSP00000353638:L537M;ENSP00000377855:L576M;ENSP00000312649:L576M;ENSP00000384403:L512M	.|ENSP00000312649:L576M	A|L	+|+	2|1	0|2	PPARGC1B|PPARGC1B	149194450|149194450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	0.759000|0.759000	0.26461|0.26461	1.532000|1.532000	0.49169|0.49169	0.655000|0.655000	0.94253|0.94253	GCT|CTG		0.433	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		6	77	1	0	2.7689e-08	0.001984	3.07737e-08	6	77				
GRIA1	2890	broad.mit.edu	37	5	152870470	152870470	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:152870470T>C	ENST00000285900.5	+	1	365	c.22T>C	c.(22-24)Ttc>Ctc	p.F8L	GRIA1_ENST00000518783.1_5'Flank|GRIA1_ENST00000448073.4_5'Flank|GRIA1_ENST00000518862.1_Intron|GRIA1_ENST00000518142.1_Missense_Mutation_p.F8L|GRIA1_ENST00000340592.5_Missense_Mutation_p.F8L|GRIA1_ENST00000521843.2_5'Flank	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	8					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.F8L(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TTTTGCCTTCTTCTGCACCGG	0.502																																							uc003lva.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(22-24)TTC>CTC		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						240.0	241.0	240.0					5																	152870470		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:152870470T>C		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.22T>C	5.37:g.152870470T>C	ENSP00000285900:p.Phe8Leu		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.F8L|GRIA1_uc003luz.3_5'UTR|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.F8L|GRIA1_uc011dcx.1_5'Flank|GRIA1_uc011dcy.1_5'Flank|GRIA1_uc011dcz.1_5'Flank|GRIA1_uc010jia.1_Intron	p.F8L	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		1	387	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	8					B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.22T>C	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718156	0.48622	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592	T;T;T	0.08896	3.05;3.04;3.05	5.3	5.3	0.74995	.	0.184267	0.49305	N	0.000153	T	0.03263	0.0095	N	0.02247	-0.625	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.001	T	0.28299	-1.0048	10	0.02654	T	1	.	14.4169	0.67155	0.0:0.0:0.0:1.0	.	8;8;8	B7Z3F6;P42261-2;P42261	.;.;GRIA1_HUMAN	L	8	ENSP00000285900:F8L;ENSP00000427920:F8L;ENSP00000339343:F8L	ENSP00000285900:F8L	F	+	1	0	GRIA1	152850663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.541000	0.60670	1.995000	0.58328	0.460000	0.39030	TTC		0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			13	338	0	0	0	0.016723	0	13	338				
ATP10B	23120	broad.mit.edu	37	5	160047786	160047786	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:160047786C>T	ENST00000327245.5	-	15	2830	c.1984G>A	c.(1984-1986)Gag>Aag	p.E662K	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	662					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E662K(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCATCTCTCTCATCCGAGTCT	0.582																																							uc003lym.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(1984-1986)GAG>AAG		ATPase, class V, type 10B							72.0	75.0	74.0					5																	160047786		2160	4262	6422	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160047786C>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1984G>A	5.37:g.160047786C>T	ENSP00000313600:p.Glu662Lys		Somatic				ATP10B_uc010jit.1_5'UTR|ATP10B_uc003lyn.2_Missense_Mutation_p.E220K	p.E662K	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		15	2831	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	662			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.1984G>A	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	6.753	0.507854	0.12883	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.86366	-2.11;-2.11	5.36	4.5	0.54988	HAD-like domain (1);	0.256303	0.38381	N	0.001714	D	0.82706	0.5095	L	0.43152	1.355	0.22591	N	0.998958	B;B	0.32653	0.002;0.379	B;B	0.38378	0.013;0.272	T	0.72010	-0.4419	9	.	.	.	.	9.5383	0.39235	0.0:0.8414:0.0:0.1586	.	270;662	Q2YDW8;O94823	.;AT10B_HUMAN	K	662;270	ENSP00000313600:E662K;ENSP00000431081:E270K	.	E	-	1	0	ATP10B	159980364	0.814000	0.29104	0.639000	0.29394	0.054000	0.15201	1.995000	0.40767	1.281000	0.44480	0.655000	0.94253	GAG		0.582	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		25	52	0	0	0	0.016522	0	25	52				
GABRG2	2566	broad.mit.edu	37	5	161580236	161580236	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:161580236A>C	ENST00000361925.4	+	9	1486	c.1266A>C	c.(1264-1266)gaA>gaC	p.E422D	GABRG2_ENST00000414552.2_Missense_Mutation_p.E470D|GABRG2_ENST00000356592.3_Missense_Mutation_p.E430D|GABRG2_ENST00000393933.4_Missense_Mutation_p.E327D			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	422					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.E430D(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTGTTTTGAAGATTGTCGAA	0.468																																							uc003lyz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1264-1266)GAA>GAC		gamma-aminobutyric acid A receptor, gamma 2							219.0	210.0	213.0					5																	161580236		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161580236A>C		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1266A>C	5.37:g.161580236A>C	ENSP00000354651:p.Glu422Asp		Somatic				GABRG2_uc010jjc.2_Missense_Mutation_p.E470D|GABRG2_uc003lyy.3_Missense_Mutation_p.E430D|GABRG2_uc011dej.1_Missense_Mutation_p.E327D	p.E422D	NM_000816	NP_000807	WXS	Illumina HiSeq	Unspecified	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	9	1624	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	422			Cytoplasmic (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.1266A>C	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.826544	0.32329	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	N	0.16656	0.425	0.58432	D	0.999995	B;B;B	0.22909	0.077;0.004;0.016	B;B;B	0.33799	0.17;0.019;0.059	T	0.65689	-0.6107	10	0.27785	T	0.31	.	6.3605	0.21425	0.8122:0.0:0.1878:0.0	.	470;422;430	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	D	430;470;422;327	ENSP00000349000:E430D;ENSP00000410732:E470D;ENSP00000354651:E422D;ENSP00000377510:E327D	ENSP00000349000:E430D	E	+	3	2	GABRG2	161512814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.826000	0.39092	2.279000	0.76181	0.533000	0.62120	GAA		0.468	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			25	155	0	0	0	0.01892	0	25	155				
TENM2	57451	broad.mit.edu	37	5	167420063	167420063	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:167420063G>A	ENST00000518659.1	+	5	1101	c.1062G>A	c.(1060-1062)agG>agA	p.R354R	TENM2_ENST00000403607.2_Silent_p.R187R|TENM2_ENST00000519204.1_Silent_p.R233R|TENM2_ENST00000520394.1_Silent_p.R163R|TENM2_ENST00000545108.1_Silent_p.R354R	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	354	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R233R(1)|p.R354R(1)|p.R187R(1)									TGCTGCCCAGGAATACTTTCT	0.602																																							uc010jjd.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(1060-1062)AGG>AGA		odz, odd Oz/ten-m homolog 2							55.0	58.0	57.0					5																	167420063		1875	4104	5979	SO:0001819	synonymous_variant	57451							g.chr5:167420063G>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1062G>A	5.37:g.167420063G>A			Somatic				ODZ2_uc003lzq.2_Silent_p.R233R|ODZ2_uc003lzr.3_Silent_p.R163R	p.R354R	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	5	1062	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Silent	SNP	ENST00000518659.1	37	c.1062G>A																																																																																					0.602	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		17	66	0	0	0	0.028581	0	17	66				
DOCK2	1794	broad.mit.edu	37	5	169111353	169111353	+	Splice_Site	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:169111353A>C	ENST00000256935.8	+	8	840	c.760A>C	c.(760-762)Agt>Cgt	p.S254R		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	254					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.S254R(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACGGTCATAAGGTAGGTGTG	0.488																																							uc003maf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(760-762)AGT>CGT		dedicator of cytokinesis 2							147.0	134.0	138.0					5																	169111353		2203	4300	6503	SO:0001630	splice_region_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169111353A>C	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.761+1A>C	5.37:g.169111353A>C			Somatic				DOCK2_uc011der.1_RNA	p.S254R	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		8	840	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	254					Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.760A>C	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.827559	0.90955	.	.	ENSG00000134516	ENST00000256935	T	0.17370	2.28	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.21962	0.0529	M	0.66560	2.04	0.80722	D	1	P	0.34864	0.473	B	0.31442	0.13	T	0.02829	-1.1105	10	0.87932	D	0	.	15.4945	0.75637	1.0:0.0:0.0:0.0	.	254	Q92608	DOCK2_HUMAN	R	254	ENSP00000256935:S254R	ENSP00000256935:S254R	S	+	1	0	DOCK2	169043931	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	8.910000	0.92685	2.058000	0.61347	0.533000	0.62120	AGT		0.488	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	Missense_Mutation	9	132	0	0	0	0.004482	0	9	132				
DOCK2	1794	broad.mit.edu	37	5	169508967	169508967	+	Silent	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr5:169508967C>A	ENST00000256935.8	+	51	5489	c.5409C>A	c.(5407-5409)gtC>gtA	p.V1803V	DOCK2_ENST00000540750.1_Silent_p.V864V|DOCK2_ENST00000520908.1_Silent_p.V1295V|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1803					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.V1803V(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGAAGAAGGTCAATCAGTTCT	0.512																																							uc003maf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(5407-5409)GTC>GTA		dedicator of cytokinesis 2							109.0	101.0	104.0					5																	169508967		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169508967C>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5409C>A	5.37:g.169508967C>A			Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.V1295V|DOCK2_uc003mah.2_Silent_p.V359V	p.V1803V	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		51	5489	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1803					Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.5409C>A	CCDS4371.1																																																																																				0.512	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		18	66	1	0	1.96292e-10	0.010504	2.24105e-10	18	66				
Unknown	0	broad.mit.edu	37	6	29855800	29855800	+	IGR	SNP	T	T	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:29855800T>A								HLA-G (56898 upstream) : HLA-A (53236 downstream)																							CCGCTTCATCTCCGTCGGCTA	0.692																																							uc010jro.2		NA																	0					0						c.(37-39)TCC>ACC		SubName: Full=cDNA FLJ52667, highly similar to HLA class I histocompatibility antigen, alpha chain H;																																				SO:0001628	intergenic_variant	3136							g.chr6:29855800T>A																													6.37:g.29855800T>A			Somatic				HLA-G_uc011dmb.1_Intron|HLA-H_uc003nod.2_RNA	p.S13T			WXS	Illumina HiSeq	Unspecified					2	89	+									Missense_Mutation	SNP		37	c.37T>A																																																																																				0	0.692									3	12	0	0	0	0.014758	0	3	12				
MDC1	9656	broad.mit.edu	37	6	30672360	30672360	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:30672360C>A	ENST00000376406.3	-	10	5247	c.4600G>T	c.(4600-4602)Gcc>Tcc	p.A1534S	MDC1_ENST00000376405.2_Missense_Mutation_p.A1270S|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1534	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.A1534S(1)		breast(2)|kidney(1)|ovary(1)	4						AGCTCAGGGGCTGCGGGCACA	0.587								Other conserved DNA damage response genes																															uc003nrg.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|kidney(1)	4						c.(4600-4602)GCC>TCC	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							120.0	138.0	132.0					6																	30672360		2203	4300	6503	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30672360C>A	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4600G>T	6.37:g.30672360C>A	ENSP00000365588:p.Ala1534Ser		Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.A1141S	p.A1534S	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			10	5040	-			1534			Interaction with the PRKDC complex.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.4600G>T	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	C	9.136	1.012739	0.19277	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.11604	2.76;2.76	4.06	1.31	0.21738	.	.	.	.	.	T	0.08088	0.0202	L	0.59436	1.845	0.09310	N	1	D;P	0.63046	0.992;0.86	P;B	0.60286	0.872;0.404	T	0.20806	-1.0264	9	0.19147	T	0.46	.	5.8974	0.18947	0.0:0.6663:0.0:0.3337	.	1270;1534	Q14676-2;Q14676	.;MDC1_HUMAN	S	1534;1270;1247;1100	ENSP00000365588:A1534S;ENSP00000365587:A1270S	ENSP00000365587:A1270S	A	-	1	0	MDC1	30780339	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.289000	0.08365	0.289000	0.22422	0.449000	0.29647	GCC		0.587	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		64	299	1	0	1.42676e-28	0.01441	1.78452e-28	64	299				
ZBTB12	221527	broad.mit.edu	37	6	31868936	31868936	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:31868936G>A	ENST00000375527.2	-	2	322	c.147C>T	c.(145-147)gtC>gtT	p.V49V	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_Intron	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	49	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V49V(1)		endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						CGGCCAAGATGACCTTGTGGC	0.632																																							uc003nyd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(145-147)GTC>GTT		zinc finger and BTB domain containing 12							41.0	34.0	36.0					6																	31868936		2203	4300	6503	SO:0001819	synonymous_variant	221527				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:31868936G>A	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.147C>T	6.37:g.31868936G>A			Somatic				C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron	p.V49V	NM_181842	NP_862825	WXS	Illumina HiSeq	Unspecified	Q9Y330	ZBT12_HUMAN			2	323	-			49			BTB.		B0UY00|Q5JQ98	Silent	SNP	ENST00000375527.2	37	c.147C>T	CCDS4727.1																																																																																				0.632	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842		5	34	0	0	0	0.021553	0	5	34				
PACSIN1	29993	broad.mit.edu	37	6	34496627	34496627	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:34496627G>C	ENST00000538621.1	+	4	674	c.429G>C	c.(427-429)caG>caC	p.Q143H	PACSIN1_ENST00000244458.2_Missense_Mutation_p.Q143H|PACSIN1_ENST00000486120.1_3'UTR|PACSIN1_ENST00000374043.2_Missense_Mutation_p.Q101H	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1	143	F-BAR domain.				actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)	p.Q143H(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						GCAAGGCCCAGAAGCCTTGGG	0.607																																							uc003ojo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(427-429)CAG>CAC		protein kinase C and casein kinase substrate in							96.0	90.0	92.0					6																	34496627		2203	4300	6503	SO:0001583	missense	29993				endocytosis		protein kinase activity	g.chr6:34496627G>C	AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.429G>C	6.37:g.34496627G>C	ENSP00000439639:p.Gln143His		Somatic				PACSIN1_uc003ojp.2_Missense_Mutation_p.Q143H	p.Q143H	NM_020804	NP_065855	WXS	Illumina HiSeq	Unspecified	Q9BY11	PACN1_HUMAN			4	635	+			143					Q9P2G8	Missense_Mutation	SNP	ENST00000538621.1	37	c.429G>C	CCDS4793.1	.	.	.	.	.	.	.	.	.	.	g	23.8	4.459935	0.84317	.	.	ENSG00000124507	ENST00000244458;ENST00000374043;ENST00000436831;ENST00000538621	T;T;T	0.47869	0.83;2.31;0.83	3.78	3.78	0.43462	.	0.139511	0.49916	D	0.000121	T	0.61602	0.2360	M	0.91612	3.225	0.80722	D	1	D	0.67145	0.996	P	0.58013	0.831	T	0.67130	-0.5748	10	0.27082	T	0.32	-24.3277	15.8118	0.78571	0.0:0.0:1.0:0.0	.	143	Q9BY11	PACN1_HUMAN	H	143;101;143;143	ENSP00000244458:Q143H;ENSP00000363155:Q101H;ENSP00000439639:Q143H	ENSP00000244458:Q143H	Q	+	3	2	PACSIN1	34604605	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.503000	0.73699	2.110000	0.64415	0.450000	0.29827	CAG		0.607	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040236.1			46	33	0	0	0	0.01441	0	46	33				
LHFPL5	222662	broad.mit.edu	37	6	35773660	35773660	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:35773660C>T	ENST00000373853.1	+	1	591	c.213C>T	c.(211-213)aaC>aaT	p.N71N	LHFPL5_ENST00000360215.1_Silent_p.N71N			Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	71					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transport (GO:0006811)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)		p.N71N(1)		endometrium(4)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|urinary_tract(1)	20						GCGTGGGTAACGTGCTGTCCT	0.587																																							uc003olg.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(211-213)AAC>AAT		lipoma HMGIC fusion partner-like 5							235.0	215.0	222.0					6																	35773660		2203	4300	6503	SO:0001819	synonymous_variant	222662					integral to membrane		g.chr6:35773660C>T	BC028630	CCDS4812.1	6p21.31	2014-01-28				ENSG00000197753			21253	protein-coding gene	gene with protein product		609427	"""deafness, autosomal recessive 67"""	DFNB67		16459341	Standard	NM_182548		Approved	MGC33835, dJ510O8.8, Tmhs	uc003olg.1	Q8TAF8		ENST00000373853.1:c.213C>T	6.37:g.35773660C>T			Somatic					p.N71N	NM_182548	NP_872354	WXS	Illumina HiSeq	Unspecified	Q8TAF8	TMHS_HUMAN			1	590	+			71			Helical; (Potential).		B3KX66	Silent	SNP	ENST00000373853.1	37	c.213C>T	CCDS4812.1																																																																																				0.587	LHFPL5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040323.1	NM_182548		37	179	0	0	0	0.019004	0	37	179				
DNAH8	1769	broad.mit.edu	37	6	38747797	38747797	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:38747797C>T	ENST00000359357.3	+	13	1698	c.1444C>T	c.(1444-1446)Cgt>Tgt	p.R482C	DNAH8_ENST00000449981.2_Missense_Mutation_p.R699C|DNAH8_ENST00000441566.1_Missense_Mutation_p.R482C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	482					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R482C(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CACAATAGAGCGTATTCTTCA	0.323																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(1444-1446)CGT>TGT		dynein, axonemal, heavy polypeptide 8							123.0	120.0	121.0					6																	38747797		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38747797C>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1444C>T	6.37:g.38747797C>T	ENSP00000352312:p.Arg482Cys		Somatic					p.R482C	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					13	2044	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.1444C>T		.	.	.	.	.	.	.	.	.	.	C	10.57	1.386587	0.25031	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57595	0.39;0.39;0.39	5.48	4.61	0.57282	Dynein heavy chain, domain-1 (1);	0.493889	0.19769	N	0.106485	T	0.18425	0.0442	N	0.17082	0.46	0.20196	N	0.999924	B	0.09022	0.002	B	0.10450	0.005	T	0.13764	-1.0497	10	0.56958	D	0.05	.	9.8775	0.41213	0.0:0.8295:0.0:0.1705	.	482	Q96JB1	DYH8_HUMAN	C	687;687;482;482	ENSP00000333363:R687C;ENSP00000352312:R482C;ENSP00000402294:R482C	ENSP00000333363:R687C	R	+	1	0	DNAH8	38855775	0.613000	0.27009	0.551000	0.28230	0.514000	0.34195	2.579000	0.46059	1.461000	0.47929	0.591000	0.81541	CGT		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		4	55	0	0	0	0.021553	0	4	55				
OARD1	221443	broad.mit.edu	37	6	41036604	41036604	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:41036604C>T	ENST00000479950.1	-	5	645	c.332G>A	c.(331-333)gGa>gAa	p.G111E	OARD1_ENST00000373154.2_Intron|OARD1_ENST00000486443.1_Missense_Mutation_p.G72E|OARD1_ENST00000244558.9_Intron|OARD1_ENST00000424266.2_Missense_Mutation_p.G111E|OARD1_ENST00000468811.1_Missense_Mutation_p.G111E|OARD1_ENST00000463088.1_Missense_Mutation_p.G111E|OARD1_ENST00000480585.1_Intron|OARD1_ENST00000467234.1_5'Flank|OARD1_ENST00000482515.1_Intron|OARD1_ENST00000464633.1_Intron			Q9Y530	OARD1_HUMAN	O-acyl-ADP-ribose deacylase 1	111	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				purine nucleoside metabolic process (GO:0042278)		deacetylase activity (GO:0019213)|purine nucleoside binding (GO:0001883)	p.G111V(2)|p.G111E(1)									GTCAGTGACTCCATTCTTCAG	0.408																																							uc003opm.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(331-333)GGA>GAA		hypothetical protein LOC221443							112.0	108.0	109.0					6																	41036604		2203	4300	6503	SO:0001583	missense	221443							g.chr6:41036604C>T	AJ420538	CCDS34445.1	6p21.1	2013-03-14	2012-11-06	2012-11-06	ENSG00000124596	ENSG00000124596			21257	protein-coding gene	gene with protein product	"""terminal ADP-ribose protein glycohydrolase 1"""	614393	"""chromosome 6 open reading frame 130"""	C6orf130		21849506	Standard	NM_145063		Approved	MGC19570, dJ34B21.3, TARG1	uc003opm.3	Q9Y530	OTTHUMG00000014667	ENST00000479950.1:c.332G>A	6.37:g.41036604C>T	ENSP00000420484:p.Gly111Glu		Somatic				UNC5CL_uc010jxe.1_Intron|C6orf130_uc010jxg.2_Missense_Mutation_p.G111E|C6orf130_uc003opn.2_Intron	p.G111E	NM_145063	NP_659500	WXS	Illumina HiSeq	Unspecified	Q9Y530	CF130_HUMAN			5	504	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		111			Macro.		A6NEK4|A8K4H4|Q96F23	Missense_Mutation	SNP	ENST00000479950.1	37	c.332G>A	CCDS34445.1	.	.	.	.	.	.	.	.	.	.	C	35	5.438423	0.96168	.	.	ENSG00000124596	ENST00000479950;ENST00000463088;ENST00000424266;ENST00000468811;ENST00000486443;ENST00000488238	T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89	6.08	6.08	0.98989	Appr-1-p processing (2);	0.000000	0.85682	D	0.000000	T	0.37625	0.1010	L	0.57130	1.785	0.80722	D	1	D	0.58970	0.984	P	0.61722	0.893	T	0.01512	-1.1336	10	0.48119	T	0.1	-21.8544	17.8194	0.88645	0.0:1.0:0.0:0.0	.	111	Q9Y530	CF130_HUMAN	E	111;111;111;111;72;111	ENSP00000420484:G111E;ENSP00000420193:G111E;ENSP00000416829:G111E;ENSP00000420601:G111E;ENSP00000419175:G72E;ENSP00000420414:G111E	ENSP00000416829:G111E	G	-	2	0	C6orf130	41144582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.287000	0.65645	2.894000	0.99253	0.655000	0.94253	GGA		0.408	OARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040494.2	NM_145063		9	63	0	0	0	0.006214	0	9	63				
UBR2	23304	broad.mit.edu	37	6	42657311	42657311	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:42657311C>G	ENST00000372899.1	+	46	5287	c.5029C>G	c.(5029-5031)Cgg>Ggg	p.R1677G	UBR2_ENST00000372883.3_3'UTR|UBR2_ENST00000372901.1_Missense_Mutation_p.R1677G	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1677					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R1677G(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CTACAGAGTACGGGAATGTCA	0.393																																							uc011dur.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(5029-5031)CGG>GGG		ubiquitin protein ligase E3 component n-recognin							409.0	413.0	411.0					6																	42657311		2203	4300	6503	SO:0001583	missense	23304				cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding	g.chr6:42657311C>G	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.5029C>G	6.37:g.42657311C>G	ENSP00000361990:p.Arg1677Gly		Somatic				UBR2_uc011dus.1_Missense_Mutation_p.R1322G|UBR2_uc003osh.2_RNA|UBR2_uc011dut.1_Missense_Mutation_p.R265G|UBR2_uc011duu.1_Missense_Mutation_p.R69G	p.R1677G	NM_015255	NP_056070	WXS	Illumina HiSeq	Unspecified	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		46	5029	+	Colorectal(47;0.196)		1677					O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	c.5029C>G	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052024	0.75960	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.66099	-0.19;-0.19	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	M	0.92970	3.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;0.999;1.0	D	0.84946	0.0868	10	0.72032	D	0.01	-22.0097	14.2047	0.65728	0.1494:0.8506:0.0:0.0	.	265;1677;1677	B3KXG6;Q8IWV8-4;Q8IWV8	.;.;UBR2_HUMAN	G	1677	ENSP00000361990:R1677G;ENSP00000361992:R1677G	ENSP00000361990:R1677G	R	+	1	2	UBR2	42765289	1.000000	0.71417	0.872000	0.34217	0.994000	0.84299	4.960000	0.63673	2.563000	0.86464	0.557000	0.71058	CGG		0.393	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255		5	717	0	0	0	0.014758	0	5	717				
TRAM2	9697	broad.mit.edu	37	6	52370505	52370505	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:52370505C>A	ENST00000182527.3	-	9	766	c.767G>T	c.(766-768)cGc>cTc	p.R256L	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	256	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)		p.R256L(1)		endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					GATGAAGAGGCGGGTAACCCC	0.537																																							uc003paq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(766-768)CGC>CTC		translocation-associated membrane protein 2							90.0	88.0	89.0					6																	52370505		2203	4300	6503	SO:0001583	missense	9697				collagen biosynthetic process|protein transport|transmembrane transport	integral to membrane	protein binding	g.chr6:52370505C>A	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.767G>T	6.37:g.52370505C>A	ENSP00000182527:p.Arg256Leu		Somatic				EFHC1_uc011dwv.1_Intron|TRAM2_uc003par.1_RNA	p.R256L	NM_012288	NP_036420	WXS	Illumina HiSeq	Unspecified	Q15035	TRAM2_HUMAN			9	916	-	Lung NSC(77;0.109)		256			TLC.|Helical; (Potential).		A8K6T6	Missense_Mutation	SNP	ENST00000182527.3	37	c.767G>T	CCDS34477.1	.	.	.	.	.	.	.	.	.	.	C	31	5.067935	0.93950	.	.	ENSG00000065308	ENST00000182527	D	0.99760	-6.66	5.44	4.56	0.56223	TRAM/LAG1/CLN8 homology domain (3);	0.102562	0.64402	N	0.000002	D	0.99579	0.9848	M	0.86651	2.83	0.80722	D	1	P	0.52842	0.956	P	0.56163	0.793	D	0.98076	1.0401	10	0.87932	D	0	.	10.6324	0.45545	0.1327:0.7969:0.0:0.0703	.	256	Q15035	TRAM2_HUMAN	L	256	ENSP00000182527:R256L	ENSP00000182527:R256L	R	-	2	0	TRAM2	52478464	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	4.869000	0.63028	1.278000	0.44430	0.561000	0.74099	CGC		0.537	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040910.1	NM_012288		36	46	1	0	6.70999e-13	0.019004	7.76653e-13	36	46				
GFRAL	389400	broad.mit.edu	37	6	55264023	55264023	+	Missense_Mutation	SNP	G	G	C	rs137898068		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:55264023G>C	ENST00000340465.2	+	7	1084	c.998G>C	c.(997-999)aGa>aCa	p.R333T		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	333					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R333T(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTGTATACAAGAAAACATGCA	0.274																																							uc003pcm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(997-999)AGA>ACA		GDNF family receptor alpha like precursor							41.0	41.0	41.0					6																	55264023		2203	4292	6495	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55264023G>C	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.998G>C	6.37:g.55264023G>C	ENSP00000343636:p.Arg333Thr		Somatic					p.R333T	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		7	1084	+	Lung NSC(77;0.0875)|Renal(3;0.122)		333			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.998G>C	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	G	7.516	0.655772	0.14580	.	.	ENSG00000187871	ENST00000340465	T	0.35421	1.31	5.79	1.48	0.22813	.	1.462330	0.04304	N	0.347761	T	0.09113	0.0225	N	0.24115	0.695	0.09310	N	1	B	0.30763	0.294	B	0.22152	0.038	T	0.26744	-1.0094	10	0.66056	D	0.02	-1.2099	4.1543	0.10252	0.2909:0.1722:0.5369:0.0	.	333	Q6UXV0	GFRAL_HUMAN	T	333	ENSP00000343636:R333T	ENSP00000343636:R333T	R	+	2	0	GFRAL	55371982	0.000000	0.05858	0.022000	0.16811	0.103000	0.19146	0.320000	0.19540	0.763000	0.33175	0.655000	0.94253	AGA		0.274	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		7	30	0	0	0	0.00308	0	7	30				
FAM135A	57579	broad.mit.edu	37	6	71248050	71248050	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:71248050C>G	ENST00000418814.2	+	20	4788	c.4174C>G	c.(4174-4176)Cga>Gga	p.R1392G	FAM135A_ENST00000361499.3_Missense_Mutation_p.R1196G|FAM135A_ENST00000505769.1_Missense_Mutation_p.R972G|FAM135A_ENST00000457062.2_Missense_Mutation_p.R1179G|FAM135A_ENST00000505868.1_Missense_Mutation_p.R1392G|FAM135A_ENST00000370479.3_Missense_Mutation_p.R1179G	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1392								p.R1179G(1)|p.R1392G(1)		breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						GCTGACATGTCGAGATCACTC	0.323																																							uc003pfj.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(4174-4176)CGA>GGA		hypothetical protein LOC57579 isoform c							58.0	60.0	59.0					6																	71248050		2203	4300	6503	SO:0001583	missense	57579							g.chr6:71248050C>G	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.4174C>G	6.37:g.71248050C>G	ENSP00000410768:p.Arg1392Gly		Somatic				FAM135A_uc003pfi.2_Missense_Mutation_p.R1196G|FAM135A_uc003pfh.2_Missense_Mutation_p.R1179G|FAM135A_uc003pfl.2_Missense_Mutation_p.R1059G|FAM135A_uc003pfn.2_Missense_Mutation_p.R598G|FAM135A_uc003pfo.1_Missense_Mutation_p.R763G|FAM135A_uc010kan.1_Intron	p.R1392G	NM_001162529	NP_001156001	WXS	Illumina HiSeq	Unspecified	Q9P2D6	F135A_HUMAN			18	4307	+			1392					A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	37	c.4174C>G	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903897	0.72754	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88	5.3	4.42	0.53409	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.85682	D	0.000000	T	0.55689	0.1936	M	0.78637	2.42	0.80722	D	1	D;D;B;D	0.89917	0.999;1.0;0.392;1.0	D;D;P;D	0.91635	0.997;0.999;0.498;0.999	T	0.62723	-0.6794	10	0.59425	D	0.04	.	13.3896	0.60816	0.2863:0.7137:0.0:0.0	.	1392;1392;1196;1179	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	G	1392;1179;972;1179;1196;1392	ENSP00000410768:R1392G;ENSP00000359510:R1179G;ENSP00000423785:R972G;ENSP00000409201:R1179G;ENSP00000354913:R1196G;ENSP00000423307:R1392G	ENSP00000354913:R1196G	R	+	1	2	FAM135A	71304771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.709000	0.61867	1.341000	0.45600	0.650000	0.86243	CGA		0.323	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819		10	60	0	0	0	0.008291	0	10	60				
CASP8AP2	9994	broad.mit.edu	37	6	90566859	90566859	+	RNA	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:90566859C>G	ENST00000551025.1	+	0	1794									caspase 8 associated protein 2									p.I119M(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CAGCACTTATCAAAACTGCCA	0.338																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(355-357)ATC>ATG		caspase 8 associated protein 2							52.0	47.0	49.0					6																	90566859		1816	4078	5894			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90566859C>G	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90566859C>G			Somatic				CASP8AP2_uc003pns.2_Missense_Mutation_p.I119M|CASP8AP2_uc003pnt.2_Missense_Mutation_p.I119M|CASP8AP2_uc011dzz.1_Missense_Mutation_p.I119M	p.I119M	NM_001137667	NP_001131139	WXS	Illumina HiSeq	Unspecified	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	6	553	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	119						Missense_Mutation	SNP	ENST00000551025.1	37	c.357C>G																																																																																					0.338	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		4	10	0	0	0	0.014758	0	4	10				
TBC1D32	221322	broad.mit.edu	37	6	121402010	121402010	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:121402010C>T	ENST00000398212.2	-	32	3730	c.3681G>A	c.(3679-3681)gtG>gtA	p.V1227V	TBC1D32_ENST00000275159.6_Silent_p.V1268V|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	1227	Rab-GAP TBC.				cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.V1227V(1)									AATAATCACTCACTCGAAACC	0.358																																							uc003pyo.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3679-3681)GTG>GTA		hypothetical protein LOC221322							93.0	87.0	89.0					6																	121402010		1884	4121	6005	SO:0001819	synonymous_variant	221322				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity	g.chr6:121402010C>T	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.3681G>A	6.37:g.121402010C>T			Somatic					p.V1227V	NM_152730	NP_689943	WXS	Illumina HiSeq	Unspecified	Q96NH3	BROMI_HUMAN		GBM - Glioblastoma multiforme(226;0.00521)	32	3749	-			1227			Rab-GAP TBC.		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	c.3681G>A	CCDS43501.1																																																																																				0.358	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		33	46	0	0	0	0.012213	0	33	46				
ECHDC1	55862	broad.mit.edu	37	6	127636021	127636021	+	Missense_Mutation	SNP	G	G	A	rs146146402		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:127636021G>A	ENST00000531967.1	-	5	958	c.455C>T	c.(454-456)gCg>gTg	p.A152V	ECHDC1_ENST00000430841.2_Missense_Mutation_p.A146V|ECHDC1_ENST00000368289.2_Silent_p.C128C|ECHDC1_ENST00000454591.2_Missense_Mutation_p.A71V|ECHDC1_ENST00000368291.2_Silent_p.C128C|ECHDC1_ENST00000309620.9_Missense_Mutation_p.A129V|ECHDC1_ENST00000474289.2_Missense_Mutation_p.A146V|ECHDC1_ENST00000454859.3_Missense_Mutation_p.A146V|ECHDC1_ENST00000528402.1_Silent_p.C53C	NM_001139510.1	NP_001132982.1	Q9NTX5	ECHD1_HUMAN	enoyl CoA hydratase domain containing 1	152						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxy-lyase activity (GO:0016831)|methylmalonyl-CoA decarboxylase activity (GO:0004492)	p.C128C(1)|p.A152V(1)		large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TTGAACCAGCGCAACACTTAT	0.289																																							uc003qax.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(454-456)GCG>GTG		enoyl Coenzyme A hydratase domain containing 1		G	VAL/ALA,VAL/ALA,,VAL/ALA,	4,4402	8.1+/-20.4	0,4,2199	80.0	79.0	79.0		437,212,159,455,384	5.0	0.9	6	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,coding-synonymous,missense,coding-synonymous	ECHDC1	NM_001002030.1,NM_001105544.1,NM_001105545.1,NM_001139510.1,NM_018479.3	64,64,,64,	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	probably-damaging,probably-damaging,,probably-damaging,	146/302,71/227,53/71,152/308,128/146	127636021	5,13001	2203	4300	6503	SO:0001583	missense	55862						catalytic activity	g.chr6:127636021G>A	AK025796	CCDS34530.1, CCDS43504.1, CCDS47471.1, CCDS47472.1, CCDS55054.1	6q22.33	2011-12-12	2010-04-30		ENSG00000093144	ENSG00000093144			21489	protein-coding gene	gene with protein product		612136	"""enoyl Coenzyme A hydratase domain containing 1"""			22016388	Standard	NM_001002030		Approved	dJ351K20.2	uc003qax.3	Q9NTX5	OTTHUMG00000015523	ENST00000531967.1:c.455C>T	6.37:g.127636021G>A	ENSP00000436585:p.Ala152Val		Somatic				ECHDC1_uc003qaz.3_Missense_Mutation_p.A146V|ECHDC1_uc010key.2_Missense_Mutation_p.A71V|ECHDC1_uc003qay.3_Silent_p.C128C|ECHDC1_uc010kez.2_Silent_p.C53C|ECHDC1_uc010kex.2_RNA	p.A152V	NM_001139510	NP_001132982	WXS	Illumina HiSeq	Unspecified	Q9NTX5	ECHD1_HUMAN		GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)	5	491	-			152					A6NFJ5|B7Z8S0|E9PEN7|E9PR31|F8W851|Q5TEF6|Q5TEF7|Q5TEG0|Q5TEG4|Q9NZ30|V9HW18	Missense_Mutation	SNP	ENST00000531967.1	37	c.455C>T	CCDS47471.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.563676|4.563676	0.86335|0.86335	9.08E-4|9.08E-4	1.16E-4|1.16E-4	ENSG00000093144|ENSG00000093144	ENST00000454859;ENST00000531967;ENST00000368293;ENST00000474289;ENST00000454591;ENST00000309620;ENST00000430841;ENST00000534442|ENST00000436638;ENST00000460558;ENST00000461239	D;D;D;D;D;D;D|.	0.84146|.	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81|.	5.83|5.83	4.96|4.96	0.65561|0.65561	Enoyl-CoA hydratase/isomerase, conserved site (1);Crotonase, core (1);|.	0.044993|.	0.85682|.	N|.	0.000000|.	T|T	0.75554|0.75554	0.3865|0.3865	M|M	0.91768|0.91768	3.24|3.24	0.53688|0.53688	D|D	0.999973|0.999973	D|.	0.71674|.	0.998|.	D|.	0.67900|.	0.954|.	T|T	0.81634|0.81634	-0.0844|-0.0844	10|5	0.87932|.	D|.	0|.	.|.	12.1602|12.1602	0.54099|0.54099	0.08:0.0:0.92:0.0|0.08:0.0:0.92:0.0	.|.	152|.	Q9NTX5|.	ECHD1_HUMAN|.	V|C	146;152;118;146;71;129;146;146|160;25;11	ENSP00000401751:A146V;ENSP00000436585:A152V;ENSP00000434908:A146V;ENSP00000404866:A71V;ENSP00000311115:A129V;ENSP00000402492:A146V;ENSP00000435502:A146V|.	ENSP00000311115:A129V|.	A|R	-|-	2|1	0|0	ECHDC1|ECHDC1	127677714|127677714	1.000000|1.000000	0.71417|0.71417	0.894000|0.894000	0.35097|0.35097	0.985000|0.985000	0.73830|0.73830	7.100000|7.100000	0.76989|0.76989	1.471000|1.471000	0.48121|0.48121	0.650000|0.650000	0.86243|0.86243	GCG|CGC		0.289	ECHDC1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042131.2			9	67	0	0	0	0.010729	0	9	67				
OLIG3	167826	broad.mit.edu	37	6	137815158	137815158	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:137815158C>T	ENST00000367734.2	-	1	373	c.150G>A	c.(148-150)aaG>aaA	p.K50K		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	50					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.K50K(1)		endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CCCCGGGCATCTTCTGCATCA	0.612																																							uc003qhp.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(148-150)AAG>AAA		oligodendrocyte transcription factor 3							77.0	80.0	79.0					6																	137815158		2203	4300	6503	SO:0001819	synonymous_variant	167826				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr6:137815158C>T	AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.150G>A	6.37:g.137815158C>T			Somatic					p.K50K	NM_175747	NP_786923	WXS	Illumina HiSeq	Unspecified	Q7RTU3	OLIG3_HUMAN		GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)	1	374	-	Breast(32;0.165)|Colorectal(23;0.24)		50					Q8N8Q0	Silent	SNP	ENST00000367734.2	37	c.150G>A	CCDS5186.1																																																																																				0.612	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747		4	148	0	0	0	0.014758	0	4	148				
SHPRH	257218	broad.mit.edu	37	6	146264343	146264343	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:146264343G>T	ENST00000367505.2	-	9	2438	c.2174C>A	c.(2173-2175)tCc>tAc	p.S725Y	SHPRH_ENST00000438092.2_Missense_Mutation_p.S725Y|SHPRH_ENST00000367503.3_Missense_Mutation_p.S725Y|SHPRH_ENST00000275233.7_Missense_Mutation_p.S725Y			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	725	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S725Y(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GTGACAGATGGAACTTGGAGA	0.473																																							uc003qlf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(2173-2175)TCC>TAC		SNF2 histone linker PHD RING helicase isoform a							79.0	80.0	80.0					6																	146264343		1966	4157	6123	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146264343G>T	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2174C>A	6.37:g.146264343G>T	ENSP00000356475:p.Ser725Tyr		Somatic				SHPRH_uc003qld.2_Missense_Mutation_p.S725Y|SHPRH_uc003qle.2_Missense_Mutation_p.S725Y|SHPRH_uc003qlg.1_Missense_Mutation_p.S281Y|SHPRH_uc003qlj.1_Missense_Mutation_p.S614Y	p.S725Y	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	9	2573	-		Ovarian(120;0.0365)	725			Helicase ATP-binding; second part.		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.2174C>A	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874021	0.91664	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41	5.36	5.36	0.76844	DEAD-like helicase (1);SNF2-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	D	0.97879	0.9303	H	0.95611	3.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.995;0.991;1.0	D	0.98655	1.0681	10	0.87932	D	0	-14.1991	19.4564	0.94892	0.0:0.0:1.0:0.0	.	614;725;725;614	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	Y	725;725;725;725;614	ENSP00000356475:S725Y;ENSP00000356473:S725Y;ENSP00000412797:S725Y;ENSP00000275233:S725Y	ENSP00000275233:S725Y	S	-	2	0	SHPRH	146306036	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.779000	0.99018	2.684000	0.91462	0.650000	0.86243	TCC		0.473	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		8	94	1	0	0.00307968	0.00308	0.00327509	8	94				
GRM1	2911	broad.mit.edu	37	6	146720735	146720735	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr6:146720735G>A	ENST00000282753.1	+	7	2795	c.2560G>A	c.(2560-2562)Gat>Aat	p.D854N	GRM1_ENST00000361719.2_Missense_Mutation_p.D854N|GRM1_ENST00000507907.1_Missense_Mutation_p.D854N|GRM1_ENST00000355289.4_Missense_Mutation_p.D854N|GRM1_ENST00000392299.2_Missense_Mutation_p.D854N|GRM1_ENST00000492807.2_Missense_Mutation_p.D854N			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	854					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.D854N(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CACCACCTCTGATGTTGTCCG	0.532																																							uc010khw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(2560-2562)GAT>AAT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						79.0	66.0	70.0					6																	146720735		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146720735G>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2560G>A	6.37:g.146720735G>A	ENSP00000282753:p.Asp854Asn		Somatic				GRM1_uc010khv.1_Missense_Mutation_p.D854N|GRM1_uc003qll.2_Missense_Mutation_p.D854N|GRM1_uc011edz.1_Missense_Mutation_p.D854N|GRM1_uc011eea.1_Missense_Mutation_p.D854N	p.D854N	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	8	3030	+		Ovarian(120;0.0387)	854			Cytoplasmic (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.2560G>A	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432680	0.43224	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.87650	-2.27;-2.28;-2.28;-2.27;-2.28;-2.28	5.68	5.68	0.88126	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90752	0.7097	L	0.59436	1.845	0.80722	D	1	B;D;B	0.89917	0.013;1.0;0.013	B;D;B	0.83275	0.02;0.996;0.02	D	0.87247	0.2270	10	0.25751	T	0.34	.	19.7753	0.96389	0.0:0.0:1.0:0.0	.	854;854;854	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	N	854	ENSP00000354896:D854N;ENSP00000376119:D854N;ENSP00000424095:D854N;ENSP00000282753:D854N;ENSP00000347437:D854N;ENSP00000425599:D854N	ENSP00000282753:D854N	D	+	1	0	GRM1	146762428	1.000000	0.71417	0.501000	0.27601	0.974000	0.67602	8.062000	0.89475	2.686000	0.91538	0.585000	0.79938	GAT		0.532	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		10	54	0	0	0	0.006214	0	10	54				
CARD11	84433	broad.mit.edu	37	7	2946328	2946328	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:2946328C>T	ENST00000396946.4	-	25	3812	c.3409G>A	c.(3409-3411)Gac>Aac	p.D1137N		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1137	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.D1130N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCGATCTTGTCCTTGACAACG	0.662			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(3409-3411)GAC>AAC		caspase recruitment domain family, member 11							91.0	74.0	80.0					7																	2946328		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2946328C>T	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3409G>A	7.37:g.2946328C>T	ENSP00000380150:p.Asp1137Asn		Somatic					p.D1137N	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	25	3813	-		Ovarian(82;0.0115)	1137			Guanylate kinase-like.		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.3409G>A	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643140	0.47153	.	.	ENSG00000198286	ENST00000396946	T	0.17054	2.3	3.68	3.68	0.42216	.	0.161907	0.40640	N	0.001054	T	0.11922	0.0290	N	0.25647	0.755	0.58432	D	0.999999	B	0.12630	0.006	B	0.10450	0.005	T	0.07028	-1.0794	10	0.09843	T	0.71	-31.4958	15.4166	0.74974	0.0:1.0:0.0:0.0	.	1137	Q9BXL7	CAR11_HUMAN	N	1137	ENSP00000380150:D1137N	ENSP00000380150:D1137N	D	-	1	0	CARD11	2912854	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	7.475000	0.81041	1.591000	0.50007	0.511000	0.50034	GAC		0.662	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		8	74	0	0	0	0.004482	0	8	74				
FBXL18	80028	broad.mit.edu	37	7	5540616	5540616	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:5540616G>A	ENST00000382368.3	-	3	1407	c.1284C>T	c.(1282-1284)tcC>tcT	p.S428S	FBXL18_ENST00000453700.3_Silent_p.S428S	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	428								p.S428S(2)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		cgcgcggcgcggAGTCAGCGA	0.736																																							uc003soo.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(1282-1284)TCC>TCT		F-box and leucine-rich repeat protein 18							9.0	11.0	10.0					7																	5540616		2155	4195	6350	SO:0001819	synonymous_variant	80028							g.chr7:5540616G>A	AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1284C>T	7.37:g.5540616G>A			Somatic				FBXL18_uc003son.3_Silent_p.S428S	p.S428S	NM_024963	NP_079239	WXS	Illumina HiSeq	Unspecified	Q96ME1	FXL18_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)	3	1378	-		Ovarian(82;0.0607)	428					Q9BR90|Q9BTC7|Q9HAK7	Silent	SNP	ENST00000382368.3	37	c.1284C>T	CCDS43546.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.753949	0.00663	.	.	ENSG00000155034	ENST00000458142	.	.	.	5.36	-10.7	0.00240	.	.	.	.	.	T	0.13798	0.0334	.	.	.	0.23346	N	0.997863	.	.	.	.	.	.	T	0.09885	-1.0654	4	.	.	.	.	1.0515	0.01581	0.3768:0.1473:0.2587:0.2172	.	.	.	.	L	312	.	.	P	-	2	0	FBXL18	5507142	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-1.662000	0.01970	-3.038000	0.00264	-2.184000	0.00315	CCG		0.736	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963		5	15	0	0	0	0.021553	0	5	15				
PHF14	9678	broad.mit.edu	37	7	11068332	11068332	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:11068332C>T	ENST00000403050.3	+	7	1794	c.1342C>T	c.(1342-1344)Cgc>Tgc	p.R448C	PHF14_ENST00000445996.2_Missense_Mutation_p.R163C	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	448					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R448C(1)		NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		TGAAGACCCTCGCTTTGCTAG	0.433																																							uc003sry.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|skin(1)	3						c.(1342-1344)CGC>TGC		PHD finger protein 14 isoform 2							122.0	112.0	115.0					7																	11068332		1909	4146	6055	SO:0001583	missense	9678						zinc ion binding	g.chr7:11068332C>T	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1342C>T	7.37:g.11068332C>T	ENSP00000385795:p.Arg448Cys		Somatic				PHF14_uc011jxi.1_Missense_Mutation_p.R163C|PHF14_uc003srz.2_Missense_Mutation_p.R448C|PHF14_uc011jxj.1_Missense_Mutation_p.R163C	p.R448C	NM_014660	NP_055475	WXS	Illumina HiSeq	Unspecified	O94880	PHF14_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.205)	7	1777	+			448					A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	37	c.1342C>T	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	C	33	5.264160	0.95399	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.67698	-0.28;-0.05	5.31	5.31	0.75309	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.76097	0.3940	L	0.37850	1.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;D	0.75020	0.901;0.912;0.98;0.985	T	0.77579	-0.2535	10	0.62326	D	0.03	.	19.3605	0.94436	0.0:1.0:0.0:0.0	.	163;163;448;448	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	C	448;163	ENSP00000385795:R448C;ENSP00000403907:R163C	ENSP00000385795:R448C	R	+	1	0	PHF14	11034857	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.729000	0.84864	2.630000	0.89119	0.650000	0.86243	CGC		0.433	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660		8	56	0	0	0	0.004482	0	8	56				
STK31	56164	broad.mit.edu	37	7	23830456	23830456	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:23830456C>T	ENST00000355870.3	+	22	2770	c.2651C>T	c.(2650-2652)tCg>tTg	p.S884L	STK31_ENST00000428484.1_Missense_Mutation_p.S861L|STK31_ENST00000354639.3_Missense_Mutation_p.S861L|STK31_ENST00000433467.2_Missense_Mutation_p.S884L|STK31_ENST00000405627.3_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	884	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CAGCGAGCCTCGGTGAACATG	0.398																																							uc003sws.3		NA																	0				skin(3)|lung(2)|ovary(2)|stomach(2)	9						c.(2650-2652)TCG>TTG		serine/threonine kinase 31 isoform a							160.0	151.0	154.0					7																	23830456		2203	4300	6503	SO:0001583	missense	56164						ATP binding|nucleic acid binding|protein serine/threonine kinase activity	g.chr7:23830456C>T	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2651C>T	7.37:g.23830456C>T	ENSP00000348132:p.Ser884Leu		Somatic				STK31_uc003swt.3_Missense_Mutation_p.S861L|STK31_uc011jze.1_Missense_Mutation_p.S884L|STK31_uc010kuq.2_Missense_Mutation_p.S861L|STK31_uc003swv.1_Missense_Mutation_p.S50L	p.S884L	NM_031414	NP_113602	WXS	Illumina HiSeq	Unspecified	Q9BXU1	STK31_HUMAN			22	2718	+			884			Protein kinase.		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	c.2651C>T	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667768	0.67814	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.66099	-0.19;2.19;-0.19;-0.19	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.319446	0.29932	N	0.010821	T	0.60495	0.2273	L	0.40543	1.245	0.37729	D	0.925193	D;D;D	0.57571	0.98;0.98;0.958	P;P;B	0.46110	0.448;0.504;0.37	T	0.64879	-0.6303	10	0.40728	T	0.16	-6.9945	18.7143	0.91670	0.0:1.0:0.0:0.0	.	884;884;884	B4DZ06;A4D159;Q9BXU1	.;.;STK31_HUMAN	L	884;884;861;861	ENSP00000348132:S884L;ENSP00000411852:S884L;ENSP00000346660:S861L;ENSP00000406146:S861L	ENSP00000346660:S861L	S	+	2	0	STK31	23796981	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.926000	0.56491	2.510000	0.84645	0.557000	0.71058	TCG		0.398	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414		7	73	0	0	0	0.004482	0	7	73				
AQP1	358	broad.mit.edu	37	7	30963079	30963079	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:30963079G>A	ENST00000311813.4	+	4	700	c.645G>A	c.(643-645)ggG>ggA	p.G215G	AQP1_ENST00000482461.1_3'UTR|AQP1_ENST00000441328.2_Silent_p.G132G|AQP1_ENST00000434909.2_Silent_p.G275G|AQP1_ENST00000409611.1_Silent_p.G164G|AQP1_ENST00000409899.1_Silent_p.G100G|AQP1_ENST00000509504.1_Silent_p.G392G	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	215					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.G132G(1)|p.G215G(1)		kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	TCTGGGTGGGGCCATTCATCG	0.612																																							uc003tbv.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(643-645)GGG>GGA		aquaporin 1	Acetazolamide(DB00819)						43.0	40.0	41.0					7																	30963079		2203	4300	6503	SO:0001819	synonymous_variant	358				ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity	g.chr7:30963079G>A	M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.645G>A	7.37:g.30963079G>A			Somatic				AQP1_uc011kac.1_Silent_p.G275G|AQP1_uc010kwf.1_Silent_p.G132G|AQP1_uc010kwg.1_Silent_p.G96G|AQP1_uc010kwh.1_Silent_p.G164G	p.G215G	NM_198098	NP_932766	WXS	Illumina HiSeq	Unspecified	P29972	AQP1_HUMAN			4	702	+		Melanoma(862;0.16)	215			Helical; Name=Helix 6.		B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Silent	SNP	ENST00000311813.4	37	c.645G>A	CCDS5431.1																																																																																				0.612	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215002.3	NM_000385		10	69	0	0	0	0.008291	0	10	69				
BBS9	27241	broad.mit.edu	37	7	33427662	33427662	+	Missense_Mutation	SNP	G	G	A	rs555671554		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:33427662G>A	ENST00000242067.6	+	19	2542	c.2021G>A	c.(2020-2022)cGg>cAg	p.R674Q	BBS9_ENST00000350941.3_Missense_Mutation_p.R634Q|BBS9_ENST00000396127.2_Missense_Mutation_p.R639Q|BBS9_ENST00000354265.4_Missense_Mutation_p.R639Q|BBS9_ENST00000355070.2_Missense_Mutation_p.R669Q	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	674					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.R674L(2)|p.R674Q(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GTACAATTTCGGGCCATTCAA	0.403									Bardet-Biedl syndrome																														uc003tdn.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(2020-2022)CGG>CAG		parathyroid hormone-responsive B1 isoform 2							141.0	148.0	145.0					7																	33427662		2203	4300	6503	SO:0001583	missense	27241	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding	g.chr7:33427662G>A		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2021G>A	7.37:g.33427662G>A	ENSP00000242067:p.Arg674Gln		Somatic				BBS9_uc003tdo.1_Missense_Mutation_p.R639Q|BBS9_uc003tdp.1_Missense_Mutation_p.R669Q|BBS9_uc003tdq.1_Missense_Mutation_p.R634Q|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Missense_Mutation_p.R198Q|BBS9_uc003tds.1_Missense_Mutation_p.R97Q|BBS9_uc003tdt.2_RNA	p.R674Q	NM_198428	NP_940820	WXS	Illumina HiSeq	Unspecified	Q3SYG4	PTHB1_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)		19	2534	+			674					E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	c.2021G>A	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	G	33	5.256605	0.95336	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.57	5.57	0.84162	.	0.063267	0.64402	D	0.000009	T	0.48677	0.1513	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79108	0.992;0.992;0.992;0.992;0.987	T	0.46911	-0.9157	10	0.62326	D	0.03	-16.7312	17.7345	0.88388	0.0:0.0:1.0:0.0	.	674;634;669;639;674	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	Q	674;634;639;669;639;674	ENSP00000242067:R674Q;ENSP00000313122:R634Q;ENSP00000379433:R639Q;ENSP00000347182:R669Q;ENSP00000346214:R639Q	ENSP00000242067:R674Q	R	+	2	0	BBS9	33394187	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.191000	0.94940	2.614000	0.88457	0.555000	0.69702	CGG		0.403	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1			22	278	0	0	0	0.016522	0	22	278				
SUN3	256979	broad.mit.edu	37	7	48033980	48033980	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:48033980C>G	ENST00000297325.4	-	8	952	c.793G>C	c.(793-795)Gag>Cag	p.E265Q	SUN3_ENST00000453192.2_Missense_Mutation_p.E253Q|SUN3_ENST00000395572.2_Missense_Mutation_p.E265Q|SUN3_ENST00000473723.1_5'UTR|SUN3_ENST00000412142.1_Missense_Mutation_p.E165Q	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	265	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.					integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)		p.E265Q(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GAGATGTGCTCCATGGTAACA	0.458																																							uc003tof.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(793-795)GAG>CAG		Sad1 and UNC84 domain containing 1							205.0	194.0	198.0					7																	48033980		2203	4300	6503	SO:0001583	missense	256979					integral to membrane		g.chr7:48033980C>G	AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.793G>C	7.37:g.48033980C>G	ENSP00000297325:p.Glu265Gln		Somatic				SUN3_uc010kyq.2_Missense_Mutation_p.E165Q|SUN3_uc003tog.2_Missense_Mutation_p.E265Q|SUN3_uc011kcf.1_Missense_Mutation_p.E253Q	p.E265Q	NM_152782	NP_689995	WXS	Illumina HiSeq	Unspecified	Q8TAQ9	SUN3_HUMAN			9	890	-			265			SUN.		A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	37	c.793G>C	CCDS34636.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.163322|4.163322	0.78226|0.78226	.|.	.|.	ENSG00000164744|ENSG00000164744	ENST00000297325;ENST00000412371;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771|ENST00000453071	T;T;T;T;T;T|.	0.45668|.	0.89;0.89;0.89;0.89;0.89;0.89|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Sad1/UNC-like, C-terminal (2);|.	0.227320|.	0.44483|.	D|.	0.000446|.	T|T	0.73583|0.73583	0.3605|0.3605	M|M	0.66939|0.66939	2.045|2.045	0.52501|0.52501	D|D	0.999959|0.999959	D;D;D|.	0.89917|.	0.966;1.0;0.999|.	P;D;D|.	0.78314|.	0.908;0.988;0.991|.	T|T	0.72290|0.72290	-0.4337|-0.4337	10|5	0.45353|.	T|.	0.12|.	.|.	16.9474|16.9474	0.86233|0.86233	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	253;165;265|.	E7EWC8;Q8TAQ9-2;Q8TAQ9|.	.;.;SUN3_HUMAN|.	Q|C	265;87;165;265;253;165|188	ENSP00000297325:E265Q;ENSP00000406887:E87Q;ENSP00000410204:E165Q;ENSP00000378939:E265Q;ENSP00000387525:E253Q;ENSP00000409077:E165Q|.	ENSP00000297325:E265Q|.	E|W	-|-	1|3	0|0	SUN3|SUN3	48000505|48000505	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	5.648000|5.648000	0.67930|0.67930	2.602000|2.602000	0.87976|0.87976	0.551000|0.551000	0.68910|0.68910	GAG|TGG		0.458	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782		26	193	0	0	0	0.027356	0	26	193				
SUN3	256979	broad.mit.edu	37	7	48035654	48035654	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:48035654C>T	ENST00000297325.4	-	7	826	c.667G>A	c.(667-669)Gaa>Aaa	p.E223K	SUN3_ENST00000453192.2_Missense_Mutation_p.E211K|SUN3_ENST00000395572.2_Missense_Mutation_p.E223K|SUN3_ENST00000473723.1_5'UTR|SUN3_ENST00000412142.1_Missense_Mutation_p.E123K	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	223	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.					integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)		p.E223K(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGAGGCATTTCATGATTTAGG	0.284																																							uc003tof.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(667-669)GAA>AAA		Sad1 and UNC84 domain containing 1							80.0	85.0	83.0					7																	48035654		2203	4292	6495	SO:0001583	missense	256979					integral to membrane		g.chr7:48035654C>T	AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.667G>A	7.37:g.48035654C>T	ENSP00000297325:p.Glu223Lys		Somatic				SUN3_uc010kyq.2_Missense_Mutation_p.E123K|SUN3_uc003tog.2_Missense_Mutation_p.E223K|SUN3_uc011kcf.1_Missense_Mutation_p.E211K	p.E223K	NM_152782	NP_689995	WXS	Illumina HiSeq	Unspecified	Q8TAQ9	SUN3_HUMAN			8	764	-			223			SUN.		A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	37	c.667G>A	CCDS34636.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.73|19.73	3.882619|3.882619	0.72410|0.72410	.|.	.|.	ENSG00000164744|ENSG00000164744	ENST00000297325;ENST00000412371;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771|ENST00000453071	T;T;T;T;T;T|.	0.43688|.	0.94;0.94;0.94;0.94;0.94;0.94|.	5.25|5.25	5.25|5.25	0.73442|0.73442	Sad1/UNC-like, C-terminal (2);|.	0.268407|.	0.38272|.	N|.	0.001754|.	T|T	0.57154|0.57154	0.2034|0.2034	L|L	0.38175|0.38175	1.15|1.15	0.35571|0.35571	D|D	0.805459|0.805459	B;D;D|.	0.71674|.	0.387;0.997;0.998|.	B;D;D|.	0.71870|.	0.198;0.909;0.975|.	T|T	0.62969|0.62969	-0.6741|-0.6741	10|5	0.72032|.	D|.	0.01|.	.|.	14.4091|14.4091	0.67103|0.67103	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	211;123;223|.	E7EWC8;Q8TAQ9-2;Q8TAQ9|.	.;.;SUN3_HUMAN|.	K|I	223;45;123;223;211;123|146	ENSP00000297325:E223K;ENSP00000406887:E45K;ENSP00000410204:E123K;ENSP00000378939:E223K;ENSP00000387525:E211K;ENSP00000409077:E123K|.	ENSP00000297325:E223K|.	E|M	-|-	1|3	0|0	SUN3|SUN3	48002179|48002179	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.495000|4.495000	0.60353|0.60353	2.489000|2.489000	0.83994|0.83994	0.650000|0.650000	0.86243|0.86243	GAA|ATG		0.284	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782		20	131	0	0	0	0.012319	0	20	131				
IKZF1	10320	broad.mit.edu	37	7	50455159	50455159	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:50455159C>G	ENST00000331340.3	+	6	861	c.706C>G	c.(706-708)Ctg>Gtg	p.L236V	IKZF1_ENST00000359197.5_Intron|IKZF1_ENST00000343574.5_Missense_Mutation_p.L149V|IKZF1_ENST00000439701.1_Intron|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000438033.1_Missense_Mutation_p.L149V|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000440768.2_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	236					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)|p.L236V(1)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TCCGGGCACACTGTACCCAGG	0.582			"""D,T"""	BCL6	"""ALL, DLBCL"""																																		uc003tow.3		NA		"""Rec,Dom"""	yes		7	7p12.2	10320	D	IKAROS family zinc finger 1			L			ALL		132	Unknown(131)|Substitution - Missense(1)	p.?(74)	haematopoietic_and_lymphoid_tissue(131)|lung(1)	haematopoietic_and_lymphoid_tissue(147)|lung(1)	148						c.(706-708)CTG>GTG		zinc finger protein, subfamily 1A, 1 (Ikaros)							30.0	31.0	31.0					7																	50455159		1935	4130	6065	SO:0001583	missense	10320				cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	g.chr7:50455159C>G	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.706C>G	7.37:g.50455159C>G	ENSP00000331614:p.Leu236Val		Somatic				IKZF1_uc003tox.3_Intron|IKZF1_uc003toy.3_Intron|IKZF1_uc011kck.1_Missense_Mutation_p.L149V|IKZF1_uc003toz.3_Missense_Mutation_p.L206V|IKZF1_uc010kyx.2_Intron	p.L236V	NM_006060	NP_006051	WXS	Illumina HiSeq	Unspecified	Q13422	IKZF1_HUMAN			7	874	+	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)	236					A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	37	c.706C>G		.	.	.	.	.	.	.	.	.	.	C	8.056	0.767120	0.15983	.	.	ENSG00000185811	ENST00000343574;ENST00000331340;ENST00000438033	T;T;T	0.05925	3.37;3.46;3.37	5.4	3.57	0.40892	.	0.126360	0.52532	D	0.000061	T	0.04724	0.0128	.	.	.	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.42865	-0.9426	9	0.21014	T	0.42	-24.9801	9.198	0.37240	0.2602:0.6707:0.0:0.0691	.	149;236	Q13422-2;Q13422	.;IKZF1_HUMAN	V	149;236;149	ENSP00000342750:L149V;ENSP00000331614:L236V;ENSP00000396554:L149V	ENSP00000331614:L236V	L	+	1	2	IKZF1	50422653	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.437000	0.44828	0.634000	0.30469	0.655000	0.94253	CTG		0.582	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060		9	15	0	0	0	0.006214	0	9	15				
POM121L12	285877	broad.mit.edu	37	7	53103781	53103781	+	Missense_Mutation	SNP	C	C	G	rs534712268		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:53103781C>G	ENST00000408890.4	+	1	433	c.417C>G	c.(415-417)atC>atG	p.I139M		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	139								p.I139M(1)|p.I139I(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CGGTGACCATCGGGATCGCGC	0.716																																							uc003tpz.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)		0						c.(415-417)ATC>ATG		POM121 membrane glycoprotein-like 12							24.0	28.0	27.0					7																	53103781		1967	4116	6083	SO:0001583	missense	285877							g.chr7:53103781C>G		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.417C>G	7.37:g.53103781C>G	ENSP00000386133:p.Ile139Met		Somatic					p.I139M	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	433	+			139					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.417C>G	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349037	0.24426	.	.	ENSG00000221900	ENST00000408890	T	0.28069	1.63	1.63	0.679	0.17975	.	.	.	.	.	T	0.33760	0.0874	L	0.29908	0.895	0.09310	N	1	D	0.63880	0.993	P	0.61328	0.887	T	0.13469	-1.0508	9	0.87932	D	0	.	5.0233	0.14372	0.3512:0.6488:0.0:0.0	.	139	Q8N7R1	P1L12_HUMAN	M	139	ENSP00000386133:I139M	ENSP00000386133:I139M	I	+	3	3	POM121L12	53071275	0.009000	0.17119	0.001000	0.08648	0.004000	0.04260	0.442000	0.21628	0.241000	0.21283	0.462000	0.41574	ATC		0.716	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		4	48	0	0	0	0.014758	0	4	48				
ZP3	7784	broad.mit.edu	37	7	76058924	76058924	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:76058924G>C	ENST00000394857.3	+	2	463	c.405G>C	c.(403-405)gaG>gaC	p.E135D	ZP3_ENST00000336517.4_Missense_Mutation_p.E84D|ZP3_ENST00000416245.1_5'UTR	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	135	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)	p.E84D(1)|p.E135D(1)		endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						ACCGCGCAGAGATTCCCATCG	0.622																																							uc003ufd.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(403-405)GAG>GAC		zona pellucida glycoprotein 3 isoform 1							117.0	88.0	98.0					7																	76058924		2203	4300	6503	SO:0001583	missense	7784				binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding	g.chr7:76058924G>C	M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.405G>C	7.37:g.76058924G>C	ENSP00000378326:p.Glu135Asp		Somatic				ZP3_uc003ufc.3_Missense_Mutation_p.E84D|ZP3_uc003ufe.2_Missense_Mutation_p.E43D	p.E135D	NM_001110354	NP_001103824	WXS	Illumina HiSeq	Unspecified	P21754	ZP3_HUMAN			2	415	+			135			Extracellular (Potential).|ZP.		Q06633|Q29RW0	Missense_Mutation	SNP	ENST00000394857.3	37	c.405G>C	CCDS47618.1	.	.	.	.	.	.	.	.	.	.	G	5.502	0.277653	0.10403	.	.	ENSG00000188372	ENST00000336517;ENST00000394857;ENST00000544121	D;D	0.82984	-1.67;-1.67	5.4	-0.186	0.13272	Zona pellucida sperm-binding protein (3);	0.847094	0.10336	N	0.686918	T	0.74473	0.3721	L	0.57130	1.785	0.09310	N	0.999997	B;B	0.20671	0.047;0.002	B;B	0.24541	0.054;0.008	T	0.55927	-0.8063	10	0.14656	T	0.56	-19.7539	4.4801	0.11762	0.3828:0.2667:0.3505:0.0	.	84;135	P21754-3;P21754	.;ZP3_HUMAN	D	84;135;135	ENSP00000337310:E84D;ENSP00000378326:E135D	ENSP00000337310:E84D	E	+	3	2	ZP3	75896860	0.002000	0.14202	0.007000	0.13788	0.240000	0.25518	-0.302000	0.08221	0.278000	0.22164	-0.266000	0.10368	GAG		0.622	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1			25	26	0	0	0	0.021523	0	25	26				
ZNF804B	219578	broad.mit.edu	37	7	88966042	88966042	+	Missense_Mutation	SNP	C	C	G	rs368481408		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:88966042C>G	ENST00000333190.4	+	4	4355	c.3746C>G	c.(3745-3747)tCg>tGg	p.S1249W		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1249							metal ion binding (GO:0046872)	p.S1249W(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATTTCATTTTCGACTCTGACT	0.458										HNSCC(36;0.09)																													uc011khi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(3745-3747)TCG>TGG		zinc finger protein 804B							214.0	180.0	191.0					7																	88966042		2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88966042C>G	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3746C>G	7.37:g.88966042C>G	ENSP00000329638:p.Ser1249Trp	HNSCC(36;0.09)	Somatic					p.S1249W	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	4284	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		1249					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.3746C>G	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467273	0.43839	.	.	ENSG00000182348	ENST00000333190	T	0.10382	2.88	5.16	5.16	0.70880	.	0.127393	0.36066	N	0.002805	T	0.34919	0.0914	M	0.71581	2.175	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.04855	-1.0922	10	0.87932	D	0	-7.7776	18.8226	0.92103	0.0:1.0:0.0:0.0	.	1249	A4D1E1	Z804B_HUMAN	W	1249	ENSP00000329638:S1249W	ENSP00000329638:S1249W	S	+	2	0	ZNF804B	88803978	1.000000	0.71417	0.860000	0.33809	0.012000	0.07955	6.985000	0.76193	2.670000	0.90874	0.561000	0.74099	TCG		0.458	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		9	158	0	0	0	0.008291	0	9	158				
SAMD9L	219285	broad.mit.edu	37	7	92762501	92762501	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:92762501G>A	ENST00000318238.4	-	5	4000	c.2784C>T	c.(2782-2784)ctC>ctT	p.L928L	SAMD9L_ENST00000437805.1_Silent_p.L928L|SAMD9L_ENST00000411955.1_Silent_p.L928L	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	928					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.L928L(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CATAAGAGCTGAGTAAAGCCA	0.368																																							uc003umh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(2782-2784)CTC>CTT		sterile alpha motif domain containing 9-like							98.0	93.0	95.0					7																	92762501		2203	4300	6503	SO:0001819	synonymous_variant	219285							g.chr7:92762501G>A	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2784C>T	7.37:g.92762501G>A			Somatic				SAMD9L_uc003umj.1_Silent_p.L928L|SAMD9L_uc003umi.1_Silent_p.L928L|SAMD9L_uc010lfb.1_Silent_p.L928L|SAMD9L_uc003umk.1_Silent_p.L928L|SAMD9L_uc010lfc.1_Silent_p.L928L|SAMD9L_uc010lfd.1_Silent_p.L928L|SAMD9L_uc011khx.1_Intron	p.L928L	NM_152703	NP_689916	WXS	Illumina HiSeq	Unspecified	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	4000	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		928					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	ENST00000318238.4	37	c.2784C>T	CCDS34681.1																																																																																				0.368	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		12	10	0	0	0	0.016723	0	12	10				
PTCD1	26024	broad.mit.edu	37	7	99022694	99022694	+	Silent	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:99022694G>A	ENST00000292478.4	-	6	1711	c.1461C>T	c.(1459-1461)atC>atT	p.I487I	PTCD1_ENST00000555673.1_Silent_p.I536I|ATP5J2-PTCD1_ENST00000413834.1_Silent_p.I536I	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	487					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.I487I(1)|p.I487M(1)		endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGAGGGTCCTGATGTCGGGCT	0.647																																							uc003uqh.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	ovary(1)	1						c.(1459-1461)ATC>ATT		pentatricopeptide repeat domain 1							55.0	58.0	57.0					7																	99022694		2203	4300	6503	SO:0001819	synonymous_variant	26024							g.chr7:99022694G>A	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1461C>T	7.37:g.99022694G>A			Somatic				PTCD1_uc011kiw.1_Silent_p.I536I	p.I487I	NM_015545	NP_056360	WXS	Illumina HiSeq	Unspecified	O75127	PTCD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		6	1592	-	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		487					Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	c.1461C>T	CCDS34691.1																																																																																				0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545		22	27	0	0	0	0.014323	0	22	27				
CTTNBP2	83992	broad.mit.edu	37	7	117431286	117431286	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:117431286G>A	ENST00000160373.3	-	4	2055	c.1964C>T	c.(1963-1965)tCc>tTc	p.S655F	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	655					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.S655F(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AATGACAAGGGAACTGTCTGA	0.577																																							uc003vjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1963-1965)TCC>TTC		cortactin binding protein 2							123.0	108.0	113.0					7																	117431286		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117431286G>A		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1964C>T	7.37:g.117431286G>A	ENSP00000160373:p.Ser655Phe		Somatic					p.S655F	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	4	2056	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		655					O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.1964C>T	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.788982	0.70337	.	.	ENSG00000077063	ENST00000160373	T	0.68181	-0.31	5.74	4.81	0.61882	.	0.246278	0.49916	D	0.000129	T	0.76198	0.3954	M	0.65975	2.015	0.46981	D	0.999273	D	0.55385	0.971	P	0.57502	0.822	T	0.73814	-0.3864	10	0.34782	T	0.22	-1.2084	16.5893	0.84761	0.0:0.13:0.87:0.0	.	655	Q8WZ74	CTTB2_HUMAN	F	655	ENSP00000160373:S655F	ENSP00000160373:S655F	S	-	2	0	CTTNBP2	117218522	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.920000	0.70017	2.873000	0.98535	0.563000	0.77884	TCC		0.577	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		6	65	0	0	0	0.021553	0	6	65				
DGKI	9162	broad.mit.edu	37	7	137282598	137282598	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:137282598C>T	ENST00000288490.5	-	12	1306	c.1306G>A	c.(1306-1308)Gga>Aga	p.G436R	DGKI_ENST00000446122.1_Missense_Mutation_p.G436R|DGKI_ENST00000453654.2_Missense_Mutation_p.G136R|DGKI_ENST00000424189.2_Missense_Mutation_p.G436R	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	436	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.G436R(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CCTACCGTTCCATCCCCACCA	0.393																																							uc003vtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)|skin(1)	3						c.(1306-1308)GGA>AGA		diacylglycerol kinase, iota							75.0	66.0	69.0					7																	137282598		2203	4300	6503	SO:0001583	missense	9162				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr7:137282598C>T	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1306G>A	7.37:g.137282598C>T	ENSP00000288490:p.Gly436Arg		Somatic				DGKI_uc003vtu.2_Missense_Mutation_p.G136R	p.G436R	NM_004717	NP_004708	WXS	Illumina HiSeq	Unspecified	O75912	DGKI_HUMAN			12	1307	-			436			DAGKc.		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	c.1306G>A	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737705	0.89573	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	D;D;D	0.90197	-2.63;-2.63;-2.63	5.08	5.08	0.68730	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.97707	0.9248	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99032	1.0821	10	0.87932	D	0	.	17.7686	0.88485	0.0:1.0:0.0:0.0	.	136;436	E9PFX6;O75912	.;DGKI_HUMAN	R	136;384;436;436;436	ENSP00000392161:G136R;ENSP00000288490:G436R;ENSP00000399131:G436R	ENSP00000288490:G436R	G	-	1	0	DGKI	136933138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.415000	0.73328	2.793000	0.96121	0.655000	0.94253	GGA		0.393	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		8	27	0	0	0	0.004482	0	8	27				
AGAP3	116988	broad.mit.edu	37	7	150817229	150817229	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:150817229C>T	ENST00000463381.1	+	8	937	c.441C>T	c.(439-441)ttC>ttT	p.F147F	AGAP3_ENST00000473312.1_Silent_p.F375F|AGAP3_ENST00000479901.1_Intron|AGAP3_ENST00000335367.3_Silent_p.F555F|AGAP3_ENST00000397238.2_Silent_p.F375F	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	339	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.F375F(2)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CCAACATCTTCACGGTACGTG	0.687																																							uc003wjg.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(1123-1125)TTC>TTT		centaurin, gamma 3 isoform a							73.0	85.0	81.0					7																	150817229		2153	4257	6410	SO:0001819	synonymous_variant	116988				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding	g.chr7:150817229C>T	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.441C>T	7.37:g.150817229C>T			Somatic				AGAP3_uc003wje.1_Silent_p.F147F|AGAP3_uc003wjf.1_Silent_p.F375F|AGAP3_uc010lpy.1_Intron|AGAP3_uc003wjh.1_Silent_p.F555F|AGAP3_uc003wji.1_5'Flank	p.F375F	NM_031946	NP_114152	WXS	Illumina HiSeq	Unspecified	Q96P47	AGAP3_HUMAN			8	1128	+			339			Small GTPase-like.		B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Silent	SNP	ENST00000463381.1	37	c.1125C>T																																																																																					0.687	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946		6	16	0	0	0	0.021553	0	6	16				
DLGAP2	9228	broad.mit.edu	37	8	1497624	1497624	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:1497624C>T	ENST00000421627.2	+	2	899	c.765C>T	c.(763-765)ttC>ttT	p.F255F		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	334					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.F299F(1)|p.F277F(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGAGCCCCTTCGGGGACCTGT	0.667																																							uc003wpl.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(763-765)TTC>TTT		discs large-associated protein 2							52.0	60.0	58.0					8																	1497624		2091	4230	6321	SO:0001819	synonymous_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497624C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.765C>T	8.37:g.1497624C>T			Somatic				DLGAP2_uc003wpm.2_Silent_p.F255F	p.F255F	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	862	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	334					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	c.765C>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	6.426	0.446700	0.12223	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.3	-7.6	0.01303	.	.	.	.	.	T	0.66277	0.2773	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70978	-0.4725	4	.	.	.	-10.7524	19.1986	0.93699	0.0:0.1188:0.0:0.8812	.	.	.	.	L	272	.	.	S	+	2	0	DLGAP2	1485031	0.127000	0.22367	0.162000	0.22713	0.691000	0.40173	-0.471000	0.06631	-1.838000	0.01187	-0.880000	0.02959	TCG		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		31	86	0	0	0	0.015359	0	31	86				
PRSS55	203074	broad.mit.edu	37	8	10387085	10387085	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:10387085G>C	ENST00000328655.3	+	2	263	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Missense_Mutation_p.E75Q	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	75	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.E75Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GATGGAGGCGGAGGTGGGTGA	0.512																																							uc003wta.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(223-225)GAG>CAG		hypothetical protein LOC203074 precursor							230.0	225.0	227.0					8																	10387085		2203	4300	6503	SO:0001583	missense	203074				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr8:10387085G>C	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.223G>C	8.37:g.10387085G>C	ENSP00000333003:p.Glu75Gln		Somatic				uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	p.E75Q	NM_198464	NP_940866	WXS	Illumina HiSeq	Unspecified	Q6UWB4	PRS55_HUMAN			2	238	+			75			Extracellular (Potential).|Peptidase S1.		E5RJX5	Missense_Mutation	SNP	ENST00000328655.3	37	c.223G>C	CCDS5976.1	.	.	.	.	.	.	.	.	.	.	G	3.960	-0.010456	0.07727	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	D;D	0.88201	-2.35;-2.35	4.05	1.12	0.20585	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.69314	0.3097	N	0.05592	-0.015	0.24941	N	0.991859	P	0.35551	0.509	B	0.28553	0.091	T	0.60306	-0.7289	9	0.15066	T	0.55	.	3.7266	0.08477	0.2404:0.2037:0.556:0.0	.	75	Q6UWB4	PRS55_HUMAN	Q	75	ENSP00000333003:E75Q;ENSP00000430459:E75Q	ENSP00000333003:E75Q	E	+	1	0	PRSS55	10424495	0.000000	0.05858	0.417000	0.26559	0.294000	0.27393	-0.178000	0.09782	0.221000	0.20879	0.561000	0.74099	GAG		0.512	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464		84	227	0	0	0	0.01441	0	84	227				
DOK2	9046	broad.mit.edu	37	8	21768239	21768240	+	Nonsense_Mutation	DNP	CC	CC	TA			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:21768239_21768240CC>TA	ENST00000276420.4	-	4	820_821	c.562_563GG>TA	c.(562-564)GGg>TAg	p.G188*	DOK2_ENST00000544659.1_Nonsense_Mutation_p.G34*	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	188	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)	p.G188*(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CAGCTGGGTCCCTGGCTCGGGC	0.634																																							uc003wzy.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(562-564)GGG>TAG		docking protein 2																																				SO:0001587	stop_gained	9046				blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding	g.chr8:21768239_21768240CC>TA	AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.562_563delinsTA	8.37:g.21768239_21768240delinsTA	ENSP00000276420:p.Gly188*		Somatic				DOK2_uc003wzx.1_Nonsense_Mutation_p.G188*|DOK2_uc003wzz.1_Nonsense_Mutation_p.G34*|DOK2_uc010lth.1_Nonsense_Mutation_p.G34*	p.G188*	NM_003974	NP_003965	WXS	Illumina HiSeq	Unspecified	O60496	DOK2_HUMAN		Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)	4	655_656	-			188			IRS-type PTB.		Q8N5A4	Nonsense_Mutation	DNP	ENST00000276420.4	37	c.562_563GG>TA	CCDS6016.1																																																																																				0.634	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253735.3	NM_003974		15	32	0	0	0	0.004672	0	15	32				
PPP3CC	5533	broad.mit.edu	37	8	22368701	22368701	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:22368701G>A	ENST00000240139.5	+	5	914	c.587G>A	c.(586-588)gGa>gAa	p.G196E	PPP3CC_ENST00000289963.8_Missense_Mutation_p.G196E|PPP3CC_ENST00000397775.3_Missense_Mutation_p.G196E|PPP3CC_ENST00000518852.1_Missense_Mutation_p.G196E	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	196					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.G196E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		TGTGTACATGGAGGAATGTCA	0.363																																							uc003xbs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(586-588)GGA>GAA		protein phosphatase 3, catalytic subunit, gamma							167.0	139.0	149.0					8																	22368701		2203	4300	6503	SO:0001583	missense	5533				activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	cytosol	calmodulin binding|metal ion binding|phosphoprotein phosphatase activity	g.chr8:22368701G>A		CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.587G>A	8.37:g.22368701G>A	ENSP00000240139:p.Gly196Glu		Somatic				PPP3CC_uc003xbr.1_Missense_Mutation_p.G196E|PPP3CC_uc011kzi.1_Missense_Mutation_p.G196E|PPP3CC_uc003xbt.2_Missense_Mutation_p.G196E	p.G196E	NM_005605	NP_005596	WXS	Illumina HiSeq	Unspecified	P48454	PP2BC_HUMAN		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)	5	914	+		Prostate(55;0.104)	196					B4DRT5|Q9BSS6|Q9H4M5	Missense_Mutation	SNP	ENST00000240139.5	37	c.587G>A	CCDS34859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.061779|5.061779	0.93846|0.93846	.|.	.|.	ENSG00000120910|ENSG00000120910	ENST00000522034;ENST00000521651|ENST00000518852;ENST00000240139;ENST00000289963;ENST00000397775;ENST00000523620	.|T;T;T;T;T	.|0.16196	.|2.36;2.36;2.36;2.36;2.36	6.03|6.03	6.03|6.03	0.97812|0.97812	.|Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70193|0.70193	0.3196|0.3196	H|H	0.99985|0.99985	5.245|5.245	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;1.0	.|D;D;D;D	.|0.79108	.|0.991;0.976;0.986;0.992	D|D	0.86131|0.86131	0.1575|0.1575	5|10	.|0.87932	.|D	.|0	-20.5927|-20.5927	19.3283|19.3283	0.94273|0.94273	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|196;196;196;196	.|B4DRT5;P48454-2;P48454;G3V111	.|.;.;PP2BC_HUMAN;.	K|E	46;73|196;196;196;196;22	.|ENSP00000429379:G196E;ENSP00000240139:G196E;ENSP00000289963:G196E;ENSP00000380878:G196E;ENSP00000430555:G22E	.|ENSP00000240139:G196E	E|G	+|+	1|2	0|0	PPP3CC|PPP3CC	22424646|22424646	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.363	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375652.1	NM_005605		8	102	0	0	0	0.00308	0	8	102				
ADAM7	8756	broad.mit.edu	37	8	24324370	24324370	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:24324370G>T	ENST00000175238.6	+	6	531	c.448G>T	c.(448-450)Gag>Tag	p.E150*	ADAM7_ENST00000441335.2_Nonsense_Mutation_p.E150*|ADAM7_ENST00000380789.1_Nonsense_Mutation_p.E150*|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E150*(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		ATACTCAGATGAGGGAGAACA	0.393																																							uc003xeb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(3)|ovary(1)|kidney(1)	5						c.(448-450)GAG>TAG		a disintegrin and metalloproteinase domain 7							106.0	108.0	108.0					8																	24324370		2203	4300	6503	SO:0001587	stop_gained	8756				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24324370G>T	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.448G>T	8.37:g.24324370G>T	ENSP00000175238:p.Glu150*		Somatic				ADAM7_uc003xea.1_Nonsense_Mutation_p.E150*	p.E150*	NM_003817	NP_003808	WXS	Illumina HiSeq	Unspecified	Q9H2U9	ADAM7_HUMAN		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)	6	561	+		Prostate(55;0.0181)	150			Extracellular (Potential).		A8K8X7|O75959|Q6PEJ6	Nonsense_Mutation	SNP	ENST00000175238.6	37	c.448G>T	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519607	0.85495	.	.	ENSG00000069206	ENST00000441335;ENST00000175238;ENST00000380789	.	.	.	5.03	4.12	0.48240	.	0.281962	0.25377	N	0.031107	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	10.51	0.44855	0.0:0.2125:0.7875:0.0	.	.	.	.	X	150	.	ENSP00000175238:E150X	E	+	1	0	ADAM7	24380260	0.992000	0.36948	0.930000	0.37139	0.865000	0.49528	1.758000	0.38410	2.620000	0.88729	0.561000	0.74099	GAG		0.393	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817		49	107	1	0	2.43468e-25	0.01441	3.00039e-25	49	107				
CCDC25	55246	broad.mit.edu	37	8	27598009	27598009	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:27598009C>A	ENST00000356537.4	-	8	670	c.577G>T	c.(577-579)Gaa>Taa	p.E193*	CCDC25_ENST00000539095.1_Nonsense_Mutation_p.E125*|CCDC25_ENST00000522915.1_Nonsense_Mutation_p.E125*|RP11-16P20.3_ENST00000521510.1_RNA	NM_018246.2	NP_060716.2	Q86WR0	CCD25_HUMAN	coiled-coil domain containing 25	193						extracellular vesicular exosome (GO:0070062)		p.E193*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0223)|KIRC - Kidney renal clear cell carcinoma(542;0.11)|Kidney(114;0.131)|Colorectal(74;0.154)		GACATATTTTCAACTTTCATT	0.318																																							uc003xgc.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(577-579)GAA>TAA		coiled-coil domain containing 25							130.0	128.0	129.0					8																	27598009		2203	4300	6503	SO:0001587	stop_gained	55246							g.chr8:27598009C>A	AK001715	CCDS6062.2	8p21.1	2006-09-20			ENSG00000147419	ENSG00000147419			25591	protein-coding gene	gene with protein product						12477932	Standard	NM_018246		Approved	FLJ10853	uc003xgc.3	Q86WR0	OTTHUMG00000132173	ENST00000356537.4:c.577G>T	8.37:g.27598009C>A	ENSP00000348933:p.Glu193*		Somatic				CCDC25_uc003xgd.2_Nonsense_Mutation_p.E125*|CCDC25_uc011lan.1_RNA|CCDC25_uc011lao.1_Intron|CCDC25_uc003xge.2_RNA	p.E193*	NM_018246	NP_060716	WXS	Illumina HiSeq	Unspecified	Q86WR0	CCD25_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0223)|KIRC - Kidney renal clear cell carcinoma(542;0.11)|Kidney(114;0.131)|Colorectal(74;0.154)	8	690	-		Ovarian(32;0.000953)	193					Q0P663|Q96SI2|Q9NV98	Nonsense_Mutation	SNP	ENST00000356537.4	37	c.577G>T	CCDS6062.2	.	.	.	.	.	.	.	.	.	.	C	37	6.013992	0.97200	.	.	ENSG00000147419	ENST00000356537;ENST00000539095;ENST00000522915	.	.	.	4.73	4.73	0.59995	.	0.055575	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-22.0683	15.5731	0.76354	0.0:1.0:0.0:0.0	.	.	.	.	X	193;125;125	.	ENSP00000348933:E193X	E	-	1	0	CCDC25	27653928	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.746000	0.68681	2.349000	0.79799	0.655000	0.94253	GAA		0.318	CCDC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255224.1	NM_018246		64	145	1	0	3.07281e-33	0.01441	3.87804e-33	64	145				
TEX15	56154	broad.mit.edu	37	8	30704643	30704643	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:30704643C>T	ENST00000256246.2	-	1	1965	c.1891G>A	c.(1891-1893)Gaa>Aaa	p.E631K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	631					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E631K(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TCTGGACTTTCAGAAGAACAA	0.323																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(1891-1893)GAA>AAA		testis expressed 15							63.0	62.0	63.0					8																	30704643		2202	4300	6502	SO:0001583	missense	56154							g.chr8:30704643C>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1891G>A	8.37:g.30704643C>T	ENSP00000256246:p.Glu631Lys		Somatic					p.E631K	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	1891	-			631						Missense_Mutation	SNP	ENST00000256246.2	37	c.1891G>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.638501	0.67130	.	.	ENSG00000133863	ENST00000256246	T	0.12672	2.66	5.36	1.25	0.21368	.	0.981047	0.08340	N	0.961098	T	0.10723	0.0262	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.17433	0.018	T	0.35748	-0.9776	10	0.87932	D	0	.	6.2204	0.20677	0.0:0.5503:0.2872:0.1625	.	631	Q9BXT5	TEX15_HUMAN	K	631	ENSP00000256246:E631K	ENSP00000256246:E631K	E	-	1	0	TEX15	30824185	0.000000	0.05858	0.001000	0.08648	0.734000	0.41952	0.578000	0.23773	0.326000	0.23384	0.655000	0.94253	GAA		0.323	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			23	81	0	0	0	0.016522	0	23	81				
ERLIN2	11160	broad.mit.edu	37	8	37605166	37605166	+	Intron	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:37605166G>C	ENST00000276461.5	+	7	491				ERLIN2_ENST00000519638.1_Intron	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2						cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CAAACTTGACGACTGCTCCAT	0.468																																							uc010lvx.1		NA																	0					0						c.(208-210)GTC>GTG		SubName: Full=cDNA FLJ38978 fis, clone NT2RI2004209; SubName: Full=Chromosome X open reading frame 56, isoform CRA_b; SubName: Full=Putative uncharacterized protein CXorf56;																																				SO:0001627	intron_variant	728024							g.chr8:37605166G>C	AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.425-1911G>C	8.37:g.37605166G>C			Somatic				ERLIN2_uc003xke.3_Intron	p.V70V	NR_003671		WXS	Illumina HiSeq	Unspecified					1	356	-								A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Silent	SNP	ENST00000276461.5	37	c.210C>G	CCDS6095.1																																																																																				0.468	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2	NM_007175		25	55	0	0	0	0.01892	0	25	55				
PRKDC	5591	broad.mit.edu	37	8	48805717	48805717	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:48805717C>G	ENST00000314191.2	-	32	3883	c.3827G>C	c.(3826-3828)gGa>gCa	p.G1276A	PRKDC_ENST00000338368.3_Missense_Mutation_p.G1276A|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1277					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.G1276A(1)|p.G1277R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CTGGAGCGCTCCTACAGTTCT	0.607								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	Esophageal Squamous(79;1091 1253 12329 31680 40677)	uc003xqi.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34						c.(3829-3831)GGA>GCA	NHEJ	protein kinase, DNA-activated, catalytic							47.0	50.0	49.0					8																	48805717		2045	4186	6231	SO:0001583	missense	5591				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding	g.chr8:48805717C>G		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3827G>C	8.37:g.48805717C>G	ENSP00000313420:p.Gly1276Ala		Somatic				PRKDC_uc003xqj.2_Missense_Mutation_p.G1277A|PRKDC_uc011ldh.1_Intron	p.G1277A	NM_006904	NP_008835	WXS	Illumina HiSeq	Unspecified	P78527	PRKDC_HUMAN			32	3887	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	1277					P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37	c.3830G>C		.	.	.	.	.	.	.	.	.	.	C	8.555	0.876388	0.17395	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02177	4.48;4.41	5.83	-1.97	0.07503	.	1.648360	0.03091	N	0.159834	T	0.01558	0.0050	N	0.08118	0	0.09310	N	1	B;B	0.19200	0.034;0.009	B;B	0.18263	0.021;0.009	T	0.47522	-0.9111	10	0.20046	T	0.44	.	8.2179	0.31524	0.1043:0.0989:0.0:0.7968	.	1276;1277	E7EUY0;P78527	.;PRKDC_HUMAN	A	1276	ENSP00000313420:G1276A;ENSP00000345182:G1276A	ENSP00000313420:G1276A	G	-	2	0	PRKDC	48968270	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.669000	0.25142	-0.323000	0.08602	-0.469000	0.05056	GGA		0.607	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		4	24	0	0	0	0.014758	0	4	24				
PXDNL	137902	broad.mit.edu	37	8	52321922	52321922	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:52321922C>A	ENST00000356297.4	-	17	2362	c.2262G>T	c.(2260-2262)caG>caT	p.Q754H	PXDNL_ENST00000543296.1_Missense_Mutation_p.Q754H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	754					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.Q754H(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGTAGGCTGGCTGCAGCAGGC	0.751																																							uc003xqu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2260-2262)CAG>CAT		peroxidasin homolog-like precursor							7.0	8.0	8.0					8																	52321922		1785	3916	5701	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52321922C>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2262G>T	8.37:g.52321922C>A	ENSP00000348645:p.Gln754His		Somatic				PXDNL_uc003xqt.3_RNA	p.Q754H	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			17	2363	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	754					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.2262G>T	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.486905	0.44249	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69806	-0.43;-0.43	3.71	-4.4	0.03600	.	.	.	.	.	T	0.66327	0.2778	L	0.39245	1.2	0.20638	N	0.999873	P	0.49358	0.923	P	0.53450	0.726	T	0.65602	-0.6128	9	0.52906	T	0.07	.	14.3412	0.66627	0.0:0.795:0.0:0.205	.	754	A1KZ92	PXDNL_HUMAN	H	754	ENSP00000348645:Q754H;ENSP00000444865:Q754H	ENSP00000348645:Q754H	Q	-	3	2	PXDNL	52484475	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	-1.112000	0.03299	-1.395000	0.02074	-1.164000	0.01763	CAG		0.751	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		5	10	1	0	5.9392e-07	0.021553	6.51446e-07	5	10				
NSMAF	8439	broad.mit.edu	37	8	59512531	59512531	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:59512531C>T	ENST00000038176.3	-	17	1542	c.1330G>A	c.(1330-1332)Gag>Aag	p.E444K	NSMAF_ENST00000519858.1_5'Flank|NSMAF_ENST00000427130.2_Missense_Mutation_p.E475K	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	444	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)	p.E475K(1)|p.E444K(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				CTGCTTACCTCTTTAAAATCC	0.333																																							uc003xtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1330-1332)GAG>AAG		neutral sphingomyelinase (N-SMase) activation							123.0	121.0	122.0					8																	59512531		2202	4300	6502	SO:0001583	missense	8439				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity	g.chr8:59512531C>T	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1330G>A	8.37:g.59512531C>T	ENSP00000038176:p.Glu444Lys		Somatic				NSMAF_uc011lee.1_Missense_Mutation_p.E475K	p.E444K	NM_003580	NP_003571	WXS	Illumina HiSeq	Unspecified	Q92636	FAN_HUMAN			17	1544	-		all_lung(136;0.174)|Lung NSC(129;0.2)	444			BEACH.		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	c.1330G>A	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312644	0.95655	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	D;D	0.87256	-2.23;-2.23	6.17	6.17	0.99709	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.96393	0.8823	H	0.99156	4.45	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.97110	0.995;1.0	D	0.97205	0.9867	9	.	.	.	.	13.5813	0.61905	0.0:0.9262:0.0:0.0738	.	475;444	Q92636-2;Q92636	.;FAN_HUMAN	K	444;475	ENSP00000038176:E444K;ENSP00000411012:E475K	.	E	-	1	0	NSMAF	59675085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.926000	0.70070	2.941000	0.99782	0.655000	0.94253	GAG		0.333	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580		9	66	0	0	0	0.008291	0	9	66				
LACTB2	51110	broad.mit.edu	37	8	71556453	71556453	+	Missense_Mutation	SNP	C	C	T	rs561918644	byFrequency	TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:71556453C>T	ENST00000276590.4	-	4	475	c.439G>A	c.(439-441)Gat>Aat	p.D147N	LACTB2_ENST00000522447.1_Missense_Mutation_p.D147N|LACTB2_ENST00000517601.1_5'UTR|RP11-382J12.1_ENST00000518553.1_Intron|RP11-382J12.1_ENST00000499227.2_Intron	NM_016027.2	NP_057111.1	Q53H82	LACB2_HUMAN	lactamase, beta 2	147						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.D147N(1)		endometrium(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|prostate(1)	10	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			ATGTGATCATCAGTGTGGCCA	0.363																																							uc011lfd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(439-441)GAT>AAT		lactamase, beta 2							155.0	162.0	160.0					8																	71556453		2203	4300	6503	SO:0001583	missense	51110						hydrolase activity|metal ion binding	g.chr8:71556453C>T	AF151841	CCDS6208.1	8q13.3	2005-10-14			ENSG00000147592	ENSG00000147592			18512	protein-coding gene	gene with protein product							Standard	NM_016027		Approved	CGI-83	uc003xyp.3	Q53H82	OTTHUMG00000164430	ENST00000276590.4:c.439G>A	8.37:g.71556453C>T	ENSP00000276590:p.Asp147Asn		Somatic				LACTB2_uc003xyp.2_Missense_Mutation_p.D147N	p.D147N	NM_016027	NP_057111	WXS	Illumina HiSeq	Unspecified	Q53H82	LACB2_HUMAN	Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)		4	531	-	Breast(64;0.0716)		147					A8K2D6|Q9Y392	Missense_Mutation	SNP	ENST00000276590.4	37	c.439G>A	CCDS6208.1	.	.	.	.	.	.	.	.	.	.	C	33	5.205679	0.95033	.	.	ENSG00000147592	ENST00000522447;ENST00000276590	T;T	0.79454	-1.27;-1.27	6.17	6.17	0.99709	Beta-lactamase-like (2);	0.098604	0.64402	D	0.000001	D	0.83843	0.5342	L	0.58810	1.83	0.58432	D	0.999999	D	0.67145	0.996	P	0.59546	0.859	T	0.78193	-0.2299	10	0.18710	T	0.47	-22.1694	19.0599	0.93085	0.0:1.0:0.0:0.0	.	147	Q53H82	LACB2_HUMAN	N	147	ENSP00000428801:D147N;ENSP00000276590:D147N	ENSP00000276590:D147N	D	-	1	0	LACTB2	71719007	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.543000	0.82106	2.941000	0.99782	0.655000	0.94253	GAT		0.363	LACTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378748.1	NM_016027		55	260	0	0	0	0.01441	0	55	260				
DCAF4L2	138009	broad.mit.edu	37	8	88886265	88886265	+	De_novo_Start_OutOfFrame	SNP	T	T	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:88886265T>A	ENST00000319675.3	-	0	31					NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2											breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GAAGTACCGCTTCTTTACAAG	0.582																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(-67--63)GAAGC>GATGC		WD repeat domain 21C																																						138009							g.chr8:88886265T>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.-66A>T	8.37:g.88886265T>A			Somatic						NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	32	-									Translation_Start_Site	SNP	ENST00000319675.3	37	c.-65A>T	CCDS6245.1																																																																																				0.582	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		8	7	0	0	0	0.00308	0	8	7				
SLC26A7	115111	broad.mit.edu	37	8	92378836	92378836	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:92378836C>T	ENST00000276609.3	+	14	1756	c.1517C>T	c.(1516-1518)tCa>tTa	p.S506L	SLC26A7_ENST00000523719.1_Missense_Mutation_p.S506L|SLC26A7_ENST00000309536.2_Missense_Mutation_p.S506L|SLC26A7_ENST00000520249.1_3'UTR	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.S506L(2)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			AAAATTATCTCAATAAACAAC	0.328																																							uc003yex.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1516-1518)TCA>TTA		solute carrier family 26, member 7 isoform a							45.0	49.0	48.0					8																	92378836		2203	4300	6503	SO:0001583	missense	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92378836C>T	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1517C>T	8.37:g.92378836C>T	ENSP00000276609:p.Ser506Leu		Somatic				SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.S506L|SLC26A7_uc003yfa.2_Missense_Mutation_p.S506L	p.S506L	NM_052832	NP_439897	WXS	Illumina HiSeq	Unspecified	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		15	1795	+			506			STAS.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000276609.3	37	c.1517C>T	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032008	0.75504	.	.	ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536	D;D;D	0.88277	-2.36;-2.36;-2.36	5.33	4.46	0.54185	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.127961	0.34676	N	0.003776	D	0.90466	0.7014	M	0.67953	2.075	0.29878	N	0.826242	P;P	0.46859	0.86;0.885	P;P	0.51324	0.536;0.666	D	0.87981	0.2743	10	0.72032	D	0.01	.	11.2839	0.49210	0.0:0.9138:0.0:0.0862	.	506;506	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	L	506	ENSP00000428849:S506L;ENSP00000276609:S506L;ENSP00000309504:S506L	ENSP00000276609:S506L	S	+	2	0	SLC26A7	92448012	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.888000	0.48594	1.263000	0.44181	0.655000	0.94253	TCA		0.328	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			13	51	0	0	0	0.016723	0	13	51				
RIMS2	9699	broad.mit.edu	37	8	104709462	104709462	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:104709462T>C	ENST00000406091.3	+	2	325	c.325T>C	c.(325-327)Tca>Cca	p.S109P		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	140	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S109P(1)|p.S145P(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCATAACTGTTCATATTGCCA	0.438										HNSCC(12;0.0054)																													uc003ylp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(325-327)TCA>CCA		regulating synaptic membrane exocytosis 2							197.0	195.0	196.0					8																	104709462		1982	4174	6156	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104709462T>C	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.325T>C	8.37:g.104709462T>C	ENSP00000384892:p.Ser109Pro	HNSCC(12;0.0054)	Somatic					p.S109P	NM_001100117	NP_001093587	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	464	+			140			FYVE-type.|RabBD.		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000406091.3	37	c.325T>C	CCDS55269.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.864582	0.91511	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.38887	1.11;1.11	5.61	5.61	0.85477	.	.	.	.	.	T	0.60625	0.2283	M	0.64170	1.965	0.80722	D	1	D	0.76494	0.999	D	0.64776	0.929	T	0.63070	-0.6719	9	0.59425	D	0.04	.	15.81	0.78552	0.0:0.0:0.0:1.0	.	109	F8WD47	.	P	109;140;109;140	ENSP00000427018:S109P;ENSP00000384892:S109P	ENSP00000332184:S140P	S	+	1	0	RIMS2	104778638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.123000	0.65237	0.459000	0.35465	TCA		0.438	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117		3	132	0	0	0	0.009096	0	3	132				
CSMD3	114788	broad.mit.edu	37	8	113316974	113316974	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:113316974T>C	ENST00000297405.5	-	52	8486	c.8242A>G	c.(8242-8244)Aga>Gga	p.R2748G	CSMD3_ENST00000352409.3_Missense_Mutation_p.R2678G|CSMD3_ENST00000343508.3_Missense_Mutation_p.R2708G|CSMD3_ENST00000455883.2_Intron	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2748	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2748G(1)|p.R2708G(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTTCATTTCTCCAACTCCAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8242-8244)AGA>GGA		CUB and Sushi multiple domains 3 isoform 1							135.0	120.0	125.0					8																	113316974		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113316974T>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8242A>G	8.37:g.113316974T>C	ENSP00000297405:p.Arg2748Gly	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.R1950G|CSMD3_uc003ynt.2_Missense_Mutation_p.R2708G|CSMD3_uc011lhx.1_Intron	p.R2748G	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			52	8401	-			2748			Extracellular (Potential).|Sushi 16.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.8242A>G	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	9.296	1.051919	0.19827	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.04	3.86	0.44501	Complement control module (2);Sushi/SCR/CCP (3);	0.071147	0.53938	D	0.000044	T	0.20659	0.0497	N	0.11560	0.145	0.51012	D	0.999903	P;B	0.50066	0.931;0.0	P;B	0.52454	0.699;0.001	T	0.03175	-1.1064	10	0.20046	T	0.44	.	12.1663	0.54131	0.0:0.0:0.1433:0.8567	.	2748;2708	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	G	2708;2748;2018;2678	ENSP00000345799:R2708G;ENSP00000297405:R2748G;ENSP00000341558:R2018G;ENSP00000343124:R2678G	ENSP00000297405:R2748G	R	-	1	2	CSMD3	113386150	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.222000	0.72249	0.821000	0.34540	-0.313000	0.08912	AGA		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		4	65	0	0	0	0.021553	0	4	65				
TRPS1	7227	broad.mit.edu	37	8	116599829	116599829	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:116599829C>T	ENST00000220888.5	-	4	2219	c.2060G>A	c.(2059-2061)aGa>aAa	p.R687K	TRPS1_ENST00000520276.1_Missense_Mutation_p.R691K|TRPS1_ENST00000519674.1_Missense_Mutation_p.R687K|TRPS1_ENST00000519076.1_Missense_Mutation_p.R441K|TRPS1_ENST00000395715.3_Missense_Mutation_p.R700K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	687	Mediates interaction with GLI3.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R700K(1)|p.R687K(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GCTGTGTGCTCTCCTGGAGAA	0.448									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(2059-2061)AGA>AAA		zinc finger transcription factor TRPS1							99.0	98.0	98.0					8																	116599829		1936	4126	6062	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116599829C>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2060G>A	8.37:g.116599829C>T	ENSP00000220888:p.Arg687Lys		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.R691K|TRPS1_uc003yny.2_Missense_Mutation_p.R700K|TRPS1_uc010mcy.2_Missense_Mutation_p.R687K	p.R687K	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		4	2519	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		687			Mediates interaction with GLI3.|C2H2-type 4.		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.2060G>A		.	.	.	.	.	.	.	.	.	.	C	32	5.178656	0.94846	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	L	0.36672	1.1	0.50813	D	0.999897	D;D;D	0.71674	0.998;0.996;0.998	P;P;P	0.60473	0.875;0.754;0.875	T	0.00299	-1.1836	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	691;687;700	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	K	700;687;441;691;687	ENSP00000379065:R700K;ENSP00000220888:R687K;ENSP00000428910:R441K;ENSP00000428680:R691K;ENSP00000429174:R687K	ENSP00000220888:R687K	R	-	2	0	TRPS1	116669004	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.180000	0.71981	2.885000	0.99019	0.655000	0.94253	AGA		0.448	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		36	99	0	0	0	0.027894	0	36	99				
OC90	729330	broad.mit.edu	37	8	133062114	133062114	+	Intron	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:133062114C>A	ENST00000443356.2	-	3	133				OC90_ENST00000254627.3_Intron|OC90_ENST00000603859.1_Intron|OC90_ENST00000262283.5_Intron			Q02509	OC90_HUMAN	otoconin 90						lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.M1I(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CTTCAGCTGCCATCTTTGGAC	0.418																																							uc003ytg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1-3)ATG>ATT		otoconin 90							133.0	125.0	127.0					8																	133062114		1945	4154	6099	SO:0001627	intron_variant	729330				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity	g.chr8:133062114C>A	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.47-3984G>T	8.37:g.133062114C>A			Somatic				OC90_uc011lix.1_Intron	p.M1I	NM_001080399	NP_001073868	WXS	Illumina HiSeq	Unspecified	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)		1	3	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		Error:Variant_position_missing_in_Q02509_after_alignment					B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37	c.3G>T																																																																																					0.418	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		29	60	1	0	7.01153e-11	0.007291	8.02687e-11	29	60				
KHDRBS3	10656	broad.mit.edu	37	8	136554916	136554916	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr8:136554916T>G	ENST00000355849.5	+	3	637	c.227T>G	c.(226-228)cTt>cGt	p.L76R	KHDRBS3_ENST00000520981.1_Intron	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	76	KH.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L77fs*49(1)|p.L76R(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			GTGGGGAAACTTTTGGGTCCA	0.373																																							uc003yuv.2		NA																	2	Substitution - Missense(1)|Insertion - Frameshift(1)		large_intestine(1)|lung(1)	ovary(2)	2						c.(226-228)CTT>CGT		KH domain containing, RNA binding, signal							143.0	148.0	146.0					8																	136554916		2203	4300	6503	SO:0001583	missense	10656				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding	g.chr8:136554916T>G	AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.227T>G	8.37:g.136554916T>G	ENSP00000348108:p.Leu76Arg		Somatic				KHDRBS3_uc003yuw.2_Missense_Mutation_p.L76R	p.L76R	NM_006558	NP_006549	WXS	Illumina HiSeq	Unspecified	O75525	KHDR3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.247)		3	621	+	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		76			KH.		Q6NUL8|Q9UPA8	Missense_Mutation	SNP	ENST00000355849.5	37	c.227T>G	CCDS6374.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.229503	0.79688	.	.	ENSG00000131773	ENST00000355849;ENST00000524199;ENST00000517394	T;T;T	0.54479	0.57;0.57;0.57	5.61	5.61	0.85477	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.78717	0.4327	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.991;0.993	D	0.84325	0.0518	10	0.87932	D	0	-12.7277	14.9802	0.71306	0.0:0.0:0.0:1.0	.	76;76	O75525-2;O75525	.;KHDR3_HUMAN	R	76;48;49	ENSP00000348108:L76R;ENSP00000431022:L48R;ENSP00000430284:L49R	ENSP00000348108:L76R	L	+	2	0	KHDRBS3	136624098	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.279000	0.72620	2.142000	0.66516	0.533000	0.62120	CTT		0.373	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377529.1			10	103	0	0	0	0.008291	0	10	103				
CNTLN	54875	broad.mit.edu	37	9	17409351	17409351	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:17409351G>C	ENST00000380647.3	+	16	2760	c.2676G>C	c.(2674-2676)caG>caC	p.Q892H	CNTLN_ENST00000425824.1_Missense_Mutation_p.Q892H|CNTLN_ENST00000262360.5_Missense_Mutation_p.Q892H			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	892					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.Q892H(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AAACATCCCAGAAAATAAGTC	0.343																																							uc003zmz.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2671-2673)CAG>CAC		centlein isoform 1							105.0	103.0	104.0					9																	17409351		1812	4076	5888	SO:0001583	missense	54875					centriole|membrane	two-component sensor activity	g.chr9:17409351G>C	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2676G>C	9.37:g.17409351G>C	ENSP00000370021:p.Gln892His		Somatic				CNTLN_uc003zmy.2_Missense_Mutation_p.Q892H|CNTLN_uc010mio.2_Missense_Mutation_p.Q571H	p.Q891H	NM_017738	NP_060208	WXS	Illumina HiSeq	Unspecified	Q9NXG0	CNTLN_HUMAN		GBM - Glioblastoma multiforme(50;6.14e-10)	16	2699	+			892					A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	c.2673G>C	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230251	0.58777	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.18810	2.19;2.19;2.45	5.41	3.45	0.39498	.	.	.	.	.	T	0.37732	0.1014	M	0.63428	1.95	0.29109	N	0.880976	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.69479	0.964;0.958;0.958	T	0.15954	-1.0419	9	0.62326	D	0.03	.	6.5418	0.22385	0.2137:0.0:0.7863:0.0	.	892;892;892	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	H	892	ENSP00000370021:Q892H;ENSP00000392798:Q892H;ENSP00000262360:Q892H	ENSP00000262360:Q892H	Q	+	3	2	CNTLN	17399351	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.352000	0.34033	1.516000	0.48900	0.591000	0.81541	CAG		0.343	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738		55	65	0	0	0	0.01441	0	55	65				
CHMP5	51510	broad.mit.edu	37	9	33264328	33264328	+	5'Flank	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:33264328C>T	ENST00000223500.8	+	0	0				BAG1_ENST00000379704.2_5'UTR|BAG1_ENST00000472232.3_Silent_p.E115E|CHMP5_ENST00000419016.2_5'Flank	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E115E(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			TCCGATTCATCTCTTCGCCCT	0.647																																						GBM(77;1066 1502 5858 12192)	uc003zsj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(343-345)GAG>GAA		BCL2-associated athanogene isoform 1L							72.0	60.0	64.0					9																	33264328		2203	4300	6503	SO:0001631	upstream_gene_variant	573				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|chaperone cofactor-dependent protein refolding	cytoplasm|intermediate filament cytoskeleton|nucleus	protein binding|receptor signaling protein activity	g.chr9:33264328C>T	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264328C>T	Exception_encountered		Somatic				SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Intron|BAG1_uc003zsk.2_5'UTR|CHMP5_uc003zsl.3_5'UTR|CHMP5_uc003zsm.3_5'Flank|CHMP5_uc011lnv.1_5'Flank	p.E115E	NM_004323	NP_004314	WXS	Illumina HiSeq	Unspecified	Q99933	BAG1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00506)		1	434	-			115			7 X 6 AA tandem repeat of E-E-X(4).|4.		B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Silent	SNP	ENST00000223500.8	37	c.345G>A	CCDS6537.1																																																																																				0.647	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410		26	16	0	0	0	0.024334	0	26	16				
PTCH1	5727	broad.mit.edu	37	9	98242859	98242859	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:98242859G>A	ENST00000331920.6	-	6	1057	c.758C>T	c.(757-759)cCt>cTt	p.P253L	PTCH1_ENST00000375274.2_Missense_Mutation_p.P252L|PTCH1_ENST00000430669.2_Missense_Mutation_p.P187L|PTCH1_ENST00000548379.1_5'UTR|PTCH1_ENST00000437951.1_Missense_Mutation_p.P187L|PTCH1_ENST00000418258.1_Missense_Mutation_p.P102L|PTCH1_ENST00000421141.1_Missense_Mutation_p.P102L|PTCH1_ENST00000429896.2_Missense_Mutation_p.P102L	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	253					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.P252L(2)|p.P253L(2)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCACCGCAAAGGAGGTTTACC	0.458																																							uc004avk.3		NA																	4	Substitution - Missense(4)		lung(4)	skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(757-759)CCT>CTT		patched isoform L							72.0	72.0	72.0					9																	98242859		2203	4300	6503	SO:0001583	missense	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98242859G>A	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.758C>T	9.37:g.98242859G>A	ENSP00000332353:p.Pro253Leu		Somatic				PTCH1_uc010mro.2_Missense_Mutation_p.P102L|PTCH1_uc010mrp.2_Missense_Mutation_p.P102L|PTCH1_uc010mrq.2_Missense_Mutation_p.P102L|PTCH1_uc004avl.3_Missense_Mutation_p.P102L|PTCH1_uc010mrr.2_Missense_Mutation_p.P187L|PTCH1_uc004avm.3_Missense_Mutation_p.P252L|PTCH1_uc010mrs.1_5'UTR|PTCH1_uc010mrt.1_RNA|PTCH1_uc010mru.1_RNA	p.P253L	NM_000264	NP_000255	WXS	Illumina HiSeq	Unspecified	Q13635	PTC1_HUMAN			6	946	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	253			Extracellular (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	c.758C>T	CCDS6714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.175|8.175	0.792496|0.792496	0.16258|0.16258	.|.	.|.	ENSG00000185920|ENSG00000185920	ENST00000544247|ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000553011;ENST00000551845;ENST00000547672;ENST00000546820	.|D;D;D;D;D;D;D;D;D;D;D	.|0.90004	.|-2.59;-2.58;-2.57;-2.57;-2.58;-2.57;-2.6;-2.01;-2.01;-2.01;-2.01	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.255477	.|0.46442	.|D	.|0.000283	T|T	0.80613|0.80613	0.4656|0.4656	L|L	0.31664|0.31664	0.95|0.95	0.52099|0.52099	D|D	0.999942|0.999942	.|B;B;B	.|0.11235	.|0.002;0.004;0.001	.|B;B;B	.|0.12156	.|0.007;0.007;0.003	T|T	0.72293|0.72293	-0.4336|-0.4336	6|10	0.13108|0.16420	T|T	0.6|0.52	-16.1611|-16.1611	9.2242|9.2242	0.37395|0.37395	0.0719:0.0:0.7818:0.1463|0.0719:0.0:0.7818:0.1463	.|.	.|187;252;253	.|Q13635-3;Q13635-2;Q13635	.|.;.;PTC1_HUMAN	F|L	70|253;187;102;102;187;102;252;102;102;102;102	.|ENSP00000332353:P253L;ENSP00000389744:P187L;ENSP00000399981:P102L;ENSP00000396135:P102L;ENSP00000410287:P187L;ENSP00000414823:P102L;ENSP00000364423:P252L;ENSP00000447797:P102L;ENSP00000447008:P102L;ENSP00000447878:P102L;ENSP00000448843:P102L	ENSP00000439213:L70F|ENSP00000332353:P253L	L|P	-|-	1|2	0|0	PTCH1|PTCH1	97282680|97282680	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.010000|3.010000	0.49559|0.49559	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	CTT|CCT		0.458	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		8	44	0	0	0	0.004482	0	8	44				
ERCC6L2	375748	broad.mit.edu	37	9	98774545	98774545	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:98774545C>G	ENST00000407474.3	+	4	1169	c.656C>G	c.(655-657)tCt>tGt	p.S219C				Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	1249	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)	p.S219C(1)									TTTAACTCGTCTTCTGTAAAC	0.299																																							uc010msa.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(655-657)TCT>TGT		RecName: Full=Uncharacterized protein C9orf102;							43.0	44.0	44.0					9																	98774545		2202	4297	6499	SO:0001583	missense	0							g.chr9:98774545C>G	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000407474.3:c.656C>G	9.37:g.98774545C>G	ENSP00000384365:p.Ser219Cys		Somatic				uc011lun.1_Intron	p.S219C			WXS	Illumina HiSeq	Unspecified					4	1532	+								A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	ENST00000407474.3	37	c.656C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.12|14.12	2.441974|2.441974	0.43326|0.43326	.|.	.|.	ENSG00000182150|ENSG00000182150	ENST00000320486|ENST00000407474	.|.	.|.	.|.	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	.|0.312135	.|0.23377	.|N	.|0.048859	T|T	0.53738|0.53738	0.1815|0.1815	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999995|0.999995	.|D	.|0.67145	.|0.996	.|P	.|0.59288	.|0.855	T|T	0.47824|0.47824	-0.9087|-0.9087	4|8	.|0.56958	.|D	.|0.05	.|.	10.2617|10.2617	0.43430|0.43430	0.1404:0.705:0.1546:0.0|0.1404:0.705:0.1546:0.0	.|.	.|219	.|A4D997	.|CI102_HUMAN	V|C	210|219	.|.	.|ENSP00000384365:S219C	L|S	+|+	1|2	0|0	C9orf102|C9orf102	97814366|97814366	0.034000|0.034000	0.19679|0.19679	0.715000|0.715000	0.30552|0.30552	0.977000|0.977000	0.68977|0.68977	0.488000|0.488000	0.22371|0.22371	2.553000|2.553000	0.86117|0.86117	0.650000|0.650000	0.86243|0.86243	CTT|TCT		0.299	ERCC6L2-201	KNOWN	basic	protein_coding	protein_coding		NM_001010895		3	19	0	0	0	0.004672	0	3	19				
CYLC2	1539	broad.mit.edu	37	9	105767260	105767260	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:105767260A>C	ENST00000374798.3	+	5	417	c.347A>C	c.(346-348)aAg>aCg	p.K116T	CYLC2_ENST00000487798.1_Missense_Mutation_p.K116T	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	116	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.K116T(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				GAAATTGGTAAGAAAGGTGAA	0.294																																							uc004bbs.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(346-348)AAG>ACG		cylicin 2							49.0	50.0	50.0					9																	105767260		2200	4295	6495	SO:0001583	missense	1539				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:105767260A>C	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.347A>C	9.37:g.105767260A>C	ENSP00000420256:p.Lys116Thr		Somatic					p.K116T	NM_001340	NP_001331	WXS	Illumina HiSeq	Unspecified	Q14093	CYLC2_HUMAN			5	417	+		all_hematologic(171;0.125)	116			31 X 3 AA repeats of K-K-X.		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	ENST00000374798.3	37	c.347A>C	CCDS35085.1	.	.	.	.	.	.	.	.	.	.	A	9.721	1.159798	0.21454	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.16897	2.31;2.31	3.98	2.81	0.32909	.	0.491983	0.17136	N	0.185636	T	0.23965	0.0580	L	0.31926	0.97	0.09310	N	1	D	0.67145	0.996	P	0.62740	0.906	T	0.03651	-1.1016	10	0.52906	T	0.07	0.5498	7.5555	0.27822	0.7818:0.2182:0.0:0.0	.	116	Q14093	CYLC2_HUMAN	T	116	ENSP00000420256:K116T;ENSP00000417674:K116T	ENSP00000420256:K116T	K	+	2	0	CYLC2	104807081	0.009000	0.17119	0.003000	0.11579	0.016000	0.09150	2.144000	0.42197	0.669000	0.31146	0.383000	0.25322	AAG		0.294	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340		5	54	0	0	0	0.00308	0	5	54				
PAPPA	5069	broad.mit.edu	37	9	118949434	118949434	+	Splice_Site	SNP	G	G	A	rs138083509		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:118949434G>A	ENST00000328252.3	+	2	786	c.417G>A	c.(415-417)ggG>ggA	p.G139G	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	139					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G139G(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GCCACATAGGGCTGTATGACA	0.408																																							uc004bjn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(4)|pancreas(1)	9						c.(415-417)GGG>GGA		pregnancy-associated plasma protein A		G		0,4406		0,0,2203	49.0	51.0	50.0		417	4.9	1.0	9	dbSNP_134	50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice	PAPPA	NM_002581.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		139/1628	118949434	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:118949434G>A		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.416-1G>A	9.37:g.118949434G>A			Somatic				PAPPA_uc011lxp.1_5'UTR|PAPPA_uc011lxq.1_5'UTR	p.G139G	NM_002581	NP_002572	WXS	Illumina HiSeq	Unspecified	Q13219	PAPP1_HUMAN			2	798	+			139					B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	c.417G>A	CCDS6813.1																																																																																				0.408	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	Silent	10	60	0	0	0	0.010729	0	10	60				
TLR4	7099	broad.mit.edu	37	9	120476246	120476246	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:120476246G>A	ENST00000355622.6	+	3	1941	c.1840G>A	c.(1840-1842)Gat>Aat	p.D614N	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.D574N	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	614	LRRCT.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.D614N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AACACCTTCAGATAAGCAGGG	0.463																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(1840-1842)GAT>AAT		toll-like receptor 4 precursor							163.0	138.0	146.0					9																	120476246		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476246G>A	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1840G>A	9.37:g.120476246G>A	ENSP00000363089:p.Asp614Asn		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.D574N|TLR4_uc004bkb.2_Missense_Mutation_p.D414N	p.D614N	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	2131	+			614			LRRCT.|Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.1840G>A	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	3.078	-0.189617	0.06299	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37752	1.47;1.18	6.02	-4.95	0.03048	Cysteine-rich flanking region, C-terminal (1);	1.358930	0.04392	N	0.362609	T	0.23330	0.0564	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15093	-1.0449	10	0.19147	T	0.46	.	0.6499	0.00824	0.2436:0.2419:0.2799:0.2346	.	614	O00206	TLR4_HUMAN	N	574;614	ENSP00000377997:D574N;ENSP00000363089:D614N	ENSP00000363089:D614N	D	+	1	0	TLR4	119516067	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.545000	0.06069	-0.703000	0.05049	-0.143000	0.13931	GAT		0.463	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		12	28	0	0	0	0.010729	0	12	28				
TLR4	7099	broad.mit.edu	37	9	120476748	120476748	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:120476748A>G	ENST00000355622.6	+	3	2443	c.2342A>G	c.(2341-2343)cAg>cGg	p.Q781R	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.Q741R	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	781	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.Q781R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CTGCTCAGGCAGCAGGTGGAG	0.537																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2341-2343)CAG>CGG		toll-like receptor 4 precursor							67.0	66.0	66.0					9																	120476748		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476748A>G	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2342A>G	9.37:g.120476748A>G	ENSP00000363089:p.Gln781Arg		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.Q741R|TLR4_uc004bkb.2_Missense_Mutation_p.Q581R	p.Q781R	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	2633	+			781			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.2342A>G	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	a	14.86	2.662628	0.47572	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.02345	4.33;4.33	5.91	3.6	0.41247	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.186121	0.38605	N	0.001636	T	0.02047	0.0064	N	0.02854	-0.475	0.25881	N	0.983591	P	0.36086	0.536	B	0.42798	0.398	T	0.47611	-0.9104	10	0.44086	T	0.13	.	10.0155	0.42011	0.8648:0.0:0.1352:0.0	.	781	O00206	TLR4_HUMAN	R	741;781	ENSP00000377997:Q741R;ENSP00000363089:Q781R	ENSP00000363089:Q781R	Q	+	2	0	TLR4	119516569	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	4.167000	0.58209	1.067000	0.40740	-0.253000	0.11424	CAG		0.537	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		7	60	0	0	0	0.001984	0	7	60				
OR5C1	392391	broad.mit.edu	37	9	125551304	125551304	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:125551304C>T	ENST00000373680.2	+	1	155	c.93C>T	c.(91-93)ctC>ctT	p.L31L		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L31L(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						GTGTGGCCCTCTTCCTGACCT	0.612																																							uc011lzd.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(91-93)CTC>CTT		olfactory receptor, family 5, subfamily C,							98.0	92.0	94.0					9																	125551304		2203	4300	6503	SO:0001819	synonymous_variant	392391				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125551304C>T	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.93C>T	9.37:g.125551304C>T			Somatic					p.L31L	NM_001001923	NP_001001923	WXS	Illumina HiSeq	Unspecified	Q8NGR4	OR5C1_HUMAN			1	93	+			31			Helical; Name=1; (Potential).		B2RN54|B9EGT0|Q96RC4	Silent	SNP	ENST00000373680.2	37	c.93C>T	CCDS35131.1																																																																																				0.612	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1			26	55	0	0	0	0.024334	0	26	55				
CDK9	1025	broad.mit.edu	37	9	130551617	130551617	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:130551617A>C	ENST00000373264.4	+	7	1014	c.914A>C	c.(913-915)gAc>gCc	p.D305A	CDK9_ENST00000373265.2_Missense_Mutation_p.D422A	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.D305A(1)		lung(1)	1						CAGCGCATCGACAGCGATGAC	0.607																																							uc004bse.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(913-915)GAC>GCC		cyclin-dependent kinase 9							163.0	98.0	120.0					9																	130551617		2203	4300	6503	SO:0001583	missense	1025				cell proliferation|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription elongation factor complex	ATP binding|cyclin-dependent protein kinase activity|DNA binding|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr9:130551617A>C	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.914A>C	9.37:g.130551617A>C	ENSP00000362361:p.Asp305Ala		Somatic					p.D305A	NM_001261	NP_001252	WXS	Illumina HiSeq	Unspecified	P50750	CDK9_HUMAN			7	1037	+			305			Protein kinase.		Q5JU24|Q5JU25|Q5U006|Q96TF1	Missense_Mutation	SNP	ENST00000373264.4	37	c.914A>C	CCDS6879.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619294	0.87460	.	.	ENSG00000136807	ENST00000373265;ENST00000373264	T;T	0.44482	0.92;0.92	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51227	0.1662	N	0.25426	0.745	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.54364	-0.8305	10	0.59425	D	0.04	-17.8204	14.9106	0.70755	1.0:0.0:0.0:0.0	.	305	P50750	CDK9_HUMAN	A	422;305	ENSP00000362362:D422A;ENSP00000362361:D305A	ENSP00000362361:D305A	D	+	2	0	CDK9	129591438	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	9.058000	0.93896	2.119000	0.64992	0.482000	0.46254	GAC		0.607	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1			6	26	0	0	0	0.001984	0	6	26				
CARD9	64170	broad.mit.edu	37	9	139265114	139265114	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr9:139265114C>T	ENST00000371732.5	-	5	832	c.667G>A	c.(667-669)Gac>Aac	p.D223N	CARD9_ENST00000315908.7_Missense_Mutation_p.D223N|CARD9_ENST00000371734.3_Missense_Mutation_p.D223N	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	223					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)	p.D223N(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		ACCTTGCAGTCGTCCTCGGCC	0.657																																							uc004chg.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|lung(1)|skin(1)	3						c.(667-669)GAC>AAC		caspase recruitment domain protein 9 isoform 1							87.0	67.0	74.0					9																	139265114		2202	4300	6502	SO:0001583	missense	64170				positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity	g.chr9:139265114C>T	AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.667G>A	9.37:g.139265114C>T	ENSP00000360797:p.Asp223Asn		Somatic				CARD9_uc011mdw.1_Missense_Mutation_p.D223N|CARD9_uc011mdx.1_Missense_Mutation_p.D119N|CARD9_uc010nbj.2_3'UTR	p.D223N	NM_052813	NP_434700	WXS	Illumina HiSeq	Unspecified	Q9H257	CARD9_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)	5	833	-		Myeloproliferative disorder(178;0.0511)	223			Potential.		Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	ENST00000371732.5	37	c.667G>A	CCDS6997.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.599004	0.66332	.	.	ENSG00000187796	ENST00000371734;ENST00000371732;ENST00000315908	T;T;T	0.32753	1.44;1.44;1.44	3.4	3.4	0.38934	.	0.154165	0.42420	D	0.000714	T	0.50701	0.1631	M	0.64997	1.995	0.49051	D	0.999741	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.984;0.989;0.974	T	0.54111	-0.8342	10	0.51188	T	0.08	-28.1032	14.3098	0.66407	0.0:1.0:0.0:0.0	.	119;223;223	B4DIK5;Q9H257-2;Q9H257	.;.;CARD9_HUMAN	N	223	ENSP00000360799:D223N;ENSP00000360797:D223N;ENSP00000323719:D223N	ENSP00000323719:D223N	D	-	1	0	CARD9	138384935	0.986000	0.35501	0.967000	0.41034	0.818000	0.46254	2.661000	0.46758	1.894000	0.54839	0.467000	0.42956	GAC		0.657	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055053.1	NM_052813		5	39	0	0	0	0.021553	0	5	39				
NLGN4X	57502	broad.mit.edu	37	X	5821683	5821683	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:5821683C>A	ENST00000381095.3	-	5	1663	c.1036G>T	c.(1036-1038)Ggc>Tgc	p.G346C	NLGN4X_ENST00000381092.1_Missense_Mutation_p.G346C|NLGN4X_ENST00000275857.6_Missense_Mutation_p.G346C|NLGN4X_ENST00000538097.1_Missense_Mutation_p.G346C|NLGN4X_ENST00000381093.2_Missense_Mutation_p.G366C	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	346					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.G346C(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						ATGACGTCGCCGTCGATCACC	0.582																																							uc010ndh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(1036-1038)GGC>TGC		X-linked neuroligin 4 precursor							148.0	102.0	118.0					X																	5821683		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821683C>A	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1036G>T	X.37:g.5821683C>A	ENSP00000370485:p.Gly346Cys		Somatic				NLGN4X_uc004crp.2_Missense_Mutation_p.G366C|NLGN4X_uc004crq.2_Missense_Mutation_p.G346C|NLGN4X_uc010ndi.2_Missense_Mutation_p.G383C|NLGN4X_uc004crr.2_Missense_Mutation_p.G346C|NLGN4X_uc010ndj.2_Missense_Mutation_p.G346C	p.G346C	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			5	1537	-			346			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.1036G>T	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313368	0.40996	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	D	0.89238	0.6658	H	0.97707	4.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93013	0.6433	8	.	.	.	.	14.4946	0.67678	0.0:1.0:0.0:0.0	.	403;346;366	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	C	346;366;346;346;346	ENSP00000370485:G346C;ENSP00000370483:G366C;ENSP00000275857:G346C;ENSP00000370482:G346C;ENSP00000439203:G346C	.	G	-	1	0	NLGN4X	5831683	1.000000	0.71417	0.096000	0.21009	0.005000	0.04900	6.722000	0.74735	1.579000	0.49836	0.600000	0.82982	GGC		0.582	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		37	19	1	0	1.00001e-27	0.009718	1.24333e-27	37	19				
GK	2710	broad.mit.edu	37	X	30739036	30739036	+	Silent	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:30739036C>T	ENST00000378943.3	+	17	1586	c.1407C>T	c.(1405-1407)gtC>gtT	p.V469V	RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000378946.3_Silent_p.V475V|GK-AS1_ENST00000464659.1_RNA|GK_ENST00000427190.1_Silent_p.V270V|GK_ENST00000378945.3_Silent_p.V469V	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	475					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)	p.V469V(1)		central_nervous_system(1)|large_intestine(3)	4						CAGAAGGAGTCGGCGTATGGA	0.522																																							uc004dch.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1423-1425)GTC>GTT		glycerol kinase isoform a							44.0	39.0	41.0					X																	30739036		2202	4300	6502	SO:0001819	synonymous_variant	2710				glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity	g.chrX:30739036C>T	X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.1407C>T	X.37:g.30739036C>T			Somatic				GK_uc010ngj.2_Silent_p.V469V|GK_uc004dci.3_Silent_p.V469V|GK_uc011mjz.1_Silent_p.V270V|GK_uc011mka.1_Silent_p.V312V|GK_uc010ngk.2_Silent_p.V264V	p.V475V	NM_203391	NP_976325	WXS	Illumina HiSeq	Unspecified	P32189	GLPK_HUMAN			18	1604	+			475					A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Silent	SNP	ENST00000378943.3	37	c.1425C>T	CCDS48090.1																																																																																				0.522	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056170.1	NM_000167		13	8	0	0	0	0.020292	0	13	8				
CCNB3	85417	broad.mit.edu	37	X	50053789	50053789	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:50053789T>G	ENST00000376042.1	+	6	2918	c.2620T>G	c.(2620-2622)Ttt>Gtt	p.F874V	CCNB3_ENST00000276014.7_Missense_Mutation_p.F874V|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	874					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.F874V(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					GGAGGCCCTCTTTAAGCGACA	0.512																																							uc004dox.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9						c.(2620-2622)TTT>GTT		cyclin B3 isoform 3							49.0	43.0	45.0					X																	50053789		2203	4300	6503	SO:0001583	missense	85417				cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding	g.chrX:50053789T>G	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2620T>G	X.37:g.50053789T>G	ENSP00000365210:p.Phe874Val		Somatic				CCNB3_uc004doy.2_Missense_Mutation_p.F874V|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	p.F874V	NM_033031	NP_149020	WXS	Illumina HiSeq	Unspecified	Q8WWL7	CCNB3_HUMAN			6	2918	+	Ovarian(276;0.236)		874					B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	c.2620T>G	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	T	6.529	0.465870	0.12402	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.34472	1.36;1.36	3.43	-5.21	0.02815	.	8.516620	0.00166	N	0.000000	T	0.22044	0.0531	N	0.24115	0.695	0.09310	N	1	B	0.17268	0.021	B	0.12837	0.008	T	0.10291	-1.0636	9	.	.	.	.	6.1994	0.20567	0.1447:0.1999:0.0:0.6554	.	874	Q8WWL7	CCNB3_HUMAN	V	874	ENSP00000365210:F874V;ENSP00000276014:F874V	.	F	+	1	0	CCNB3	50070529	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.230000	0.00548	-1.588000	0.01627	-0.395000	0.06472	TTT		0.512	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			17	28	0	0	0	0.006122	0	17	28				
KDM5C	8242	broad.mit.edu	37	X	53223699	53223699	+	Silent	SNP	G	G	C	rs373545419		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:53223699G>C	ENST00000375401.3	-	23	4192	c.3660C>G	c.(3658-3660)ctC>ctG	p.L1220L	KDM5C_ENST00000375379.3_Silent_p.L1220L|KDM5C_ENST00000452825.3_Silent_p.L1153L|KDM5C_ENST00000375383.3_Silent_p.L1179L|KDM5C_ENST00000404049.3_Silent_p.L1219L	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1220					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.L1153L(1)|p.L1220L(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCGGAGAGCTGAGGAGGCGAG	0.632			"""N, F, S"""		clear cell renal carcinoma																																		uc004drz.2		NA		Rec	yes		X	Xp11.22-p11.21	8242	N|F|S	lysine (K)-specific demethylase 5C (JARID1C)			E			clear cell renal carcinoma		2	Substitution - coding silent(2)		lung(2)	kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						c.(3658-3660)CTC>CTG		jumonji, AT rich interactive domain 1C isoform							142.0	81.0	101.0					X																	53223699		2202	4298	6500	SO:0001819	synonymous_variant	8242				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrX:53223699G>C	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3660C>G	X.37:g.53223699G>C			Somatic				KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Silent_p.L1153L|KDM5C_uc004dsa.2_Silent_p.L1219L|uc004dsb.1_RNA	p.L1220L	NM_004187	NP_004178	WXS	Illumina HiSeq	Unspecified	P41229	KDM5C_HUMAN			23	4193	-			1220			PHD-type 2.		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	ENST00000375401.3	37	c.3660C>G	CCDS14351.1																																																																																				0.632	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		5	5	0	0	0	0.021553	0	5	5				
TRO	7216	broad.mit.edu	37	X	54949381	54949381	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:54949381C>T	ENST00000173898.7	+	3	528	c.416C>T	c.(415-417)gCc>gTc	p.A139V	TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Intron|TRO_ENST00000484031.1_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000319167.8_Missense_Mutation_p.A139V|TRO_ENST00000375022.4_Missense_Mutation_p.A139V	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	139					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A139V(2)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCTAAGAAAGCCAACAAGATG	0.517																																							uc004dtq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(415-417)GCC>GTC		trophinin isoform 5							50.0	47.0	48.0					X																	54949381		2004	4166	6170	SO:0001583	missense	7216				embryo implantation|homophilic cell adhesion	integral to plasma membrane		g.chrX:54949381C>T	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.416C>T	X.37:g.54949381C>T	ENSP00000173898:p.Ala139Val		Somatic				TRO_uc011moj.1_Missense_Mutation_p.A82V|TRO_uc004dts.2_Missense_Mutation_p.A139V|TRO_uc004dtr.2_Missense_Mutation_p.A139V|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	p.A139V	NM_001039705	NP_001034794	WXS	Illumina HiSeq	Unspecified	Q12816	TROP_HUMAN			3	523	+			139					B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	c.416C>T	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.414009	0.25465	.	.	ENSG00000067445	ENST00000411534;ENST00000430420;ENST00000442098;ENST00000173898;ENST00000319167;ENST00000375022;ENST00000440759;ENST00000449980;ENST00000416704;ENST00000427099	T;T;T;T;T;T;T;T;T;T	0.60040	0.22;0.22;0.46;3.32;3.17;3.17;0.46;0.33;0.46;0.33	3.23	0.447	0.16608	.	.	.	.	.	T	0.38904	0.1058	N	0.24115	0.695	0.09310	N	1	B;B	0.18461	0.01;0.028	B;B	0.11329	0.004;0.006	T	0.30995	-0.9959	9	0.87932	D	0	.	5.1727	0.15118	0.0:0.5565:0.0:0.4435	.	139;139	Q96SX2;Q12816	.;TROP_HUMAN	V	95;95;139;139;139;139;139;95;139;95	ENSP00000388947:A95V;ENSP00000411717:A95V;ENSP00000404645:A139V;ENSP00000173898:A139V;ENSP00000318278:A139V;ENSP00000364162:A139V;ENSP00000406574:A139V;ENSP00000392841:A95V;ENSP00000404767:A139V;ENSP00000405311:A95V	ENSP00000173898:A139V	A	+	2	0	TRO	54966106	1.000000	0.71417	0.002000	0.10522	0.260000	0.26232	2.294000	0.43567	-0.032000	0.13758	0.429000	0.28392	GCC		0.517	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		17	13	0	0	0	0.006122	0	17	13				
AR	367	broad.mit.edu	37	X	66863122	66863122	+	Silent	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:66863122T>G	ENST00000374690.3	+	2	2165	c.1641T>G	c.(1639-1641)gtT>gtG	p.V547V	AR_ENST00000504326.1_Silent_p.V547V|AR_ENST00000396044.3_Silent_p.V547V|AR_ENST00000513847.1_3'UTR|AR_ENST00000396043.2_Silent_p.V15V	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	546	Modulating.		L -> F (in PAIS).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V357V(1)|p.V547V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GGGACCATGTTTTGCCCATTG	0.473									Androgen Insensitivity Syndrome																														uc004dwu.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8						c.(1639-1641)GTT>GTG		androgen receptor isoform 1	Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)						175.0	144.0	155.0					X																	66863122		2203	4300	6503	SO:0001819	synonymous_variant	367	Androgen_Insensitivity_Syndrome	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chrX:66863122T>G	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1641T>G	X.37:g.66863122T>G			Somatic				AR_uc011mpd.1_Silent_p.V547V|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Silent_p.V547V|AR_uc004dwv.1_Silent_p.V15V	p.V547V	NM_000044	NP_000035	WXS	Illumina HiSeq	Unspecified	P10275	ANDR_HUMAN			2	2756	+	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)	546			Modulating.		A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	37	c.1641T>G	CCDS14387.1																																																																																				0.473	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044		12	67	0	0	0	0.020292	0	12	67				
COL4A5	1287	broad.mit.edu	37	X	107840675	107840675	+	Silent	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:107840675T>G	ENST00000361603.2	+	24	1900	c.1656T>G	c.(1654-1656)acT>acG	p.T552T	COL4A5_ENST00000328300.6_Silent_p.T552T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	552	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.T552T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATATCCTCACTTTTCCAGGAA	0.512									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1654-1656)ACT>ACG		type IV collagen alpha 5 isoform 2 precursor							80.0	79.0	80.0					X																	107840675		2203	4300	6503	SO:0001819	synonymous_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107840675T>G	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1656T>G	X.37:g.107840675T>G			Somatic				COL4A5_uc011mso.1_Silent_p.T552T|COL4A5_uc004eob.1_Silent_p.T160T	p.T552T	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			24	1858	+			552			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	c.1656T>G	CCDS14543.1																																																																																				0.512	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			17	52	0	0	0	0.00499	0	17	52				
TFDP3	51270	broad.mit.edu	37	X	132351956	132351956	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:132351956A>T	ENST00000310125.4	-	1	420	c.332T>A	c.(331-333)cTg>cAg	p.L111Q		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	111					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L51Q(1)|p.L111Q(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					AAGACGGCACAGGCCCATGCC	0.592																																							uc004exb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(331-333)CTG>CAG		transcription factor Dp family, member 3							105.0	99.0	101.0					X																	132351956		2203	4300	6503	SO:0001583	missense	51270					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:132351956A>T	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.332T>A	X.37:g.132351956A>T	ENSP00000385461:p.Leu111Gln		Somatic					p.L111Q	NM_016521	NP_057605	WXS	Illumina HiSeq	Unspecified	Q5H9I0	TFDP3_HUMAN			1	421	-	Acute lymphoblastic leukemia(192;0.000127)		111			Potential.		Q6DK49|Q9NZ54	Missense_Mutation	SNP	ENST00000310125.4	37	c.332T>A	CCDS14636.2	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283980	0.40394	.	.	ENSG00000183434	ENST00000310125	T	0.60040	0.22	0.235	0.235	0.15431	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	T	0.71134	0.3304	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68784	-0.5317	9	0.87932	D	0	.	4.7703	0.13153	0.9997:0.0:3.0E-4:0.0	.	111	Q5H9I0	TFDP3_HUMAN	Q	111	ENSP00000385461:L111Q	ENSP00000385461:L111Q	L	-	2	0	TFDP3	132179622	1.000000	0.71417	0.012000	0.15200	0.012000	0.07955	6.150000	0.71801	0.245000	0.21373	0.242000	0.17961	CTG		0.592	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521		63	33	0	0	0	0.01441	0	63	33				
GPC3	2719	broad.mit.edu	37	X	133087112	133087112	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:133087112T>C	ENST00000370818.3	-	2	747	c.302A>G	c.(301-303)aAg>aGg	p.K101R	GPC3_ENST00000394299.2_Missense_Mutation_p.K101R|GPC3_ENST00000543339.1_Intron	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	101					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.K101R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					AATTAAGAACTTGAGCTCCAT	0.433			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														uc004exe.1		NA	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	T|D|Mis|N|F|S	glypican 3			O		Wilms tumour			1	Substitution - Missense(1)		lung(1)	lung(2)|prostate(1)|breast(1)|skin(1)	5						c.(301-303)AAG>AGG		glypican 3 isoform 2 precursor							223.0	197.0	206.0					X																	133087112		2203	4300	6503	SO:0001583	missense	2719	Simpson-Golabi-Behmel_syndrome	Familial Cancer Database	SGBS		extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity	g.chrX:133087112T>C	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.302A>G	X.37:g.133087112T>C	ENSP00000359854:p.Lys101Arg		Somatic				GPC3_uc010nrn.1_Missense_Mutation_p.K101R|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron|GPC3_uc010nrp.1_5'UTR	p.K101R	NM_004484	NP_004475	WXS	Illumina HiSeq	Unspecified	P51654	GPC3_HUMAN			2	492	-	Acute lymphoblastic leukemia(192;0.000127)		101					C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	c.302A>G	CCDS14638.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733388	0.69189	.	.	ENSG00000147257	ENST00000370818;ENST00000394299	T;T	0.51071	0.72;0.72	5.5	5.5	0.81552	.	0.130517	0.50627	D	0.000120	T	0.47563	0.1452	L	0.43923	1.385	0.80722	D	1	B;B	0.33583	0.418;0.201	B;B	0.40329	0.326;0.141	T	0.51148	-0.8742	10	0.72032	D	0.01	.	13.6977	0.62589	0.0:0.0:0.0:1.0	.	101;101	C9JLE3;P51654	.;GPC3_HUMAN	R	101	ENSP00000359854:K101R;ENSP00000377836:K101R	ENSP00000359854:K101R	K	-	2	0	GPC3	132914778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.499000	0.81566	1.830000	0.53286	0.412000	0.27726	AAG		0.433	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484		23	111	0	0	0	0.014323	0	23	111				
ARHGEF6	9459	broad.mit.edu	37	X	135758848	135758848	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:135758848T>C	ENST00000250617.6	-	18	3085	c.1880A>G	c.(1879-1881)aAg>aGg	p.K627R	ARHGEF6_ENST00000535227.1_Missense_Mutation_p.K500R|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.K473R|ARHGEF6_ENST00000370620.1_Missense_Mutation_p.K473R	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	627					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K627R(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					AAGAAATTTCTTCATCGTTTT	0.338																																							uc004fab.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1879-1881)AAG>AGG		Rac/Cdc42 guanine nucleotide exchange factor 6							103.0	94.0	97.0					X																	135758848		2203	4299	6502	SO:0001583	missense	9459				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chrX:135758848T>C	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1880A>G	X.37:g.135758848T>C	ENSP00000250617:p.Lys627Arg		Somatic				ARHGEF6_uc011mwd.1_Missense_Mutation_p.K500R|ARHGEF6_uc011mwe.1_Missense_Mutation_p.K473R	p.K627R	NM_004840	NP_004831	WXS	Illumina HiSeq	Unspecified	Q15052	ARHG6_HUMAN			18	2342	-	Acute lymphoblastic leukemia(192;0.000127)		627					A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	c.1880A>G	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081403	0.76528	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.57752	0.41;0.54;0.54;0.38	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.68696	0.3029	M	0.62723	1.935	0.80722	D	1	D;P	0.89917	1.0;0.876	D;B	0.87578	0.998;0.338	T	0.64918	-0.6294	10	0.21014	T	0.42	.	15.6684	0.77252	0.0:0.0:0.0:1.0	.	500;627	B7Z3C7;Q15052	.;ARHG6_HUMAN	R	627;473;473;473;500	ENSP00000250617:K627R;ENSP00000359654:K473R;ENSP00000359656:K473R;ENSP00000439483:K500R	ENSP00000250617:K627R	K	-	2	0	ARHGEF6	135586514	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.707000	0.61852	2.085000	0.62840	0.481000	0.45027	AAG		0.338	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840		10	33	0	0	0	0.010729	0	10	33				
ATP11C	286410	broad.mit.edu	37	X	138857035	138857035	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:138857035T>G	ENST00000327569.3	-	19	2137	c.2039A>C	c.(2038-2040)aAg>aCg	p.K680T	ATP11C_ENST00000359686.2_Missense_Mutation_p.K680T|ATP11C_ENST00000370557.1_Missense_Mutation_p.K677T|ATP11C_ENST00000370543.1_Missense_Mutation_p.K680T|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Missense_Mutation_p.K680T	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	680					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.K680T(2)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TGTCTCCATCTTGTCCCCAGT	0.483																																							uc004faz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(3)	8						c.(2038-2040)AAG>ACG		ATPase, class VI, type 11C isoform a							142.0	122.0	129.0					X																	138857035		2203	4300	6503	SO:0001583	missense	286410				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chrX:138857035T>G	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2039A>C	X.37:g.138857035T>G	ENSP00000332756:p.Lys680Thr		Somatic				ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.K680T	p.K680T	NM_173694	NP_775965	WXS	Illumina HiSeq	Unspecified	Q8NB49	AT11C_HUMAN			19	2138	-	Acute lymphoblastic leukemia(192;0.000127)		680			Cytoplasmic (Potential).		Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	c.2039A>C	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336092	0.81801	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18;-3.18	5.84	5.84	0.93424	HAD-like domain (2);	0.047118	0.85682	D	0.000000	D	0.98305	0.9438	H	0.99582	4.64	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.77557	0.983;0.99	D	0.99368	1.0919	10	0.87932	D	0	.	14.3053	0.66380	0.0:0.0:0.0:1.0	.	680;680	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	T	677;680;680;680;680	ENSP00000359588:K677T;ENSP00000355165:K680T;ENSP00000332756:K680T;ENSP00000359574:K680T;ENSP00000352715:K680T	ENSP00000332756:K680T	K	-	2	0	ATP11C	138684701	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.698000	0.84413	1.977000	0.57605	0.430000	0.28490	AAG		0.483	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		10	59	0	0	0	0.006214	0	10	59				
CNGA2	1260	broad.mit.edu	37	X	150911915	150911915	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chrX:150911915G>A	ENST00000329903.4	+	6	973	c.940G>A	c.(940-942)Gac>Aac	p.D314N		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	314					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.D314N(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					AAACATCACTGACCCTGAGTA	0.493																																							uc004fey.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(940-942)GAC>AAC		cyclic nucleotide gated channel alpha 2							176.0	164.0	168.0					X																	150911915		2203	4300	6503	SO:0001583	missense	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150911915G>A	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.940G>A	X.37:g.150911915G>A	ENSP00000328478:p.Asp314Asn		Somatic					p.D314N	NM_005140	NP_005131	WXS	Illumina HiSeq	Unspecified	Q16280	CNGA2_HUMAN			7	1164	+	Acute lymphoblastic leukemia(192;6.56e-05)		314			Cytoplasmic (Potential).		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	c.940G>A	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	7.927	0.739828	0.15642	.	.	ENSG00000183862	ENST00000329903	D	0.97870	-4.58	4.96	4.96	0.65561	Ion transport (1);	0.448479	0.27289	N	0.020058	D	0.94791	0.8318	L	0.37507	1.11	0.37821	D	0.928396	B	0.12630	0.006	B	0.14578	0.011	D	0.93361	0.6727	10	0.20046	T	0.44	.	14.8649	0.70406	0.0:0.0:1.0:0.0	.	314	Q16280	CNGA2_HUMAN	N	314	ENSP00000328478:D314N	ENSP00000328478:D314N	D	+	1	0	CNGA2	150662571	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	5.053000	0.64269	2.183000	0.69458	0.529000	0.55759	GAC		0.493	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		19	105	0	0	0	0.007413	0	19	105				
MRPL37	51253	broad.mit.edu	37	1	54666245	54666246	+	Frame_Shift_Ins	INS	-	-	T			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr1:54666245_54666246insT	ENST00000360840.5	+	1	406_407	c.329_330insT	c.(328-333)cgttgcfs	p.C111fs	MRPL37_ENST00000487096.1_Intron|CYB5RL_ENST00000537208.1_5'Flank|CYB5RL_ENST00000542737.1_5'Flank|RP11-446E24.4_ENST00000311841.7_5'Flank|MRPL37_ENST00000605337.1_Frame_Shift_Ins_p.C111fs|MRPL37_ENST00000336230.6_Frame_Shift_Ins_p.V80fs	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	111					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						TTTCACCACCGTTGCCGCCTTC	0.624																																							uc001cxa.3		NA																	0					0						c.(328-330)CGTfs		mitochondrial ribosomal protein L37 precursor																																				SO:0001589	frameshift_variant	51253				translation	mitochondrial ribosome	structural constituent of ribosome	g.chr1:54666245_54666246insT	AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.331dupT	1.37:g.54666247_54666247dupT	ENSP00000354086:p.Cys111fs		Somatic				CYB5RL_uc009vzo.2_5'Flank|CYB5RL_uc001cwx.3_5'Flank|CYB5RL_uc001cwy.3_5'Flank|MRPL37_uc009vzp.2_Frame_Shift_Ins_p.V80fs|MRPL37_uc001cxb.1_Frame_Shift_Ins_p.R110fs|MRPL37_uc001cxc.3_Intron|MRPL37_uc010oob.1_RNA	p.R110fs	NM_016491	NP_057575	WXS	Illumina HiSeq	Unspecified	Q9BZE1	RM37_HUMAN			1	406_407	+			110					Q96Q67|Q9BWR1|Q9P0P3	Frame_Shift_Ins	INS	ENST00000360840.5	37	c.329_330insT	CCDS589.1																																																																																				0.624	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491		17	45	NA	NA	NA	NA	NA	17	45	---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17164803	17164803	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr10:17164803delC	ENST00000377833.4	-	6	649	c.584delG	c.(583-585)ggafs	p.G195fs		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	195	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCTGTAACTTCCCATTGTATT	0.373																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(583-585)GGAfs		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						59.0	53.0	55.0					10																	17164803		2203	4300	6503	SO:0001589	frameshift_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:17164803delC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.584delG	10.37:g.17164803delC	ENSP00000367064:p.Gly195fs		Somatic					p.G195fs	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			6	636	-			195			EGF-like 2; calcium-binding (Potential).		B0YIZ4|Q5VTA6|Q96RU9	Frame_Shift_Del	DEL	ENST00000377833.4	37	c.584delG	CCDS7113.1																																																																																				0.373	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		10	41	NA	NA	NA	NA	NA	10	41	---	---	---	---
DDX10	1662	broad.mit.edu	37	11	108788635	108788637	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	TGA	TGA	-	-	TGA	TGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr11:108788635_108788637delTGA	ENST00000322536.3	+	17	2469_2471	c.2340_2342delTGA	c.(2338-2343)agtgat>agt	p.D788del	DDX10_ENST00000526794.1_In_Frame_Del_p.D788del	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	788					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TGGATTGGAGtgatgatgatgat	0.355			T	NUP98	AML*																																		uc001pkm.2		NA		Dom	yes		11	11q22-q23	1662	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10			L	NUP98		AML*		0				breast(2)|lung(1)|prostate(1)	4						c.(2338-2343)AGTGAT>AGT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 10				25,260,77,3902		0,2,0,23,4,0,250,5,67,1781						4.9	1.0			85	14,28,155,8057		0,0,0,14,0,0,28,12,131,3942	no	codingComplex	DDX10	NM_004398.2		0,2,0,37,4,0,278,17,198,5723	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		2.3867,8.4897,4.4656				39,288,232,11959				SO:0001651	inframe_deletion	1662						ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity	g.chr11:108788635_108788637delTGA	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.2340_2342delTGA	11.37:g.108788644_108788646delTGA	ENSP00000314348:p.Asp788del		Somatic				DDX10_uc001pkl.1_In_Frame_Del_p.D788del	p.D788del	NM_004398	NP_004389	WXS	Illumina HiSeq	Unspecified	Q13206	DDX10_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)	17	2405_2407	+		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)	788					B2RCQ3|Q5BJD8	In_Frame_Del	DEL	ENST00000322536.3	37	c.2340_2342delTGA	CCDS8342.1																																																																																				0.355	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	NM_004398		8	106	NA	NA	NA	NA	NA	8	106	---	---	---	---
PACS2	23241	broad.mit.edu	37	14	105814832	105814840	+	In_Frame_Del	DEL	TGTGCAGCC	TGTGCAGCC	-	rs199554211		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	TGTGCAGCC	TGTGCAGCC	-	-	TGTGCAGCC	TGTGCAGCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr14:105814832_105814840delTGTGCAGCC	ENST00000325438.8	+	2	626_634	c.122_130delTGTGCAGCC	c.(121-132)ttgtgcagcctg>ttg	p.41_44LCSL>L	PACS2_ENST00000447393.1_In_Frame_Del_p.41_44LCSL>L|PACS2_ENST00000458164.2_In_Frame_Del_p.41_44LCSL>L|PACS2_ENST00000430725.2_5'UTR|PACS2_ENST00000547217.1_In_Frame_Del_p.41_44LCSL>L			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	41					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CCTCACAGGTTGTGCAGCCTGACTCTGAA	0.646																																							uc001yqt.2		NA																	0				pancreas(1)	1						c.(121-132)TTGTGCAGCCTG>TTG		phosphofurin acidic cluster sorting protein 2																																				SO:0001651	inframe_deletion	23241				apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion		g.chr14:105814832_105814840delTGTGCAGCC	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.122_130delTGTGCAGCC	14.37:g.105814832_105814840delTGTGCAGCC	ENSP00000321834:p.Leu41_Ser43del		Somatic				PACS2_uc001yqs.2_5'UTR|PACS2_uc001yqv.2_In_Frame_Del_p.41_44LCSL>L|PACS2_uc001yqu.2_In_Frame_Del_p.41_44LCSL>L	p.41_44LCSL>L	NM_015197	NP_056012	WXS	Illumina HiSeq	Unspecified	Q86VP3	PACS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)	2	297_305	+		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	41_44					A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	In_Frame_Del	DEL	ENST00000325438.8	37	c.122_130delTGTGCAGCC	CCDS32168.1																																																																																				0.646	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		10	78	NA	NA	NA	NA	NA	10	78	---	---	---	---
EPN2	22905	broad.mit.edu	37	17	19216480	19216480	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr17:19216480delC	ENST00000314728.5	+	7	1519	c.1035delC	c.(1033-1035)ggcfs	p.G345fs	EPN2_ENST00000575595.1_Frame_Shift_Del_p.G53fs|EPN2_ENST00000395618.3_Frame_Shift_Del_p.G60fs|EPN2_ENST00000347697.2_Frame_Shift_Del_p.G288fs|EPN2_ENST00000571254.1_Frame_Shift_Del_p.G281fs|EPN2_ENST00000395626.1_Frame_Shift_Del_p.G345fs|EPN2_ENST00000395620.2_Frame_Shift_Del_p.G288fs	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	345					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CCAGCTCGGGCCCCGCGGCCC	0.602																																							uc002gvd.3		NA																	0				skin(1)	1						c.(1033-1035)GGCfs		epsin 2 isoform b							51.0	60.0	57.0					17																	19216480		2203	4300	6503	SO:0001589	frameshift_variant	22905				endocytosis		lipid binding	g.chr17:19216480delC	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1035delC	17.37:g.19216480delC	ENSP00000320543:p.Gly345fs		Somatic				EPN2_uc010cql.1_Frame_Shift_Del_p.G54fs|EPN2_uc002gve.3_Frame_Shift_Del_p.G288fs|EPN2_uc002gvf.3_Frame_Shift_Del_p.G60fs|EPN2_uc010vyo.1_Frame_Shift_Del_p.G53fs|EPN2_uc002gvg.1_Frame_Shift_Del_p.G288fs|EPN2_uc010vyp.1_Frame_Shift_Del_p.G281fs|EPN2_uc010vyq.1_Frame_Shift_Del_p.G282fs|EPN2_uc002gvh.1_Frame_Shift_Del_p.G345fs|EPN2_uc002gvj.3_Frame_Shift_Del_p.G8fs	p.G345fs	NM_014964	NP_055779	WXS	Illumina HiSeq	Unspecified	O95208	EPN2_HUMAN			7	1483	+	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)		345					A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Frame_Shift_Del	DEL	ENST00000314728.5	37	c.1035delC	CCDS11203.1																																																																																				0.602	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964		37	99	NA	NA	NA	NA	NA	37	99	---	---	---	---
NFIC	4782	broad.mit.edu	37	19	3434378	3434382	+	Frame_Shift_Del	DEL	GCCCA	GCCCA	-	rs368371894		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	GCCCA	GCCCA	-	-	GCCCA	GCCCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr19:3434378_3434382delGCCCA	ENST00000443272.2	+	5	864_868	c.813_817delGCCCA	c.(811-819)ctgcccagcfs	p.PS272fs	NFIC_ENST00000395111.3_Frame_Shift_Del_p.PS263fs|NFIC_ENST00000590282.1_Frame_Shift_Del_p.PS272fs|NFIC_ENST00000589123.1_Frame_Shift_Del_p.PS263fs|NFIC_ENST00000341919.3_Frame_Shift_Del_p.PS272fs|NFIC_ENST00000346156.5_Frame_Shift_Del_p.PS239fs|NFIC_ENST00000586919.1_Frame_Shift_Del_p.PS239fs	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	272					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GAAGAACGCTGCCCAGCACCTCCTC	0.615																																							uc010xhi.1		NA																	0					0						c.(811-819)CTGCCCAGCfs		nuclear factor I/C isoform 2																																				SO:0001589	frameshift_variant	4782				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:3434378_3434382delGCCCA	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.813_817delGCCCA	19.37:g.3434378_3434382delGCCCA	ENSP00000396843:p.Pro272fs		Somatic				NFIC_uc002lxo.2_Frame_Shift_Del_p.L262fs|NFIC_uc010xhh.1_Frame_Shift_Del_p.L262fs|NFIC_uc002lxp.2_Frame_Shift_Del_p.L271fs|NFIC_uc010xhj.1_Frame_Shift_Del_p.L271fs|NFIC_uc002lxq.1_Frame_Shift_Del_p.L223fs	p.L271fs	NM_205843	NP_995315	WXS	Illumina HiSeq	Unspecified	P08651	NFIC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)	5	875_879	+		Hepatocellular(1079;0.137)	271_273					A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Frame_Shift_Del	DEL	ENST00000443272.2	37	c.813_817delGCCCA	CCDS59330.1																																																																																				0.615	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597		22	27	NA	NA	NA	NA	NA	22	27	---	---	---	---
LRRC3B	116135	broad.mit.edu	37	3	26751187	26751187	+	Frame_Shift_Del	DEL	A	A	-			TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr3:26751187delA	ENST00000396641.2	+	2	616	c.24delA	c.(22-24)ttafs	p.L8fs	LRRC3B_ENST00000417744.1_Frame_Shift_Del_p.L8fs|AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000456208.2_Frame_Shift_Del_p.L8fs	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	8						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						ACCTGTGGTTAACCCGTTCCC	0.473																																							uc003cdp.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(22-24)TTAfs		leucine rich repeat containing 3B precursor							192.0	184.0	186.0					3																	26751187		2203	4300	6503	SO:0001589	frameshift_variant	116135					integral to membrane		g.chr3:26751187delA	AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.24delA	3.37:g.26751187delA	ENSP00000379880:p.Leu8fs		Somatic				LRRC3B_uc003cdq.2_Frame_Shift_Del_p.L8fs	p.L8fs	NM_052953	NP_443185	WXS	Illumina HiSeq	Unspecified	Q96PB8	LRC3B_HUMAN			2	613	+			8					Q5M8T0	Frame_Shift_Del	DEL	ENST00000396641.2	37	c.24delA	CCDS2644.1																																																																																				0.473	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953		13	187	NA	NA	NA	NA	NA	13	187	---	---	---	---
FSCN3	29999	broad.mit.edu	37	7	127235473	127235473	+	Frame_Shift_Del	DEL	G	G	-	rs182430717		TCGA-49-6742-01A-11D-1855-08	TCGA-49-6742-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	49dec0c2-8e75-4f44-a253-82b2ea605890	f09f9865-726d-41bd-b206-b8fae7d4a81b	g.chr7:127235473delG	ENST00000265825.5	+	2	476	c.257delG	c.(256-258)cgcfs	p.R86fs	FSCN3_ENST00000420086.2_5'UTR|FSCN3_ENST00000478328.1_3'UTR|GCC1_ENST00000497650.1_5'Flank	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	86						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						TGTTATGGCCGCCCAAGGACC	0.557																																							uc003vmd.1		NA																	0				ovary(1)	1						c.(256-258)CGCfs		fascin 3							133.0	109.0	117.0					7																	127235473		2203	4300	6503	SO:0001589	frameshift_variant	29999					actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging	g.chr7:127235473delG		CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.257delG	7.37:g.127235473delG	ENSP00000265825:p.Arg86fs		Somatic				FSCN3_uc003vmc.1_Frame_Shift_Del_p.R41fs|FSCN3_uc011kog.1_RNA|FSCN3_uc011koh.1_5'UTR|FSCN3_uc010llc.1_Frame_Shift_Del_p.R86fs	p.R86fs	NM_020369	NP_065102	WXS	Illumina HiSeq	Unspecified	Q9NQT6	FSCN3_HUMAN			2	476	+			86					A4D0Z2|A6NLL7|B2RA62|B4DU68	Frame_Shift_Del	DEL	ENST00000265825.5	37	c.257delG	CCDS34746.1																																																																																				0.557	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059256.2	NM_020369		22	30	NA	NA	NA	NA	NA	22	30	---	---	---	---
