#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PTCHD2	57540	broad.mit.edu	37	1	11561297	11561297	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:11561297G>T	ENST00000294484.6	+	2	386	c.248G>T	c.(247-249)aGc>aTc	p.S83I	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S83I	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	83					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.S300I(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CTGGGCTGCAGCATCCCCATG	0.612																																							uc001ash.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)|breast(1)	7						c.(247-249)AGC>ATC		patched domain containing 2							85.0	87.0	86.0					1																	11561297		2133	4252	6385	SO:0001583	missense	57540				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity	g.chr1:11561297G>T	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.248G>T	1.37:g.11561297G>T	ENSP00000294484:p.Ser83Ile		Somatic				PTCHD2_uc001asi.1_Missense_Mutation_p.S83I	p.S83I	NM_020780	NP_065831	WXS	Illumina HiSeq	Unspecified	Q9P2K9	PTHD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)	2	386	+	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	83			Helical; (Potential).		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	c.248G>T	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727418	0.30593	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.25414	1.8;1.8	5.91	4.98	0.66077	.	0.671525	0.13613	U	0.374961	T	0.12347	0.0300	N	0.08118	0	0.31028	N	0.717774	B	0.20887	0.049	B	0.19666	0.026	T	0.13388	-1.0511	10	0.15066	T	0.55	-30.277	8.6776	0.34189	0.0:0.2442:0.6266:0.1292	.	83	Q9P2K9	PTHD2_HUMAN	I	83	ENSP00000294484:S83I;ENSP00000374226:S83I	ENSP00000294484:S83I	S	+	2	0	PTCHD2	11483884	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.753000	0.47524	2.793000	0.96121	0.655000	0.94253	AGC		0.612	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561		17	80	1	0	1.56452e-12	0.007413	2.83849e-12	17	80				
PTPRU	10076	broad.mit.edu	37	1	29606079	29606079	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:29606079C>T	ENST00000345512.3	+	10	1804	c.1675C>T	c.(1675-1677)Cca>Tca	p.P559S	PTPRU_ENST00000428026.2_Missense_Mutation_p.P559S|PTPRU_ENST00000356870.3_Missense_Mutation_p.P559S|PTPRU_ENST00000460170.2_Missense_Mutation_p.P559S|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000323874.8_Missense_Mutation_p.P559S|PTPRU_ENST00000373779.3_Missense_Mutation_p.P559S	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	559	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P559S(6)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CAACCTGCACCCAGGCACCAC	0.602																																							uc001bru.2		NA																	6	Substitution - Missense(6)		lung(6)	large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7						c.(1675-1677)CCA>TCA		protein tyrosine phosphatase, receptor type, U							161.0	159.0	160.0					1																	29606079		2203	4300	6503	SO:0001583	missense	10076				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:29606079C>T	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1675C>T	1.37:g.29606079C>T	ENSP00000334941:p.Pro559Ser		Somatic				PTPRU_uc001brv.2_Missense_Mutation_p.P559S|PTPRU_uc001brw.2_Missense_Mutation_p.P559S|PTPRU_uc009vtq.2_Missense_Mutation_p.P559S|PTPRU_uc009vtr.2_Missense_Mutation_p.P559S	p.P559S	NM_005704	NP_005695	WXS	Illumina HiSeq	Unspecified	Q92729	PTPRU_HUMAN		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	10	1785	+		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	559			Extracellular (Potential).|Fibronectin type-III 3.		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	c.1675C>T	CCDS334.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994558	0.93167	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.11	5.11	0.69529	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81103	0.4753	M	0.70903	2.155	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.81317	-0.0987	9	.	.	.	.	17.526	0.87800	0.0:1.0:0.0:0.0	.	559;559;559;559;559	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	S	559	ENSP00000334941:P559S;ENSP00000362884:P559S;ENSP00000349333:P559S;ENSP00000314987:P559S;ENSP00000392332:P559S;ENSP00000432906:P559S	.	P	+	1	0	PTPRU	29478666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.369000	0.80426	0.551000	0.68910	CCA		0.602	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1			10	162	0	0	0	0.008291	0	10	162				
EBNA1BP2	10969	broad.mit.edu	37	1	43632904	43632904	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:43632904C>A	ENST00000236051.2	-	6	681	c.540G>T	c.(538-540)gtG>gtT	p.V180V	EBNA1BP2_ENST00000431635.2_Silent_p.V235V	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	180					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V180V(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCTCCGTTTGCACCTGTGATA	0.418																																							uc001cin.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(538-540)GTG>GTT		EBNA1 binding protein 2 isoform 2							202.0	189.0	193.0					1																	43632904		2203	4300	6503	SO:0001819	synonymous_variant	10969				ribosome biogenesis	membrane fraction|nucleolus	protein binding	g.chr1:43632904C>A	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.540G>T	1.37:g.43632904C>A			Somatic				EBNA1BP2_uc001cio.2_Silent_p.V235V|EBNA1BP2_uc001cim.2_Silent_p.V75V|EBNA1BP2_uc010ojx.1_Silent_p.V235V	p.V180V	NM_006824	NP_006815	WXS	Illumina HiSeq	Unspecified	Q99848	EBP2_HUMAN			6	737	-	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	180					Q96A66	Silent	SNP	ENST00000236051.2	37	c.540G>T	CCDS478.1																																																																																				0.418	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1			14	147	1	0	6.31663e-08	0.003163	1.01119e-07	14	147				
EFCAB7	84455	broad.mit.edu	37	1	63998406	63998406	+	Missense_Mutation	SNP	T	T	A	rs529167027		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:63998406T>A	ENST00000371088.4	+	4	711	c.465T>A	c.(463-465)gaT>gaA	p.D155E	RN7SL488P_ENST00000585186.1_RNA	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	155	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.D155E(1)		breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						TAAATGCTGATGGCAAATTTG	0.313																																							uc001dbf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(463-465)GAT>GAA		EF-hand calcium binding domain 7							106.0	111.0	110.0					1																	63998406		2203	4297	6500	SO:0001583	missense	84455						calcium ion binding	g.chr1:63998406T>A	BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.465T>A	1.37:g.63998406T>A	ENSP00000360129:p.Asp155Glu		Somatic					p.D155E	NM_032437	NP_115813	WXS	Illumina HiSeq	Unspecified	A8K855	EFCB7_HUMAN			4	759	+			155			EF-hand 2.		Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	ENST00000371088.4	37	c.465T>A	CCDS30737.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.348248	0.61183	.	.	ENSG00000203965	ENST00000371088	T	0.80566	-1.39	4.82	4.82	0.62117	EF-hand-like domain (1);	0.135993	0.64402	D	0.000003	T	0.73931	0.3650	M	0.82323	2.585	0.80722	D	1	P	0.44241	0.829	B	0.37601	0.254	T	0.78735	-0.2088	9	.	.	.	-15.2693	14.5173	0.67827	0.0:0.0:0.0:1.0	.	155	A8K855	EFCB7_HUMAN	E	155	ENSP00000360129:D155E	.	D	+	3	2	EFCAB7	63770994	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.562000	0.36353	2.016000	0.59253	0.482000	0.46254	GAT		0.313	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024910.1	NM_032437		12	100	0	0	0	0.001855	0	12	100				
SPAG17	200162	broad.mit.edu	37	1	118566053	118566053	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:118566053G>T	ENST00000336338.5	-	28	4008	c.3943C>A	c.(3943-3945)Ccc>Acc	p.P1315T		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1315						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.P1315T(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CCTGAATTGGGACTCCTGCTC	0.423																																							uc001ehk.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(3943-3945)CCC>ACC		sperm associated antigen 17							97.0	91.0	93.0					1																	118566053		2203	4300	6503	SO:0001583	missense	200162					cilium|flagellar axoneme|microtubule		g.chr1:118566053G>T		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3943C>A	1.37:g.118566053G>T	ENSP00000337804:p.Pro1315Thr		Somatic					p.P1315T	NM_206996	NP_996879	WXS	Illumina HiSeq	Unspecified	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	28	4011	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	1315					Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	c.3943C>A	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.979803	0.53827	.	.	ENSG00000155761	ENST00000336338	T	0.20463	2.07	5.72	4.8	0.61643	.	0.221347	0.47093	D	0.000258	T	0.26484	0.0647	M	0.70275	2.135	0.28756	N	0.901192	D	0.58620	0.983	P	0.56865	0.808	T	0.09574	-1.0668	10	0.87932	D	0	.	13.4064	0.60915	0.0:0.0:0.8425:0.1575	.	1315	Q6Q759	SPG17_HUMAN	T	1315	ENSP00000337804:P1315T	ENSP00000337804:P1315T	P	-	1	0	SPAG17	118367576	1.000000	0.71417	0.975000	0.42487	0.484000	0.33280	3.326000	0.52037	1.410000	0.46936	0.655000	0.94253	CCC		0.423	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		4	66	1	0	1.6384e-10	0.001984	2.82457e-10	4	66				
ITGA10	8515	broad.mit.edu	37	1	145536120	145536120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:145536120C>T	ENST00000369304.3	+	17	2387	c.2212C>T	c.(2212-2214)Cag>Tag	p.Q738*	ITGA10_ENST00000538811.1_Nonsense_Mutation_p.Q607*|ITGA10_ENST00000539363.1_Nonsense_Mutation_p.Q595*	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	738					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.Q738*(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CACTTGTGAGCAGCTACACTT	0.552																																							uc001eoa.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(2212-2214)CAG>TAG		integrin, alpha 10 precursor							89.0	80.0	83.0					1																	145536120		2203	4300	6503	SO:0001587	stop_gained	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145536120C>T	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2212C>T	1.37:g.145536120C>T	ENSP00000358310:p.Gln738*		Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Nonsense_Mutation_p.Q607*|ITGA10_uc009wiw.2_Nonsense_Mutation_p.Q595*|ITGA10_uc010oyw.1_Nonsense_Mutation_p.Q683*	p.Q738*	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			17	2288	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		738			Extracellular (Potential).		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Nonsense_Mutation	SNP	ENST00000369304.3	37	c.2212C>T	CCDS918.1	.	.	.	.	.	.	.	.	.	.	C	37	6.569201	0.97671	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	.	.	.	5.28	4.37	0.52481	.	0.470892	0.22309	N	0.061747	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	10.9612	0.47387	0.3398:0.6602:0.0:0.0	.	.	.	.	X	738;704;595;607	.	ENSP00000358310:Q738X	Q	+	1	0	ITGA10	144247477	0.174000	0.23070	1.000000	0.80357	0.936000	0.57629	0.546000	0.23284	1.449000	0.47699	0.462000	0.41574	CAG		0.552	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		23	70	0	0	0	0.00278	0	23	70				
PIAS3	10401	broad.mit.edu	37	1	145580301	145580301	+	Silent	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:145580301T>C	ENST00000393045.2	+	6	873	c.783T>C	c.(781-783)aaT>aaC	p.N261N	PIAS3_ENST00000369298.1_Silent_p.N226N|PIAS3_ENST00000369299.3_Silent_p.N252N	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	261	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)	p.N252N(1)|p.N261N(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTGTGGTCAATTGGTCATCTG	0.587																																							uc001eoc.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(781-783)AAT>AAC		protein inhibitor of activated STAT, 3							143.0	135.0	138.0					1																	145580301		2203	4300	6503	SO:0001819	synonymous_variant	10401				positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding	g.chr1:145580301T>C	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.783T>C	1.37:g.145580301T>C			Somatic				NBPF10_uc001emp.3_Intron|PIAS3_uc010oyy.1_Silent_p.N252N|PIAS3_uc001eod.1_5'Flank	p.N261N	NM_006099	NP_006090	WXS	Illumina HiSeq	Unspecified	Q9Y6X2	PIAS3_HUMAN			6	874	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		261			PINIT.		Q9UFI3	Silent	SNP	ENST00000393045.2	37	c.783T>C	CCDS920.2																																																																																				0.587	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099		5	139	0	0	0	0.000602	0	5	139				
HIST2H3D	653604	broad.mit.edu	37	1	149785214	149785214	+	Missense_Mutation	SNP	G	G	A	rs587655126		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:149785214G>A	ENST00000331491.1	-	1	22	c.23C>T	c.(22-24)gCc>gTc	p.A8V	HIST2H2BF_ENST00000427880.2_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	8					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A8V(1)		biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						CGACTTGCGGGCAGTCTGCTT	0.602																																							uc010pbl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(22-24)GCC>GTC		histone cluster 2, H3d							28.0	29.0	29.0					1																	149785214		1556	3554	5110	SO:0001583	missense	653604				blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr1:149785214G>A	AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.23C>T	1.37:g.149785214G>A	ENSP00000333277:p.Ala8Val		Somatic				HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	p.A8V	NM_001123375	NP_001116847	WXS	Illumina HiSeq	Unspecified	Q71DI3	H32_HUMAN			1	23	-			8					A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	ENST00000331491.1	37	c.23C>T	CCDS41388.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238752	0.22711	.	.	ENSG00000183598	ENST00000331491	T	0.46819	0.86	4.13	3.22	0.36961	.	0.000000	0.53938	U	0.000059	T	0.47746	0.1462	.	.	.	0.49051	D	0.999749	.	.	.	.	.	.	T	0.54563	-0.8275	7	0.87932	D	0	.	10.819	0.46593	0.0951:0.0:0.9049:0.0	.	.	.	.	V	8	ENSP00000333277:A8V	ENSP00000333277:A8V	A	-	2	0	HIST2H3D	148051838	1.000000	0.71417	0.917000	0.36280	0.069000	0.16628	7.164000	0.77533	1.091000	0.41335	0.436000	0.28706	GCC		0.602	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033452.1	NM_001123375		4	50	0	0	0	0.000602	0	4	50				
FLG	2312	broad.mit.edu	37	1	152283027	152283027	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:152283027C>T	ENST00000368799.1	-	3	4370	c.4335G>A	c.(4333-4335)gtG>gtA	p.V1445V	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1445	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.V1445V(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGAGAGCTCACCTGGTAGA	0.587									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(4333-4335)GTG>GTA		filaggrin							208.0	202.0	204.0					1																	152283027		2203	4300	6503	SO:0001819	synonymous_variant	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152283027C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4335G>A	1.37:g.152283027C>T			Somatic				uc001ezv.2_5'Flank	p.V1445V	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4371	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1445			Ser-rich.		Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	c.4335G>A	CCDS30860.1																																																																																				0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		12	333	0	0	0	0.001368	0	12	333				
FLG2	388698	broad.mit.edu	37	1	152328814	152328814	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:152328814C>A	ENST00000388718.5	-	3	1520	c.1448G>T	c.(1447-1449)gGg>gTg	p.G483V	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	483	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G483V(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCAGACCCATGTTGTCC	0.527																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(1447-1449)GGG>GTG		filaggrin family member 2							213.0	211.0	212.0					1																	152328814		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152328814C>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1448G>T	1.37:g.152328814C>A	ENSP00000373370:p.Gly483Val		Somatic				uc001ezv.2_Intron	p.G483V	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1521	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		483			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.1448G>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869009	0.32977	.	.	ENSG00000143520	ENST00000388718	T	0.19938	2.11	4.42	3.5	0.40072	.	.	.	.	.	T	0.22936	0.0554	L	0.54323	1.7	0.09310	N	0.999999	D	0.64830	0.994	D	0.65773	0.938	T	0.03795	-1.1003	9	0.51188	T	0.08	-0.4816	10.1347	0.42699	0.0:0.9009:0.0:0.0991	.	483	Q5D862	FILA2_HUMAN	V	483	ENSP00000373370:G483V	ENSP00000373370:G483V	G	-	2	0	FLG2	150595438	0.000000	0.05858	0.002000	0.10522	0.106000	0.19336	0.154000	0.16343	1.070000	0.40811	0.655000	0.94253	GGG		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		38	335	1	0	1.90571e-15	0.004289	3.61231e-15	38	335				
PEAR1	375033	broad.mit.edu	37	1	156878710	156878710	+	Silent	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:156878710C>G	ENST00000338302.3	+	12	1518	c.1293C>G	c.(1291-1293)ggC>ggG	p.G431G	PEAR1_ENST00000292357.7_Silent_p.G431G			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	431	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.G431G(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCTTTCAGGGCCCTCACTGTG	0.627																																							uc001fqj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1291-1293)GGC>GGG		platelet endothelial aggregation receptor 1							111.0	84.0	93.0					1																	156878710		2203	4300	6503	SO:0001819	synonymous_variant	375033					integral to membrane		g.chr1:156878710C>G	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1293C>G	1.37:g.156878710C>G			Somatic				PEAR1_uc009wsl.1_Silent_p.G232G|PEAR1_uc001fqk.1_Silent_p.G56G	p.G431G	NM_001080471	NP_001073940	WXS	Illumina HiSeq	Unspecified	Q5VY43	PEAR1_HUMAN			11	1409	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		431			EGF-like 5.		Q8TEK2	Silent	SNP	ENST00000338302.3	37	c.1293C>G	CCDS30892.1																																																																																				0.627	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		16	57	0	0	0	0.006122	0	16	57				
DUSP27	92235	broad.mit.edu	37	1	167095997	167095997	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:167095997C>A	ENST00000361200.2	+	6	1795	c.1629C>A	c.(1627-1629)gcC>gcA	p.A543A	DUSP27_ENST00000443333.1_Silent_p.A543A|DUSP27_ENST00000271385.5_Silent_p.A543A|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	543					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A543A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGCTCACTGCCCTGGAAAGAT	0.552																																							uc001geb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1627-1629)GCC>GCA		dual specificity phosphatase 27							90.0	88.0	89.0					1																	167095997		2203	4300	6503	SO:0001819	synonymous_variant	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167095997C>A	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1629C>A	1.37:g.167095997C>A			Somatic					p.A543A	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	1629	+			543					A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	c.1629C>A	CCDS30932.1																																																																																				0.552	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		10	91	1	0	2.17888e-05	0.006214	2.96483e-05	10	91				
F5	2153	broad.mit.edu	37	1	169511383	169511383	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:169511383C>T	ENST00000367797.3	-	13	3146	c.2945G>A	c.(2944-2946)tGg>tAg	p.W982*	F5_ENST00000367796.3_Nonsense_Mutation_p.W987*	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	982	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.W982*(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GCTTTCTCCCCAAGCACGTGA	0.463																																							uc001ggg.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(2944-2946)TGG>TAG		coagulation factor V precursor	Drotrecogin alfa(DB00055)						113.0	119.0	117.0					1																	169511383		2203	4300	6503	SO:0001587	stop_gained	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169511383C>T	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.2945G>A	1.37:g.169511383C>T	ENSP00000356771:p.Trp982*		Somatic					p.W982*	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			13	3090	-	all_hematologic(923;0.208)		982			B.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Nonsense_Mutation	SNP	ENST00000367797.3	37	c.2945G>A	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	41	8.654996	0.98901	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	.	.	.	5.81	2.81	0.32909	.	0.577364	0.18466	N	0.140363	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0995	11.9565	0.52984	0.4482:0.5518:0.0:0.0	.	.	.	.	X	982;987	.	ENSP00000356770:W987X	W	-	2	0	F5	167778007	0.000000	0.05858	0.008000	0.14137	0.319000	0.28217	-0.038000	0.12144	0.328000	0.23435	0.567000	0.79289	TGG		0.463	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		12	206	0	0	0	0.000978	0	12	206				
MROH9	80133	broad.mit.edu	37	1	170961380	170961380	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:170961380G>C	ENST00000367758.3	+	12	1203	c.1104G>C	c.(1102-1104)ttG>ttC	p.L368F	MROH9_ENST00000367759.4_Missense_Mutation_p.L368F	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	368								p.L368F(2)									CAATCTTATTGATACTGAAAG	0.502																																							uc001ghg.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1102-1104)TTG>TTC		hypothetical protein LOC80133 isoform 2							127.0	129.0	128.0					1																	170961380		2008	4162	6170	SO:0001583	missense	80133						binding	g.chr1:170961380G>C	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1104G>C	1.37:g.170961380G>C	ENSP00000356732:p.Leu368Phe		Somatic				C1orf129_uc009wvy.2_Missense_Mutation_p.L175F|C1orf129_uc010plz.1_Missense_Mutation_p.L368F	p.L368F	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			12	1234	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		368					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	c.1104G>C	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988825	0.53934	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.32515	4.05;1.45	5.61	2.52	0.30459	Armadillo-like helical (1);	0.409722	0.19964	N	0.102153	T	0.29458	0.0734	M	0.63428	1.95	0.25102	N	0.990777	D;D	0.71674	0.998;0.998	D;D	0.69142	0.962;0.962	T	0.02901	-1.1096	10	0.41790	T	0.15	-13.9194	5.368	0.16125	0.0845:0.1397:0.6327:0.1431	.	368;368	F5GWX6;Q5TGP6	.;CA129_HUMAN	F	368	ENSP00000356733:L368F;ENSP00000356732:L368F	ENSP00000356732:L368F	L	+	3	2	C1orf129	169228004	0.117000	0.22190	0.984000	0.44739	0.883000	0.51084	0.002000	0.13061	1.340000	0.45581	0.591000	0.81541	TTG		0.502	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		8	95	0	0	0	0.00308	0	8	95				
FMO2	2327	broad.mit.edu	37	1	171154954	171154954	+	Silent	SNP	T	T	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:171154954T>G	ENST00000209929.7	+	2	260	c.102T>G	c.(100-102)acT>acG	p.T34T	FMO2_ENST00000441535.1_Silent_p.T34T|FMO2_ENST00000529935.1_Intron			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	34					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.T34T(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGAGAGAACTGAAGATATTG	0.458																																							uc001ghk.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(100-102)ACT>ACG		flavin containing monooxygenase 2							258.0	247.0	251.0					1																	171154954		2203	4300	6503	SO:0001819	synonymous_variant	2327				drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171154954T>G	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.102T>G	1.37:g.171154954T>G			Somatic				FMO2_uc010pmd.1_Intron	p.T34T	NM_001460	NP_001451	WXS	Illumina HiSeq	Unspecified	Q99518	FMO2_HUMAN			2	219	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		34					Q53XR0	Silent	SNP	ENST00000209929.7	37	c.102T>G	CCDS1293.1																																																																																				0.458	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460		9	188	0	0	0	0.006214	0	9	188				
SLC9C2	284525	broad.mit.edu	37	1	173517545	173517545	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:173517545T>C	ENST00000367714.3	-	12	1866	c.1444A>G	c.(1444-1446)Agg>Ggg	p.R482G	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Missense_Mutation_p.R380G	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	482					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.R482G(1)									TATTCGATCCTCGTTTTATCT	0.368																																							uc001giz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1444-1446)AGG>GGG		solute carrier family 9, member 11							139.0	143.0	142.0					1																	173517545		2201	4300	6501	SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173517545T>C	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1444A>G	1.37:g.173517545T>C	ENSP00000356687:p.Arg482Gly		Somatic				SLC9A11_uc009wwe.2_Missense_Mutation_p.R40G|SLC9A11_uc010pmq.1_RNA	p.R482G	NM_178527	NP_848622	WXS	Illumina HiSeq	Unspecified	Q5TAH2	S9A11_HUMAN			12	1867	-			482					Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.1444A>G	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	T	4.509	0.094409	0.08632	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.22134	1.97;1.97	4.78	3.63	0.41609	.	0.360843	0.23055	N	0.052455	T	0.03136	0.0092	N	0.14661	0.345	0.09310	N	1	B	0.29716	0.255	B	0.22152	0.038	T	0.40478	-0.9561	10	0.22706	T	0.39	-1.8391	7.8818	0.29627	0.184:0.0:0.0:0.816	.	482	Q5TAH2	S9A11_HUMAN	G	482;380	ENSP00000356687:R482G;ENSP00000445437:R380G	ENSP00000356687:R482G	R	-	1	2	SLC9A11	171784168	0.040000	0.19996	0.001000	0.08648	0.298000	0.27526	3.387000	0.52501	0.754000	0.32968	0.332000	0.21555	AGG		0.368	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		3	85	0	0	0	0.000248	0	3	85				
PAPPA2	60676	broad.mit.edu	37	1	176525866	176525866	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:176525866G>A	ENST00000367662.3	+	2	1572	c.408G>A	c.(406-408)ggG>ggA	p.G136G	PAPPA2_ENST00000367661.3_Silent_p.G136G	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	136					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G136G(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTCCTATTGGGCAATCTGAGC	0.557																																							uc001gkz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(406-408)GGG>GGA		pappalysin 2 isoform 1							110.0	112.0	111.0					1																	176525866		2106	4238	6344	SO:0001819	synonymous_variant	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176525866G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.408G>A	1.37:g.176525866G>A			Somatic				PAPPA2_uc001gky.1_Silent_p.G136G|PAPPA2_uc009www.2_RNA	p.G136G	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			2	1572	+			136					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	c.408G>A	CCDS41438.1																																																																																				0.557	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			5	155	0	0	0	0.000602	0	5	155				
ASTN1	460	broad.mit.edu	37	1	176845741	176845741	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:176845741C>A	ENST00000367654.3	-	21	3630	c.3419G>T	c.(3418-3420)cGg>cTg	p.R1140L	ASTN1_ENST00000367657.3_Missense_Mutation_p.R1132L|ASTN1_ENST00000424564.2_Missense_Mutation_p.R1132L|ASTN1_ENST00000361833.2_Missense_Mutation_p.R1132L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1140	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R1132L(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCTGGAGCGCCGTCCTGTGTT	0.572																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(3394-3396)CGG>CTG		astrotactin isoform 1							118.0	89.0	99.0					1																	176845741		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176845741C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3419G>T	1.37:g.176845741C>A	ENSP00000356626:p.Arg1140Leu		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.R1132L|ASTN1_uc001gld.1_Missense_Mutation_p.R1132L	p.R1132L	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			21	3607	-			1140			Fibronectin type-III 1.		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.3395G>T		.	.	.	.	.	.	.	.	.	.	C	35	5.450368	0.96205	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16457	2.34;2.76;2.76;2.34	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.53249	1.67	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.79108	0.992;0.992	T	0.16041	-1.0416	10	0.72032	D	0.01	-17.3769	18.3051	0.90177	0.0:1.0:0.0:0.0	.	1132;1132	O14525-2;B1AJS1	.;.	L	1132;1132;1140;1132;1132	ENSP00000356629:R1132L;ENSP00000354536:R1132L;ENSP00000356626:R1140L;ENSP00000395041:R1132L	ENSP00000354536:R1132L	R	-	2	0	ASTN1	175112364	1.000000	0.71417	0.994000	0.49952	0.962000	0.63368	7.390000	0.79816	2.400000	0.81607	0.655000	0.94253	CGG		0.572	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		8	49	1	0	1.12685e-05	0.004482	1.57264e-05	8	49				
TDRD5	163589	broad.mit.edu	37	1	179562702	179562702	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:179562702G>T	ENST00000367614.1	+	3	699	c.340G>T	c.(340-342)Gga>Tga	p.G114*	TDRD5_ENST00000444136.1_Nonsense_Mutation_p.G114*|RP11-545A16.4_ENST00000567150.1_RNA|TDRD5_ENST00000294848.8_Nonsense_Mutation_p.G114*	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	114					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.G114*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TATTTATTCTGGACCGAGATC	0.463																																							uc001gnf.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(340-342)GGA>TGA		tudor domain containing 5							131.0	122.0	125.0					1																	179562702		2203	4300	6503	SO:0001587	stop_gained	163589				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding	g.chr1:179562702G>T	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.340G>T	1.37:g.179562702G>T	ENSP00000356586:p.Gly114*		Somatic				TDRD5_uc010pnp.1_Nonsense_Mutation_p.G114*	p.G114*	NM_173533	NP_775804	WXS	Illumina HiSeq	Unspecified	Q8NAT2	TDRD5_HUMAN			3	590	+			114					A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	37	c.340G>T	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949713	0.92660	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	.	.	.	5.59	4.48	0.54585	.	0.696278	0.13545	N	0.379907	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-11.0688	10.2391	0.43301	0.1042:0.0:0.8958:0.0	.	.	.	.	X	114	.	ENSP00000294848:G114X	G	+	1	0	TDRD5	177829325	0.012000	0.17670	0.051000	0.19133	0.008000	0.06430	1.267000	0.33050	2.613000	0.88420	0.655000	0.94253	GGA		0.463	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		4	80	1	0	2.56e-06	0.000248	3.6806e-06	4	80				
HMCN1	83872	broad.mit.edu	37	1	186122916	186122916	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:186122916G>A	ENST00000271588.4	+	97	15282	c.15053G>A	c.(15052-15054)gGg>gAg	p.G5018E	HMCN1_ENST00000367492.2_Missense_Mutation_p.G5018E	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5018	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G5018E(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACAGGTCCTGGGCAGCTGTAC	0.458																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(15052-15054)GGG>GAG		hemicentin 1 precursor							113.0	104.0	107.0					1																	186122916		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186122916G>A	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15053G>A	1.37:g.186122916G>A	ENSP00000271588:p.Gly5018Glu		Somatic				HMCN1_uc001grs.1_Missense_Mutation_p.G587E	p.G5018E	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			97	15282	+			5018			Nidogen G2 beta-barrel.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.15053G>A	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	34	5.304055	0.95601	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.39787	1.06;1.06	5.81	5.81	0.92471	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.000000	0.85682	D	0.000000	T	0.69360	0.3102	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71928	-0.4444	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	5018	Q96RW7	HMCN1_HUMAN	E	5018	ENSP00000271588:G5018E;ENSP00000356462:G5018E	ENSP00000271588:G5018E	G	+	2	0	HMCN1	184389539	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	GGG		0.458	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		7	61	0	0	0	0.00308	0	7	61				
PTGS2	5743	broad.mit.edu	37	1	186645168	186645168	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:186645168C>G	ENST00000367468.5	-	8	1255	c.1119G>C	c.(1117-1119)tgG>tgC	p.W373C	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	373					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.W373C(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	GAAGGGGATGCCAGTGATAGA	0.383																																							uc001gsb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1117-1119)TGG>TGC		prostaglandin-endoperoxide synthase 2 precursor	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)						216.0	214.0	215.0					1																	186645168		2203	4300	6503	SO:0001583	missense	5743				cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr1:186645168C>G	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.1119G>C	1.37:g.186645168C>G	ENSP00000356438:p.Trp373Cys		Somatic				PTGS2_uc009wyo.2_Missense_Mutation_p.W220C	p.W373C	NM_000963	NP_000954	WXS	Illumina HiSeq	Unspecified	P35354	PGH2_HUMAN			8	1256	-			373					A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	c.1119G>C	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482638	0.84747	.	.	ENSG00000073756	ENST00000367468	T	0.23754	1.89	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.67211	0.2869	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77827	-0.2443	10	0.87932	D	0	-9.9304	19.9823	0.97331	0.0:1.0:0.0:0.0	.	373	P35354	PGH2_HUMAN	C	373	ENSP00000356438:W373C	ENSP00000356438:W373C	W	-	3	0	PTGS2	184911791	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.585000	0.82584	2.788000	0.95919	0.650000	0.86243	TGG		0.383	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963		8	135	0	0	0	0.006214	0	8	135				
UCHL5	51377	broad.mit.edu	37	1	192992151	192992151	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:192992151C>T	ENST00000367455.4	-	9	986	c.751G>A	c.(751-753)Gat>Aat	p.D251N	UCHL5_ENST00000367449.1_Missense_Mutation_p.D250N|UCHL5_ENST00000367452.4_Missense_Mutation_p.D126N|UCHL5_ENST00000367448.1_Missense_Mutation_p.D250N|UCHL5_ENST00000530098.2_Missense_Mutation_p.D127N|UCHL5_ENST00000367454.1_Missense_Mutation_p.D250N|UCHL5_ENST00000367451.4_Missense_Mutation_p.D277N	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	251					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)	p.D251N(1)|p.D251H(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						TTACCTTGATCTGTATCCATG	0.338																																							uc001gsm.2		NA																	2	Substitution - Missense(2)		cervix(1)|lung(1)	lung(2)|ovary(1)	3						c.(751-753)GAT>AAT		ubiquitin carboxyl-terminal hydrolase L5							132.0	136.0	135.0					1																	192992151		2203	4300	6503	SO:0001583	missense	51377				DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:192992151C>T		CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.751G>A	1.37:g.192992151C>T	ENSP00000356425:p.Asp251Asn		Somatic				UCHL5_uc001gsn.2_RNA|UCHL5_uc001gso.2_Missense_Mutation_p.D250N|UCHL5_uc010pov.1_RNA|UCHL5_uc001gsp.2_Missense_Mutation_p.D250N|UCHL5_uc001gsq.2_Missense_Mutation_p.D250N|UCHL5_uc010pow.1_Missense_Mutation_p.D126N|UCHL5_uc010pox.1_Missense_Mutation_p.D127N	p.D251N	NM_015984	NP_057068	WXS	Illumina HiSeq	Unspecified	Q9Y5K5	UCHL5_HUMAN			9	882	-			251					Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	ENST00000367455.4	37	c.751G>A	CCDS1378.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.008961|4.008961	0.75046|0.75046	.|.	.|.	ENSG00000116750|ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000367452;ENST00000530098;ENST00000391991;ENST00000421683|ENST00000449480;ENST00000443327;ENST00000416915	T;T;T;T;T;T;T;T;T|.	0.65549|.	-0.11;-0.09;-0.16;-0.12;-0.08;-0.08;0.9;0.88;-0.16|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53916|0.53916	0.1826|0.1826	N|N	0.17278|0.17278	0.47|0.47	0.80722|0.80722	D|D	1|1	P;P;B;B;B;P|.	0.46395|.	0.872;0.872;0.098;0.443;0.199;0.877|.	P;P;B;B;B;P|.	0.49012|.	0.478;0.478;0.083;0.064;0.18;0.598|.	T|T	0.46762|0.46762	-0.9168|-0.9168	10|5	0.37606|.	T|.	0.19|.	-26.0213|-26.0213	20.0553|20.0553	0.97649|0.97649	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	127;126;250;250;250;251|.	B7Z9U9;B4DW59;Q9Y5K5-2;Q9Y5K5-4;Q9Y5K5-3;Q9Y5K5|.	.;.;.;.;.;UCHL5_HUMAN|.	N|K	251;250;290;277;250;250;126;127;241;241|38;106;32	ENSP00000356425:D251N;ENSP00000356424:D250N;ENSP00000356420:D290N;ENSP00000356421:D277N;ENSP00000356418:D250N;ENSP00000356419:D250N;ENSP00000356422:D126N;ENSP00000431171:D127N;ENSP00000389563:D241N|.	ENSP00000356418:D250N|.	D|R	-|-	1|2	0|0	UCHL5|UCHL5	191258774|191258774	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.364000|7.364000	0.79526|0.79526	2.754000|2.754000	0.94517|0.94517	0.585000|0.585000	0.79938|0.79938	GAT|AGA		0.338	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984		11	177	0	0	0	0.008291	0	11	177				
DDX59	83479	broad.mit.edu	37	1	200635159	200635159	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:200635159C>T	ENST00000331314.6	-	2	923	c.710G>A	c.(709-711)gGa>gAa	p.G237E	DDX59_ENST00000367348.3_Missense_Mutation_p.G237E|DDX59_ENST00000447706.2_Missense_Mutation_p.G237E	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	237	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.G237E(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TCCCAGAAGTCCCACAGGAAT	0.443																																							uc009wzk.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|central_nervous_system(1)	4						c.(709-711)GGA>GAA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 59							120.0	122.0	121.0					1																	200635159		2203	4300	6503	SO:0001583	missense	83479					intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding	g.chr1:200635159C>T	BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.710G>A	1.37:g.200635159C>T	ENSP00000330460:p.Gly237Glu		Somatic				DDX59_uc010ppl.1_Missense_Mutation_p.G237E	p.G237E	NM_001031725	NP_001026895	WXS	Illumina HiSeq	Unspecified	Q5T1V6	DDX59_HUMAN			2	953	-			237			Helicase ATP-binding.		Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	37	c.710G>A	CCDS30964.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456674	0.84317	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314	T;T;T	0.15256	2.44;2.44;2.44	5.33	5.33	0.75918	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	L	0.39245	1.2	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.68765	0.96;0.96	T	0.02251	-1.1188	10	0.51188	T	0.08	-26.0749	19.0796	0.93177	0.0:1.0:0.0:0.0	.	237;237	B7Z5N6;Q5T1V6	.;DDX59_HUMAN	E	237	ENSP00000394367:G237E;ENSP00000356317:G237E;ENSP00000330460:G237E	ENSP00000330460:G237E	G	-	2	0	DDX59	198901782	1.000000	0.71417	0.964000	0.40570	0.999000	0.98932	5.984000	0.70548	2.498000	0.84270	0.650000	0.86243	GGA		0.443	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4		10	157	0	0	0	0.000978	0	10	157				
PPP1R15B	84919	broad.mit.edu	37	1	204379882	204379882	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:204379882A>T	ENST00000367188.4	-	1	1037	c.658T>A	c.(658-660)Tcc>Acc	p.S220T	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	220					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.S220T(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			AGCAAATAGGATACCACACTG	0.498																																							uc001hav.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(658-660)TCC>ACC		protein phosphatase 1, regulatory subunit 15B							122.0	119.0	120.0					1																	204379882		2203	4300	6503	SO:0001583	missense	84919				regulation of translation			g.chr1:204379882A>T	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.658T>A	1.37:g.204379882A>T	ENSP00000356156:p.Ser220Thr		Somatic					p.S220T	NM_032833	NP_116222	WXS	Illumina HiSeq	Unspecified	Q5SWA1	PR15B_HUMAN	all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)		1	1063	-	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		220					Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	c.658T>A	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.434083	0.62955	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.24723	1.84	5.4	5.4	0.78164	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.223440	0.29403	N	0.012249	T	0.46521	0.1397	M	0.61703	1.905	0.31453	N	0.67054	D	0.71674	0.998	D	0.74348	0.983	T	0.56872	-0.7907	10	0.87932	D	0	-15.9327	11.8162	0.52211	1.0:0.0:0.0:0.0	.	220	Q5SWA1	PR15B_HUMAN	T	220;130	ENSP00000356156:S220T	ENSP00000356156:S220T	S	-	1	0	PPP1R15B	202646505	0.984000	0.35163	0.993000	0.49108	0.368000	0.29767	1.615000	0.36922	2.035000	0.60131	0.533000	0.62120	TCC		0.498	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833		6	113	0	0	0	0.001984	0	6	113				
USH2A	7399	broad.mit.edu	37	1	216172314	216172314	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:216172314C>G	ENST00000307340.3	-	34	6958	c.6572G>C	c.(6571-6573)aGt>aCt	p.S2191T	USH2A_ENST00000366943.2_Missense_Mutation_p.S2191T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2191	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S2191T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATAGATGACACTCCAAATTGT	0.343										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(6571-6573)AGT>ACT		usherin isoform B							149.0	142.0	144.0					1																	216172314		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216172314C>G	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6572G>C	1.37:g.216172314C>G	ENSP00000305941:p.Ser2191Thr	HNSCC(13;0.011)	Somatic					p.S2191T	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	34	6959	-			2191			Extracellular (Potential).|Fibronectin type-III 8.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.6572G>C	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	7.220	0.597218	0.13875	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12672	2.67;2.66	5.56	1.8	0.24995	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.095070	0.07245	U	0.864883	T	0.08891	0.0220	L	0.29908	0.895	0.19775	N	0.999953	B	0.11235	0.004	B	0.06405	0.002	T	0.41998	-0.9477	10	0.06625	T	0.88	.	6.5579	0.22469	0.0:0.1423:0.1303:0.7274	.	2191	O75445	USH2A_HUMAN	T	2191	ENSP00000305941:S2191T;ENSP00000355910:S2191T	ENSP00000305941:S2191T	S	-	2	0	USH2A	214238937	0.507000	0.26146	0.915000	0.36163	0.931000	0.56810	1.603000	0.36794	0.039000	0.15632	-0.469000	0.05056	AGT		0.343	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		4	96	0	0	0	0.000248	0	4	96				
USH2A	7399	broad.mit.edu	37	1	216595317	216595317	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:216595317T>C	ENST00000307340.3	-	2	748	c.362A>G	c.(361-363)cAt>cGt	p.H121R	USH2A_ENST00000366943.2_Missense_Mutation_p.H121R|USH2A_ENST00000366942.3_Missense_Mutation_p.H121R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	121					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.H121R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGAATTGCTATGGGCGTTAGG	0.458										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(361-363)CAT>CGT		usherin isoform B							109.0	103.0	105.0					1																	216595317		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216595317T>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.362A>G	1.37:g.216595317T>C	ENSP00000305941:p.His121Arg	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.H121R	p.H121R	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	2	749	-			121			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.362A>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	2.494	-0.316702	0.05386	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.62364	0.03;0.03;0.03	5.42	-10.8	0.00216	Concanavalin A-like lectin/glucanase (1);	1.682770	0.03663	N	0.242849	T	0.35653	0.0939	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16188	-1.0411	10	0.07644	T	0.81	.	5.4157	0.16372	0.107:0.1419:0.1669:0.5842	.	121;121	O75445-2;O75445	.;USH2A_HUMAN	R	121	ENSP00000305941:H121R;ENSP00000355910:H121R;ENSP00000355909:H121R	ENSP00000305941:H121R	H	-	2	0	USH2A	214661940	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.430000	0.06973	-3.184000	0.00221	-1.208000	0.01637	CAT		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		3	89	0	0	0	0.004672	0	3	89				
HEATR1	55127	broad.mit.edu	37	1	236730018	236730018	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:236730018G>A	ENST00000366582.3	-	30	4350	c.4236C>T	c.(4234-4236)ctC>ctT	p.L1412L	HEATR1_ENST00000366581.2_Silent_p.L1331L	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1412					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L1412L(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGAGAATCCAGAGGAATTTCT	0.498																																							uc001hyd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(4234-4236)CTC>CTT		protein BAP28							55.0	54.0	55.0					1																	236730018		2203	4300	6503	SO:0001819	synonymous_variant	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236730018G>A	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4236C>T	1.37:g.236730018G>A			Somatic				HEATR1_uc009xgh.1_Silent_p.L574L	p.L1412L	NM_018072	NP_060542	WXS	Illumina HiSeq	Unspecified	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		30	4361	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	1412					Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	ENST00000366582.3	37	c.4236C>T	CCDS31066.1																																																																																				0.498	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		4	37	0	0	0	0.000248	0	4	37				
RYR2	6262	broad.mit.edu	37	1	237843805	237843805	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:237843805T>G	ENST00000366574.2	+	62	9262	c.8945T>G	c.(8944-8946)tTc>tGc	p.F2982C	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.F2966C|RYR2_ENST00000360064.6_Missense_Mutation_p.F2980C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2982					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.F2980C(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGTTTATACTTCTTATCTGCA	0.388																																							uc001hyl.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(8944-8946)TTC>TGC		cardiac muscle ryanodine receptor							134.0	113.0	119.0					1																	237843805		1848	4103	5951	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237843805T>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8945T>G	1.37:g.237843805T>G	ENSP00000355533:p.Phe2982Cys		Somatic				RYR2_uc010pxz.1_5'UTR	p.F2982C	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		62	9065	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2982			Modulator (Potential).|Cytoplasmic (By similarity).		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.8945T>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424807	0.83667	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;D	0.98666	-0.19;-5.04;-5.06	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000006	D	0.99146	0.9705	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.99581	1.0973	10	0.87932	D	0	.	15.8023	0.78463	0.0:0.0:0.0:1.0	.	2982	Q92736	RYR2_HUMAN	C	2982;2980;2966	ENSP00000355533:F2982C;ENSP00000353174:F2980C;ENSP00000443798:F2966C	ENSP00000353174:F2980C	F	+	2	0	RYR2	235910428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.137000	0.66172	0.533000	0.62120	TTC		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		3	32	0	0	0	0.004672	0	3	32				
RYR2	6262	broad.mit.edu	37	1	237886560	237886560	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:237886560C>A	ENST00000366574.2	+	74	11004	c.10687C>A	c.(10687-10689)Cag>Aag	p.Q3563K	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.Q3547K|RYR2_ENST00000360064.6_Missense_Mutation_p.Q3561K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3563					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.Q3561K(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCATCTTGAACAGGTCAGGCT	0.348																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(10687-10689)CAG>AAG		cardiac muscle ryanodine receptor							128.0	117.0	120.0					1																	237886560		1863	4087	5950	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237886560C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10687C>A	1.37:g.237886560C>A	ENSP00000355533:p.Gln3563Lys		Somatic				RYR2_uc010pxz.1_Missense_Mutation_p.Q518K	p.Q3563K	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		74	10807	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3563					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.10687C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024121	0.54683	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96651	-4.08;-4.05;-4.08	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000013	D	0.95089	0.8409	L	0.56769	1.78	0.80722	D	1	B	0.28713	0.22	B	0.24541	0.054	D	0.92487	0.5997	10	0.45353	T	0.12	-18.0426	20.275	0.98485	0.0:1.0:0.0:0.0	.	3563	Q92736	RYR2_HUMAN	K	3563;3561;3547;518	ENSP00000355533:Q3563K;ENSP00000353174:Q3561K;ENSP00000443798:Q3547K	ENSP00000353174:Q3561K	Q	+	1	0	RYR2	235953183	0.998000	0.40836	0.997000	0.53966	0.942000	0.58702	3.715000	0.54897	2.800000	0.96347	0.455000	0.32223	CAG		0.348	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		9	96	1	0	2.17888e-05	0.006214	2.96483e-05	9	96				
WDR64	128025	broad.mit.edu	37	1	241913018	241913018	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:241913018G>T	ENST00000366552.2	+	13	1941	c.1734G>T	c.(1732-1734)atG>atT	p.M578I	WDR64_ENST00000437684.2_Missense_Mutation_p.M578I	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	578								p.M578I(1)|p.M298I(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CTATCAAAATGATCCAGGTTT	0.502																																							uc001hzf.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(892-894)ATG>ATT		WD repeat domain 64							114.0	116.0	115.0					1																	241913018		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241913018G>T	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1734G>T	1.37:g.241913018G>T	ENSP00000355510:p.Met578Ile		Somatic				WDR64_uc001hzg.1_Missense_Mutation_p.M44I	p.M298I	NM_144625	NP_653226	WXS	Illumina HiSeq	Unspecified	B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		8	1047	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	578			WD 8.		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.894G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.527|1.527	-0.545249|-0.545249	0.04024|0.04024	.|.	.|.	ENSG00000162843|ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635|ENST00000425826	T;T;T|.	0.45668|.	0.89;0.89;0.89|.	6.06|6.06	0.387|0.387	0.16259|0.16259	WD40 repeat-like-containing domain (1);|.	0.323671|.	0.30840|.	N|.	0.008766|.	T|.	0.29945|.	0.0749|.	L|L	0.27053|0.27053	0.805|0.805	0.25415|0.25415	N|N	0.988323|0.988323	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.04013|.	0.0;0.001|.	T|.	0.27773|.	-1.0064|.	10|.	0.07990|.	T|.	0.79|.	-11.8955|-11.8955	8.4915|8.4915	0.33104|0.33104	0.0:0.2293:0.2971:0.4736|0.0:0.2293:0.2971:0.4736	.|.	578;298|.	B1ANS9;D1MPS4|.	WDR64_HUMAN;.|.	I|L	578;578;349|57	ENSP00000355510:M578I;ENSP00000402446:M578I;ENSP00000406656:M349I|.	ENSP00000355510:M578I|.	M|X	+|+	3|2	0|2	WDR64|WDR64	239979641|239979641	0.890000|0.890000	0.30428|0.30428	0.996000|0.996000	0.52242|0.52242	0.379000|0.379000	0.30106|0.30106	0.132000|0.132000	0.15891|0.15891	0.389000|0.389000	0.25086|0.25086	0.655000|0.655000	0.94253|0.94253	ATG|TGA		0.502	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		16	96	1	0	3.52763e-06	0.00499	5.03381e-06	16	96				
SMYD3	64754	broad.mit.edu	37	1	246493833	246493833	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:246493833C>T	ENST00000388985.4	-	4	342	c.343G>A	c.(343-345)Gga>Aga	p.G115R	SMYD3_ENST00000490107.1_Missense_Mutation_p.G56R|SMYD3_ENST00000403792.3_Missense_Mutation_p.G115R|SMYD3_ENST00000541742.1_Missense_Mutation_p.G56R			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	115	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)	p.G115R(1)|p.G56R(1)		breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GAAGGTGCTCCATCCATCTGT	0.318																																							uc001ibl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(343-345)GGA>AGA		SET and MYND domain containing 3							69.0	72.0	71.0					1																	246493833		2203	4300	6503	SO:0001583	missense	64754					cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding	g.chr1:246493833C>T	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.343G>A	1.37:g.246493833C>T	ENSP00000373637:p.Gly115Arg		Somatic				SMYD3_uc001ibk.2_Missense_Mutation_p.G56R	p.G115R	NM_022743	NP_073580	WXS	Illumina HiSeq	Unspecified	Q9H7B4	SMYD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)	4	438	-	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	115					A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	ENST00000388985.4	37	c.343G>A	CCDS53486.1	.	.	.	.	.	.	.	.	.	.	C	7.260	0.604999	0.14002	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000388985;ENST00000453676;ENST00000403792;ENST00000455277	T;T;T;T;T	0.47528	1.82;1.82;1.85;1.44;0.84	5.33	3.45	0.39498	SET domain (2);	1.302520	0.05239	N	0.511737	T	0.39937	0.1097	L	0.39898	1.24	0.27016	N	0.964572	B	0.18461	0.028	B	0.16722	0.016	T	0.29088	-1.0023	10	0.18276	T	0.48	-20.4382	8.3118	0.32075	0.0:0.597:0.3199:0.0831	.	115	Q9H7B4	SMYD3_HUMAN	R	56;56;115;56;115;56	ENSP00000444184:G56R;ENSP00000419184:G56R;ENSP00000373637:G115R;ENSP00000408122:G56R;ENSP00000385380:G115R	ENSP00000373637:G115R	G	-	1	0	SMYD3	244560456	0.994000	0.37717	0.963000	0.40424	0.032000	0.12392	0.668000	0.25127	0.740000	0.32651	-0.172000	0.13284	GGA		0.318	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743		6	101	0	0	0	0.001168	0	6	101				
OR2M4	26245	broad.mit.edu	37	1	248402509	248402509	+	Silent	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr1:248402509T>C	ENST00000306687.1	+	1	279	c.279T>C	c.(277-279)tcT>tcC	p.S93S		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	93					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S93S(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AATCTATCTCTCTGGCAGGTT	0.463																																							uc010pzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(277-279)TCT>TCC		olfactory receptor, family 2, subfamily M,							151.0	132.0	139.0					1																	248402509		2203	4300	6503	SO:0001819	synonymous_variant	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402509T>C	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.279T>C	1.37:g.248402509T>C			Somatic					p.S93S	NM_017504	NP_059974	WXS	Illumina HiSeq	Unspecified	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	279	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		93			Extracellular (Potential).		Q15611|Q8NG82	Silent	SNP	ENST00000306687.1	37	c.279T>C	CCDS31108.1																																																																																				0.463	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		12	101	0	0	0	0.000978	0	12	101				
CUBN	8029	broad.mit.edu	37	10	16975090	16975090	+	Silent	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:16975090T>A	ENST00000377833.4	-	40	6185	c.6120A>T	c.(6118-6120)cgA>cgT	p.R2040R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2040	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R2040R(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTCACCATCTCGTATCACAA	0.458																																							uc001ioo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(6118-6120)CGA>CGT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						112.0	99.0	104.0					10																	16975090		2203	4300	6503	SO:0001819	synonymous_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16975090T>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6120A>T	10.37:g.16975090T>A			Somatic					p.R2040R	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			40	6172	-			2040			CUB 14.		B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	c.6120A>T	CCDS7113.1																																																																																				0.458	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		4	71	0	0	0	0.000602	0	4	71				
CUL2	8453	broad.mit.edu	37	10	35349836	35349836	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:35349836T>A	ENST00000374748.1	-	5	596	c.283A>T	c.(283-285)Agc>Tgc	p.S95C	CUL2_ENST00000374749.3_Missense_Mutation_p.S95C|CUL2_ENST00000537177.1_Missense_Mutation_p.S114C|CUL2_ENST00000478044.1_5'Flank|CUL2_ENST00000374746.1_Missense_Mutation_p.S95C|CUL2_ENST00000374751.3_Missense_Mutation_p.S95C|CUL2_ENST00000602371.1_Missense_Mutation_p.S38C|CUL2_ENST00000374742.1_Missense_Mutation_p.S95C			Q13617	CUL2_HUMAN	cullin 2	95				SKGA -> IRHE (in Ref. 7; AAC50545). {ECO:0000305}.	cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)	p.S95C(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						GCACCCTTGCTGTATTCTTCC	0.368																																							uc001ixv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(283-285)AGC>TGC		cullin 2							158.0	140.0	146.0					10																	35349836		2203	4300	6503	SO:0001583	missense	8453				cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr10:35349836T>A	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.283A>T	10.37:g.35349836T>A	ENSP00000363880:p.Ser95Cys		Somatic				CUL2_uc009xma.2_5'UTR|CUL2_uc010qer.1_Missense_Mutation_p.S114C|CUL2_uc001ixw.2_Missense_Mutation_p.S95C|CUL2_uc010qes.1_Missense_Mutation_p.S95C	p.S95C	NM_003591	NP_003582	WXS	Illumina HiSeq	Unspecified	Q13617	CUL2_HUMAN			4	493	-			95	SKGA -> IRHE (in Ref. 7; AAC50545).				B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	c.283A>T	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	T	31	5.080936	0.94050	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177;ENST00000421317	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.98	5.98	0.97165	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53932	0.1827	M	0.66297	2.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.983;0.99	T	0.49808	-0.8900	10	0.36615	T	0.2	-14.6834	16.1311	0.81442	0.0:0.0:0.0:1.0	.	95;114;95	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	C	95;95;95;95;38;95;114;95	ENSP00000363883:S95C;ENSP00000363880:S95C;ENSP00000363878:S95C;ENSP00000363881:S95C;ENSP00000363874:S95C;ENSP00000444856:S114C;ENSP00000414095:S95C	ENSP00000363874:S95C	S	-	1	0	CUL2	35389842	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.009000	0.70745	2.289000	0.77006	0.482000	0.46254	AGC		0.368	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591		13	64	0	0	0	0.001368	0	13	64				
ZNF33B	7582	broad.mit.edu	37	10	43088981	43088981	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:43088981C>G	ENST00000359467.3	-	5	1531	c.1417G>C	c.(1417-1419)Gag>Cag	p.E473Q	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E473*(1)|p.E473Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						TTCCCACACTCAAGACATTCA	0.378																																					Melanoma(137;1247 1767 16772 25727 43810)	Melanoma(137;1247 1767 16772 25727 43810)	uc001jaf.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)		0						c.(1417-1419)GAG>CAG		zinc finger protein 33B							91.0	87.0	89.0					10																	43088981		2203	4300	6503	SO:0001583	missense	7582					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:43088981C>G	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1417G>C	10.37:g.43088981C>G	ENSP00000352444:p.Glu473Gln		Somatic				ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Missense_Mutation_p.E361Q|ZNF33B_uc001jad.2_Intron	p.E473Q	NM_006955	NP_008886	WXS	Illumina HiSeq	Unspecified	Q06732	ZN33B_HUMAN			5	1532	-			473			C2H2-type 6.		Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	c.1417G>C	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	C	3.358	-0.131035	0.06753	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.18502	2.21	2.58	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.262056	0.20071	N	0.099862	T	0.09774	0.0240	N	0.25094	0.71	0.09310	N	1	B	0.06786	0.001	B	0.14578	0.011	T	0.25606	-1.0127	10	0.34782	T	0.22	.	6.3468	0.21353	0.0:0.7866:0.0:0.2134	.	473	Q06732	ZN33B_HUMAN	Q	473;439	ENSP00000352444:E473Q	ENSP00000352444:E473Q	E	-	1	0	ZNF33B	42408987	0.000000	0.05858	0.553000	0.28255	0.816000	0.46133	-0.707000	0.05041	0.465000	0.27167	0.416000	0.27883	GAG		0.378	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955		3	69	0	0	0	0.004672	0	3	69				
MARCH8	220972	broad.mit.edu	37	10	45953764	45953764	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:45953764C>A	ENST00000319836.3	-	7	1548	c.799G>T	c.(799-801)Gga>Tga	p.G267*	MARCH8_ENST00000395771.3_Nonsense_Mutation_p.G267*|MARCH8_ENST00000453424.2_Nonsense_Mutation_p.G549*|MARCH8_ENST00000395769.2_Nonsense_Mutation_p.G267*|MARCH8_ENST00000476962.1_5'UTR	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	267					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G267*(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						TGACAGATTCCATATCCATGT	0.388																																					NSCLC(102;658 1594 2173 16344 34808)	NSCLC(102;658 1594 2173 16344 34808)	uc001jci.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(799-801)GGA>TGA		cellular modulator of immune recognition isoform							115.0	116.0	116.0					10																	45953764		2203	4300	6503	SO:0001587	stop_gained	220972					cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr10:45953764C>A	AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.799G>T	10.37:g.45953764C>A	ENSP00000317087:p.Gly267*		Somatic				MARCH8_uc001jch.2_Nonsense_Mutation_p.G549*|MARCH8_uc001jcj.1_Nonsense_Mutation_p.G267*|MARCH8_uc001jck.1_Nonsense_Mutation_p.G267*|uc001jcf.2_5'Flank|MARCH8_uc001jcg.1_Nonsense_Mutation_p.G136*	p.G267*	NM_001002266	NP_001002266	WXS	Illumina HiSeq	Unspecified	Q5T0T0	MARH8_HUMAN			7	1038	-			267					B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Nonsense_Mutation	SNP	ENST00000319836.3	37	c.799G>T	CCDS7213.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.796916|9.796916	0.99266|0.99266	.|.	.|.	ENSG00000165406|ENSG00000165406	ENST00000395771;ENST00000319836;ENST00000395769|ENST00000453424	.|.	.|.	.|.	5.67|5.67	3.83|3.83	0.44106|0.44106	.|.	1.200030|.	0.05526|.	N|.	0.563101|.	.|T	.|0.61248	.|0.2332	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.57087	.|-0.7871	.|4	0.15499|.	T|.	0.54|.	-0.133|-0.133	10.3059|10.3059	0.43680|0.43680	0.0:0.8397:0.0:0.1603|0.0:0.8397:0.0:0.1603	.|.	.|.	.|.	.|.	X|L	267|431	.|.	ENSP00000317087:G267X|.	G|W	-|-	1|2	0|0	MARCH8|MARCH8	45273770|45273770	0.998000|0.998000	0.40836|0.40836	0.060000|0.060000	0.19600|0.19600	0.962000|0.962000	0.63368|0.63368	2.739000|2.739000	0.47409|0.47409	0.762000|0.762000	0.33152|0.33152	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.388	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051217.1	NM_145021		12	106	1	0	2.80697e-09	0.000978	4.67012e-09	12	106				
ZWINT	11130	broad.mit.edu	37	10	58118214	58118214	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:58118214C>A	ENST00000373944.3	-	8	837	c.799G>T	c.(799-801)Ggt>Tgt	p.G267C	ZWINT_ENST00000318387.2_Missense_Mutation_p.G147C|ZWINT_ENST00000395405.1_Missense_Mutation_p.G267C|ZWINT_ENST00000460654.1_5'UTR|ZWINT_ENST00000361148.6_Missense_Mutation_p.G220C			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	267					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.G267C(2)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						GGTTGTAGACCAACAGCCTTG	0.502																																							uc001jjx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(799-801)GGT>TGT		ZW10 interactor isoform a							109.0	103.0	105.0					10																	58118214		2203	4300	6503	SO:0001583	missense	11130				cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding	g.chr10:58118214C>A	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.799G>T	10.37:g.58118214C>A	ENSP00000363055:p.Gly267Cys		Somatic				ZWINT_uc001jjy.1_Missense_Mutation_p.G220C|ZWINT_uc001jka.1_Missense_Mutation_p.G267C	p.G267C	NM_007057	NP_008988	WXS	Illumina HiSeq	Unspecified	O95229	ZWINT_HUMAN			8	836	-			267					A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	c.799G>T	CCDS7249.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.492|4.492	0.091194|0.091194	0.08632|0.08632	.|.	.|.	ENSG00000122952|ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000318387;ENST00000361148|ENST00000373940	T;T;T;T|.	0.50548|.	0.74;0.74;0.74;0.74|.	3.82|3.82	-5.57|-5.57	0.02521|0.02521	.|.	1.520270|.	0.04313|.	N|.	0.349318|.	T|T	0.17323|0.17323	0.0416|0.0416	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B;B|.	0.17038|.	0.02;0.02|.	B;B|.	0.14578|.	0.011;0.011|.	T|T	0.21690|0.21690	-1.0238|-1.0238	10|6	0.54805|0.23891	T|T	0.06|0.37	-15.5415|-15.5415	2.3883|2.3883	0.04371|0.04371	0.1198:0.3024:0.1197:0.4581|0.1198:0.3024:0.1197:0.4581	.|.	220;267|.	A6NNV6;O95229|.	.;ZWINT_HUMAN|.	C|L	267;267;147;220|80	ENSP00000363055:G267C;ENSP00000378801:G267C;ENSP00000322850:G147C;ENSP00000354921:G220C|.	ENSP00000322850:G147C|ENSP00000363051:W80L	G|W	-|-	1|2	0|0	ZWINT|ZWINT	57788220|57788220	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.170000|-3.170000	0.00573|0.00573	-1.624000|-1.624000	0.01556|0.01556	-2.049000|-2.049000	0.00408|0.00408	GGT|TGG		0.502	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1			16	69	1	0	1.15088e-07	0.004007	1.78973e-07	16	69				
MYPN	84665	broad.mit.edu	37	10	69954182	69954182	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:69954182A>T	ENST00000358913.5	+	14	3476	c.2988A>T	c.(2986-2988)cgA>cgT	p.R996R	MYPN_ENST00000354393.2_Silent_p.R721R|MYPN_ENST00000540630.1_Silent_p.R996R	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	996	Ig-like 3.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.R996R(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						AAATGAGGCGAGAAGGAGATG	0.453																																							uc001jnm.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)	5						c.(2986-2988)CGA>CGT		myopalladin							116.0	91.0	99.0					10																	69954182		2203	4300	6503	SO:0001819	synonymous_variant	84665					nucleus|sarcomere	actin binding	g.chr10:69954182A>T	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.2988A>T	10.37:g.69954182A>T			Somatic				MYPN_uc001jnn.3_Silent_p.R721R|MYPN_uc001jno.3_Silent_p.R996R|MYPN_uc009xpt.2_Silent_p.R996R|MYPN_uc010qit.1_Silent_p.R702R|MYPN_uc010qiu.1_RNA	p.R996R	NM_032578	NP_115967	WXS	Illumina HiSeq	Unspecified	Q86TC9	MYPN_HUMAN			15	3173	+			996			Ig-like 3.|Interaction with ACTN.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	37	c.2988A>T	CCDS7275.1																																																																																				0.453	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		6	26	0	0	0	0.001984	0	6	26				
ADAMTS14	140766	broad.mit.edu	37	10	72511354	72511354	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:72511354G>T	ENST00000373207.1	+	17	2548	c.2548G>T	c.(2548-2550)Gag>Tag	p.E850*	ADAMTS14_ENST00000373208.1_Nonsense_Mutation_p.E853*	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	850	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E853*(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GGACACCTATGAGTGGGCGCT	0.627																																							uc001jrh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)	6						c.(2548-2550)GAG>TAG		ADAM metallopeptidase with thrombospondin type 1							60.0	62.0	61.0					10																	72511354		2203	4300	6503	SO:0001587	stop_gained	140766				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr10:72511354G>T	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2548G>T	10.37:g.72511354G>T	ENSP00000362303:p.Glu850*		Somatic				ADAMTS14_uc001jrg.2_Nonsense_Mutation_p.E853*	p.E850*	NM_080722	NP_542453	WXS	Illumina HiSeq	Unspecified	Q8WXS8	ATS14_HUMAN			17	2548	+			850			TSP type-1 2.		Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Nonsense_Mutation	SNP	ENST00000373207.1	37	c.2548G>T	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	40	7.978930	0.98591	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	.	.	.	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	16.753	0.85492	0.0:0.0:1.0:0.0	.	.	.	.	X	853;850	.	ENSP00000362303:E850X	E	+	1	0	ADAMTS14	72181360	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	9.150000	0.94667	2.280000	0.76307	0.563000	0.77884	GAG		0.627	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		9	49	1	0	3.09899e-07	0.004482	4.78022e-07	9	49				
PDE6C	5146	broad.mit.edu	37	10	95380394	95380394	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:95380394C>T	ENST00000371447.3	+	2	624	c.486C>T	c.(484-486)agC>agT	p.S162S		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	162	GAF 1.				phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.S162S(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	TTCAGAACAGCCATTTTTCTG	0.443																																							uc001kiu.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|kidney(1)|skin(1)	4						c.(484-486)AGC>AGT		phosphodiesterase 6C							85.0	80.0	82.0					10																	95380394		2203	4300	6503	SO:0001819	synonymous_variant	5146				visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding	g.chr10:95380394C>T	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.486C>T	10.37:g.95380394C>T			Somatic					p.S162S	NM_006204	NP_006195	WXS	Illumina HiSeq	Unspecified	P51160	PDE6C_HUMAN			2	624	+		Colorectal(252;0.123)	162			GAF 1.		A6NCR6|Q5VY29	Silent	SNP	ENST00000371447.3	37	c.486C>T	CCDS7429.1																																																																																				0.443	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204		10	98	0	0	0	0.006214	0	10	98				
CHUK	1147	broad.mit.edu	37	10	101977791	101977791	+	Silent	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:101977791T>A	ENST00000370397.7	-	9	980	c.894A>T	c.(892-894)ccA>ccT	p.P298P		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	298	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)	p.P298P(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CAAAACATCTTGGCTGCTTCA	0.388																																					Ovarian(159;52 1904 10536 35305 37148)	Ovarian(159;52 1904 10536 35305 37148)	uc001kqp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7						c.(892-894)CCA>CCT		conserved helix-loop-helix ubiquitous kinase							96.0	85.0	89.0					10																	101977791		2203	4300	6503	SO:0001819	synonymous_variant	1147				I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity	g.chr10:101977791T>A	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.894A>T	10.37:g.101977791T>A			Somatic					p.P298P	NM_001278	NP_001269	WXS	Illumina HiSeq	Unspecified	O15111	IKKA_HUMAN		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	9	949	-		Colorectal(252;0.117)	298			Protein kinase.		O14666|Q13132|Q5W0I4|Q92467	Silent	SNP	ENST00000370397.7	37	c.894A>T	CCDS7488.1																																																																																				0.388	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278		7	40	0	0	0	0.004482	0	7	40				
FAM178A	55719	broad.mit.edu	37	10	102683760	102683760	+	Silent	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:102683760A>G	ENST00000238961.4	+	5	1544	c.1002A>G	c.(1000-1002)gaA>gaG	p.E334E	FAM178A_ENST00000370269.3_Silent_p.E334E|FAM178A_ENST00000370271.3_Silent_p.E334E	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	334						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.E334E(1)									AATTCCCTGAAAAAAGAAAAA	0.348																																							uc001krt.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1000-1002)GAA>GAG		hypothetical protein LOC55719 isoform 1							24.0	25.0	24.0					10																	102683760		2202	4300	6502	SO:0001819	synonymous_variant	55719							g.chr10:102683760A>G	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.1002A>G	10.37:g.102683760A>G			Somatic				FAM178A_uc001krr.1_Silent_p.E334E|FAM178A_uc001krs.2_Silent_p.E334E|FAM178A_uc001kru.1_Silent_p.E269E	p.E334E	NM_018121	NP_060591	WXS	Illumina HiSeq	Unspecified	Q8IX21	F178A_HUMAN			5	1544	+			334					A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Silent	SNP	ENST00000238961.4	37	c.1002A>G	CCDS7500.1																																																																																				0.348	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3			4	31	0	0	0	0.000248	0	4	31				
SORCS3	22986	broad.mit.edu	37	10	106865208	106865208	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:106865208G>T	ENST00000369701.3	+	7	1374	c.1147G>T	c.(1147-1149)Ggg>Tgg	p.G383W		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	383					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.G383W(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AACTAGAAGTGGGCCTTTTGC	0.473																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|central_nervous_system(1)	10						c.(1147-1149)GGG>TGG		VPS10 domain receptor protein SORCS 3 precursor							170.0	138.0	149.0					10																	106865208		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106865208G>T	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1147G>T	10.37:g.106865208G>T	ENSP00000358715:p.Gly383Trp		Somatic					p.G383W	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	7	1374	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	383			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.1147G>T	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219694	0.39201	.	.	ENSG00000156395	ENST00000369701	T	0.31510	1.49	5.43	5.43	0.79202	VPS10 (1);	0.126681	0.56097	D	0.000028	T	0.32010	0.0815	N	0.22421	0.69	0.39495	D	0.968119	D	0.61697	0.99	P	0.52454	0.699	T	0.05289	-1.0894	10	0.39692	T	0.17	.	14.727	0.69351	0.0:0.0:1.0:0.0	.	383	Q9UPU3	SORC3_HUMAN	W	383	ENSP00000358715:G383W	ENSP00000358715:G383W	G	+	1	0	SORCS3	106855198	1.000000	0.71417	0.985000	0.45067	0.392000	0.30506	3.013000	0.49582	2.536000	0.85505	0.462000	0.41574	GGG		0.473	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		6	128	1	0	3.59834e-05	0.001168	4.72747e-05	6	128				
SLC18A2	6571	broad.mit.edu	37	10	119029956	119029956	+	Silent	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:119029956T>A	ENST00000298472.5	+	15	1565	c.1422T>A	c.(1420-1422)ccT>ccA	p.P474P	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	474					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)	p.P474P(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GAAGTCCACCTGCCAAAGAAG	0.378																																							uc001ldd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1420-1422)CCT>CCA		solute carrier family 18 (vesicular monoamine),	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)						111.0	106.0	108.0					10																	119029956		2203	4300	6503	SO:0001819	synonymous_variant	6571				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity	g.chr10:119029956T>A	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.1422T>A	10.37:g.119029956T>A			Somatic				SLC18A2_uc009xyy.1_Silent_p.P271P	p.P474P	NM_003054	NP_003045	WXS	Illumina HiSeq	Unspecified	Q05940	VMAT2_HUMAN		all cancers(201;0.029)	15	1453	+		Colorectal(252;0.19)	474			Cytoplasmic (Potential).		B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Silent	SNP	ENST00000298472.5	37	c.1422T>A	CCDS7599.1																																																																																				0.378	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054		4	59	0	0	0	0.000602	0	4	59				
PSTK	118672	broad.mit.edu	37	10	124740146	124740146	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:124740146G>A	ENST00000368887.3	+	1	591	c.151G>A	c.(151-153)Ggt>Agt	p.G51S	PSTK_ENST00000405485.1_Missense_Mutation_p.G51S	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	51					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)	p.G51S(1)		endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		TTGGGCCATCGGTGTTGTCGC	0.716											OREG0020597	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001lgy.1		NA																	1	Substitution - Missense(1)		lung(1)	liver(1)	1						c.(151-153)GGT>AGT		phosphoseryl-tRNA kinase							16.0	16.0	16.0					10																	124740146		2166	4244	6410	SO:0001583	missense	118672						ATP binding|kinase activity	g.chr10:124740146G>A	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.151G>A	10.37:g.124740146G>A	ENSP00000357882:p.Gly51Ser		Somatic	OREG0020597	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1536		p.G51S	NM_153336	NP_699167	WXS	Illumina HiSeq	Unspecified	Q8IV42	PSTK_HUMAN		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)	1	591	+		all_neural(114;0.169)|Glioma(114;0.222)	51					Q6ZSS9	Missense_Mutation	SNP	ENST00000368887.3	37	c.151G>A	CCDS7633.1	.	.	.	.	.	.	.	.	.	.	G	7.901	0.734433	0.15574	.	.	ENSG00000179988	ENST00000368887;ENST00000405485	T;T	0.48201	0.82;1.62	4.31	3.39	0.38822	.	0.486060	0.20509	N	0.090931	T	0.30070	0.0753	L	0.45352	1.415	0.09310	N	0.999999	P	0.37914	0.611	B	0.24394	0.053	T	0.13495	-1.0507	10	0.09843	T	0.71	-14.7126	11.2396	0.48962	0.0:0.0:0.8155:0.1845	.	51	Q8IV42	PSTK_HUMAN	S	51	ENSP00000357882:G51S;ENSP00000384764:G51S	ENSP00000357882:G51S	G	+	1	0	PSTK	124730136	0.125000	0.22332	0.614000	0.29051	0.158000	0.22134	1.840000	0.39230	1.018000	0.39521	0.655000	0.94253	GGT		0.716	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	NM_153336		3	17	0	0	0	0.000602	0	3	17				
EBF3	253738	broad.mit.edu	37	10	131640445	131640445	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr10:131640445C>G	ENST00000355311.5	-	13	1379	c.1307G>C	c.(1306-1308)gGc>gCc	p.G436A	EBF3_ENST00000368648.3_Missense_Mutation_p.G427A|MIR4297_ENST00000579857.1_RNA			Q9H4W6	COE3_HUMAN	early B-cell factor 3	436					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G427A(1)|p.G436A(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GGAGTTGACGCCCATCATGCC	0.617																																							uc001lki.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(1279-1281)GGC>GCC		early B-cell factor 3							269.0	205.0	227.0					10																	131640445		2203	4300	6503	SO:0001583	missense	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131640445C>G		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1307G>C	10.37:g.131640445C>G	ENSP00000347463:p.Gly436Ala		Somatic					p.G427A	NM_001005463	NP_001005463	WXS	Illumina HiSeq	Unspecified	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	13	1339	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	436					A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37	c.1280G>C		.	.	.	.	.	.	.	.	.	.	C	19.45	3.829564	0.71258	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.47177	0.85;0.85	5.28	5.28	0.74379	.	0.047202	0.85682	D	0.000000	T	0.52613	0.1745	M	0.68593	2.085	0.80722	D	1	B	0.14012	0.009	B	0.26770	0.073	T	0.50406	-0.8832	10	0.45353	T	0.12	-13.3079	19.2947	0.94117	0.0:1.0:0.0:0.0	.	427	Q9H4W6-2	.	A	436;427	ENSP00000347463:G436A;ENSP00000357637:G427A	ENSP00000347463:G436A	G	-	2	0	EBF3	131530435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.743000	0.85020	2.632000	0.89209	0.655000	0.94253	GGC		0.617	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		5	118	0	0	0	0.001984	0	5	118				
MMP26	56547	broad.mit.edu	37	11	5011842	5011842	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:5011842C>A	ENST00000380390.1	+	4	551	c.335C>A	c.(334-336)cCa>cAa	p.P112Q	MMP26_ENST00000300762.1_Missense_Mutation_p.P112Q			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	112					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P112Q(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	ATCAATTACCCACATGATATG	0.388																																							uc001lzv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)CCA>CAA		matrix metalloproteinase 26 preproprotein							94.0	89.0	91.0					11																	5011842		2201	4298	6499	SO:0001583	missense	56547				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:5011842C>A	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.335C>A	11.37:g.5011842C>A	ENSP00000369753:p.Pro112Gln		Somatic					p.P112Q	NM_021801	NP_068573	WXS	Illumina HiSeq	Unspecified	Q9NRE1	MMP26_HUMAN		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	3	353	+		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)	112					Q3MJ78|Q9GZS2|Q9NR87	Missense_Mutation	SNP	ENST00000380390.1	37	c.335C>A	CCDS7752.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649472	0.67358	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	T;T	0.20332	2.08;2.08	4.12	4.12	0.48240	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.161338	0.28577	N	0.014860	T	0.40645	0.1125	L	0.53780	1.695	0.26832	N	0.968552	D	0.89917	1.0	D	0.75484	0.986	T	0.17167	-1.0378	10	0.72032	D	0.01	-6.8002	13.8898	0.63731	0.0:1.0:0.0:0.0	.	112	Q9NRE1	MMP26_HUMAN	Q	112	ENSP00000369753:P112Q;ENSP00000300762:P112Q	ENSP00000300762:P112Q	P	+	2	0	MMP26	4968418	0.939000	0.31865	0.471000	0.27229	0.461000	0.32589	3.687000	0.54692	1.837000	0.53436	0.650000	0.86243	CCA		0.388	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142058.3	NM_021801		6	77	1	0	3.59834e-05	0.001168	4.72747e-05	6	77				
OR51B5	282763	broad.mit.edu	37	11	5364598	5364598	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:5364598G>T	ENST00000300773.2	-	1	211	c.157C>A	c.(157-159)Ctt>Att	p.L53I	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	53					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L53I(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTCATGAAGATTGTGATCT	0.502																																							uc001map.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(157-159)CTT>ATT		olfactory receptor, family 51, subfamily B,							66.0	71.0	69.0					11																	5364598		2201	4297	6498	SO:0001583	missense	282763				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5364598G>T	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.157C>A	11.37:g.5364598G>T	ENSP00000300773:p.Leu53Ile		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Missense_Mutation_p.L53I	p.L53I	NM_001005567	NP_001005567	WXS	Illumina HiSeq	Unspecified	Q9H339	O51B5_HUMAN		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	157	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	53			Helical; Name=2; (Potential).		B2RN59	Missense_Mutation	SNP	ENST00000300773.2	37	c.157C>A	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.415020	0.42817	.	.	ENSG00000242180	ENST00000300773	T	0.13778	2.56	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35466	N	0.003192	T	0.53818	0.1820	H	0.97758	4.07	0.33048	D	0.532302	D	0.89917	1.0	D	0.87578	0.998	T	0.77330	-0.2628	10	0.87932	D	0	.	16.5938	0.84789	0.0:0.0:1.0:0.0	.	53	Q9H339	O51B5_HUMAN	I	53	ENSP00000300773:L53I	ENSP00000300773:L53I	L	-	1	0	OR51B5	5321174	1.000000	0.71417	0.051000	0.19133	0.019000	0.09904	6.063000	0.71162	2.482000	0.83794	0.650000	0.86243	CTT		0.502	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		7	64	1	0	2.0095e-06	0.001984	2.9334e-06	7	64				
TRIM6	117854	broad.mit.edu	37	11	5624904	5624904	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:5624904G>A	ENST00000278302.5	+	2	502	c.362G>A	c.(361-363)cGg>cAg	p.R121Q	TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.R149Q|TRIM6_ENST00000515022.1_Intron|HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000506134.1_Intron|TRIM6_ENST00000380107.1_Missense_Mutation_p.R95Q|TRIM6_ENST00000380097.3_Missense_Mutation_p.R149Q|TRIM6_ENST00000445329.1_5'UTR|TRIM6_ENST00000507320.1_5'UTR	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	121					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.R149Q(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTTTGTGAGCGGTCTCAGGAG	0.557																																							uc001mbf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(445-447)CGG>CAG		tripartite motif-containing 6 and tripartite							129.0	121.0	124.0					11																	5624904		2201	4297	6498	SO:0001583	missense	445372					intracellular	zinc ion binding	g.chr11:5624904G>A	AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.362G>A	11.37:g.5624904G>A	ENSP00000278302:p.Arg121Gln		Somatic				HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.R95Q|TRIM6_uc010qzj.1_5'UTR|TRIM6_uc001mbc.1_Missense_Mutation_p.R121Q|TRIM6_uc001mbe.2_5'UTR|TRIM6_uc010qzk.1_Intron|TRIM6_uc010qzl.1_Intron|TRIM6_uc001mbd.2_Missense_Mutation_p.R149Q|TRIM6_uc001mbg.1_5'Flank|TRIM6_uc009yep.1_5'Flank	p.R149Q	NM_001003819	NP_001003819	WXS	Illumina HiSeq	Unspecified	B2RNG4	B2RNG4_HUMAN		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)	2	690	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	149					A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	ENST00000278302.5	37	c.446G>A	CCDS31390.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202301	0.58234	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000396867;ENST00000337072;ENST00000354852	T;T;T;T	0.56444	1.02;0.46;1.02;1.02	4.09	2.22	0.28083	Zinc finger, B-box (3);	.	.	.	.	T	0.52403	0.1732	N	0.21097	0.63	0.09310	N	1	D;P;D;D	0.89917	0.977;0.801;1.0;1.0	B;P;D;D	0.87578	0.425;0.59;0.996;0.998	T	0.35574	-0.9783	9	0.27082	T	0.32	.	6.2483	0.20832	0.2241:0.0:0.7759:0.0	.	95;149;149;121	E9PFM0;B2RNG4;Q9C030-2;Q9C030	.;.;.;TRIM6_HUMAN	Q	121;95;149;28;149;149	ENSP00000278302:R121Q;ENSP00000369450:R95Q;ENSP00000369440:R149Q;ENSP00000346916:R149Q	ENSP00000278302:R121Q	R	+	2	0	TRIM34;TRIM6;TRIM6-TRIM34	5581480	0.000000	0.05858	0.718000	0.30602	0.883000	0.51084	0.214000	0.17541	0.673000	0.31224	0.655000	0.94253	CGG		0.557	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143376.2	NM_001003818		6	86	0	0	0	0.001984	0	6	86				
OR52E6	390078	broad.mit.edu	37	11	5862540	5862540	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:5862540G>T	ENST00000329322.5	-	1	587	c.588C>A	c.(586-588)gtC>gtA	p.V196V	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Silent_p.V200V	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V200V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACATAATGTTGACTTTGATGC	0.463																																							uc010qzq.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(586-588)GTC>GTA		olfactory receptor, family 52, subfamily E,							93.0	88.0	90.0					11																	5862540		2201	4296	6497	SO:0001819	synonymous_variant	390078				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5862540G>T	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.588C>A	11.37:g.5862540G>T			Somatic				TRIM5_uc001mbq.1_Intron	p.V196V	NM_001005167	NP_001005167	WXS	Illumina HiSeq	Unspecified	Q96RD3	O52E6_HUMAN		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	588	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	196			Extracellular (Potential).		Q6IFF8	Silent	SNP	ENST00000329322.5	37	c.588C>A	CCDS53597.1																																																																																				0.463	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167		27	85	1	0	1.17739e-12	0.005443	2.14635e-12	27	85				
DCHS1	8642	broad.mit.edu	37	11	6650685	6650685	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:6650685G>A	ENST00000299441.3	-	12	5570	c.5159C>T	c.(5158-5160)aCa>aTa	p.T1720I	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1720	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1720I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACATGTACCTGTCAGGTTGAT	0.493																																							uc001mem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|pancreas(1)	5						c.(5158-5160)ACA>ATA		dachsous 1 precursor							85.0	80.0	82.0					11																	6650685		2201	4296	6497	SO:0001583	missense	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6650685G>A	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5159C>T	11.37:g.6650685G>A	ENSP00000299441:p.Thr1720Ile		Somatic					p.T1720I	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	12	5569	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	1720			Cadherin 16.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	c.5159C>T	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119573	0.77323	.	.	ENSG00000166341	ENST00000299441	T	0.02890	4.12	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	0.000000	0.49916	D	0.000130	T	0.08626	0.0214	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.42783	-0.9431	10	0.32370	T	0.25	.	15.482	0.75534	0.0:0.0:1.0:0.0	.	1720	Q96JQ0	PCD16_HUMAN	I	1720	ENSP00000299441:T1720I	ENSP00000299441:T1720I	T	-	2	0	DCHS1	6607261	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.781000	0.68964	2.687000	0.91594	0.563000	0.77884	ACA		0.493	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		5	20	0	0	0	0.000602	0	5	20				
OR2AG1	144125	broad.mit.edu	37	11	6806622	6806622	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:6806622G>T	ENST00000307401.4	+	1	375	c.354G>T	c.(352-354)atG>atT	p.M118I		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M118I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGGCCTTCATGGCCTATGACA	0.547																																							uc001mer.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(352-354)ATG>ATT		olfactory receptor, family 2, subfamily AG,							98.0	86.0	90.0					11																	6806622		2201	4296	6497	SO:0001583	missense	144125				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6806622G>T	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.354G>T	11.37:g.6806622G>T	ENSP00000307447:p.Met118Ile		Somatic					p.M118I	NM_001004489	NP_001004489	WXS	Illumina HiSeq	Unspecified	Q9H205	O2AG1_HUMAN		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	354	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	118			Helical; Name=3; (Potential).		B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	ENST00000307401.4	37	c.354G>T	CCDS31414.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188490	0.78789	.	.	ENSG00000170803	ENST00000307401	T	0.01126	5.3	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000013	T	0.11153	0.0272	H	0.95982	3.75	0.47698	D	0.999491	D	0.71674	0.998	D	0.81914	0.995	T	0.02020	-1.1228	10	0.87932	D	0	.	13.7659	0.62995	0.0:0.0:1.0:0.0	.	118	Q9H205	O2AG1_HUMAN	I	118	ENSP00000307447:M118I	ENSP00000307447:M118I	M	+	3	0	OR2AG1	6763198	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.226000	0.95229	2.171000	0.68590	0.591000	0.81541	ATG		0.547	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489		9	67	1	0	1.12685e-05	0.004482	1.57264e-05	9	67				
SYT9	143425	broad.mit.edu	37	11	7324269	7324269	+	Splice_Site	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:7324269G>C	ENST00000318881.6	+	2	382		c.e2-1		SYT9_ENST00000396716.2_Splice_Site	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX						positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.?(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CTTCTTTGCAGATATCTCAGT	0.537																																							uc001mfe.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.e2-1		synaptotagmin IX							154.0	137.0	143.0					11																	7324269		2201	4296	6497	SO:0001630	splice_region_variant	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7324269G>C	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.146-1G>C	11.37:g.7324269G>C			Somatic				SYT9_uc001mfd.2_Splice_Site|SYT9_uc009yfi.2_Splice_Site	p.D49_splice	NM_175733	NP_783860	WXS	Illumina HiSeq	Unspecified	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	2	383	+									Splice_Site	SNP	ENST00000318881.6	37	c.146_splice	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514015	0.85389	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.799	0.88580	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYT9	7280845	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.444000	0.97578	2.814000	0.96858	0.650000	0.86243	.		0.537	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	Intron	19	131	0	0	0	0.001882	0	19	131				
LUZP2	338645	broad.mit.edu	37	11	25098875	25098875	+	Splice_Site	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:25098875G>A	ENST00000336930.6	+	11	925	c.859G>A	c.(859-861)Gag>Aag	p.E287K	LUZP2_ENST00000533227.1_Splice_Site_p.E201K			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	287						extracellular region (GO:0005576)		p.E287K(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						ACTTTTGTAGGAGGGCAGACC	0.408																																							uc001mqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(859-861)GAG>AAG		leucine zipper protein 2 precursor							126.0	127.0	126.0					11																	25098875		2203	4300	6503	SO:0001630	splice_region_variant	338645					extracellular region		g.chr11:25098875G>A	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.859-1G>A	11.37:g.25098875G>A			Somatic				LUZP2_uc009yif.2_Missense_Mutation_p.E201K|LUZP2_uc009yig.2_Missense_Mutation_p.E245K	p.E287K	NM_001009909	NP_001009909	WXS	Illumina HiSeq	Unspecified	Q86TE4	LUZP2_HUMAN			11	1093	+			287					A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	c.859G>A	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711884	0.30322	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.50001	0.76;0.76	5.17	5.17	0.71159	.	0.561427	0.16574	N	0.208508	T	0.33177	0.0854	N	0.24115	0.695	0.80722	D	1	B;B	0.30281	0.275;0.13	B;B	0.24848	0.056;0.056	T	0.10337	-1.0634	9	.	.	.	-1.2503	14.5043	0.67743	0.0:0.0:1.0:0.0	.	201;287	E9PN53;Q86TE4	.;LUZP2_HUMAN	K	287;201	ENSP00000336817:E287K;ENSP00000432952:E201K	.	E	+	1	0	LUZP2	25055451	0.997000	0.39634	0.328000	0.25416	0.030000	0.12068	2.929000	0.48916	2.558000	0.86282	0.551000	0.68910	GAG		0.408	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	Missense_Mutation	9	156	0	0	0	0.004482	0	9	156				
LDLRAD3	143458	broad.mit.edu	37	11	36057670	36057670	+	Missense_Mutation	SNP	G	G	C	rs144816501	byFrequency	TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:36057670G>C	ENST00000315571.5	+	2	85	c.64G>C	c.(64-66)Ggg>Cgg	p.G22R	LDLRAD3_ENST00000528989.1_Intron|LDLRAD3_ENST00000524419.1_Intron	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	22					receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.G22R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				GCTGCTCCCCGGGAACAACTT	0.597																																							uc001mwk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(64-66)GGG>CGG		low density lipoprotein receptor class A domain							80.0	72.0	75.0					11																	36057670		2202	4298	6500	SO:0001583	missense	143458					integral to membrane	receptor activity	g.chr11:36057670G>C	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.64G>C	11.37:g.36057670G>C	ENSP00000318607:p.Gly22Arg		Somatic				LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron	p.G22R	NM_174902	NP_777562	WXS	Illumina HiSeq	Unspecified	Q86YD5	LRAD3_HUMAN			2	101	+	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)	22			Extracellular (Potential).		B7Z1U3|B9EG81|Q8NBJ0	Missense_Mutation	SNP	ENST00000315571.5	37	c.64G>C	CCDS31462.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456518	0.84317	.	.	ENSG00000179241	ENST00000545142;ENST00000315571	D	0.93133	-3.17	5.1	5.1	0.69264	.	0.117158	0.56097	D	0.000024	D	0.96433	0.8836	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96190	0.9137	10	0.49607	T	0.09	.	17.8777	0.88830	0.0:0.0:1.0:0.0	.	22	Q86YD5	LRAD3_HUMAN	R	22	ENSP00000318607:G22R	ENSP00000318607:G22R	G	+	1	0	LDLRAD3	36014246	1.000000	0.71417	0.953000	0.39169	0.701000	0.40568	7.133000	0.77259	2.537000	0.85549	0.655000	0.94253	GGG		0.597	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902		3	57	0	0	0	0.004672	0	3	57				
OR4A5	81318	broad.mit.edu	37	11	51412225	51412225	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:51412225C>T	ENST00000319760.6	-	1	223	c.171G>A	c.(169-171)atG>atA	p.M57I		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M57I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				GGAAGAAATACATTGGGGAAC	0.403																																							uc001nhi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(169-171)ATG>ATA		olfactory receptor, family 4, subfamily A,							60.0	58.0	59.0					11																	51412225		2201	4296	6497	SO:0001583	missense	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51412225C>T	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.171G>A	11.37:g.51412225C>T	ENSP00000367664:p.Met57Ile		Somatic					p.M57I	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	171	-		all_lung(304;0.236)	57			Helical; Name=2; (Potential).		Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	c.171G>A	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	7.317	0.616119	0.14129	.	.	ENSG00000221840	ENST00000319760	T	0.09350	2.99	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000020	T	0.26484	0.0647	H	0.97707	4.06	0.29998	N	0.816271	B	0.17268	0.021	B	0.24974	0.057	T	0.36504	-0.9745	10	0.72032	D	0.01	.	9.9079	0.41388	0.0:1.0:0.0:0.0	.	57	Q8NH83	OR4A5_HUMAN	I	57	ENSP00000367664:M57I	ENSP00000367664:M57I	M	-	3	0	OR4A5	51268801	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	4.803000	0.62546	1.394000	0.46624	0.162000	0.16502	ATG		0.403	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		4	61	0	0	0	0.000248	0	4	61				
OR4P4	81300	broad.mit.edu	37	11	55406405	55406406	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:55406405_55406406AC>CA	ENST00000314612.2	+	1	572_573	c.572_573AC>CA	c.(571-573)cAC>cCA	p.H191P		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H191P(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						TCTAATATACACATGATAGGTC	0.356																																							uc010rij.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(571-573)CAC>CCA		olfactory receptor, family 4, subfamily P,																																				SO:0001583	missense	81300				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55406405_55406406AC>CA	AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	Exception_encountered	11.37:g.55406405_55406406delinsCA	ENSP00000324831:p.His191Pro		Somatic					p.H191P	NM_001004124	NP_001004124	WXS	Illumina HiSeq	Unspecified	Q8NGL7	OR4P4_HUMAN			1	572_573	+			191			Extracellular (Potential).			Missense_Mutation	DNP	ENST00000314612.2	37	c.572_573AC>CA	CCDS31504.1																																																																																				0.356	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383356.1	NM_001004124		9	44	0	0	0	0.004672	0	9	44				
OR5L2	26338	broad.mit.edu	37	11	55594859	55594859	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:55594859C>A	ENST00000378397.1	+	1	165	c.165C>A	c.(163-165)ctC>ctA	p.L55L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L55L(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GCTCTCGGCTCCACACCCCCG	0.468										HNSCC(27;0.073)																													uc001nhy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(163-165)CTC>CTA		olfactory receptor, family 5, subfamily L,							269.0	242.0	251.0					11																	55594859		2200	4296	6496	SO:0001819	synonymous_variant	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594859C>A	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.165C>A	11.37:g.55594859C>A		HNSCC(27;0.073)	Somatic					p.L55L	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	165	+		all_epithelial(135;0.208)	55			Helical; Name=2; (Potential).		Q6IF66|Q96RB2	Silent	SNP	ENST00000378397.1	37	c.165C>A	CCDS31511.1																																																																																				0.468	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		20	309	1	0	2.4624e-09	0.008871	4.13292e-09	20	309				
P2RX3	5024	broad.mit.edu	37	11	57114033	57114033	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:57114033C>T	ENST00000263314.2	+	2	169	c.135C>T	c.(133-135)caC>caT	p.H45H		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	45					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)	p.H45H(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						TTTTCTTGCACGAGAAGGCTT	0.547																																							uc001nju.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(133-135)CAC>CAT		purinergic receptor P2X3							124.0	103.0	110.0					11																	57114033		2201	4296	6497	SO:0001819	synonymous_variant	5024				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity	g.chr11:57114033C>T	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.135C>T	11.37:g.57114033C>T			Somatic					p.H45H	NM_002559	NP_002550	WXS	Illumina HiSeq	Unspecified	P56373	P2RX3_HUMAN			2	211	+			45			Extracellular (Potential).		Q6DK37|Q9UQB6	Silent	SNP	ENST00000263314.2	37	c.135C>T	CCDS7953.1																																																																																				0.547	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559		5	53	0	0	0	0.000602	0	5	53				
OR5B17	219965	broad.mit.edu	37	11	58125859	58125859	+	Silent	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:58125859T>A	ENST00000357377.3	-	1	683	c.684A>T	c.(682-684)acA>acT	p.T228T		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T228T(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ATCCCTTACCTGTGTGCCTCT	0.348																																							uc010rke.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(682-684)ACA>ACT		olfactory receptor, family 5, subfamily B,							92.0	88.0	90.0					11																	58125859		2201	4295	6496	SO:0001819	synonymous_variant	219965				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58125859T>A	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.684A>T	11.37:g.58125859T>A			Somatic					p.T228T	NM_001005489	NP_001005489	WXS	Illumina HiSeq	Unspecified	Q8NGF7	OR5BH_HUMAN			1	684	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	228			Cytoplasmic (Potential).		Q6IEX1	Silent	SNP	ENST00000357377.3	37	c.684A>T	CCDS31548.1																																																																																				0.348	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489		12	39	0	0	0	0.000978	0	12	39				
VWCE	220001	broad.mit.edu	37	11	61026563	61026563	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:61026563C>T	ENST00000335613.5	-	20	2838	c.2452G>A	c.(2452-2454)Gca>Aca	p.A818T	VWCE_ENST00000535710.1_Missense_Mutation_p.A283T	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	818						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.A818T(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGAGCTCCTGCCGGGCTTGTA	0.602																																							uc001nra.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2452-2454)GCA>ACA		von Willebrand factor C and EGF domains							56.0	58.0	57.0					11																	61026563		2203	4299	6502	SO:0001583	missense	220001					extracellular region	calcium ion binding	g.chr11:61026563C>T	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2452G>A	11.37:g.61026563C>T	ENSP00000334186:p.Ala818Thr		Somatic				VWCE_uc001nrb.2_RNA	p.A818T	NM_152718	NP_689931	WXS	Illumina HiSeq	Unspecified	Q96DN2	VWCE_HUMAN			20	2731	-			818					A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	c.2452G>A	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783004	0.31593	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.68765	-0.35;3.53	4.42	-0.972	0.10300	.	1.030570	0.07786	N	0.954175	T	0.50103	0.1596	L	0.34521	1.04	0.09310	N	1	B	0.17038	0.02	B	0.15052	0.012	T	0.35351	-0.9792	10	0.38643	T	0.18	.	4.4619	0.11669	0.3325:0.2264:0.4411:0.0	.	818	Q96DN2	VWCE_HUMAN	T	818;283	ENSP00000334186:A818T;ENSP00000442570:A283T	ENSP00000334186:A818T	A	-	1	0	VWCE	60783139	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.253000	0.18296	-0.047000	0.13423	-0.467000	0.05162	GCA		0.602	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718		9	40	0	0	0	0.004482	0	9	40				
DDB1	1642	broad.mit.edu	37	11	61084039	61084039	+	Splice_Site	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:61084039C>A	ENST00000301764.7	-	11	1623	c.1226G>T	c.(1225-1227)gGa>gTa	p.G409V	DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	409	Interaction with CDT1.|WD repeat beta-propeller B; Interaction with CUL4A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)	p.G409V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						TGGCCATAATCCTGGAACAAG	0.522								Nucleotide excision repair (NER)																															uc001nrc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)	4						c.(1225-1227)GGA>GTA	NER	damage-specific DNA binding protein 1							139.0	123.0	129.0					11																	61084039		2203	4299	6502	SO:0001630	splice_region_variant	1642				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding	g.chr11:61084039C>A	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.1226-1G>T	11.37:g.61084039C>A			Somatic				DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Missense_Mutation_p.G409V|DDB1_uc010rlg.1_RNA|DDB1_uc001nrd.2_Missense_Mutation_p.G409V	p.G409V	NM_001923	NP_001914	WXS	Illumina HiSeq	Unspecified	Q16531	DDB1_HUMAN			11	1452	-			409			Interaction with CDT1.|Interaction with CUL4A.		A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	37	c.1226G>T	CCDS31576.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780346	0.90195	.	.	ENSG00000167986	ENST00000301764;ENST00000535967;ENST00000539739;ENST00000535174	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.76543	0.4002	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82566	-0.0393	10	0.87932	D	0	.	18.8332	0.92150	0.0:1.0:0.0:0.0	.	409;409	B7Z2A1;Q16531	.;DDB1_HUMAN	V	409;60;128;192	ENSP00000301764:G409V;ENSP00000437713:G60V;ENSP00000445563:G128V;ENSP00000446044:G192V	ENSP00000301764:G409V	G	-	2	0	DDB1	60840615	1.000000	0.71417	0.982000	0.44146	0.992000	0.81027	7.748000	0.85085	2.464000	0.83262	0.655000	0.94253	GGA		0.522	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	Missense_Mutation	24	105	1	0	2.21704e-12	0.00278	3.96568e-12	24	105				
CCDC88B	283234	broad.mit.edu	37	11	64111737	64111737	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:64111737C>G	ENST00000356786.5	+	14	1768	c.1724C>G	c.(1723-1725)tCc>tGc	p.S575C	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	575						membrane (GO:0016020)		p.S575C(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCAGACTGGTCCCCGCAAGAG	0.642																																							uc001nzy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1723-1725)TCC>TGC		coiled-coil domain containing 88							42.0	47.0	45.0					11																	64111737		2201	4297	6498	SO:0001583	missense	283234				microtubule cytoskeleton organization	cytoplasm	microtubule binding	g.chr11:64111737C>G	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1724C>G	11.37:g.64111737C>G	ENSP00000349238:p.Ser575Cys		Somatic				CCDC88B_uc009ypo.1_Missense_Mutation_p.S572C|CCDC88B_uc001nzz.1_Missense_Mutation_p.S224C	p.S575C	NM_032251	NP_115627	WXS	Illumina HiSeq	Unspecified	A6NC98	CC88B_HUMAN			14	1768	+			575					A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	c.1724C>G	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	c	11.04	1.521499	0.27211	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.23950	1.88	2.9	-0.285	0.12866	.	.	.	.	.	T	0.12902	0.0313	N	0.14661	0.345	0.18873	N	0.999981	B;P;B	0.46327	0.41;0.876;0.41	B;B;B	0.40982	0.204;0.345;0.204	T	0.14476	-1.0471	9	0.56958	D	0.05	.	4.5154	0.11932	0.0:0.5764:0.1835:0.2401	.	575;224;575	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	C	575	ENSP00000349238:S575C	ENSP00000349238:S575C	S	+	2	0	CCDC88B	63868313	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	0.005000	0.13129	-0.038000	0.13624	0.450000	0.29827	TCC		0.642	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251		4	44	0	0	0	0.000248	0	4	44				
IGHMBP2	3508	broad.mit.edu	37	11	68682307	68682307	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:68682307C>T	ENST00000255078.3	+	6	839	c.728C>T	c.(727-729)cCc>cTc	p.P243L	IGHMBP2_ENST00000539224.1_3'UTR	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	243					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)	p.P243L(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGCTGCGCCCCCTCCAACATC	0.532																																							uc001ook.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(727-729)CCC>CTC		immunoglobulin mu binding protein 2							92.0	92.0	92.0					11																	68682307		2200	4294	6494	SO:0001583	missense	3508				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding	g.chr11:68682307C>T	L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.728C>T	11.37:g.68682307C>T	ENSP00000255078:p.Pro243Leu		Somatic				IGHMBP2_uc001ooj.1_RNA	p.P243L	NM_002180	NP_002171	WXS	Illumina HiSeq	Unspecified	P38935	SMBP2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		6	830	+			243					A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	ENST00000255078.3	37	c.728C>T	CCDS8187.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127532	0.77549	.	.	ENSG00000132740	ENST00000255078	D	0.84070	-1.8	3.6	3.6	0.41247	DEAD-like helicase (1);Helicase/UvrB domain (1);ATPase, AAA+ type, core (1);	0.251019	0.41712	D	0.000838	D	0.92554	0.7635	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94382	0.7605	10	0.87932	D	0	-15.1694	14.5169	0.67826	0.0:1.0:0.0:0.0	.	243	P38935	SMBP2_HUMAN	L	243	ENSP00000255078:P243L	ENSP00000255078:P243L	P	+	2	0	IGHMBP2	68438883	1.000000	0.71417	0.957000	0.39632	0.680000	0.39746	7.065000	0.76727	2.017000	0.59298	0.555000	0.69702	CCC		0.532	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180		8	74	0	0	0	0.004482	0	8	74				
PAK1	5058	broad.mit.edu	37	11	77051741	77051741	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:77051741C>A	ENST00000356341.3	-	11	1597	c.1066G>T	c.(1066-1068)Gtg>Ttg	p.V356L	PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000530617.1_Missense_Mutation_p.V356L|PAK1_ENST00000278568.4_Missense_Mutation_p.V356L|PAK1_ENST00000528203.1_Missense_Mutation_p.V258L	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	356	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V356L(2)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					GTTTCTGTCACCACATCTGTC	0.507																																							uc001oyh.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|stomach(1)|lung(1)	4						c.(1066-1068)GTG>TTG		p21-activated kinase 1 isoform 2							280.0	248.0	259.0					11																	77051741		2200	4292	6492	SO:0001583	missense	5058				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity	g.chr11:77051741C>A	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1066G>T	11.37:g.77051741C>A	ENSP00000348696:p.Val356Leu		Somatic				PAK1_uc010rso.1_Missense_Mutation_p.V258L|PAK1_uc001oyg.3_Missense_Mutation_p.V356L|PAK1_uc001oyi.1_Missense_Mutation_p.V356L|PAK1_uc010rsn.1_Missense_Mutation_p.V69L	p.V356L	NM_002576	NP_002567	WXS	Illumina HiSeq	Unspecified	Q13153	PAK1_HUMAN			11	1599	-	all_cancers(14;1.75e-18)		356			Protein kinase.		O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	37	c.1066G>T	CCDS8250.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.247150|5.247150	0.95305|0.95305	.|.	.|.	ENSG00000149269|ENSG00000149269	ENST00000533285|ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	.|T;T;T;T	.|0.60797	.|0.16;0.16;0.16;0.16	5.81|5.81	5.81|5.81	0.92471|0.92471	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52435|0.52435	0.1734|0.1734	N|N	0.01019|0.01019	-1.045|-1.045	0.80722|0.80722	D|D	1|1	.|D;B;B;B	.|0.60575	.|0.988;0.034;0.17;0.447	.|D;B;B;B	.|0.74348	.|0.983;0.311;0.433;0.416	T|T	0.74182|0.74182	-0.3748|-0.3748	5|10	.|0.87932	.|D	.|0	.|.	20.089|20.089	0.97809|0.97809	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|258;356;356;356	.|E9PM17;B3KNX7;Q13153;Q13153-2	.|.;.;PAK1_HUMAN;.	V|L	77|356;356;356;258	.|ENSP00000348696:V356L;ENSP00000433423:V356L;ENSP00000278568:V356L;ENSP00000433211:V258L	.|ENSP00000278568:V356L	G|V	-|-	2|1	0|0	PAK1|PAK1	76729389|76729389	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.487000|7.487000	0.81328|0.81328	2.752000|2.752000	0.94435|0.94435	0.557000|0.557000	0.71058|0.71058	GGT|GTG		0.507	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576		40	240	1	0	5.44703e-19	0.002222	1.04814e-18	40	240				
CASP5	838	broad.mit.edu	37	11	104874001	104874001	+	Splice_Site	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:104874001C>A	ENST00000260315.3	-	4	542	c.543G>T	c.(541-543)gaG>gaT	p.E181D	CASP5_ENST00000531367.1_Splice_Site_p.E39D|CASP5_ENST00000393141.2_Splice_Site_p.E194D|CASP5_ENST00000393139.2_Intron|CASP5_ENST00000444749.2_Splice_Site_p.E123D|CASP5_ENST00000418434.1_Splice_Site_p.E39D|CASP5_ENST00000526056.1_Splice_Site_p.E194D			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	181					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.E165D(1)|p.E194D(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		AGCACAGCACCTCATCATGAT	0.398																																							uc010rva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)	3						c.(541-543)GAG>GAT		caspase 5 isoform a precursor							123.0	123.0	123.0					11																	104874001		2202	4299	6501	SO:0001630	splice_region_variant	838				apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding	g.chr11:104874001C>A		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.543+1G>T	11.37:g.104874001C>A			Somatic				CASP5_uc010ruz.1_Missense_Mutation_p.E194D|CASP5_uc010rvb.1_Missense_Mutation_p.E123D|CASP5_uc010rvc.1_Missense_Mutation_p.E39D|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	p.E181D	NM_004347	NP_004338	WXS	Illumina HiSeq	Unspecified	P51878	CASP5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)	4	575	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	181					B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	c.543G>T	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	.	12.81	2.048971	0.36181	.	.	ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367;ENST00000456094	T;T;T;T;T;T;T	0.12879	3.94;3.94;3.94;3.94;3.94;3.94;2.64	4.19	3.26	0.37387	.	0.500610	0.19000	N	0.125361	T	0.25938	0.0632	M	0.86178	2.8	0.80722	D	1	B;P;B;P	0.43314	0.146;0.803;0.314;0.596	B;P;B;P	0.47744	0.174;0.523;0.354;0.556	T	0.01688	-1.1295	9	.	.	.	.	7.455	0.27261	0.0:0.8726:0.0:0.1274	.	39;123;181;194	P51878-3;P51878-2;P51878;P51878-5	.;.;CASP5_HUMAN;.	D	194;39;181;123;194;39;165	ENSP00000376849:E194D;ENSP00000398130:E39D;ENSP00000260315:E181D;ENSP00000388365:E123D;ENSP00000436877:E194D;ENSP00000434471:E39D;ENSP00000415241:E165D	.	E	-	3	2	CASP5	104379211	0.992000	0.36948	0.347000	0.25668	0.008000	0.06430	1.188000	0.32102	0.857000	0.35407	0.404000	0.27445	GAG		0.398	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	Missense_Mutation	7	104	1	0	8.12818e-05	0.001984	0.000103228	7	104				
SIK2	23235	broad.mit.edu	37	11	111573994	111573994	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr11:111573994C>G	ENST00000304987.3	+	7	968	c.795C>G	c.(793-795)atC>atG	p.I265M		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.I265M(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						TAGCCCAAATCAAGGAGCATA	0.443																																							uc001plt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(793-795)ATC>ATG		SNF1-like kinase 2							121.0	106.0	111.0					11																	111573994		2201	4297	6498	SO:0001583	missense	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111573994C>G	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.795C>G	11.37:g.111573994C>G	ENSP00000305976:p.Ile265Met		Somatic					p.I265M	NM_015191	NP_056006	WXS	Illumina HiSeq	Unspecified	Q9H0K1	SIK2_HUMAN			7	913	+			265			Protein kinase.		A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	c.795C>G	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280195	0.59758	.	.	ENSG00000170145	ENST00000304987	T	0.69435	-0.4	5.57	3.51	0.40186	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.047408	0.85682	D	0.000000	T	0.76564	0.4005	M	0.64567	1.98	0.58432	D	0.999991	D	0.89917	1.0	D	0.87578	0.998	T	0.77763	-0.2466	10	0.87932	D	0	.	9.3376	0.38060	0.2173:0.7018:0.0:0.0809	.	265	Q9H0K1	SIK2_HUMAN	M	265	ENSP00000305976:I265M	ENSP00000305976:I265M	I	+	3	3	SIK2	111079204	0.997000	0.39634	1.000000	0.80357	0.951000	0.60555	0.466000	0.22019	1.358000	0.45922	0.557000	0.71058	ATC		0.443	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		11	56	0	0	0	0.008291	0	11	56				
GALNT8	26290	broad.mit.edu	37	12	4835766	4835766	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:4835766G>A	ENST00000252318.2	+	2	617	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	94					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E94K(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GGCGAAAGATGAAGTACGCCC	0.443																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(280-282)GAA>AAA		polypeptide N-acetylgalactosaminyltransferase 8							63.0	61.0	61.0					12																	4835766		2203	4300	6503	SO:0001583	missense	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4835766G>A	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.280G>A	12.37:g.4835766G>A	ENSP00000252318:p.Glu94Lys		Somatic					p.E94K	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			2	372	+			94			Lumenal (Potential).		B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	c.280G>A	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962553	0.34659	.	.	ENSG00000130035	ENST00000252318	T	0.54675	0.56	3.06	-0.13	0.13498	.	8.130020	0.00424	N	0.000061	T	0.41789	0.1174	L	0.46157	1.445	0.09310	N	1	P	0.42827	0.791	B	0.38755	0.281	T	0.27640	-1.0068	10	0.20046	T	0.44	.	2.9438	0.05839	0.2962:0.2408:0.4629:0.0	.	94	Q9NY28	GALT8_HUMAN	K	94	ENSP00000252318:E94K	ENSP00000252318:E94K	E	+	1	0	GALNT8	4706027	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	0.024000	0.13555	0.484000	0.27630	-0.145000	0.13849	GAA		0.443	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		5	34	0	0	0	0.000602	0	5	34				
GALNT8	26290	broad.mit.edu	37	12	4848400	4848400	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:4848400T>A	ENST00000252318.2	+	3	918	c.581T>A	c.(580-582)cTg>cAg	p.L194Q	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	194	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L194Q(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						AATGAAGCTCTGTCCATTATA	0.423																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(580-582)CTG>CAG		polypeptide N-acetylgalactosaminyltransferase 8							138.0	124.0	129.0					12																	4848400		2203	4300	6503	SO:0001583	missense	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4848400T>A	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.581T>A	12.37:g.4848400T>A	ENSP00000252318:p.Leu194Gln		Somatic					p.L194Q	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			3	673	+			194			Lumenal (Potential).|Catalytic subdomain A.		B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	c.581T>A	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769602	0.49680	.	.	ENSG00000130035	ENST00000252318	T	0.64438	-0.1	4.36	3.16	0.36331	Glycosyl transferase, family 2 (1);	0.000000	0.56097	D	0.000033	T	0.71945	0.3400	L	0.58969	1.84	0.37534	D	0.918058	D	0.89917	1.0	D	0.85130	0.997	T	0.74453	-0.3660	10	0.87932	D	0	.	8.2219	0.31547	0.0:0.0991:0.0:0.9009	.	194	Q9NY28	GALT8_HUMAN	Q	194	ENSP00000252318:L194Q	ENSP00000252318:L194Q	L	+	2	0	GALNT8	4718661	1.000000	0.71417	0.955000	0.39395	0.231000	0.25187	5.325000	0.65869	0.663000	0.31027	0.459000	0.35465	CTG		0.423	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		3	87	0	0	0	0.004672	0	3	87				
PDZRN4	29951	broad.mit.edu	37	12	41966757	41966757	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:41966757G>T	ENST00000402685.2	+	10	2184	c.2176G>T	c.(2176-2178)Gag>Tag	p.E726*	PDZRN4_ENST00000298919.7_Nonsense_Mutation_p.E466*|PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.E468*	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	726							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E468*(1)|p.E726*(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGACATCATGGAGCATCCAGA	0.473																																							uc010skn.1		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11						c.(1579-1581)GAG>TAG		PDZ domain containing RING finger 4 isoform 2							114.0	117.0	116.0					12																	41966757		2203	4300	6503	SO:0001587	stop_gained	29951						ubiquitin-protein ligase activity|zinc ion binding	g.chr12:41966757G>T	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2176G>T	12.37:g.41966757G>T	ENSP00000384197:p.Glu726*		Somatic				PDZRN4_uc001rmq.3_Nonsense_Mutation_p.E468*|PDZRN4_uc009zjz.2_Nonsense_Mutation_p.E466*|PDZRN4_uc001rmr.2_Nonsense_Mutation_p.E353*	p.E527*	NM_013377	NP_037509	WXS	Illumina HiSeq	Unspecified	Q6ZMN7	PZRN4_HUMAN			10	1647	+	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)	726					Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	ENST00000402685.2	37	c.1579G>T	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	40	7.960147	0.98583	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	.	.	.	4.88	4.88	0.63580	.	0.080454	0.50627	D	0.000101	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-30.592	18.9346	0.92580	0.0:0.0:1.0:0.0	.	.	.	.	X	726;468;466	.	ENSP00000298919:E466X	E	+	1	0	PDZRN4	40253024	1.000000	0.71417	0.620000	0.29132	0.977000	0.68977	9.813000	0.99286	2.649000	0.89929	0.650000	0.86243	GAG		0.473	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		13	134	1	0	1.02788e-11	0.00499	1.80472e-11	13	134				
DNAJC14	85406	broad.mit.edu	37	12	56221779	56221779	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:56221779G>A	ENST00000357606.3	-	3	953	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	TMEM198B_ENST00000478241.1_RNA|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317287.5_Missense_Mutation_p.R222W|DNAJC14_ENST00000317269.3_Missense_Mutation_p.R222W			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	222					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R222W(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CGACCCAGCCGATGTCGACCA	0.597																																							uc001shx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(664-666)CGG>TGG		dopamine receptor interacting protein							59.0	56.0	57.0					12																	56221779		2203	4300	6503	SO:0001583	missense	85406				protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding	g.chr12:56221779G>A	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.664C>T	12.37:g.56221779G>A	ENSP00000350223:p.Arg222Trp		Somatic				DNAJC14_uc001shu.1_Missense_Mutation_p.R222W|DNAJC14_uc009zob.1_Missense_Mutation_p.R222W|DNAJC14_uc001shy.1_Missense_Mutation_p.R222W	p.R222W	NM_032364	NP_115740	WXS	Illumina HiSeq	Unspecified	Q6Y2X3	DJC14_HUMAN			2	868	-			222					A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	c.664C>T	CCDS8894.1	.	.	.	.	.	.	.	.	.	.	G	8.600	0.886521	0.17540	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287	T;T;T	0.38401	1.14;1.14;1.14	4.53	1.61	0.23674	.	0.266134	0.31312	N	0.007879	T	0.19967	0.0480	N	0.24115	0.695	0.30871	N	0.732509	P;P	0.48834	0.916;0.916	B;B	0.39876	0.23;0.312	T	0.16541	-1.0399	9	.	.	.	-13.0375	7.9957	0.30267	0.0:0.1501:0.3872:0.4627	.	222;222	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	W	222	ENSP00000350223:R222W;ENSP00000316240:R222W;ENSP00000317500:R222W	.	R	-	1	2	DNAJC14	54508046	0.996000	0.38824	0.882000	0.34594	0.038000	0.13279	0.350000	0.20079	0.223000	0.20920	-0.156000	0.13503	CGG		0.597	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364		4	55	0	0	0	0.000248	0	4	55				
NAV3	89795	broad.mit.edu	37	12	78225279	78225279	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:78225279C>A	ENST00000397909.2	+	1	211	c.38C>A	c.(37-39)cCa>cAa	p.P13Q	NAV3_ENST00000536525.2_Missense_Mutation_p.P13Q|NAV3_ENST00000228327.6_Missense_Mutation_p.P13Q|NAV3_ENST00000266692.7_Missense_Mutation_p.P13Q			Q8IVL0	NAV3_HUMAN	neuron navigator 3	13						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.P13Q(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTGAGGCAGCCAGCTGTTGGG	0.458										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(37-39)CCA>CAA		neuron navigator 3							170.0	169.0	169.0					12																	78225279		1893	4114	6007	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78225279C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.38C>A	12.37:g.78225279C>A	ENSP00000381007:p.Pro13Gln	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.P13Q	p.P13Q	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			1	211	+			13					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.38C>A		.	.	.	.	.	.	.	.	.	.	C	19.35	3.810052	0.70797	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.60797	0.16;1.69;1.68;1.69;1.58	5.54	5.54	0.83059	Calponin homology domain (1);	.	.	.	.	T	0.65554	0.2702	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.68093	-0.5500	9	0.51188	T	0.08	-11.3474	19.4875	0.95035	0.0:1.0:0.0:0.0	.	13;13	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	Q	13	ENSP00000446628:P13Q;ENSP00000446132:P13Q;ENSP00000381007:P13Q;ENSP00000228327:P13Q;ENSP00000266692:P13Q	ENSP00000228327:P13Q	P	+	2	0	NAV3	76749410	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.320000	0.72876	2.615000	0.88500	0.655000	0.94253	CCA		0.458	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		52	223	1	0	6.03219e-31	0.00361	1.18467e-30	52	223				
EPYC	1833	broad.mit.edu	37	12	91372012	91372013	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:91372012_91372013CT>AA	ENST00000261172.3	-	3	284_285	c.192_193AG>TT	c.(190-195)tcAGgg>tcTTgg	p.G65W		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	65					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)	p.G65W(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						TCTCTGTTCCCTGAAGGCATCA	0.475											OREG0022019	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001tbk.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(190-195)TCAGGG>TCTTGG		dermatan sulfate proteoglycan 3 precursor																																				SO:0001583	missense	1833				female pregnancy	proteinaceous extracellular matrix	glycosaminoglycan binding	g.chr12:91372012_91372013CT>AA	AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.192_193delinsAA	12.37:g.91372012_91372013delinsAA	ENSP00000261172:p.Gly65Trp		Somatic	OREG0022019	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1282		p.G65W	NM_004950	NP_004941	WXS	Illumina HiSeq	Unspecified	Q99645	EPYC_HUMAN			3	285_286	-			65					A8K3M7|Q8NEJ5	Missense_Mutation	DNP	ENST00000261172.3	37	c.192_193AG>TT	CCDS31870.1																																																																																				0.475	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407146.2	NM_004950		15	74	0	0	0	0.004672	0	15	74				
ANO4	121601	broad.mit.edu	37	12	101510519	101510519	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:101510519G>A	ENST00000392977.3	+	25	2723	c.2513G>A	c.(2512-2514)cGa>cAa	p.R838Q	ANO4_ENST00000299222.9_Missense_Mutation_p.R358Q|ANO4_ENST00000550015.1_Missense_Mutation_p.R358Q|ANO4_ENST00000392979.3_Missense_Mutation_p.R803Q			Q32M45	ANO4_HUMAN	anoctamin 4	838					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R803Q(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TTTGAGAACCGATCTGAGCCT	0.507										HNSCC(74;0.22)																													uc010svm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(2512-2514)CGA>CAA		anoctamin 4							256.0	229.0	238.0					12																	101510519		2203	4300	6503	SO:0001583	missense	121601					chloride channel complex	chloride channel activity	g.chr12:101510519G>A	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2513G>A	12.37:g.101510519G>A	ENSP00000376703:p.Arg838Gln	HNSCC(74;0.22)	Somatic				ANO4_uc001thw.2_Missense_Mutation_p.R803Q|ANO4_uc001thx.2_Missense_Mutation_p.R838Q|ANO4_uc001thy.2_Missense_Mutation_p.R358Q	p.R838Q	NM_178826	NP_849148	WXS	Illumina HiSeq	Unspecified	Q32M45	ANO4_HUMAN			25	3085	+			838			Cytoplasmic (Potential).		Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37	c.2513G>A		.	.	.	.	.	.	.	.	.	.	G	13.53	2.264710	0.40095	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.68903	-0.35;-0.23;-0.36;-0.23	5.6	5.6	0.85130	.	0.165521	0.37809	N	0.001928	T	0.40719	0.1128	N	0.04297	-0.235	0.41912	D	0.990472	P;P;P	0.42871	0.456;0.727;0.792	B;B;B	0.36845	0.082;0.202;0.234	T	0.44081	-0.9351	10	0.19147	T	0.46	.	12.8993	0.58117	0.0742:0.0:0.9258:0.0	.	358;838;803	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	Q	803;358;838;358	ENSP00000376705:R803Q;ENSP00000299222:R358Q;ENSP00000376703:R838Q;ENSP00000450192:R358Q	ENSP00000299222:R358Q	R	+	2	0	ANO4	100034650	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	6.496000	0.73670	2.620000	0.88729	0.563000	0.77884	CGA		0.507	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826		5	145	0	0	0	0.000602	0	5	145				
CMKLR1	1240	broad.mit.edu	37	12	108686090	108686090	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:108686090T>A	ENST00000312143.7	-	3	1013	c.650A>T	c.(649-651)cAc>cTc	p.H217L	CMKLR1_ENST00000412676.1_Missense_Mutation_p.H217L|CMKLR1_ENST00000397688.2_Missense_Mutation_p.H215L|CMKLR1_ENST00000552995.1_Missense_Mutation_p.H215L|CMKLR1_ENST00000550402.1_Missense_Mutation_p.H217L	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	217					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.H215L(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						CACCACCATGTGCCGGCTATA	0.562																																							uc009zuw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(649-651)CAC>CTC		chemokine-like receptor 1 isoform a							57.0	61.0	59.0					12																	108686090		2134	4242	6376	SO:0001583	missense	1240				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity	g.chr12:108686090T>A	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.650A>T	12.37:g.108686090T>A	ENSP00000311733:p.His217Leu		Somatic				CMKLR1_uc001tmw.2_Missense_Mutation_p.H217L|CMKLR1_uc001tmv.2_Missense_Mutation_p.H215L|CMKLR1_uc009zuv.2_Missense_Mutation_p.H217L	p.H217L	NM_001142345	NP_001135817	WXS	Illumina HiSeq	Unspecified	Q99788	CML1_HUMAN			3	841	-			217			Extracellular (Potential).		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	c.650A>T	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	t	10.27	1.303522	0.23736	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.055041	0.64402	D	0.000001	T	0.29256	0.0728	L	0.33485	1.01	0.45342	D	0.998335	B	0.24920	0.114	B	0.34093	0.175	T	0.10870	-1.0611	10	0.20519	T	0.43	.	9.8979	0.41329	0.1521:0.0:0.0:0.8479	.	217	Q99788	CML1_HUMAN	L	217;217;215;215;217	ENSP00000311733:H217L;ENSP00000401293:H217L;ENSP00000380803:H215L;ENSP00000447579:H215L;ENSP00000449716:H217L	ENSP00000311733:H217L	H	-	2	0	CMKLR1	107210220	1.000000	0.71417	0.036000	0.18154	0.162000	0.22319	8.037000	0.88933	2.035000	0.60131	0.450000	0.29827	CAC		0.562	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			3	38	0	0	0	0.004672	0	3	38				
PIWIL1	9271	broad.mit.edu	37	12	130830955	130830955	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:130830955C>A	ENST00000245255.3	+	5	629	c.357C>A	c.(355-357)ttC>ttA	p.F119L		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	119					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.F119L(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTAACCATTTCCGGCTGACAT	0.393																																							uc001uik.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(355-357)TTC>TTA		piwi-like 1							80.0	80.0	80.0					12																	130830955		2203	4300	6503	SO:0001583	missense	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130830955C>A	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.357C>A	12.37:g.130830955C>A	ENSP00000245255:p.Phe119Leu		Somatic				PIWIL1_uc001uij.1_Missense_Mutation_p.F119L	p.F119L	NM_004764	NP_004755	WXS	Illumina HiSeq	Unspecified	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	5	447	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		119					A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	c.357C>A	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011937	0.35511	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000542723	T;T;T;T;T	0.50277	2.7;2.7;0.75;2.7;2.7	5.73	-1.22	0.09494	Argonaute/Dicer protein, PAZ (1);	0.205049	0.52532	D	0.000063	T	0.42698	0.1214	M	0.64997	1.995	0.34931	D	0.749407	P;P	0.42649	0.786;0.481	B;B	0.41088	0.22;0.347	T	0.55679	-0.8103	10	0.46703	T	0.11	-1.1237	11.775	0.51981	0.1198:0.69:0.0:0.1901	.	119;119	Q96J94;Q96J94-2	PIWL1_HUMAN;.	L	119	ENSP00000245255:F119L;ENSP00000442086:F119L;ENSP00000440677:F119L;ENSP00000439096:F119L;ENSP00000438582:F119L	ENSP00000245255:F119L	F	+	3	2	PIWIL1	129396908	0.930000	0.31532	0.882000	0.34594	0.166000	0.22503	-0.005000	0.12855	-0.212000	0.10109	0.650000	0.86243	TTC		0.393	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			12	39	1	0	3.07112e-06	0.000978	4.39886e-06	12	39				
MEDAG	84935	broad.mit.edu	37	13	31498491	31498491	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr13:31498491A>T	ENST00000380482.4	+	5	1156	c.831A>T	c.(829-831)tcA>tcT	p.S277S	TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000588425.1_RNA|TEX26-AS1_ENST00000451495.2_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000593246.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	277					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)		p.S277S(1)									CACCCAGATCATCTCTGACAG	0.363																																							uc001uth.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(829-831)TCA>TCT		hypothetical protein LOC84935							135.0	131.0	133.0					13																	31498491		2203	4300	6503	SO:0001819	synonymous_variant	84935							g.chr13:31498491A>T	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.831A>T	13.37:g.31498491A>T			Somatic				uc001utg.1_Intron	p.S277S	NM_032849	NP_116238	WXS	Illumina HiSeq	Unspecified	Q5VYS4	CM033_HUMAN		all cancers(112;0.00914)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.0559)|GBM - Glioblastoma multiforme(144;0.244)	5	1172	+		Lung SC(185;0.0281)	277					Q8IXF1|Q96K26|Q96NC8	Silent	SNP	ENST00000380482.4	37	c.831A>T	CCDS9338.1																																																																																				0.363	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849		21	103	0	0	0	0.008871	0	21	103				
RPGRIP1	57096	broad.mit.edu	37	14	21762860	21762860	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr14:21762860C>T	ENST00000400017.2	+	2	110	c.110C>T	c.(109-111)cCc>cTc	p.P37L	RPGRIP1_ENST00000557771.1_Missense_Mutation_p.P37L|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.P37L|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.P37L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	37					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.P37L(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		ACTCAACCACCCTTGAGCAGG	0.418																																							uc001wag.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|pancreas(1)	7						c.(109-111)CCC>CTC		retinitis pigmentosa GTPase regulator							102.0	102.0	102.0					14																	21762860		1865	4101	5966	SO:0001583	missense	57096				response to stimulus|visual perception	cilium		g.chr14:21762860C>T	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.110C>T	14.37:g.21762860C>T	ENSP00000382895:p.Pro37Leu		Somatic					p.P37L	NM_020366	NP_065099	WXS	Illumina HiSeq	Unspecified	Q96KN7	RPGR1_HUMAN	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)	2	110	+	all_cancers(95;0.0017)	all_cancers(140;0.0973)	37					Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	c.110C>T	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	C	0.365	-0.937460	0.02340	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.52	-2.94	0.05581	.	0.991219	0.08213	N	0.980363	T	0.59487	0.2197	L	0.40543	1.245	0.09310	N	1	B	0.23806	0.091	B	0.19148	0.024	T	0.41716	-0.9493	10	0.09590	T	0.72	0.7802	3.2126	0.06687	0.3672:0.3309:0.2198:0.082	.	37	Q96KN7	RPGR1_HUMAN	L	37	ENSP00000450445:P37L;ENSP00000451219:P37L;ENSP00000382895:P37L;ENSP00000206660:P37L	ENSP00000206660:P37L	P	+	2	0	RPGRIP1	20832700	0.000000	0.05858	0.000000	0.03702	0.592000	0.36648	0.040000	0.13905	-0.690000	0.05142	-1.367000	0.01198	CCC		0.418	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		9	55	0	0	0	0.008291	0	9	55				
RABGGTA	5875	broad.mit.edu	37	14	24735687	24735687	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr14:24735687C>A	ENST00000399409.3	-	15	1987	c.1504G>T	c.(1504-1506)Gac>Tac	p.D502Y	RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000216840.6_Missense_Mutation_p.D502Y|RABGGTA_ENST00000560777.1_Missense_Mutation_p.D111Y	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	502					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.D502Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GTGACGCCGTCCAGGGACTCT	0.607																																							uc001wof.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1504-1506)GAC>TAC		Rab geranylgeranyltransferase alpha							93.0	99.0	97.0					14																	24735687		2088	4211	6299	SO:0001583	missense	5875				visual perception		Rab geranylgeranyltransferase activity|zinc ion binding	g.chr14:24735687C>A		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.1504G>T	14.37:g.24735687C>A	ENSP00000382341:p.Asp502Tyr		Somatic				RABGGTA_uc001woe.2_RNA|RABGGTA_uc001wog.2_Missense_Mutation_p.D502Y|RABGGTA_uc001woh.2_RNA|RABGGTA_uc001woi.2_RNA	p.D502Y	NM_004581	NP_004572	WXS	Illumina HiSeq	Unspecified	Q92696	PGTA_HUMAN		GBM - Glioblastoma multiforme(265;0.0184)	15	1926	-			502			LRR 3.		A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	37	c.1504G>T	CCDS45088.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.726335	0.69074	.	.	ENSG00000100949	ENST00000216840;ENST00000399409	T;T	0.52057	0.68;0.68	5.81	5.81	0.92471	.	0.063337	0.64402	D	0.000007	T	0.52338	0.1728	M	0.72576	2.205	0.54753	D	0.999989	D	0.57571	0.98	B	0.43194	0.411	T	0.60403	-0.7270	10	0.72032	D	0.01	-19.6807	16.9954	0.86366	0.0:1.0:0.0:0.0	.	502	Q92696	PGTA_HUMAN	Y	502	ENSP00000216840:D502Y;ENSP00000382341:D502Y	ENSP00000216840:D502Y	D	-	1	0	RABGGTA	23805527	1.000000	0.71417	0.980000	0.43619	0.438000	0.31896	6.120000	0.71596	2.757000	0.94681	0.462000	0.41574	GAC		0.607	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836		9	75	1	0	0.000442599	0.006214	0.00055108	9	75				
ADCY4	196883	broad.mit.edu	37	14	24788542	24788542	+	Missense_Mutation	SNP	G	G	T	rs370319489		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr14:24788542G>T	ENST00000310677.4	-	23	2947	c.2834C>A	c.(2833-2835)gCa>gAa	p.A945E	ADCY4_ENST00000554068.2_Missense_Mutation_p.A945E|ADCY4_ENST00000418030.2_Missense_Mutation_p.A945E	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	945					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.A945E(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		TACCTGTTGTGCATCCTGTCC	0.552																																							uc001wov.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(2833-2835)GCA>GAA		adenylate cyclase 4							214.0	163.0	180.0					14																	24788542		2203	4300	6503	SO:0001583	missense	196883				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding	g.chr14:24788542G>T	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2834C>A	14.37:g.24788542G>T	ENSP00000312126:p.Ala945Glu		Somatic				ADCY4_uc001wow.2_Missense_Mutation_p.A945E|ADCY4_uc010toh.1_Missense_Mutation_p.A631E|ADCY4_uc001wox.2_Missense_Mutation_p.A945E|ADCY4_uc001woy.2_Missense_Mutation_p.A945E	p.A945E	NM_139247	NP_640340	WXS	Illumina HiSeq	Unspecified	Q8NFM4	ADCY4_HUMAN		GBM - Glioblastoma multiforme(265;0.0192)	22	2840	-			945			Cytoplasmic (Potential).		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	c.2834C>A	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	G	3.404	-0.121699	0.06838	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.29917	1.55;1.55;1.55	5.77	5.77	0.91146	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.439500	0.19419	N	0.114743	T	0.13072	0.0317	N	0.04063	-0.285	0.22500	N	0.999041	B	0.02656	0.0	B	0.06405	0.002	T	0.15263	-1.0443	10	0.02654	T	1	.	12.4329	0.55583	0.0:0.0:0.8324:0.1676	.	945	Q8NFM4	ADCY4_HUMAN	E	945	ENSP00000312126:A945E;ENSP00000452250:A945E;ENSP00000393177:A945E	ENSP00000312126:A945E	A	-	2	0	ADCY4	23858382	0.839000	0.29477	0.686000	0.30086	0.948000	0.59901	3.229000	0.51278	2.704000	0.92352	0.655000	0.94253	GCA		0.552	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			12	68	1	0	1.5842e-08	0.001855	2.6129e-08	12	68				
ADCY4	196883	broad.mit.edu	37	14	24793584	24793584	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr14:24793584C>A	ENST00000310677.4	-	16	1950	c.1837G>T	c.(1837-1839)Gcc>Tcc	p.A613S	ADCY4_ENST00000554068.2_Missense_Mutation_p.A613S|ADCY4_ENST00000396747.3_Missense_Mutation_p.A306S|ADCY4_ENST00000418030.2_Missense_Mutation_p.A613S	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	613					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.A613S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		TACGTGATGGCCAGAGCTGGG	0.557																																							uc001wov.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(1837-1839)GCC>TCC		adenylate cyclase 4							70.0	66.0	67.0					14																	24793584		2203	4300	6503	SO:0001583	missense	196883				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding	g.chr14:24793584C>A	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1837G>T	14.37:g.24793584C>A	ENSP00000312126:p.Ala613Ser		Somatic				ADCY4_uc001wow.2_Missense_Mutation_p.A613S|ADCY4_uc010toh.1_Missense_Mutation_p.A299S|ADCY4_uc001wox.2_Missense_Mutation_p.A613S|ADCY4_uc001woy.2_Missense_Mutation_p.A613S	p.A613S	NM_139247	NP_640340	WXS	Illumina HiSeq	Unspecified	Q8NFM4	ADCY4_HUMAN		GBM - Glioblastoma multiforme(265;0.0192)	15	1843	-			613			Helical; (Potential).		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	c.1837G>T	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815402	0.50527	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030;ENST00000396747	T;T;T;T	0.79352	-1.05;-1.05;-1.05;-1.26	5.58	2.7	0.31948	.	1.141390	0.06686	N	0.768880	T	0.69369	0.3103	L	0.44542	1.39	0.25322	N	0.989105	B	0.02656	0.0	B	0.06405	0.002	T	0.50849	-0.8779	10	0.23302	T	0.38	.	7.449	0.27227	0.0:0.7185:0.0:0.2815	.	613	Q8NFM4	ADCY4_HUMAN	S	613;613;613;306	ENSP00000312126:A613S;ENSP00000452250:A613S;ENSP00000393177:A613S;ENSP00000379971:A306S	ENSP00000312126:A613S	A	-	1	0	ADCY4	23863424	0.911000	0.30947	0.998000	0.56505	0.898000	0.52572	1.008000	0.29872	0.280000	0.22209	0.655000	0.94253	GCC		0.557	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			6	33	1	0	0.00116845	0.001168	0.00142685	6	33				
SLC35F4	341880	broad.mit.edu	37	14	58048020	58048020	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr14:58048020G>T	ENST00000339762.6	-	4	826	c.827C>A	c.(826-828)aCg>aAg	p.T276K	SLC35F4_ENST00000556826.1_Missense_Mutation_p.T240K|RP11-409I10.2_ENST00000555600.1_RNA|SLC35F4_ENST00000554729.1_Missense_Mutation_p.T117K			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	276	EamA.				transport (GO:0006810)	integral component of membrane (GO:0016021)		p.T276K(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGAGACATCCGTGGCCGTCAG	0.428																																							uc001xdb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(826-828)ACG>AAG		solute carrier family 35, member F4							62.0	58.0	59.0					14																	58048020		1969	4143	6112	SO:0001583	missense	341880							g.chr14:58048020G>T			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.827C>A	14.37:g.58048020G>T	ENSP00000342518:p.Thr276Lys		Somatic				SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_Missense_Mutation_p.T117K	p.T276K	NM_001080455	NP_001073924	WXS	Illumina HiSeq	Unspecified					4	827	-								A6NDQ3	Missense_Mutation	SNP	ENST00000339762.6	37	c.827C>A		.	.	.	.	.	.	.	.	.	.	G	24.5	4.535606	0.85812	.	.	ENSG00000151812	ENST00000556826;ENST00000339762;ENST00000554729	T;T;T	0.28454	1.61;1.61;1.61	6.08	6.08	0.98989	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63107	-0.6711	10	0.87932	D	0	-15.3915	20.6721	0.99693	0.0:0.0:1.0:0.0	.	276	A4IF30	S35F4_HUMAN	K	240;276;117	ENSP00000452086:T240K;ENSP00000342518:T276K;ENSP00000451990:T117K	ENSP00000342518:T276K	T	-	2	0	SLC35F4	57117773	1.000000	0.71417	0.972000	0.41901	0.980000	0.70556	7.800000	0.85949	2.894000	0.99253	0.591000	0.81541	ACG		0.428	SLC35F4-201	KNOWN	basic	protein_coding	protein_coding		XM_292260		12	32	1	0	1.08611e-07	0.000978	1.70291e-07	12	32				
OR4N3P	390539	broad.mit.edu	37	15	22413843	22413843	+	IGR	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:22413843C>T								RP11-69H14.6 (30035 upstream) : RP11-2F9.4 (20046 downstream)																							CACCATCTGCCTGCCTCTGCA	0.507																																							uc001yuf.2		NA																	0					0						c.(142-144)CTG>TTG		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22413843C>T																													15.37:g.22413843C>T			Somatic					p.L48L	NM_001080841	NP_001074310	WXS	Illumina HiSeq	Unspecified					1	142	+									Silent	SNP		37	c.142C>T																																																																																				0	0.507									18	498	0	0	0	0.008871	0	18	498				
OCA2	4948	broad.mit.edu	37	15	28326847	28326847	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:28326847C>A	ENST00000354638.3	-	2	329	c.174G>T	c.(172-174)caG>caT	p.Q58H	OCA2_ENST00000382996.2_Missense_Mutation_p.Q58H|OCA2_ENST00000353809.5_Missense_Mutation_p.Q58H	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	58					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.Q58H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		CCCAAGAGCTCTGCCCGGCAG	0.597									Oculocutaneous Albinism																														uc001zbh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|pancreas(1)	5						c.(172-174)CAG>CAT		oculocutaneous albinism II							39.0	37.0	38.0					15																	28326847		2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28326847C>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.174G>T	15.37:g.28326847C>A	ENSP00000346659:p.Gln58His		Somatic				OCA2_uc010ayv.2_Missense_Mutation_p.Q58H	p.Q58H	NM_000275	NP_000266	WXS	Illumina HiSeq	Unspecified	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	2	284	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	58			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.174G>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	C	9.924	1.213020	0.22289	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996;ENST00000445578;ENST00000431101	D;D;D;D;D	0.93426	-2.71;-2.72;-2.67;-3.22;-2.07	3.08	2.15	0.27550	.	0.660673	0.13252	N	0.401979	D	0.87297	0.6142	L	0.40543	1.245	0.09310	N	1	P;B	0.45348	0.856;0.291	B;B	0.38056	0.264;0.087	T	0.79692	-0.1697	10	0.56958	D	0.05	6.0E-4	6.1849	0.20491	0.0:0.8607:0.0:0.1393	.	58;58	Q04671-2;Q04671	.;P_HUMAN	H	58	ENSP00000346659:Q58H;ENSP00000261276:Q58H;ENSP00000372457:Q58H;ENSP00000414425:Q58H;ENSP00000415431:Q58H	ENSP00000261276:Q58H	Q	-	3	2	OCA2	26000442	0.003000	0.15002	0.003000	0.11579	0.028000	0.11728	0.226000	0.17776	0.878000	0.35920	0.543000	0.68304	CAG		0.597	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		6	53	1	0	3.59834e-05	0.001168	4.72747e-05	6	53				
TP53BP1	7158	broad.mit.edu	37	15	43748729	43748729	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:43748729G>A	ENST00000263801.3	-	12	2314	c.2062C>T	c.(2062-2064)Ccg>Tcg	p.P688S	TP53BP1_ENST00000382039.3_Missense_Mutation_p.P693S|TP53BP1_ENST00000450115.2_Missense_Mutation_p.P693S|TP53BP1_ENST00000605155.1_5'Flank|TP53BP1_ENST00000382044.4_Missense_Mutation_p.P693S	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	688					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.P688S(3)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGGTGCAACGGAACACTCTCC	0.453								Other conserved DNA damage response genes																															uc001zrs.2		NA																	3	Substitution - Missense(3)		skin(2)|lung(1)	ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7						c.(2062-2064)CCG>TCG	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	tumor protein p53 binding protein 1 isoform 3							108.0	111.0	110.0					15																	43748729		2201	4298	6499	SO:0001583	missense	7158				double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity	g.chr15:43748729G>A	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2062C>T	15.37:g.43748729G>A	ENSP00000263801:p.Pro688Ser		Somatic				TP53BP1_uc010udp.1_Missense_Mutation_p.P688S|TP53BP1_uc001zrq.3_Missense_Mutation_p.P693S|TP53BP1_uc001zrr.3_Missense_Mutation_p.P693S|TP53BP1_uc010udq.1_Missense_Mutation_p.P693S	p.P688S	NM_005657	NP_005648	WXS	Illumina HiSeq	Unspecified	Q12888	TP53B_HUMAN		GBM - Glioblastoma multiforme(94;1.59e-06)	12	2210	-		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)	688					F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	c.2062C>T	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	3.395	-0.123494	0.06795	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	4.94	0.882	0.19172	.	1.006500	0.07983	N	0.985927	T	0.25306	0.0615	N	0.04880	-0.145	0.09310	N	1	B;B;B;B	0.14438	0.01;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.003;0.003	T	0.17961	-1.0352	10	0.23891	T	0.37	0.0069	1.6473	0.02764	0.1856:0.1651:0.479:0.1703	.	693;688;693;693	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	S	688;693;693;693;693	ENSP00000263801:P688S;ENSP00000371475:P693S;ENSP00000371470:P693S;ENSP00000393497:P693S;ENSP00000388028:P693S	ENSP00000263801:P688S	P	-	1	0	TP53BP1	41536021	0.096000	0.21769	0.004000	0.12327	0.435000	0.31806	1.087000	0.30865	0.220000	0.20860	0.563000	0.77884	CCG		0.453	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			11	132	0	0	0	0.001855	0	11	132				
SLC24A5	283652	broad.mit.edu	37	15	48414087	48414087	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:48414087C>A	ENST00000341459.3	+	2	228	c.155C>A	c.(154-156)tCg>tAg	p.S52*	SLC24A5_ENST00000482911.2_Nonsense_Mutation_p.S52*|SLC24A5_ENST00000449382.2_Intron	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	52					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.S52L(1)|p.S52*(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		TCTCCATCATCGGAGTTTCCC	0.423																																							uc001zwe.2		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		large_intestine(1)|lung(1)		0						c.(154-156)TCG>TAG		solute carrier family 24, member 5 precursor							117.0	121.0	120.0					15																	48414087		2198	4297	6495	SO:0001587	stop_gained	283652				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr15:48414087C>A	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.155C>A	15.37:g.48414087C>A	ENSP00000341550:p.Ser52*		Somatic				SLC24A5_uc001zwd.2_Nonsense_Mutation_p.S52*|SLC24A5_uc010bel.2_Intron	p.S52*	NM_205850	NP_995322	WXS	Illumina HiSeq	Unspecified	Q71RS6	NCKX5_HUMAN		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)	2	228	+		all_lung(180;0.00217)	52			Extracellular (Potential).		A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Nonsense_Mutation	SNP	ENST00000341459.3	37	c.155C>A	CCDS10128.1	.	.	.	.	.	.	.	.	.	.	C	36	5.782869	0.96937	.	.	ENSG00000188467	ENST00000341459	.	.	.	6.03	5.09	0.68999	.	0.065643	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	14.1354	0.65284	0.0:0.9251:0.0:0.0749	.	.	.	.	X	52	.	ENSP00000341550:S52X	S	+	2	0	SLC24A5	46201379	0.990000	0.36364	0.296000	0.24974	0.984000	0.73092	3.042000	0.49815	1.492000	0.48499	0.655000	0.94253	TCG		0.423	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850		6	117	1	0	3.59834e-05	0.001168	4.72747e-05	6	117				
VPS13C	54832	broad.mit.edu	37	15	62302683	62302683	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:62302683C>A	ENST00000261517.5	-	13	1072	c.999G>T	c.(997-999)ctG>ctT	p.L333L	VPS13C_ENST00000249837.3_Silent_p.L290L|VPS13C_ENST00000395896.4_Silent_p.L333L|VPS13C_ENST00000395898.3_Silent_p.L290L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.L333L(2)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GAGGTTTGGTCAGTTCAATGG	0.383																																							uc002agz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(997-999)CTG>CTT		vacuolar protein sorting 13C protein isoform 2A							216.0	186.0	196.0					15																	62302683		2203	4300	6503	SO:0001819	synonymous_variant	54832				protein localization			g.chr15:62302683C>A	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.999G>T	15.37:g.62302683C>A			Somatic				VPS13C_uc002aha.2_Silent_p.L290L|VPS13C_uc002ahb.1_Silent_p.L333L|VPS13C_uc002ahc.1_Silent_p.L290L	p.L333L	NM_020821	NP_065872	WXS	Illumina HiSeq	Unspecified	Q709C8	VP13C_HUMAN			13	1073	-			333						Silent	SNP	ENST00000261517.5	37	c.999G>T	CCDS32257.1																																																																																				0.383	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		7	104	1	0	0.00307968	0.00308	0.00367824	7	104				
LCTL	197021	broad.mit.edu	37	15	66857164	66857164	+	Silent	SNP	G	G	T	rs372996718		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:66857164G>T	ENST00000341509.5	-	2	263	c.132C>A	c.(130-132)ggC>ggA	p.G44G	LCTL_ENST00000563438.1_5'UTR|LCTL_ENST00000537670.1_Intron	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	44					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.G44G(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AACTGCCCACGCCCCAGGAGA	0.662																																							uc002aqc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(130-132)GGC>GGA		lactase-like precursor							73.0	70.0	71.0					15																	66857164		2201	4299	6500	SO:0001819	synonymous_variant	197021				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr15:66857164G>T	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.132C>A	15.37:g.66857164G>T			Somatic				LCTL_uc002aqd.3_Intron|LCTL_uc010bhw.2_5'UTR	p.G44G	NM_207338	NP_997221	WXS	Illumina HiSeq	Unspecified	Q6UWM7	LCTL_HUMAN			2	264	-			44			Extracellular (Potential).		B3KQY0	Silent	SNP	ENST00000341509.5	37	c.132C>A	CCDS10220.1																																																																																				0.662	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338		8	62	1	0	1.12685e-05	0.004482	1.57264e-05	8	62				
AKAP13	11214	broad.mit.edu	37	15	86076960	86076960	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr15:86076960T>G	ENST00000394518.2	+	4	422	c.327T>G	c.(325-327)aaT>aaG	p.N109K	AKAP13_ENST00000361243.2_Missense_Mutation_p.N109K|AKAP13_ENST00000560302.1_Missense_Mutation_p.N109K	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	109					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.N109K(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTGCTGGAAATCAGCAGGCTT	0.498																																					Melanoma(94;603 1453 3280 32295 32951)	Melanoma(94;603 1453 3280 32295 32951)	uc002blv.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						c.(325-327)AAT>AAG		A-kinase anchor protein 13 isoform 2							121.0	117.0	118.0					15																	86076960		2202	4299	6501	SO:0001583	missense	11214				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr15:86076960T>G	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.327T>G	15.37:g.86076960T>G	ENSP00000378026:p.Asn109Lys		Somatic				AKAP13_uc002bls.2_Missense_Mutation_p.N109K|AKAP13_uc002blt.1_Missense_Mutation_p.N109K|AKAP13_uc002blu.1_Missense_Mutation_p.N109K	p.N109K	NM_007200	NP_009131	WXS	Illumina HiSeq	Unspecified	Q12802	AKP13_HUMAN			4	497	+			109					Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	c.327T>G	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	T	11.54	1.670563	0.29693	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.59906	0.23;0.23	5.67	-2.98	0.05513	.	.	.	.	.	T	0.62696	0.2449	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	0.986;0.992;1.0	P;P;D	0.91635	0.722;0.856;0.999	T	0.61874	-0.6973	9	0.59425	D	0.04	.	11.0503	0.47882	0.0:0.4861:0.0:0.5139	.	109;109;109	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	K	109;109;108;108	ENSP00000354718:N109K;ENSP00000378026:N109K	ENSP00000354718:N109K	N	+	3	2	AKAP13	83877964	0.966000	0.33281	0.174000	0.22961	0.998000	0.95712	-0.040000	0.12104	-0.790000	0.04492	0.533000	0.62120	AAT		0.498	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		5	106	0	0	0	0.000602	0	5	106				
MEFV	4210	broad.mit.edu	37	16	3299593	3299593	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:3299593G>T	ENST00000219596.1	-	3	1137	c.1098C>A	c.(1096-1098)agC>agA	p.S366R	MEFV_ENST00000541159.1_Missense_Mutation_p.S155R|MEFV_ENST00000536379.1_Missense_Mutation_p.S155R|MEFV_ENST00000339854.4_Missense_Mutation_p.S186R	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	366					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.S366R(1)|p.S155R(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGGGGCTTAGGCTTCCCGGGC	0.647																																							uc002cun.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6						c.(1096-1098)AGC>AGA		Mediterranean fever protein	Colchicine(DB01394)						41.0	38.0	39.0					16																	3299593		2197	4300	6497	SO:0001583	missense	4210				inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding	g.chr16:3299593G>T	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1098C>A	16.37:g.3299593G>T	ENSP00000219596:p.Ser366Arg		Somatic					p.S366R	NM_000243	NP_000234	WXS	Illumina HiSeq	Unspecified	O15553	MEFV_HUMAN			3	1138	-			366					D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	c.1098C>A	CCDS10498.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662730	0.29515	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.22	-3.5	0.04710	.	2.498820	0.01291	N	0.010027	T	0.40767	0.1130	L	0.46157	1.445	0.09310	N	1	P	0.49961	0.93	B	0.41571	0.36	T	0.39396	-0.9616	10	0.30854	T	0.27	-9.4213	1.9819	0.03428	0.3025:0.2345:0.3549:0.1081	.	366	O15553	MEFV_HUMAN	R	366;366;186;155;155;155	ENSP00000219596:S366R;ENSP00000339639:S186R;ENSP00000438711:S155R;ENSP00000445079:S155R	ENSP00000219596:S366R	S	-	3	2	MEFV	3239594	0.000000	0.05858	0.000000	0.03702	0.149000	0.21700	-0.509000	0.06336	-0.579000	0.05952	-1.119000	0.02030	AGC		0.647	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243		12	23	1	0	4.3838e-07	0.001855	6.73479e-07	12	23				
PPL	5493	broad.mit.edu	37	16	4934298	4934298	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:4934298G>T	ENST00000345988.2	-	22	4447	c.4358C>A	c.(4357-4359)cCg>cAg	p.P1453Q	PPL_ENST00000590782.2_Missense_Mutation_p.P1451Q	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1453					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.P1453Q(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CGCCTGCTGCGGGTCCTGCTG	0.657																																							uc002cyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4357-4359)CCG>CAG		periplakin							69.0	68.0	69.0					16																	4934298		2193	4294	6487	SO:0001583	missense	5493				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	g.chr16:4934298G>T	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.4358C>A	16.37:g.4934298G>T	ENSP00000340510:p.Pro1453Gln		Somatic					p.P1453Q	NM_002705	NP_002696	WXS	Illumina HiSeq	Unspecified	O60437	PEPL_HUMAN			22	4448	-			1453			Potential.		O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	c.4358C>A	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108585	0.77096	.	.	ENSG00000118898	ENST00000345988	T	0.72615	-0.67	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.85864	0.5796	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86664	0.1906	10	0.72032	D	0.01	.	19.9111	0.97025	0.0:0.0:1.0:0.0	.	1453	O60437	PEPL_HUMAN	Q	1453	ENSP00000340510:P1453Q	ENSP00000340510:P1453Q	P	-	2	0	PPL	4874299	1.000000	0.71417	0.998000	0.56505	0.847000	0.48162	9.827000	0.99397	2.722000	0.93159	0.591000	0.81541	CCG		0.657	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		15	106	1	0	0.000219431	0.00245	0.000275919	15	106				
RBFOX1	54715	broad.mit.edu	37	16	7760688	7760688	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:7760688C>A	ENST00000550418.1	+	16	2123	c.1135C>A	c.(1135-1137)Ctt>Att	p.L379I	RBFOX1_ENST00000547338.1_Missense_Mutation_p.L379I|RBFOX1_ENST00000553186.1_Missense_Mutation_p.L352I|RBFOX1_ENST00000340209.4_Missense_Mutation_p.L384I|RBFOX1_ENST00000355637.4_3'UTR|RBFOX1_ENST00000436368.2_Intron|RBFOX1_ENST00000311745.5_Missense_Mutation_p.L400I|RBFOX1_ENST00000547372.1_3'UTR|RBFOX1_ENST00000552089.1_3'UTR	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	379					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.L379I(1)|p.L400I(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GGGTCTCGTTCTTTCTTCATT	0.423																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1135-1137)CTT>ATT		ataxin 2-binding protein 1 isoform 4							223.0	196.0	205.0					16																	7760688		2197	4300	6497	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7760688C>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1135C>A	16.37:g.7760688C>A	ENSP00000450031:p.Leu379Ile		Somatic				A2BP1_uc002cyt.2_Missense_Mutation_p.L352I|A2BP1_uc010uyb.1_Missense_Mutation_p.L379I|A2BP1_uc002cyw.2_3'UTR|A2BP1_uc002cyy.2_Missense_Mutation_p.L400I|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Missense_Mutation_p.L373I	p.L379I	NM_018723	NP_061193	WXS	Illumina HiSeq	Unspecified	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	16	2123	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	379					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.1135C>A	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081402	0.36758	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547338;ENST00000311745;ENST00000352951;ENST00000340209	T;T;T;T;T	0.30981	1.51;1.84;1.51;1.85;1.51	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.21590	0.0520	N	0.14661	0.345	0.48395	D	0.999649	P;P;P;B	0.42518	0.782;0.782;0.557;0.011	B;B;B;B	0.37888	0.199;0.26;0.124;0.005	T	0.02567	-1.1140	10	0.22706	T	0.39	-8.4032	20.3923	0.98948	0.0:1.0:0.0:0.0	.	373;400;352;379	F8WAC5;Q9NWB1-2;Q9NWB1-3;Q9NWB1	.;.;.;RFOX1_HUMAN	I	379;352;379;400;373;384	ENSP00000450031:L379I;ENSP00000447753:L352I;ENSP00000447717:L379I;ENSP00000309117:L400I;ENSP00000344196:L384I	ENSP00000309117:L400I	L	+	1	0	RBFOX1	7700689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.316000	0.59178	2.831000	0.97527	0.609000	0.83330	CTT		0.423	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		38	106	1	0	3.62531e-18	0.004289	6.90621e-18	38	106				
ITGAM	3684	broad.mit.edu	37	16	31283276	31283276	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:31283276G>T	ENST00000287497.8	+	7	742	c.667G>T	c.(667-669)Ggg>Tgg	p.G223W	ITGAM_ENST00000544665.3_Missense_Mutation_p.G223W			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	223	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.G223W(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GCAGCTGCTTGGGCGGACACA	0.512																																							uc002ebq.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(667-669)GGG>TGG		integrin alpha M isoform 2 precursor							93.0	91.0	92.0					16																	31283276		1973	4194	6167	SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31283276G>T	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.667G>T	16.37:g.31283276G>T	ENSP00000287497:p.Gly223Trp		Somatic				ITGAM_uc002ebr.2_Missense_Mutation_p.G223W	p.G223W	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			7	765	+			223			VWFA.|Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	c.667G>T	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707097	0.68615	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.39592	1.07;1.07	5.5	5.5	0.81552	von Willebrand factor, type A (3);	.	.	.	.	T	0.75236	0.3822	H	0.95187	3.635	0.42369	D	0.99244	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82719	-0.0318	9	0.72032	D	0.01	.	16.6712	0.85267	0.0:0.0:1.0:0.0	.	223;223	Q4VAK1;P11215	.;ITAM_HUMAN	W	223	ENSP00000441691:G223W;ENSP00000287497:G223W	ENSP00000287497:G223W	G	+	1	0	ITGAM	31190777	1.000000	0.71417	0.164000	0.22755	0.003000	0.03518	5.995000	0.70631	2.758000	0.94735	0.561000	0.74099	GGG		0.512	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		10	117	1	0	3.86212e-05	0.008291	5.02207e-05	10	117				
FHOD1	29109	broad.mit.edu	37	16	67265143	67265143	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:67265143G>C	ENST00000258201.4	-	17	2862	c.2615C>G	c.(2614-2616)cCt>cGt	p.P872R		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	872	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.P872R(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AGAGGACTCAGGCCGGGTCTG	0.577																																							uc002esl.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(2614-2616)CCT>CGT		formin homology 2 domain containing 1							77.0	67.0	70.0					16																	67265143		2198	4300	6498	SO:0001583	missense	29109				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding	g.chr16:67265143G>C	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2615C>G	16.37:g.67265143G>C	ENSP00000258201:p.Pro872Arg		Somatic				FHOD1_uc002esk.2_5'Flank|FHOD1_uc010ced.2_Missense_Mutation_p.P679R	p.P872R	NM_013241	NP_037373	WXS	Illumina HiSeq	Unspecified	Q9Y613	FHOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	17	2727	-		Ovarian(137;0.0563)	872			FH2.		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	c.2615C>G	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539740	0.65085	.	.	ENSG00000135723	ENST00000258201	T	0.68765	-0.35	5.39	5.39	0.77823	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.86466	0.1782	10	0.87932	D	0	.	17.7166	0.88338	0.0:0.0:1.0:0.0	.	872	Q9Y613	FHOD1_HUMAN	R	872	ENSP00000258201:P872R	ENSP00000258201:P872R	P	-	2	0	FHOD1	65822644	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	9.490000	0.97952	2.526000	0.85167	0.561000	0.74099	CCT		0.577	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			13	39	0	0	0	0.001855	0	13	39				
SNTB2	6645	broad.mit.edu	37	16	69279517	69279517	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr16:69279517G>A	ENST00000336278.4	+	2	631	c.593G>A	c.(592-594)cGa>cAa	p.R198Q	SNTB2_ENST00000528525.1_3'UTR	NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	198	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)	p.R198Q(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		AAGTTCATCCGAGAAGTAACA	0.383																																					NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	uc002ewu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(592-594)CGA>CAA		basic beta 2 syntrophin							150.0	152.0	151.0					16																	69279517		2198	4300	6498	SO:0001583	missense	6645					cell junction|dystrophin-associated glycoprotein complex|membrane fraction|microtubule|transport vesicle membrane	actin binding|calmodulin binding|protein binding	g.chr16:69279517G>A	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.593G>A	16.37:g.69279517G>A	ENSP00000338191:p.Arg198Gln		Somatic					p.R198Q	NM_006750	NP_006741	WXS	Illumina HiSeq	Unspecified	Q13425	SNTB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.208)	2	613	+		Ovarian(137;0.101)	198			PH 1.|PDZ.		Q9BY09	Missense_Mutation	SNP	ENST00000336278.4	37	c.593G>A	CCDS10873.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.88|18.88	3.717973|3.717973	0.68844|0.68844	.|.	.|.	ENSG00000168807|ENSG00000168807	ENST00000525632;ENST00000528525|ENST00000336278	.|T	.|0.58652	.|0.32	5.75|5.75	5.75|5.75	0.90469|0.90469	.|PDZ/DHR/GLGF (2);Pleckstrin homology domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51550|0.51550	0.1681|0.1681	L|L	0.61387|0.61387	1.9|1.9	0.58432|0.58432	D|D	0.999998|0.999998	.|P	.|0.34892	.|0.474	.|B	.|0.25506	.|0.061	T|T	0.55692|0.55692	-0.8101|-0.8101	5|10	.|0.52906	.|T	.|0.07	-17.4087|-17.4087	12.8386|12.8386	0.57788|0.57788	0.0751:0.0:0.9249:0.0|0.0751:0.0:0.9249:0.0	.|.	.|198	.|Q13425	.|SNTB2_HUMAN	K|Q	67;40|198	.|ENSP00000338191:R198Q	.|ENSP00000338191:R198Q	E|R	+|+	1|2	0|0	SNTB2|SNTB2	67837018|67837018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.656000|4.656000	0.61483|0.61483	2.710000|2.710000	0.92621|0.92621	0.555000|0.555000	0.69702|0.69702	GAG|CGA		0.383	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1			6	211	0	0	0	0.004482	0	6	211				
SPATA22	84690	broad.mit.edu	37	17	3352250	3352250	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:3352250G>A	ENST00000573128.1	-	6	1006	c.523C>T	c.(523-525)Ctc>Ttc	p.L175F	SPATA22_ENST00000268981.5_Missense_Mutation_p.L175F|SPATA22_ENST00000575375.1_Missense_Mutation_p.L175F|SPATA22_ENST00000572969.1_Missense_Mutation_p.L175F|SPATA22_ENST00000355380.4_Missense_Mutation_p.L132F|SPATA22_ENST00000541913.1_Missense_Mutation_p.L159F|SPATA22_ENST00000397168.3_Missense_Mutation_p.L175F			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	175					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)		p.L175F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						GTTTGTCTGAGTAGCTCGGTT	0.388																																							uc002fvm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)CTC>TTC		spermatogenesis associated 22							246.0	239.0	242.0					17																	3352250		2202	4300	6502	SO:0001583	missense	84690							g.chr17:3352250G>A	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.523C>T	17.37:g.3352250G>A	ENSP00000459580:p.Leu175Phe		Somatic				SPATA22_uc010vrg.1_Missense_Mutation_p.L159F|SPATA22_uc010vrf.1_Missense_Mutation_p.L175F|SPATA22_uc002fvn.2_Missense_Mutation_p.L175F|SPATA22_uc002fvo.2_Missense_Mutation_p.L175F|SPATA22_uc002fvp.2_Missense_Mutation_p.L175F|SPATA22_uc010ckf.2_Missense_Mutation_p.L132F	p.L175F	NM_032598	NP_115987	WXS	Illumina HiSeq	Unspecified	Q8NHS9	SPT22_HUMAN			6	760	-			175					B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	ENST00000573128.1	37	c.523C>T	CCDS11027.1	.	.	.	.	.	.	.	.	.	.	g	7.833	0.720175	0.15372	.	.	ENSG00000141255	ENST00000355380;ENST00000397168;ENST00000268981;ENST00000541913	T;T;T;T	0.19938	2.14;2.17;2.11;2.15	4.67	2.65	0.31530	.	0.195954	0.25526	N	0.030070	T	0.15305	0.0369	L	0.27053	0.805	0.09310	N	1	P;P;P;P	0.45474	0.571;0.859;0.571;0.571	B;P;B;B	0.45712	0.395;0.491;0.373;0.395	T	0.07597	-1.0764	10	0.56958	D	0.05	1.6461	4.3212	0.11018	0.0882:0.154:0.599:0.1587	.	159;175;132;175	F5GWB9;B4DXB1;Q8NHS9-2;Q8NHS9	.;.;.;SPT22_HUMAN	F	132;175;175;159	ENSP00000347541:L132F;ENSP00000380354:L175F;ENSP00000268981:L175F;ENSP00000441920:L159F	ENSP00000268981:L175F	L	-	1	0	SPATA22	3299000	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	0.671000	0.25172	0.664000	0.31047	-0.228000	0.12330	CTC		0.388	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598		8	261	0	0	0	0.004482	0	8	261				
SLC13A5	284111	broad.mit.edu	37	17	6594199	6594199	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:6594199C>A	ENST00000433363.2	-	10	1569	c.1336G>T	c.(1336-1338)Gca>Tca	p.A446S	SLC13A5_ENST00000293800.6_Missense_Mutation_p.A429S|SLC13A5_ENST00000381074.4_Missense_Mutation_p.A403S|SLC13A5_ENST00000573648.1_Missense_Mutation_p.A446S	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	446					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)	p.A446S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						GTGATGGCTGCCGGGGGCACT	0.617																																							uc002gdj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1336-1338)GCA>TCA		solute carrier family 13, member 5 isoform a							184.0	162.0	170.0					17																	6594199		2203	4300	6503	SO:0001583	missense	284111					integral to membrane	citrate transmembrane transporter activity	g.chr17:6594199C>A	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1336G>T	17.37:g.6594199C>A	ENSP00000406220:p.Ala446Ser		Somatic				SLC13A5_uc010vtf.1_Missense_Mutation_p.A446S|SLC13A5_uc010clq.2_Missense_Mutation_p.A403S|SLC13A5_uc002gdk.2_Missense_Mutation_p.A429S	p.A446S	NM_177550	NP_808218	WXS	Illumina HiSeq	Unspecified	Q86YT5	S13A5_HUMAN			10	1424	-			446			Helical; (Potential).		B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	37	c.1336G>T	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	C	4.011	-0.000516	0.07819	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.02916	4.11;4.11	4.93	0.472	0.16758	.	0.159392	0.64402	D	0.000015	T	0.02119	0.0066	L	0.38838	1.175	0.29459	N	0.857907	B;B;B;B	0.17465	0.022;0.016;0.022;0.01	B;B;B;B	0.26310	0.068;0.025;0.038;0.023	T	0.37150	-0.9718	10	0.22109	T	0.4	.	1.0077	0.01491	0.2733:0.3928:0.1448:0.189	.	446;403;429;446	B7ZLB4;F8W7N2;B3KXR0;Q86YT5	.;.;.;S13A5_HUMAN	S	446;446;403	ENSP00000406220:A446S;ENSP00000370464:A403S	ENSP00000293800:A446S	A	-	1	0	SLC13A5	6534923	0.024000	0.19004	0.042000	0.18584	0.020000	0.10135	0.468000	0.22051	0.614000	0.30107	0.563000	0.77884	GCA		0.617	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550		7	103	1	0	2.0095e-06	0.001984	2.9334e-06	7	103				
MYH1	4619	broad.mit.edu	37	17	10419891	10419891	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:10419891C>A	ENST00000226207.5	-	3	163	c.69G>T	c.(67-69)gaG>gaT	p.E23D	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	23					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E23D(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTTCAATTCGCTCCCTTTCAG	0.502																																							uc002gmo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(67-69)GAG>GAT		myosin, heavy chain 1, skeletal muscle, adult							117.0	109.0	112.0					17																	10419891		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10419891C>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.69G>T	17.37:g.10419891C>A	ENSP00000226207:p.Glu23Asp		Somatic				uc002gml.1_Intron	p.E23D	NM_005963	NP_005954	WXS	Illumina HiSeq	Unspecified	P12882	MYH1_HUMAN			3	163	-			23			Myosin head-like.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.69G>T	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124765	0.77436	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	D	0.86097	-2.07	5.5	4.47	0.54385	.	0.000000	0.43579	U	0.000542	D	0.86615	0.5975	M	0.87758	2.905	0.46437	D	0.999041	B	0.06786	0.001	B	0.11329	0.006	D	0.85012	0.0906	10	0.59425	D	0.04	.	13.7309	0.62787	0.0:0.8781:0.0:0.1219	.	23	P12882	MYH1_HUMAN	D	23	ENSP00000226207:E23D	ENSP00000226207:E23D	E	-	3	2	MYH1	10360616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.031000	0.41117	2.861000	0.98227	0.655000	0.94253	GAG		0.502	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		28	130	1	0	1.16021e-09	0.007291	1.97339e-09	28	130				
MAP2K3	5606	broad.mit.edu	37	17	21215469	21215469	+	Missense_Mutation	SNP	C	C	A	rs71371053		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:21215469C>A	ENST00000342679.4	+	10	1039	c.790C>A	c.(790-792)Ctg>Atg	p.L264M	MAP2K3_ENST00000361818.5_Missense_Mutation_p.L235M|MAP2K3_ENST00000316920.6_Missense_Mutation_p.L235M	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.L268M(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GATGGCCATCCTGCGGTTCCC	0.682																																							uc002gys.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(790-792)CTG>ATG		mitogen-activated protein kinase kinase 3							62.0	61.0	61.0					17																	21215469		2203	4300	6503	SO:0001583	missense	5606				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:21215469C>A	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.790C>A	17.37:g.21215469C>A	ENSP00000345083:p.Leu264Met		Somatic				MAP2K3_uc002gyt.2_Missense_Mutation_p.L235M|MAP2K3_uc002gyu.2_Missense_Mutation_p.L235M	p.L264M	NM_145109	NP_659731	WXS	Illumina HiSeq	Unspecified	P46734	MP2K3_HUMAN		COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	10	1055	+			264			Protein kinase.		B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	c.790C>A	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104740	0.56291	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.40476	1.03;1.03	5.84	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000069	T	0.55242	0.1908	L	0.39245	1.2	0.46678	D	0.999155	D	0.76494	0.999	D	0.72982	0.979	T	0.58036	-0.7707	10	0.62326	D	0.03	-18.7019	14.7913	0.69844	0.0:0.9309:0.0:0.0691	.	264	P46734	MP2K3_HUMAN	M	264;235;235;268	ENSP00000345083:L264M;ENSP00000355081:L235M	ENSP00000319139:L268M	L	+	1	2	MAP2K3	21156062	0.992000	0.36948	0.642000	0.29436	0.627000	0.37826	3.058000	0.49939	1.464000	0.47987	0.655000	0.94253	CTG		0.682	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109		5	33	1	0	0.00198382	0.001984	0.00237684	5	33				
KCNJ12	3768	broad.mit.edu	37	17	21319630	21319630	+	Missense_Mutation	SNP	C	C	A	rs552588866		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:21319630C>A	ENST00000583088.1	+	3	1871	c.976C>A	c.(976-978)Cgc>Agc	p.R326S	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R326S	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	326					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.R326S(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GTGGGGTCACCGCTTTGAGCC	0.587										Prostate(3;0.18)																													uc002gyv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(976-978)CGC>AGC		potassium inwardly-rectifying channel, subfamily	Dofetilide(DB00204)						141.0	142.0	142.0					17																	21319630		2203	4300	6503	SO:0001583	missense	3768				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	g.chr17:21319630C>A	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.976C>A	17.37:g.21319630C>A	ENSP00000463778:p.Arg326Ser	Prostate(3;0.18)	Somatic					p.R326S	NM_021012	NP_066292	WXS	Illumina HiSeq	Unspecified	Q14500	IRK12_HUMAN		Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	3	1681	+			326			Cytoplasmic (By similarity).		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	c.976C>A	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.599083	0.66332	.	.	ENSG00000184185	ENST00000331718	D	0.95307	-3.67	5.63	3.56	0.40772	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.052406	0.64402	D	0.000001	D	0.97757	0.9264	H	0.95043	3.615	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.98019	1.0370	10	0.87932	D	0	.	11.0359	0.47799	0.1279:0.8046:0.0:0.0675	.	326	Q14500	IRK12_HUMAN	S	326	ENSP00000328150:R326S	ENSP00000328150:R326S	R	+	1	0	KCNJ12	21260223	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.782000	0.55401	1.388000	0.46506	0.561000	0.74099	CGC		0.587	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		6	179	1	0	0.00116845	0.001168	0.00142685	6	179				
CCT6B	10693	broad.mit.edu	37	17	33259426	33259426	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:33259426C>A	ENST00000314144.5	-	11	1422	c.1307G>T	c.(1306-1308)gGa>gTa	p.G436V	CCT6B_ENST00000436961.3_Missense_Mutation_p.G391V|CCT6B_ENST00000421975.3_Missense_Mutation_p.G399V	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	436					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)	p.G436V(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				AGCTTGGACTCCAAGACGAGC	0.408																																							uc002hig.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1306-1308)GGA>GTA		chaperonin containing TCP1, subunit 6B							158.0	164.0	162.0					17																	33259426		2203	4300	6503	SO:0001583	missense	10693				chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding	g.chr17:33259426C>A	D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.1307G>T	17.37:g.33259426C>A	ENSP00000327191:p.Gly436Val		Somatic				CCT6B_uc010ctg.2_Missense_Mutation_p.G399V|CCT6B_uc010wcc.1_Missense_Mutation_p.G391V	p.G436V	NM_006584	NP_006575	WXS	Illumina HiSeq	Unspecified	Q92526	TCPW_HUMAN			11	1401	-		Ovarian(249;0.17)	436					B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	ENST00000314144.5	37	c.1307G>T	CCDS32617.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022487	0.75275	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.80304	-1.36;-1.36;-1.36	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.90570	0.7044	M	0.88105	2.93	0.80722	D	1	P;D;D	0.67145	0.491;0.968;0.996	P;P;D	0.71656	0.724;0.86;0.974	D	0.92253	0.5810	10	0.87932	D	0	-16.6953	15.4425	0.75195	0.0:1.0:0.0:0.0	.	391;399;436	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	V	399;436;391	ENSP00000398044:G399V;ENSP00000327191:G436V;ENSP00000400917:G391V	ENSP00000327191:G436V	G	-	2	0	CCT6B	30283539	1.000000	0.71417	0.995000	0.50966	0.823000	0.46562	7.088000	0.76901	2.574000	0.86865	0.650000	0.86243	GGA		0.408	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448014.1	NM_006584		22	185	1	0	2.21704e-12	0.00278	3.96568e-12	22	185				
GGNBP2	79893	broad.mit.edu	37	17	34937774	34937774	+	Splice_Site	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:34937774A>T	ENST00000304718.4	+	9	1337	c.1021A>T	c.(1021-1023)Atg>Ttg	p.M341L		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	341					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.M341L(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTTATAATAGATGACCGTGGA	0.393																																							uc002hnb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1021-1023)ATG>TTG		zinc finger protein 403							69.0	73.0	72.0					17																	34937774		2203	4300	6503	SO:0001630	splice_region_variant	79893				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle		g.chr17:34937774A>T	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1021-1A>T	17.37:g.34937774A>T			Somatic				GGNBP2_uc002hna.2_Missense_Mutation_p.M341L|GGNBP2_uc002hnc.1_Missense_Mutation_p.M170L	p.M341L	NM_024835	NP_079111	WXS	Illumina HiSeq	Unspecified	Q9H3C7	GGNB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)	9	1270	+		Breast(25;0.00957)|Ovarian(249;0.17)	341					B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	c.1021A>T	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	9.958	1.221922	0.22457	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.48	4.37	0.52481	.	0.043818	0.85682	D	0.000000	T	0.35913	0.0948	L	0.29908	0.895	0.80722	D	1	B;B;B	0.28850	0.138;0.138;0.225	B;B;B	0.28465	0.09;0.09;0.053	T	0.10497	-1.0627	8	.	.	.	-12.4085	7.061	0.25125	0.7759:0.15:0.0742:0.0	.	341;341;341	A8K3S2;Q9H3C7;Q9H3C7-3	.;GGNB2_HUMAN;.	L	341	.	.	M	+	1	0	GGNBP2	32011887	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	6.750000	0.74888	0.878000	0.35920	0.402000	0.26972	ATG		0.393	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	Missense_Mutation	10	61	0	0	0	0.008291	0	10	61				
MRPL45	84311	broad.mit.edu	37	17	36455435	36455435	+	Splice_Site	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:36455435G>T	ENST00000312513.5	+	3	523		c.e3+1			NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45							mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)	p.?(1)		breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CACAAGTGTCGTAGGTGTCTG	0.408																																							uc002hpy.2		NA																	1	Unknown(1)		lung(1)		0						c.e3+1		mitochondrial ribosomal protein L45 precursor							72.0	71.0	71.0					17																	36455435		2203	4297	6500	SO:0001630	splice_region_variant	84311				intracellular protein transport|translation	mitochondrial inner membrane presequence translocase complex|ribosome	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|structural constituent of ribosome	g.chr17:36455435G>T	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.362+1G>T	17.37:g.36455435G>T			Somatic					p.S121_splice	NM_032351	NP_115727	WXS	Illumina HiSeq	Unspecified	Q9BRJ2	RM45_HUMAN			3	514	+	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)						A1L436|Q6ZMJ5	Splice_Site	SNP	ENST00000312513.5	37	c.362_splice	CCDS11326.1	.	.	.	.	.	.	.	.	.	.	G	8.906	0.957626	0.18507	.	.	ENSG00000174100	ENST00000312513	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0341	0.71731	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPL45	33708953	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.084000	0.76866	2.299000	0.77371	0.407000	0.27541	.		0.408	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256792.3	NM_032351	Intron	8	63	1	0	4.68919e-08	0.008291	7.57026e-08	8	63				
KRT40	125115	broad.mit.edu	37	17	39138576	39138576	+	Nonsense_Mutation	SNP	T	T	A	rs369387095		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:39138576T>A	ENST00000398486.2	-	5	830	c.670A>T	c.(670-672)Aag>Tag	p.K224*	KRT40_ENST00000377755.4_Nonsense_Mutation_p.K224*	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	224	Coil 1B.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.K224*(1)		endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				TGGTTTTTCTTAAGGCAAAGG	0.473																																							uc010cxh.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(670-672)AAG>TAG		type I hair keratin KA36							91.0	85.0	87.0					17																	39138576		1964	4167	6131	SO:0001587	stop_gained	125115					intermediate filament	structural molecule activity	g.chr17:39138576T>A	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.670A>T	17.37:g.39138576T>A	ENSP00000381500:p.Lys224*		Somatic				KRT40_uc002hvq.1_RNA	p.K224*	NM_182497	NP_872303	WXS	Illumina HiSeq	Unspecified	Q6A162	K1C40_HUMAN			5	831	-		Breast(137;0.00043)	224			Rod.|Coil 1B.		Q6IFU5	Nonsense_Mutation	SNP	ENST00000398486.2	37	c.670A>T	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	T	37	6.607678	0.97701	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	.	.	.	5.47	5.47	0.80525	.	0.000000	0.35349	N	0.003279	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0253	0.71667	0.0:0.0:0.0:1.0	.	.	.	.	X	224	.	ENSP00000366984:K224X	K	-	1	0	KRT40	36392102	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.210000	0.72176	2.204000	0.70986	0.533000	0.62120	AAG		0.473	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497		11	96	0	0	0	0.000978	0	11	96				
WNK4	65266	broad.mit.edu	37	17	40948087	40948087	+	Intron	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:40948087C>T	ENST00000246914.5	+	16	3452				CNTD1_ENST00000588408.1_5'Flank|CNTD1_ENST00000588527.1_5'Flank	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4						chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GAGAGGAGAACCTGGGAGAGC	0.537																																					Esophageal Squamous(6;201 374 4964 23855 42828)		uc010wgz.1		NA																	0					0						c.(169-171)AGG>AGA		SubName: Full=cDNA FLJ50764;							66.0	67.0	67.0					17																	40948087		2203	4300	6503	SO:0001627	intron_variant	28958					integral to membrane		g.chr17:40948087C>T	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3431+36C>T	17.37:g.40948087C>T			Somatic				WNK4_uc002ibj.2_Intron|WNK4_uc010wgx.1_Intron|CNTD1_uc002ibm.3_5'Flank|CNTD1_uc010wha.1_5'Flank	p.R57R			WXS	Illumina HiSeq	Unspecified	Q9Y2R0	CCD56_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0741)	3	448	-		Breast(137;0.00104)	Error:Variant_position_missing_in_Q9Y2R0_after_alignment					B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Silent	SNP	ENST00000246914.5	37	c.171G>A	CCDS11439.1																																																																																				0.537	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			4	93	0	0	0	0.000602	0	4	93				
APPBP2	10513	broad.mit.edu	37	17	58541402	58541402	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:58541402C>T	ENST00000083182.3	-	6	1029	c.742G>A	c.(742-744)Gtc>Atc	p.V248I	APPBP2_ENST00000592995.1_Intron	NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	248					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)	p.V248I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TGTCTTAAGACATCCACCACA	0.294																																							uc002iys.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(742-744)GTC>ATC		amyloid beta precursor protein-binding protein							87.0	86.0	86.0					17																	58541402		2203	4300	6503	SO:0001583	missense	10513				intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding	g.chr17:58541402C>T	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.742G>A	17.37:g.58541402C>T	ENSP00000083182:p.Val248Ile		Somatic				APPBP2_uc010ddl.1_Missense_Mutation_p.V177I	p.V248I	NM_006380	NP_006371	WXS	Illumina HiSeq	Unspecified	Q92624	APBP2_HUMAN	Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)		6	1030	-	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		248					A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	c.742G>A	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798879	0.70567	.	.	ENSG00000062725	ENST00000083182	T	0.75477	-0.94	5.47	5.47	0.80525	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	L	0.41236	1.265	0.80722	D	1	P	0.35745	0.518	B	0.41374	0.355	T	0.69359	-0.5166	10	0.31617	T	0.26	-1.5999	19.3236	0.94252	0.0:1.0:0.0:0.0	.	248	Q92624	APBP2_HUMAN	I	248	ENSP00000083182:V248I	ENSP00000083182:V248I	V	-	1	0	APPBP2	55896184	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.392000	0.79840	2.560000	0.86352	0.467000	0.42956	GTC		0.294	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380		7	66	0	0	0	0.004482	0	7	66				
KIF19	124602	broad.mit.edu	37	17	72338032	72338032	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:72338032C>A	ENST00000389916.4	+	3	276	c.138C>A	c.(136-138)gaC>gaA	p.D46E		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	46	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.D46E(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						TTCTCATGGACCCAATGGAGG	0.622																																							uc002jkm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)GAC>GAA		kinesin family member 19							114.0	112.0	113.0					17																	72338032		2203	4300	6503	SO:0001583	missense	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72338032C>A	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.138C>A	17.37:g.72338032C>A	ENSP00000374566:p.Asp46Glu		Somatic				KIF19_uc002jkj.2_Missense_Mutation_p.D46E|KIF19_uc002jkk.2_Missense_Mutation_p.D46E|KIF19_uc002jkl.2_Missense_Mutation_p.D46E	p.D46E	NM_153209	NP_694941	WXS	Illumina HiSeq	Unspecified	Q2TAC6	KIF19_HUMAN			3	276	+			46			Kinesin-motor.		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	c.138C>A	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832528	0.71258	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.74209	-0.62;-0.82	5.29	2.17	0.27698	Kinesin, motor domain (4);	.	.	.	.	T	0.78805	0.4341	L	0.44542	1.39	0.48452	D	0.999655	D;D;D;D	0.89917	0.994;1.0;0.994;0.987	D;D;D;P	0.76575	0.968;0.988;0.919;0.858	T	0.76987	-0.2755	9	0.56958	D	0.05	.	9.9808	0.41813	0.0:0.7137:0.0:0.2863	.	46;46;46;46	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	E	46	ENSP00000449134:D46E;ENSP00000374566:D46E	ENSP00000374566:D46E	D	+	3	2	KIF19	69849627	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	1.463000	0.35277	0.629000	0.30376	-0.273000	0.10243	GAC		0.622	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		18	93	1	0	7.07596e-05	0.006122	9.07724e-05	18	93				
C17orf70	80233	broad.mit.edu	37	17	79517597	79517597	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:79517597T>C	ENST00000327787.8	-	3	969	c.923A>G	c.(922-924)cAc>cGc	p.H308R	C17orf70_ENST00000537152.1_Missense_Mutation_p.H157R|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	308					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H157R(1)|p.H308R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GCAGTCACAGTGCACATCCTC	0.607																																							uc002kaq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(922-924)CAC>CGC		Fanconi anemia core complex 100 kDa subunit							49.0	51.0	50.0					17																	79517597		2202	4300	6502	SO:0001583	missense	80233				DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding	g.chr17:79517597T>C	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.923A>G	17.37:g.79517597T>C	ENSP00000333283:p.His308Arg		Somatic				C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.H157R	p.H308R	NM_001109760	NP_001103230	WXS	Illumina HiSeq	Unspecified	Q0VG06	FP100_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)		3	978	-	all_neural(118;0.0878)|Melanoma(429;0.242)		308					A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	ENST00000327787.8	37	c.923A>G	CCDS32765.2	.	.	.	.	.	.	.	.	.	.	T	10.32	1.318662	0.23994	.	.	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302	T;T	0.31510	1.49;1.5	3.91	-1.6	0.08426	.	0.788107	0.11726	N	0.535412	T	0.22820	0.0551	L	0.59436	1.845	0.09310	N	1	P	0.35982	0.531	B	0.35607	0.206	T	0.20405	-1.0276	10	0.48119	T	0.1	.	1.1151	0.01712	0.1695:0.2711:0.3447:0.2147	.	308	Q0VG06	FP100_HUMAN	R	308;157;157;157	ENSP00000333283:H308R;ENSP00000440151:H157R	ENSP00000333283:H308R	H	-	2	0	C17orf70	77128039	0.017000	0.18338	0.000000	0.03702	0.938000	0.57974	-0.015000	0.12634	-0.216000	0.10048	-0.371000	0.07208	CAC		0.607	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161		7	61	0	0	0	0.001984	0	7	61				
DSG4	147409	broad.mit.edu	37	18	28980905	28980905	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:28980905C>G	ENST00000308128.4	+	10	1474	c.1339C>G	c.(1339-1341)Caa>Gaa	p.Q447E	RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.Q447E|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q447E(2)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGGTGAGATACAATTTTCTAG	0.303																																							uc002kwq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(3)	8						c.(1339-1341)CAA>GAA		desmoglein 4 isoform 2 preproprotein							48.0	54.0	52.0					18																	28980905		2199	4285	6484	SO:0001583	missense	147409				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28980905C>G	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1339C>G	18.37:g.28980905C>G	ENSP00000311859:p.Gln447Glu		Somatic				DSG4_uc002kwr.2_Missense_Mutation_p.Q447E	p.Q447E	NM_177986	NP_817123	WXS	Illumina HiSeq	Unspecified	Q86SJ6	DSG4_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		10	1474	+			447			Extracellular (Potential).|Cadherin 4.		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	c.1339C>G	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029086	0.35797	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.50001	0.76;0.76	5.42	3.56	0.40772	Cadherin (4);Cadherin-like (1);	0.249913	0.20950	N	0.082768	T	0.40067	0.1102	L	0.31664	0.95	0.29251	N	0.871992	B;B	0.25206	0.12;0.021	B;B	0.32624	0.149;0.103	T	0.39702	-0.9601	10	0.46703	T	0.11	.	13.6122	0.62086	0.5762:0.4238:0.0:0.0	.	447;447	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	E	447	ENSP00000311859:Q447E;ENSP00000352785:Q447E	ENSP00000311859:Q447E	Q	+	1	0	DSG4	27234903	0.962000	0.33011	0.994000	0.49952	0.830000	0.47004	0.918000	0.28678	0.695000	0.31675	0.591000	0.81541	CAA		0.303	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		3	81	0	0	0	0.004672	0	3	81				
ZNF271	10778	broad.mit.edu	37	18	32887120	32887120	+	RNA	SNP	G	G	T	rs142309584		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:32887120G>T	ENST00000399070.3	+	0	1514					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V178F(1)		large_intestine(3)|lung(9)	12						TTTAGTCGCCGTTCAGATCTT	0.378																																							uc002kyq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(532-534)GTT>TTT		SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;							97.0	99.0	98.0					18																	32887120		2203	4300	6503			10778							g.chr18:32887120G>T	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32887120G>T			Somatic				ZNF271_uc002kyp.3_Missense_Mutation_p.V178F|ZNF271_uc002kyr.3_Missense_Mutation_p.V178F	p.V178F	NR_024565		WXS	Illumina HiSeq	Unspecified					3	1524	+								B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	Missense_Mutation	SNP	ENST00000399070.3	37	c.532G>T																																																																																					0.378	ZNF271-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255767.2	NR_024565		10	157	1	0	1.58986e-06	0.008291	2.39422e-06	10	157				
SETBP1	26040	broad.mit.edu	37	18	42532822	42532822	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:42532822C>G	ENST00000282030.5	+	4	3813	c.3517C>G	c.(3517-3519)Ctt>Gtt	p.L1173V		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1173						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L1119V(1)|p.L1173V(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCTGAGTGGTCTTTTTGCAGG	0.542									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(3517-3519)CTT>GTT		SET binding protein 1 isoform a							75.0	78.0	77.0					18																	42532822		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532822C>G	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3517C>G	18.37:g.42532822C>G	ENSP00000282030:p.Leu1173Val		Somatic					p.L1173V	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	3813	+			1173					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.3517C>G	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260254	0.59321	.	.	ENSG00000152217	ENST00000282030	T	0.74106	-0.81	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.82139	0.4972	L	0.34521	1.04	0.47862	D	0.999539	D	0.89917	1.0	D	0.83275	0.996	T	0.82748	-0.0304	10	0.87932	D	0	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	1173	Q9Y6X0	SETBP_HUMAN	V	1173	ENSP00000282030:L1173V	ENSP00000282030:L1173V	L	+	1	0	SETBP1	40786820	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.658000	0.68003	2.873000	0.98535	0.561000	0.74099	CTT		0.542	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		7	66	0	0	0	0.001984	0	7	66				
SLC14A2	8170	broad.mit.edu	37	18	43262466	43262466	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:43262466G>T	ENST00000255226.6	+	20	3561	c.2745G>T	c.(2743-2745)caG>caT	p.Q915H	SLC14A2_ENST00000586448.1_Missense_Mutation_p.Q915H|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.Q392H	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	915					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)	p.Q915H(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAAAGTATCAGGCCTACGATG	0.498																																							uc010dnj.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(2743-2745)CAG>CAT		solute carrier family 14 (urea transporter),							140.0	129.0	132.0					18																	43262466		2203	4300	6503	SO:0001583	missense	8170					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity	g.chr18:43262466G>T	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2745G>T	18.37:g.43262466G>T	ENSP00000255226:p.Gln915His		Somatic				SLC14A2_uc002lbe.2_Missense_Mutation_p.Q915H	p.Q915H	NM_007163	NP_009094	WXS	Illumina HiSeq	Unspecified	Q15849	UT2_HUMAN			21	3066	+			915					A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	c.2745G>T	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611318	0.46631	.	.	ENSG00000132874	ENST00000255226	T	0.37235	1.21	4.82	-0.173	0.13322	.	0.117678	0.37530	N	0.002058	T	0.31167	0.0788	L	0.44542	1.39	0.80722	D	1	D	0.54397	0.966	P	0.46796	0.527	T	0.08391	-1.0724	10	0.87932	D	0	-7.4278	8.1262	0.30999	0.4766:0.0:0.5234:0.0	.	915	Q15849	UT2_HUMAN	H	915	ENSP00000255226:Q915H	ENSP00000255226:Q915H	Q	+	3	2	SLC14A2	41516464	1.000000	0.71417	0.998000	0.56505	0.533000	0.34776	0.665000	0.25083	-0.036000	0.13669	-0.258000	0.10820	CAG		0.498	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			6	92	1	0	1.06961e-07	0.00308	1.68398e-07	6	92				
MYO5B	4645	broad.mit.edu	37	18	47421485	47421485	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:47421485C>G	ENST00000285039.7	-	22	3170	c.2871G>C	c.(2869-2871)atG>atC	p.M957I	MYO5B_ENST00000324581.6_Missense_Mutation_p.M98I	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	957					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.M957I(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCTCTACCTCCATGGTGTATG	0.547																																							uc002leb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(2869-2871)ATG>ATC		myosin VB							75.0	74.0	74.0					18																	47421485		2002	4185	6187	SO:0001583	missense	4645				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr18:47421485C>G	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2871G>C	18.37:g.47421485C>G	ENSP00000285039:p.Met957Ile		Somatic				MYO5B_uc002lea.2_Missense_Mutation_p.M98I	p.M957I	NM_001080467	NP_001073936	WXS	Illumina HiSeq	Unspecified	Q9ULV0	MYO5B_HUMAN		READ - Rectum adenocarcinoma(32;0.103)	22	3159	-			957			Potential.		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	c.2871G>C	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	6.977	0.550251	0.13374	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.16597	2.33;2.33	5.68	2.95	0.34219	.	0.534882	0.21396	N	0.075227	T	0.09818	0.0241	L	0.29908	0.895	0.25944	N	0.982837	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.21793	-1.0235	10	0.41790	T	0.15	.	1.4601	0.02394	0.1325:0.3992:0.2329:0.2355	.	957;98	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	I	957;98	ENSP00000285039:M957I;ENSP00000315531:M98I	ENSP00000285039:M957I	M	-	3	0	MYO5B	45675483	0.000000	0.05858	0.974000	0.42286	0.340000	0.28889	-0.971000	0.03806	0.765000	0.33221	0.491000	0.48974	ATG		0.547	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			6	57	0	0	0	0.00308	0	6	57				
CDH7	1005	broad.mit.edu	37	18	63492008	63492008	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:63492008G>T	ENST00000397968.2	+	6	1348	c.922G>T	c.(922-924)Ggc>Tgc	p.G308C	CDH7_ENST00000536984.2_Missense_Mutation_p.G308C|CDH7_ENST00000323011.3_Missense_Mutation_p.G308C	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G308C(2)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TGATGGTTTGGGCATTTTTAA	0.368																																							uc002ljz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(922-924)GGC>TGC		cadherin 7, type 2 preproprotein							149.0	141.0	144.0					18																	63492008		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63492008G>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.922G>T	18.37:g.63492008G>T	ENSP00000381058:p.Gly308Cys		Somatic				CDH7_uc002lka.2_Missense_Mutation_p.G308C|CDH7_uc002lkb.2_Missense_Mutation_p.G308C	p.G308C	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			6	1247	+		Esophageal squamous(42;0.129)	308			Extracellular (Potential).|Cadherin 3.		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.922G>T	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116783	0.77323	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.55413	0.52;0.52;0.52	4.65	4.65	0.58169	Cadherin (4);Cadherin-like (1);	0.063069	0.64402	D	0.000011	T	0.76898	0.4052	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.927;1.0	T	0.82400	-0.0476	10	0.87932	D	0	.	17.9028	0.88910	0.0:0.0:1.0:0.0	.	308;308	F5H5X9;Q9ULB5	.;CADH7_HUMAN	C	308	ENSP00000319166:G308C;ENSP00000443030:G308C;ENSP00000381058:G308C	ENSP00000319166:G308C	G	+	1	0	CDH7	61642988	1.000000	0.71417	0.942000	0.38095	0.878000	0.50629	9.256000	0.95535	2.291000	0.77112	0.637000	0.83480	GGC		0.368	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		15	96	1	0	5.01169e-05	0.00499	6.47273e-05	15	96				
NETO1	81832	broad.mit.edu	37	18	70417390	70417390	+	Nonsense_Mutation	SNP	G	G	T	rs139202022		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:70417390G>T	ENST00000327305.6	-	9	2105	c.1448C>A	c.(1447-1449)tCg>tAg	p.S483*	NETO1_ENST00000299430.2_Nonsense_Mutation_p.S482*|RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000583169.1_Nonsense_Mutation_p.S483*	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	483					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.S483*(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AGCATCTTGCGAGTAGCTGTG	0.502																																							uc002lkw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1447-1449)TCG>TAG		neuropilin- and tolloid-like protein 1 isoform 3							179.0	153.0	162.0					18																	70417390		2203	4300	6503	SO:0001587	stop_gained	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70417390G>T	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1448C>A	18.37:g.70417390G>T	ENSP00000313088:p.Ser483*		Somatic				NETO1_uc002lkx.1_Nonsense_Mutation_p.S482*|NETO1_uc002lky.1_Nonsense_Mutation_p.S483*	p.S483*	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	9	1732	-		Esophageal squamous(42;0.129)	483			Cytoplasmic (Potential).		Q86W85|Q8ND78|Q8TDF4	Nonsense_Mutation	SNP	ENST00000327305.6	37	c.1448C>A	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	G	44	10.939980	0.99492	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	.	.	.	5.76	5.76	0.90799	.	0.000000	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7174	19.973	0.97292	0.0:0.0:1.0:0.0	.	.	.	.	X	483;482	.	ENSP00000299430:S482X	S	-	2	0	NETO1	68568370	1.000000	0.71417	0.959000	0.39883	0.980000	0.70556	9.183000	0.94887	2.725000	0.93324	0.460000	0.39030	TCG		0.502	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		10	59	1	0	0.000442599	0.006214	0.00055108	10	59				
SHC2	25759	broad.mit.edu	37	19	425152	425152	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:425152C>A	ENST00000264554.6	-	10	1253	c.1254G>T	c.(1252-1254)caG>caT	p.Q418H		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	418	CH1.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)		p.Q779H(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCCAGACCCTGGGTGTTGA	0.682																																							uc002loq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1252-1254)CAG>CAT		SHC (Src homology 2 domain containing)							40.0	48.0	45.0					19																	425152		1934	4116	6050	SO:0001583	missense	25759				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol		g.chr19:425152C>A	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.1254G>T	19.37:g.425152C>A	ENSP00000264554:p.Gln418His		Somatic				SHC2_uc002lop.3_Missense_Mutation_p.Q159H	p.Q418H	NM_012435	NP_036567	WXS	Illumina HiSeq	Unspecified	P98077	SHC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	10	1254	-		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	418			CH1.		O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	ENST00000264554.6	37	c.1254G>T	CCDS45891.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993356	0.35131	.	.	ENSG00000129946	ENST00000264554	T	0.31510	1.49	4.22	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	M	0.82923	2.615	0.41067	D	0.98542	P	0.47484	0.896	B	0.40602	0.334	T	0.42849	-0.9427	10	0.62326	D	0.03	-38.3277	10.4467	0.44499	0.0:0.8991:0.0:0.1009	.	418	P98077	SHC2_HUMAN	H	418	ENSP00000264554:Q418H	ENSP00000264554:Q418H	Q	-	3	2	SHC2	376152	1.000000	0.71417	0.995000	0.50966	0.121000	0.20230	1.654000	0.37334	0.898000	0.36418	0.491000	0.48974	CAG		0.682	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3			12	47	1	0	1.61879e-10	0.001368	2.80345e-10	12	47				
KHSRP	8570	broad.mit.edu	37	19	6427222	6427222	+	5'Flank	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:6427222C>T	ENST00000398148.3	-	0	0				SLC25A41_ENST00000321510.6_Missense_Mutation_p.G278R	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.G278R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CTGGGGTCCCCCATATCCCTG	0.627																																					Colon(55;593 1006 2067 9135 22980)		uc010dus.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(832-834)GGG>AGG		solute carrier family 25, member 41							25.0	29.0	28.0					19																	6427222		2016	4187	6203	SO:0001631	upstream_gene_variant	284427				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr19:6427222C>T	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945			19.37:g.6427222C>T	Exception_encountered		Somatic				KHSRP_uc002mer.3_5'Flank|SLC25A41_uc010dut.2_Missense_Mutation_p.G140R	p.G278R	NM_173637	NP_775908	WXS	Illumina HiSeq	Unspecified	Q8N5S1	S2541_HUMAN			6	918	-			278					O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	c.832G>A	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	C	5.558	0.287801	0.10513	.	.	ENSG00000181240	ENST00000321510	T	0.78003	-1.14	3.98	-0.89	0.10577	Mitochondrial carrier domain (2);	.	.	.	.	T	0.50411	0.1614	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.36432	-0.9748	9	0.27082	T	0.32	-8.2755	5.5519	0.17095	0.0:0.5808:0.1434:0.2759	.	278	Q8N5S1	S2541_HUMAN	R	278	ENSP00000322649:G278R	ENSP00000322649:G278R	G	-	1	0	SLC25A41	6378222	0.000000	0.05858	0.933000	0.37362	0.462000	0.32619	0.048000	0.14078	0.018000	0.15052	0.462000	0.41574	GGG		0.627	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1			6	25	0	0	0	0.001984	0	6	25				
MUC16	94025	broad.mit.edu	37	19	9066578	9066578	+	Silent	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:9066578G>C	ENST00000397910.4	-	3	21071	c.20868C>G	c.(20866-20868)acC>acG	p.T6956T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6958	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T6956T(2)|p.T2589T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGAAATGCTGGTCTCTCTCA	0.448																																							uc002mkp.2		NA																	3	Substitution - coding silent(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(20866-20868)ACC>ACG		mucin 16							151.0	147.0	148.0					19																	9066578		1938	4148	6086	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9066578G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20868C>G	19.37:g.9066578G>C			Somatic					p.T6956T	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	21072	-			6958			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.20868C>G	CCDS54212.1																																																																																				0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		20	175	0	0	0	0.008871	0	20	175				
ZNF317	57693	broad.mit.edu	37	19	9270789	9270789	+	Splice_Site	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:9270789G>A	ENST00000247956.6	+	7	773		c.e7-1		ZNF317_ENST00000360385.3_Splice_Site	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						TTAACCAACAGGAAAGAGCCG	0.478																																							uc002mku.2		NA																	1	Unknown(1)		lung(1)		0						c.e7-1		zinc finger protein 317							76.0	75.0	75.0					19																	9270789		2203	4300	6503	SO:0001630	splice_region_variant	57693				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9270789G>A	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.469-1G>A	19.37:g.9270789G>A			Somatic				ZNF317_uc002mkv.2_Splice_Site_p.E16_splice|ZNF317_uc002mkw.2_Splice_Site_p.E125_splice|ZNF317_uc002mkx.2_Splice_Site_p.E72_splice|ZNF317_uc002mky.2_Splice_Site_p.E40_splice	p.E157_splice	NM_020933	NP_065984	WXS	Illumina HiSeq	Unspecified	Q96PQ6	ZN317_HUMAN			7	744	+								Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Splice_Site	SNP	ENST00000247956.6	37	c.469_splice	CCDS12210.1	.	.	.	.	.	.	.	.	.	.	.	12.12	1.841452	0.32513	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	.	.	.	3.31	3.31	0.37934	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7605	0.34672	0.0:0.2331:0.7668:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF317	9131789	0.005000	0.15991	0.990000	0.47175	0.101000	0.19017	-0.058000	0.11750	2.167000	0.68274	0.591000	0.81541	.		0.478	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933	Intron	5	74	0	0	0	0.000602	0	5	74				
JAK3	3718	broad.mit.edu	37	19	17942109	17942109	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:17942109C>A	ENST00000527670.1	-	20	2935	c.2906G>T	c.(2905-2907)gGc>gTc	p.G969V	JAK3_ENST00000534444.1_Missense_Mutation_p.G969V|JAK3_ENST00000458235.1_Missense_Mutation_p.G969V			P52333	JAK3_HUMAN	Janus kinase 3	969	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.G969V(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CTTAGCTAGGCCGAAGTCAGC	0.657		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		uc002nhn.3		2		Dom	yes		19	19p13.1	3718	Mis	Janus kinase 3			L			acute megakaryocytic leukemia|		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						c.(2905-2907)GGC>GTC		Janus kinase 3							136.0	118.0	124.0					19																	17942109		2203	4300	6503	SO:0001583	missense	3718				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr19:17942109C>A	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2906G>T	19.37:g.17942109C>A	ENSP00000432511:p.Gly969Val		Somatic				JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Missense_Mutation_p.G969V	p.G969V	NM_000215	NP_000206	WXS	Illumina HiSeq	Unspecified	P52333	JAK3_HUMAN			21	3006	-			969			Protein kinase 2.		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	c.2906G>T	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658103	0.88154	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.99270	-3.12;-3.12;-5.66	3.28	3.28	0.37604	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.133715	0.49916	D	0.000134	D	0.99573	0.9846	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.981;0.997	D	0.97740	1.0208	10	0.87932	D	0	-24.1166	12.8641	0.57930	0.0:1.0:0.0:0.0	.	969;969	P52333-2;P52333	.;JAK3_HUMAN	V	969	ENSP00000391676:G969V;ENSP00000432511:G969V;ENSP00000436421:G969V	ENSP00000391676:G969V	G	-	2	0	JAK3	17803109	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.670000	0.83925	1.799000	0.52666	0.462000	0.41574	GGC		0.657	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215		11	98	1	0	0.00136819	0.001368	0.00166013	11	98				
ZNF536	9745	broad.mit.edu	37	19	30936068	30936068	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:30936068G>T	ENST00000355537.3	+	2	1746	c.1599G>T	c.(1597-1599)atG>atT	p.M533I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	533					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.M533I(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCATGGCCATGGAACATGGCT	0.602																																							uc002nsu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(1597-1599)ATG>ATT		zinc finger protein 536							55.0	61.0	59.0					19																	30936068		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30936068G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1599G>T	19.37:g.30936068G>T	ENSP00000347730:p.Met533Ile		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.M533I	p.M533I	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	1737	+	Esophageal squamous(110;0.0834)		533					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.1599G>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	9.619	1.133333	0.21041	.	.	ENSG00000198597	ENST00000355537	T	0.40476	1.03	5.53	4.47	0.54385	.	0.037199	0.85682	D	0.000000	T	0.36441	0.0967	L	0.44542	1.39	0.46609	D	0.999121	B;B	0.26318	0.146;0.146	B;B	0.24974	0.057;0.057	T	0.10177	-1.0641	10	0.25751	T	0.34	-15.3262	15.5642	0.76277	0.0:0.0:0.8609:0.1391	.	533;533	A7E228;O15090	.;ZN536_HUMAN	I	533	ENSP00000347730:M533I	ENSP00000347730:M533I	M	+	3	0	ZNF536	35627908	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.837000	0.86796	1.278000	0.44430	0.655000	0.94253	ATG		0.602	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		6	80	1	0	3.59834e-05	0.001168	4.72747e-05	6	80				
WDR62	284403	broad.mit.edu	37	19	36580003	36580003	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:36580003A>T	ENST00000270301.7	+	14	1832	c.1832A>T	c.(1831-1833)cAg>cTg	p.Q611L	WDR62_ENST00000401500.2_Missense_Mutation_p.Q611L			O43379	WDR62_HUMAN	WD repeat domain 62	611					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.Q611L(1)		cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGCAGTGCCCAGCAGGTAGGG	0.622																																							uc002odc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1831-1833)CAG>CTG		WD repeat domain 62 isoform 2							60.0	48.0	52.0					19																	36580003		2203	4300	6503	SO:0001583	missense	284403				cerebral cortex development	nucleus		g.chr19:36580003A>T	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1832A>T	19.37:g.36580003A>T	ENSP00000270301:p.Gln611Leu		Somatic				WDR62_uc002odd.2_Missense_Mutation_p.Q611L	p.Q611L	NM_173636	NP_775907	WXS	Illumina HiSeq	Unspecified	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		14	1923	+	Esophageal squamous(110;0.162)		611			WD 9.		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	c.1832A>T	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.305106	0.40795	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.51325	0.8;0.71	5.31	5.31	0.75309	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.197445	0.43579	D	0.000542	T	0.41026	0.1141	L	0.47190	1.495	0.80722	D	1	P;P	0.37122	0.518;0.583	B;B	0.33620	0.167;0.118	T	0.40720	-0.9548	10	0.52906	T	0.07	-10.9945	13.2188	0.59875	1.0:0.0:0.0:0.0	.	611;611	O43379-4;O43379	.;WDR62_HUMAN	L	611	ENSP00000384792:Q611L;ENSP00000270301:Q611L	ENSP00000270301:Q611L	Q	+	2	0	WDR62	41271843	1.000000	0.71417	0.997000	0.53966	0.503000	0.33858	6.959000	0.76031	2.014000	0.59158	0.533000	0.62120	CAG		0.622	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		7	21	0	0	0	0.001984	0	7	21				
ZNF260	339324	broad.mit.edu	37	19	37005826	37005826	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:37005826G>A	ENST00000523638.1	-	3	1436	c.315C>T	c.(313-315)caC>caT	p.H105H	ZNF260_ENST00000593142.1_Silent_p.H105H|ZNF260_ENST00000588993.1_Silent_p.H105H|ZNF260_ENST00000592282.1_Silent_p.H105H	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	105					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H105H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					TCTCTCCAGTGTGATGTTTCT	0.378																																							uc002oee.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(313-315)CAC>CAT		zinc finger protein 260							122.0	116.0	118.0					19																	37005826		2203	4300	6503	SO:0001819	synonymous_variant	339324				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37005826G>A	AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.315C>T	19.37:g.37005826G>A			Somatic				ZNF260_uc002oed.1_Silent_p.H102H|ZNF260_uc010eey.1_Silent_p.H102H|ZNF260_uc002oef.1_Silent_p.H102H	p.H105H	NM_001012756	NP_001012774	WXS	Illumina HiSeq	Unspecified	Q3ZCT1	ZN260_HUMAN			4	1159	-	Esophageal squamous(110;0.162)		105			C2H2-type 3.		Q0VF43	Silent	SNP	ENST00000523638.1	37	c.315C>T	CCDS33003.1																																																																																				0.378	ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109564.2	NM_001012756		10	148	0	0	0	0.008291	0	10	148				
RELB	5971	broad.mit.edu	37	19	45541024	45541024	+	Silent	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:45541024A>G	ENST00000221452.8	+	12	1866	c.1716A>G	c.(1714-1716)ctA>ctG	p.L572L	RELB_ENST00000540120.1_Silent_p.L572L|CLASRP_ENST00000221455.3_5'Flank|CLASRP_ENST00000391953.4_5'Flank|CLASRP_ENST00000544944.2_5'Flank|RELB_ENST00000505236.1_Silent_p.L569L	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	572					antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.L572L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GCGGCCTCCTATCCCCGGGGC	0.687																																							uc002paj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1714-1716)CTA>CTG		reticuloendotheliosis viral oncogene homolog B							20.0	23.0	22.0					19																	45541024		1850	4072	5922	SO:0001819	synonymous_variant	5971					nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr19:45541024A>G	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.1716A>G	19.37:g.45541024A>G			Somatic				SFRS16_uc002pak.2_5'Flank|SFRS16_uc002pal.2_5'Flank|SFRS16_uc010xxh.1_5'Flank|SFRS16_uc002pam.2_5'Flank|SFRS16_uc002pan.1_5'Flank	p.L572L	NM_006509	NP_006500	WXS	Illumina HiSeq	Unspecified	Q01201	RELB_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00986)	13	1842	+		Ovarian(192;0.0728)|all_neural(266;0.112)	572					Q6GTX7|Q9UEI7	Silent	SNP	ENST00000221452.8	37	c.1716A>G	CCDS46110.1																																																																																				0.687	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2			6	41	0	0	0	0.001984	0	6	41				
SLC6A16	28968	broad.mit.edu	37	19	49813408	49813408	+	Missense_Mutation	SNP	C	C	A	rs377673703		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:49813408C>A	ENST00000335875.4	-	4	830	c.589G>T	c.(589-591)Ggc>Tgc	p.G197C	SLC6A16_ENST00000454748.3_Missense_Mutation_p.G197C|MIR4324_ENST00000584846.1_RNA	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	197					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G197C(1)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		AAGTACAGGCCGAGGATGAAG	0.522																																							uc002pmz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|kidney(1)	4						c.(589-591)GGC>TGC		solute carrier family 6, member 16							76.0	73.0	74.0					19																	49813408		2006	4169	6175	SO:0001583	missense	28968					integral to membrane|intracellular	neurotransmitter:sodium symporter activity	g.chr19:49813408C>A	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.589G>T	19.37:g.49813408C>A	ENSP00000338627:p.Gly197Cys		Somatic				SLC6A16_uc002pna.2_Missense_Mutation_p.G197C|hsa-mir-4324|MI0015854_5'Flank	p.G197C	NM_014037	NP_054756	WXS	Illumina HiSeq	Unspecified	Q9GZN6	S6A16_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)	4	823	-		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	197			Helical; Name=2; (Potential).		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	c.589G>T	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.788614	0.49997	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.76060	-0.99;-0.99	4.58	-8.88	0.00789	.	0.537577	0.19136	N	0.121801	T	0.77471	0.4135	L	0.47016	1.485	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.979	T	0.80151	-0.1502	10	0.87932	D	0	.	17.1252	0.86712	0.0:0.2046:0.0:0.7954	.	197;197	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	C	197	ENSP00000338627:G197C;ENSP00000404022:G197C	ENSP00000338627:G197C	G	-	1	0	SLC6A16	54505220	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.137000	0.10389	-2.094000	0.00854	-0.768000	0.03414	GGC		0.522	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037		19	63	1	0	7.45023e-12	0.001523	1.32025e-11	19	63				
NUP62	23636	broad.mit.edu	37	19	50413058	50413058	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:50413058C>A	ENST00000596217.1	-	2	1894	c.7G>T	c.(7-9)Ggg>Tgg	p.G3W	CTC-326K19.6_ENST00000451973.1_3'UTR|NUP62_ENST00000352066.3_Missense_Mutation_p.G3W|NUP62_ENST00000600583.1_5'UTR|NUP62_ENST00000413454.1_Missense_Mutation_p.G3W|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597723.1_Missense_Mutation_p.G3W|NUP62_ENST00000597029.1_Missense_Mutation_p.G3W|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Missense_Mutation_p.G3W			P37198	NUP62_HUMAN	nucleoporin 62kDa	3	15 X 9 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.G3W(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AAATTAAACCCGCTCATGGCT	0.557																																							uc002pqx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(7-9)GGG>TGG		nucleoporin 62kDa							24.0	29.0	27.0					19																	50413058		2197	4293	6490	SO:0001583	missense	23636				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding	g.chr19:50413058C>A	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.7G>T	19.37:g.50413058C>A	ENSP00000471191:p.Gly3Trp		Somatic				IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Missense_Mutation_p.G3W|NUP62_uc002pqz.2_Missense_Mutation_p.G3W|NUP62_uc002pra.2_Missense_Mutation_p.G3W|NUP62_uc002prb.2_Missense_Mutation_p.G3W|NUP62_uc002prc.2_Missense_Mutation_p.G3W	p.G3W	NM_153719	NP_714941	WXS	Illumina HiSeq	Unspecified	P37198	NUP62_HUMAN		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)	2	111	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	3			15 X 9 AA approximate repeats.|1.		B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	ENST00000596217.1	37	c.7G>T	CCDS12788.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712381	0.48517	.	.	ENSG00000213024	ENST00000319225;ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.43688	0.94;0.94;0.94	5.09	3.99	0.46301	Nucleoporin, NSP1-like, C-terminal (1);	0.080232	0.48286	U	0.000186	T	0.55000	0.1893	M	0.72894	2.215	0.28324	N	0.922097	D;D	0.69078	0.997;0.997	P;P	0.60949	0.881;0.764	T	0.52087	-0.8622	10	0.87932	D	0	-1.1429	8.2065	0.31458	0.1741:0.6579:0.168:0.0	.	3;3	Q8WYU3;P37198	.;NUP62_HUMAN	W	3	ENSP00000305503:G3W;ENSP00000407331:G3W;ENSP00000387991:G3W	ENSP00000321866:G3W	G	-	1	0	NUP62	55104870	0.879000	0.30193	1.000000	0.80357	0.993000	0.82548	0.490000	0.22403	2.806000	0.96561	0.655000	0.94253	GGG		0.557	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719		6	25	1	0	2.0095e-06	0.001984	2.9334e-06	6	25				
ZNF836	162962	broad.mit.edu	37	19	52658445	52658445	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:52658445C>A	ENST00000322146.8	-	5	3012	c.2491G>T	c.(2491-2493)Gac>Tac	p.D831Y	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Missense_Mutation_p.D831Y	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	831					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D831Y(2)		endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TAAGGTTTGTCCCCAGTATGC	0.388																																							uc010ydi.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2491-2493)GAC>TAC		zinc finger protein 836							129.0	138.0	135.0					19																	52658445		2182	4290	6472	SO:0001583	missense	162962				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52658445C>A	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2491G>T	19.37:g.52658445C>A	ENSP00000325038:p.Asp831Tyr		Somatic				ZNF836_uc010ydj.1_Missense_Mutation_p.D831Y	p.D831Y	NM_001102657	NP_001096127	WXS	Illumina HiSeq	Unspecified	Q6ZNA1	ZN836_HUMAN			5	2865	-			831						Missense_Mutation	SNP	ENST00000322146.8	37	c.2491G>T	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513359	0.44660	.	.	ENSG00000196267	ENST00000322146	T	0.18657	2.2	1.9	0.782	0.18567	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31071	0.0785	M	0.66939	2.045	0.24222	N	0.995437	P	0.38677	0.642	P	0.48524	0.58	T	0.23404	-1.0189	9	0.87932	D	0	.	7.4066	0.26993	0.0:0.8497:0.0:0.1503	.	831	Q6ZNA1	ZN836_HUMAN	Y	831	ENSP00000325038:D831Y	ENSP00000325038:D831Y	D	-	1	0	ZNF836	57350257	0.000000	0.05858	0.005000	0.12908	0.210000	0.24377	0.010000	0.13242	0.128000	0.18479	0.484000	0.47621	GAC		0.388	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657		30	241	1	0	7.26314e-15	0.007291	1.34988e-14	30	241				
FCAR	2204	broad.mit.edu	37	19	55385779	55385779	+	Splice_Site	SNP	G	G	A	rs535382825		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:55385779G>A	ENST00000355524.3	+	1	44	c.34G>A	c.(34-36)Gtg>Atg	p.V12M	FCAR_ENST00000345937.4_Splice_Site_p.V12M|FCAR_ENST00000391726.3_Splice_Site_p.G12R|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000353758.4_Splice_Site_p.G12S|FCAR_ENST00000359272.4_Splice_Site_p.G12R|FCAR_ENST00000391725.3_Splice_Site_p.V12M|FCAR_ENST00000391724.3_Splice_Site_p.G12R|FCAR_ENST00000469767.1_Splice_Site_p.V12M|FCAR_ENST00000391723.3_Splice_Site_p.G12R	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	12					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.V12M(2)|p.V12L(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CCTGTGTCTTGGTGAGTTTCA	0.478													.|||	1	0.000199681	0.0	0.0	5008	,	,		18252	0.001		0.0	False		,,,				2504	0.0						uc002qhr.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)|skin(1)	2						c.(34-36)GTG>ATG		Fc alpha receptor isoform a precursor							119.0	108.0	112.0					19																	55385779		2203	4300	6503	SO:0001630	splice_region_variant	2204				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity	g.chr19:55385779G>A	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.34+1G>A	19.37:g.55385779G>A			Somatic				FCAR_uc002qhq.2_Missense_Mutation_p.V12M|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Translation_Start_Site|FCAR_uc010esi.1_5'UTR|FCAR_uc002qhu.1_Missense_Mutation_p.V12M|FCAR_uc002qhv.1_Missense_Mutation_p.V12M|FCAR_uc002qhw.1_Missense_Mutation_p.G12R|FCAR_uc002qhx.1_Missense_Mutation_p.G12R|FCAR_uc002qhy.1_Missense_Mutation_p.G12R|FCAR_uc002qhz.1_Missense_Mutation_p.G12R|FCAR_uc002qia.1_Missense_Mutation_p.G12S	p.V12M	NM_002000	NP_001991	WXS	Illumina HiSeq	Unspecified	P24071	FCAR_HUMAN		GBM - Glioblastoma multiforme(193;0.0443)	1	231	+			12					Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	c.34G>A	CCDS12907.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	13.92|13.92|13.92	2.381045|2.381045|2.381045	0.42207|0.42207|0.42207	.|.|.	.|.|.	ENSG00000186431|ENSG00000186431|ENSG00000186431	ENST00000391726;ENST00000359272;ENST00000391723;ENST00000391724|ENST00000353758|ENST00000433231;ENST00000355524;ENST00000391725;ENST00000345937	T;T;T;T|T|T;T;T	0.14266|0.00691|0.01265	2.52;2.52;2.52;2.52|5.84|6.89;6.75;5.08	2.76|2.76|2.76	1.67|1.67|1.67	0.24075|0.24075|0.24075	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	0.04815|0.04815|0.04815	0.0130|0.0130|0.0130	M|M|M	0.63843|0.63843|0.63843	1.955|1.955|1.955	0.80722|0.80722|0.80722	D|D|D	1|1|1	P;B;P;D|D|D;P;P;D	0.76494|0.89917|0.69078	0.583;0.417;0.713;0.999|1.0|0.994;0.471;0.645;0.997	B;B;B;D|D|P;B;B;D	0.67103|0.83275|0.66847	0.274;0.075;0.392;0.949|0.996|0.887;0.4;0.186;0.947	T|T|T	0.41431|0.41431|0.41431	-0.9509|-0.9509|-0.9509	9|9|9	0.87932|0.87932|0.59425	D|D|D	0|0|0.04	.|.|.	7.1612|7.1612|7.1612	0.25664|0.25664|0.25664	0.0:0.0:0.7367:0.2633|0.0:0.0:0.7367:0.2633|0.0:0.0:0.7367:0.2633	.|.|.	12;12;12;12|12|12;12;12;12	Q92588;Q92593;Q92587;Q9UEK0|Q92592|Q53X39;P24071-3;P24071;P24071-4	.;.;.;.|.|.;.;FCAR_HUMAN;.	R|S|M	12|12|12	ENSP00000375606:G12R;ENSP00000352218:G12R;ENSP00000375603:G12R;ENSP00000375604:G12R|ENSP00000338058:G12S|ENSP00000347714:V12M;ENSP00000375605:V12M;ENSP00000338257:V12M	ENSP00000352218:G12R|ENSP00000338058:G12S|ENSP00000338257:V12M	G|G|V	+|+|+	1|1|1	0|0|0	FCAR|FCAR|FCAR	60077591|60077591|60077591	0.136000|0.136000|0.136000	0.22515|0.22515|0.22515	0.431000|0.431000|0.431000	0.26735|0.26735|0.26735	0.206000|0.206000|0.206000	0.24218|0.24218|0.24218	-0.051000|-0.051000|-0.051000	0.11885|0.11885|0.11885	0.681000|0.681000|0.681000	0.31386|0.31386|0.31386	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	GGG|GGC|GTG		0.478	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	Missense_Mutation	11	80	0	0	0	0.000978	0	11	80				
NLRP13	126204	broad.mit.edu	37	19	56443652	56443652	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:56443652G>T	ENST00000342929.3	-	1	25	c.26C>A	c.(25-27)cCc>cAc	p.P9H	NLRP13_ENST00000588751.1_Missense_Mutation_p.P9H	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	9	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)	p.P9H(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ACCACCGTTGGGGCAGGTGAT	0.498																																							uc010ygg.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(1)|lung(1)	9						c.(25-27)CCC>CAC		NACHT, leucine rich repeat and PYD containing							82.0	77.0	79.0					19																	56443652		2203	4300	6503	SO:0001583	missense	126204						ATP binding	g.chr19:56443652G>T	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.26C>A	19.37:g.56443652G>T	ENSP00000343891:p.Pro9His		Somatic					p.P9H	NM_176810	NP_789780	WXS	Illumina HiSeq	Unspecified	Q86W25	NAL13_HUMAN		GBM - Glioblastoma multiforme(193;0.0642)	1	51	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	9			DAPIN.		Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	c.26C>A	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	G	2.066	-0.414163	0.04766	.	.	ENSG00000173572	ENST00000342929	T	0.76448	-1.02	1.69	-2.18	0.07037	Pyrin (1);DEATH-like (1);	.	.	.	.	T	0.60856	0.2301	L	0.29908	0.895	0.09310	N	1	B	0.26120	0.142	B	0.28232	0.087	T	0.47812	-0.9088	9	0.41790	T	0.15	.	3.0528	0.06174	0.3558:0.2562:0.388:0.0	.	9	Q86W25	NAL13_HUMAN	H	9	ENSP00000343891:P9H	ENSP00000343891:P9H	P	-	2	0	NLRP13	61135464	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.018000	0.13422	-0.754000	0.04715	-1.031000	0.02408	CCC		0.498	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		4	71	1	0	1.23904e-05	0.000602	1.71041e-05	4	71				
ZSCAN5B	342933	broad.mit.edu	37	19	56701419	56701419	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:56701419T>A	ENST00000586855.2	-	5	1578	c.1265A>T	c.(1264-1266)cAc>cTc	p.H422L	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.H422L			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	422					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.H422L(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GGTGGACTCGTGGGCGAACCG	0.567																																							uc010ygh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1264-1266)CAC>CTC		zinc finger and SCAN domain containing 5B							87.0	89.0	88.0					19																	56701419		2141	4265	6406	SO:0001583	missense	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56701419T>A		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.1265A>T	19.37:g.56701419T>A	ENSP00000466072:p.His422Leu		Somatic					p.H422L	NM_001080456	NP_001073925	WXS	Illumina HiSeq	Unspecified	A6NJL1	ZSA5B_HUMAN			4	1265	-			422			C2H2-type 3.			Missense_Mutation	SNP	ENST00000586855.2	37	c.1265A>T	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.657967	0.67586	.	.	ENSG00000197213	ENST00000358992	T	0.06218	3.33	3.15	3.15	0.36227	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06280	0.0162	L	0.39566	1.225	0.35485	D	0.798512	B	0.33777	0.425	B	0.31495	0.131	T	0.28490	-1.0042	9	0.56958	D	0.05	.	9.6797	0.40063	0.0:0.0:0.0:1.0	.	422	A6NJL1	ZSA5B_HUMAN	L	422	ENSP00000351883:H422L	ENSP00000351883:H422L	H	-	2	0	ZSCAN5B	61393231	0.000000	0.05858	0.456000	0.27044	0.175000	0.22909	-0.659000	0.05323	1.448000	0.47680	0.254000	0.18369	CAC		0.567	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		4	67	0	0	0	0.000248	0	4	67				
ZNF772	400720	broad.mit.edu	37	19	57985662	57985662	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr19:57985662G>T	ENST00000343280.4	-	5	710	c.450C>A	c.(448-450)ggC>ggA	p.G150G	ZNF772_ENST00000601768.1_Intron|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000427512.2_Silent_p.G38G|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000425074.3_3'UTR|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000356584.3_Silent_p.G109G	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G150G(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TTAAGACCAGGCCACATGTCC	0.483																																					Melanoma(5;289 436 14293 15924 30817)	Melanoma(5;289 436 14293 15924 30817)	uc002qot.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(448-450)GGC>GGA		zinc finger protein 772 isoform 1							112.0	107.0	108.0					19																	57985662		2203	4300	6503	SO:0001819	synonymous_variant	400720				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57985662G>T	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.450C>A	19.37:g.57985662G>T			Somatic				ZNF547_uc002qpm.3_Intron|ZNF772_uc010ygy.1_Silent_p.G109G|ZNF772_uc010ygz.1_Silent_p.G38G|ZNF772_uc010yha.1_Silent_p.G96G|ZNF772_uc002qou.2_Silent_p.G38G	p.G150G	NM_001024596	NP_001019767	WXS	Illumina HiSeq	Unspecified	Q68DY9	ZN772_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)	5	711	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	150			C2H2-type 1.		A6NJK9|B4DH56|B4DYS0	Silent	SNP	ENST00000343280.4	37	c.450C>A	CCDS33133.1																																																																																				0.483	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1	NM_001024596		8	95	1	0	0.000274275	0.004482	0.000343746	8	95				
GREB1	9687	broad.mit.edu	37	2	11718443	11718443	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:11718443C>A	ENST00000381486.2	+	6	958	c.658C>A	c.(658-660)Ccc>Acc	p.P220T	GREB1_ENST00000263834.5_Missense_Mutation_p.P220T|GREB1_ENST00000389825.3_Missense_Mutation_p.P110T|GREB1_ENST00000234142.5_Missense_Mutation_p.P220T|GREB1_ENST00000381483.2_Missense_Mutation_p.P220T	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	220						integral component of membrane (GO:0016021)		p.P220T(3)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CCGGCAGATCCCCGCCAGTAC	0.582																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(658-660)CCC>ACC		growth regulation by estrogen in breast cancer 1							125.0	130.0	128.0					2																	11718443		2203	4300	6503	SO:0001583	missense	9687					integral to membrane		g.chr2:11718443C>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.658C>A	2.37:g.11718443C>A	ENSP00000370896:p.Pro220Thr		Somatic				GREB1_uc002rbl.2_Missense_Mutation_p.P220T|GREB1_uc002rbm.2_Missense_Mutation_p.P110T|GREB1_uc002rbn.1_Missense_Mutation_p.P220T	p.P220T	NM_014668	NP_055483	WXS	Illumina HiSeq	Unspecified	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	6	958	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		220					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.658C>A	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493725	0.26774	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;T;T;T;T	0.42900	3.3;2.32;0.96;2.33;3.3	5.71	-11.1	0.00147	.	0.891865	0.09716	N	0.765084	T	0.13500	0.0327	N	0.04636	-0.2	0.09310	N	1	B;B;B;B	0.20261	0.043;0.015;0.027;0.002	B;B;B;B	0.24541	0.054;0.046;0.045;0.008	T	0.19321	-1.0309	10	0.41790	T	0.15	-1.1516	3.3865	0.07273	0.0976:0.2349:0.4028:0.2646	.	220;110;220;220	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	T	220;220;110;220;220	ENSP00000370896:P220T;ENSP00000263834:P220T;ENSP00000374475:P110T;ENSP00000370892:P220T;ENSP00000234142:P220T	ENSP00000234142:P220T	P	+	1	0	GREB1	11635894	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.373000	0.07494	-2.230000	0.00719	-2.982000	0.00079	CCC		0.582	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		37	159	1	0	1.13552e-05	0.002222	1.57895e-05	37	159				
GREB1	9687	broad.mit.edu	37	2	11755257	11755257	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:11755257T>A	ENST00000381486.2	+	20	3463	c.3163T>A	c.(3163-3165)Tgc>Agc	p.C1055S	GREB1_ENST00000234142.5_Missense_Mutation_p.C1055S|GREB1_ENST00000396123.1_Missense_Mutation_p.C53S	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1055						integral component of membrane (GO:0016021)		p.C1055S(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		AAACTCCTCCTGCTTGGTGAG	0.542																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3163-3165)TGC>AGC		growth regulation by estrogen in breast cancer 1							118.0	114.0	115.0					2																	11755257		2029	4191	6220	SO:0001583	missense	9687					integral to membrane		g.chr2:11755257T>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3163T>A	2.37:g.11755257T>A	ENSP00000370896:p.Cys1055Ser		Somatic				GREB1_uc002rbp.1_Missense_Mutation_p.C53S	p.C1055S	NM_014668	NP_055483	WXS	Illumina HiSeq	Unspecified	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	20	3463	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		1055					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.3163T>A	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	7.964	0.747606	0.15710	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.20200	3.44;3.44;2.09	4.93	4.93	0.64822	.	0.204155	0.45867	D	0.000328	T	0.11922	0.0290	N	0.13235	0.315	0.31930	N	0.612251	B	0.09022	0.002	B	0.10450	0.005	T	0.11348	-1.0591	10	0.23891	T	0.37	-29.1017	9.908	0.41388	0.1521:0.0:0.0:0.8479	.	1055	Q4ZG55	GREB1_HUMAN	S	1055;1055;53	ENSP00000370896:C1055S;ENSP00000234142:C1055S;ENSP00000379429:C53S	ENSP00000234142:C1055S	C	+	1	0	GREB1	11672708	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	4.519000	0.60517	1.851000	0.53745	0.459000	0.35465	TGC		0.542	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		4	61	0	0	0	0.000602	0	4	61				
SLC8A1	6546	broad.mit.edu	37	2	40656903	40656903	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:40656903C>A	ENST00000403092.1	-	2	551	c.518G>T	c.(517-519)gGa>gTa	p.G173V	SLC8A1_ENST00000405269.1_Missense_Mutation_p.G173V|SLC8A1_ENST00000408028.2_Missense_Mutation_p.G173V|SLC8A1_ENST00000405901.3_Missense_Mutation_p.G173V|SLC8A1_ENST00000542024.1_Missense_Mutation_p.G173V|SLC8A1_ENST00000406785.2_Missense_Mutation_p.G173V|SLC8A1_ENST00000402441.1_Missense_Mutation_p.G173V|SLC8A1_ENST00000332839.4_Missense_Mutation_p.G173V|SLC8A1_ENST00000542756.1_Missense_Mutation_p.G173V|SLC8A1_ENST00000406391.2_Missense_Mutation_p.G173V			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	173					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.G173V(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGCAGCACTTCCCACGATGGT	0.468																																							uc002rrx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(517-519)GGA>GTA		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						100.0	89.0	93.0					2																	40656903		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656903C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.518G>T	2.37:g.40656903C>A	ENSP00000384763:p.Gly173Val		Somatic				SLC8A1_uc002rry.2_Missense_Mutation_p.G173V|SLC8A1_uc002rrz.2_Missense_Mutation_p.G173V|SLC8A1_uc002rsa.2_Missense_Mutation_p.G173V|SLC8A1_uc002rsd.3_Missense_Mutation_p.G173V|SLC8A1_uc002rsb.1_Missense_Mutation_p.G173V|SLC8A1_uc010fan.1_Missense_Mutation_p.G173V|SLC8A1_uc002rsc.1_Missense_Mutation_p.G173V	p.G173V	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	542	-			173			Alpha-1.|Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.518G>T	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630084	0.67015	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	D;D;D;D;D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	5.59	5.59	0.84812	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.95940	0.8678	H	0.97131	3.945	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97136	0.9821	10	0.87932	D	0	.	17.1057	0.86662	0.0:1.0:0.0:0.0	.	173;173;173;173;173	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	V	173	ENSP00000383886:G173V;ENSP00000440727:G173V;ENSP00000384763:G173V;ENSP00000385678:G173V;ENSP00000385188:G173V;ENSP00000385535:G173V;ENSP00000332931:G173V;ENSP00000384908:G173V;ENSP00000385811:G173V;ENSP00000443515:G173V	ENSP00000332931:G173V	G	-	2	0	SLC8A1	40510407	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.663000	0.83820	2.648000	0.89879	0.563000	0.77884	GGA		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		6	43	1	0	2.0095e-06	0.001984	2.9334e-06	6	43				
PSME4	23198	broad.mit.edu	37	2	54122797	54122797	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:54122797A>T	ENST00000404125.1	-	33	3820	c.3765T>A	c.(3763-3765)acT>acA	p.T1255T	PSME4_ENST00000421748.2_Silent_p.T399T	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1255					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.T1141T(1)|p.T1255T(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TTCTTGGTATAGTTTTGCTGT	0.403																																							uc002rxp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|breast(2)|pancreas(1)	5						c.(3763-3765)ACT>ACA		proteasome (prosome, macropain) activator							207.0	205.0	206.0					2																	54122797		2203	4300	6503	SO:0001819	synonymous_variant	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54122797A>T	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3765T>A	2.37:g.54122797A>T			Somatic				PSME4_uc010yop.1_Silent_p.T1141T|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Silent_p.T630T|PSME4_uc010fbv.1_Silent_p.T399T	p.T1255T	NM_014614	NP_055429	WXS	Illumina HiSeq	Unspecified	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		33	3821	-			1255					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	37	c.3765T>A	CCDS33197.2																																																																																				0.403	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		11	195	0	0	0	0.000978	0	11	195				
ARHGAP25	9938	broad.mit.edu	37	2	69053120	69053120	+	Splice_Site	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:69053120C>A	ENST00000295381.3	+	11	2151	c.1732C>A	c.(1732-1734)Ctt>Att	p.L578I	ARHGAP25_ENST00000467265.1_Splice_Site_p.L539I|ARHGAP25_ENST00000409202.3_Splice_Site_p.L579I|ARHGAP25_ENST00000479844.1_Splice_Site_p.L272I|ARHGAP25_ENST00000409220.1_Splice_Site_p.L572I|ARHGAP25_ENST00000409030.3_Splice_Site_p.L571I	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	578					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L572I(1)|p.L579I(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						TCCTTGTAGCCTTGAGAAGGA	0.443																																							uc002seu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)	4						c.(1732-1734)CTT>ATT		Rho GTPase activating protein 25 isoform a							53.0	54.0	54.0					2																	69053120		2203	4300	6503	SO:0001630	splice_region_variant	9938				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr2:69053120C>A	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1731-1C>A	2.37:g.69053120C>A			Somatic				ARHGAP25_uc010fdg.2_Missense_Mutation_p.L579I|ARHGAP25_uc010yql.1_Missense_Mutation_p.L539I|ARHGAP25_uc002sew.2_Missense_Mutation_p.L571I|ARHGAP25_uc002sex.2_Missense_Mutation_p.L572I|ARHGAP25_uc002sey.2_Missense_Mutation_p.L305I	p.L578I	NM_001007231	NP_001007232	WXS	Illumina HiSeq	Unspecified	P42331	RHG25_HUMAN			11	2096	+			578			Potential.		A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	ENST00000295381.3	37	c.1732C>A		.	.	.	.	.	.	.	.	.	.	C	17.07	3.296025	0.60086	.	.	ENSG00000163219	ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000543533;ENST00000479844	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.82	4.0	0.46444	.	0.142334	0.47455	D	0.000239	T	0.67211	0.2869	L	0.33624	1.015	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.988	D;D;D;D;P	0.85130	0.994;0.997;0.997;0.997;0.751	T	0.63795	-0.6556	10	0.37606	T	0.19	.	12.1266	0.53920	0.0:0.8752:0.0:0.1248	.	539;579;572;571;578	E9PFQ7;P42331-4;G5E9G2;P42331-3;P42331	.;.;.;.;RHG25_HUMAN	I	578;579;539;571;572;572;563;272	ENSP00000295381:L578I;ENSP00000386911:L579I;ENSP00000420583:L539I;ENSP00000386863:L571I;ENSP00000386241:L572I;ENSP00000417467:L272I	ENSP00000295381:L578I	L	+	1	0	ARHGAP25	68906624	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	2.723000	0.47277	2.756000	0.94617	0.563000	0.77884	CTT		0.443	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882	Missense_Mutation	7	46	1	0	2.7689e-08	0.001984	4.48915e-08	7	46				
ACTG2	72	broad.mit.edu	37	2	74129498	74129499	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:74129498_74129499GG>TT	ENST00000409624.1	+	4	781_782	c.138_139GG>TT	c.(136-141)gtGGga>gtTTga	p.G47*	ACTG2_ENST00000409918.1_Nonsense_Mutation_p.G47*|ACTG2_ENST00000409731.3_Intron|ACTG2_ENST00000345517.3_Nonsense_Mutation_p.G47*			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	47					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.G47*(1)		large_intestine(3)|lung(14)|skin(1)	18						GTGTGATGGTGGGAATGGGCCA	0.5																																							uc002sjw.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(136-141)GTGGGA>GTTTGA		actin, gamma 2 propeptide																																				SO:0001587	stop_gained	72				muscle contraction	cytoskeleton|cytosol	ATP binding	g.chr2:74129498_74129499GG>TT		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	Exception_encountered	2.37:g.74129498_74129499delinsTT	ENSP00000386857:p.Gly47*		Somatic				ACTG2_uc010fex.1_Nonsense_Mutation_p.G47*|ACTG2_uc010fey.2_Nonsense_Mutation_p.G47*|ACTG2_uc010yrn.1_Intron	p.G47*	NM_001615	NP_001606	WXS	Illumina HiSeq	Unspecified	P63267	ACTH_HUMAN			3	260_261	+			47					B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Nonsense_Mutation	DNP	ENST00000409624.1	37	c.138_139GG>TT	CCDS1930.1																																																																																				0.500	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	NM_001615		5	56	0	0	0	0.004672	0	5	56				
REG1A	5967	broad.mit.edu	37	2	79349965	79349965	+	Splice_Site	SNP	A	A	G	rs373908260		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:79349965A>G	ENST00000233735.1	+	5	424		c.e5-1			NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha						positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)	p.?(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						TTCCCCATCTAGAACCGCCGC	0.547																																							uc002snz.2		NA																	1	Unknown(1)		lung(1)		0						c.e5-2		regenerating islet-derived 1 alpha precursor							87.0	89.0	88.0					2																	79349965		2203	4300	6503	SO:0001630	splice_region_variant	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79349965A>G		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.322-1A>G	2.37:g.79349965A>G			Somatic				REG1A_uc010ysd.1_Splice_Site_p.N108_splice	p.N108_splice	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			5	425	+								P11379|Q4ZG28	Splice_Site	SNP	ENST00000233735.1	37	c.322_splice	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	A	7.064	0.566956	0.13560	.	.	ENSG00000115386	ENST00000233735	.	.	.	2.74	1.57	0.23409	.	.	.	.	.	.	.	.	.	.	.	0.51767	D	0.999936	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.277	0.10813	0.8269:0.0:0.1731:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	REG1A	79203473	0.902000	0.30710	0.387000	0.26183	0.461000	0.32589	2.523000	0.45580	0.299000	0.22661	0.455000	0.32223	.		0.547	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909	Intron	11	129	0	0	0	0.000978	0	11	129				
FUNDC2P2	388965	broad.mit.edu	37	2	84518100	84518100	+	RNA	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:84518100G>A	ENST00000331369.5	+	0	294									FUN14 domain containing 2 pseudogene 2																		TTCATTGGAGGTGTCACTGGA	0.502																																							uc010ffz.1		NA																	0					0						c.(157-159)GGT>GAT		RecName: Full=FUN14 domain-containing protein 2; AltName: Full=Hepatitis C virus core-binding protein 6; AltName: Full=Cervical cancer proto-oncogene 3 protein;          Short=HCC-3;																																						388965							g.chr2:84518100G>A			2p11.2	2010-03-12			ENSG00000182814	ENSG00000182814			17247	pseudogene	pseudogene							Standard	NR_003663		Approved		uc010ffz.1		OTTHUMG00000152875		2.37:g.84518100G>A			Somatic					p.G53D	NR_003663		WXS	Illumina HiSeq	Unspecified					1	295	+									Missense_Mutation	SNP	ENST00000331369.5	37	c.158G>A																																																																																					0.502	FUNDC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000333681.1	NR_003663		8	141	0	0	0	0.008291	0	8	141				
ZRANB3	84083	broad.mit.edu	37	2	135988469	135988469	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:135988469C>G	ENST00000264159.6	-	13	1684	c.1568G>C	c.(1567-1569)cGa>cCa	p.R523P	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000536680.1_Missense_Mutation_p.R523P|ZRANB3_ENST00000401392.1_Missense_Mutation_p.R523P	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	523					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.R523P(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		AAAAAATGATCGAATATCATG	0.348																																							uc002tum.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1567-1569)CGA>CCA		zinc finger, RAN-binding domain containing 3							60.0	56.0	58.0					2																	135988469		1816	4079	5895	SO:0001583	missense	84083					intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding	g.chr2:135988469C>G	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1568G>C	2.37:g.135988469C>G	ENSP00000264159:p.Arg523Pro		Somatic				ZRANB3_uc002tuk.2_Missense_Mutation_p.R66P|ZRANB3_uc002tul.2_Missense_Mutation_p.R523P	p.R523P	NM_032143	NP_115519	WXS	Illumina HiSeq	Unspecified	Q5FWF4	ZRAB3_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.135)	13	1685	-			523					B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	c.1568G>C	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.140910	0.77775	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.91577	-2.87;-2.87;-2.86	5.79	4.92	0.64577	.	0.190663	0.46758	D	0.000268	D	0.94653	0.8276	M	0.77103	2.36	0.51233	D	0.999914	D;D	0.76494	0.999;0.999	D;D	0.75020	0.967;0.985	D	0.94991	0.8134	10	0.87932	D	0	-4.4065	12.7912	0.57534	0.0:0.9237:0.0:0.0763	.	523;523	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	P	523	ENSP00000383979:R523P;ENSP00000264159:R523P;ENSP00000441320:R523P	ENSP00000264159:R523P	R	-	2	0	ZRANB3	135704939	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.707000	0.54838	1.462000	0.47948	0.563000	0.77884	CGA		0.348	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143		6	98	0	0	0	0.001168	0	6	98				
ABCB11	8647	broad.mit.edu	37	2	169869807	169869807	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:169869807T>C	ENST00000263817.6	-	5	488	c.364A>G	c.(364-366)Aac>Gac	p.N122D		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	122	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.N122D(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TTTGTCATGTTCTGGTTGAGG	0.343																																							uc002ueo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)	5						c.(364-366)AAC>GAC		ATP-binding cassette, sub-family B (MDR/TAP),	Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)						230.0	215.0	220.0					2																	169869807		1864	4119	5983	SO:0001583	missense	8647				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism	g.chr2:169869807T>C	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.364A>G	2.37:g.169869807T>C	ENSP00000263817:p.Asn122Asp		Somatic					p.N122D	NM_003742	NP_003733	WXS	Illumina HiSeq	Unspecified	O95342	ABCBB_HUMAN			5	490	-			122			ABC transmembrane type-1 1.|Extracellular (Potential).		Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	c.364A>G	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	T	11.43	1.635838	0.29068	.	.	ENSG00000073734	ENST00000263817	D	0.86562	-2.14	5.4	5.4	0.78164	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.716008	0.14664	N	0.305749	D	0.83170	0.5196	L	0.38175	1.15	0.44677	D	0.997664	B	0.14012	0.009	B	0.16289	0.015	T	0.78391	-0.2222	10	0.54805	T	0.06	-2.6321	15.4266	0.75055	0.0:0.0:0.0:1.0	.	122	O95342	ABCBB_HUMAN	D	122	ENSP00000263817:N122D	ENSP00000263817:N122D	N	-	1	0	ABCB11	169578053	1.000000	0.71417	0.510000	0.27712	0.239000	0.25481	5.086000	0.64474	2.052000	0.61016	0.454000	0.30748	AAC		0.343	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742		89	280	0	0	0	0.00361	0	89	280				
TTN	7273	broad.mit.edu	37	2	179395805	179395805	+	Silent	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:179395805G>C	ENST00000591111.1	-	308	100838	c.100614C>G	c.(100612-100614)acC>acG	p.T33538T	TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000342175.6_Silent_p.T26306T|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Silent_p.T26239T|TTN_ENST00000589042.1_Silent_p.T35179T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342992.6_Silent_p.T32611T|TTN_ENST00000460472.2_Silent_p.T26114T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588804.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33538	Ig-like 147.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T26306T(1)|p.T26114T(1)|p.T32611T(1)|p.T26239T(1)|p.T32609T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTACTTTGTGGTGGTCACTT	0.498																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(97831-97833)ACC>ACG		titin isoform N2-A							220.0	218.0	219.0					2																	179395805		2011	4157	6168	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179395805G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100614C>G	2.37:g.179395805G>C			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.T26306T|TTN_uc010zfi.1_Silent_p.T26239T|TTN_uc010zfj.1_Silent_p.T26114T|TTN_uc002umq.2_5'Flank	p.T32611T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	98057	-			33538					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.97833C>G																																																																																					0.498	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		18	380	0	0	0	0.006122	0	18	380				
TTN	7273	broad.mit.edu	37	2	179428039	179428039	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:179428039A>C	ENST00000591111.1	-	276	78121	c.77897T>G	c.(77896-77898)gTa>gGa	p.V25966G	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V18734G|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V18667G|TTN_ENST00000589042.1_Missense_Mutation_p.V27607G|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V25039G|TTN_ENST00000460472.2_Missense_Mutation_p.V18542G|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25966	Fibronectin type-III 89. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V18667G(1)|p.V25039G(1)|p.V25037G(1)|p.V18542G(1)|p.V18734G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGACCTCTACAACATAGCC	0.468																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(75115-75117)GTA>GGA		titin isoform N2-A							79.0	78.0	78.0					2																	179428039		2038	4207	6245	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179428039A>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77897T>G	2.37:g.179428039A>C	ENSP00000465570:p.Val25966Gly		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V18734G|TTN_uc010zfi.1_Missense_Mutation_p.V18667G|TTN_uc010zfj.1_Missense_Mutation_p.V18542G	p.V25039G	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	75340	-			25966					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.75116T>G		.	.	.	.	.	.	.	.	.	.	A	17.47	3.397403	0.62177	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.74	5.74	0.90152	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87509	0.6195	H	0.98664	4.295	0.80722	D	1	P;P;P;P	0.42483	0.781;0.781;0.781;0.781	P;P;P;P	0.54965	0.627;0.627;0.765;0.765	D	0.91589	0.5285	9	0.87932	D	0	.	16.0337	0.80603	1.0:0.0:0.0:0.0	.	18542;18667;18734;25966	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	25039;18542;18734;18667;18540	ENSP00000343764:V25039G;ENSP00000434586:V18542G;ENSP00000340554:V18734G;ENSP00000352154:V18667G	ENSP00000340554:V18734G	V	-	2	0	TTN	179136285	1.000000	0.71417	0.871000	0.34182	0.939000	0.58152	9.339000	0.96797	2.188000	0.69820	0.460000	0.39030	GTA		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	91	0	0	0	0.004672	0	3	91				
TTN	7273	broad.mit.edu	37	2	179575972	179575972	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:179575972A>C	ENST00000591111.1	-	95	27264	c.27040T>G	c.(27040-27042)Tcc>Gcc	p.S9014A	TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S9331A|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S8087A|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13152	Ig-like 73.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S8087A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGACACGGAGATAGGTTCT	0.378																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(24259-24261)TCC>GCC		titin isoform N2-A							182.0	178.0	180.0					2																	179575972		1870	4113	5983	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179575972A>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27040T>G	2.37:g.179575972A>C	ENSP00000465570:p.Ser9014Ala		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S4748A	p.S8087A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		94	24483	-			9014					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.24259T>G		.	.	.	.	.	.	.	.	.	.	A	14.02	2.410914	0.42817	.	.	ENSG00000155657	ENST00000342992	T	0.68903	-0.36	5.76	1.93	0.25924	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55909	0.1950	L	0.43598	1.365	0.80722	D	1	B	0.16802	0.019	B	0.19666	0.026	T	0.58306	-0.7659	9	0.87932	D	0	.	8.3757	0.32442	0.4093:0.5099:0.0809:0.0	.	9014	Q8WZ42	TITIN_HUMAN	A	8087	ENSP00000343764:S8087A	ENSP00000343764:S8087A	S	-	1	0	TTN	179284217	0.985000	0.35326	0.965000	0.40720	0.974000	0.67602	1.672000	0.37523	1.094000	0.41399	0.533000	0.62120	TCC		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		59	223	0	0	0	0.00361	0	59	223				
COL3A1	1281	broad.mit.edu	37	2	189839273	189839273	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:189839273A>G	ENST00000304636.3	+	1	228	c.58A>G	c.(58-60)Att>Gtt	p.I20V	COL3A1_ENST00000317840.5_Missense_Mutation_p.I20V	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	20					aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.I20V(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TCATCCCACTATTATTTTGGC	0.413																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(58-60)ATT>GTT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						120.0	116.0	117.0					2																	189839273		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189839273A>G	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.58A>G	2.37:g.189839273A>G	ENSP00000304408:p.Ile20Val		Somatic					p.I20V	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		1	175	+			20					D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.58A>G	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	A	1.962	-0.438706	0.04636	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.89552	-2.38;-2.53	5.68	-5.52	0.02560	.	1.705350	0.03793	N	0.263230	T	0.71099	0.3300	N	0.03608	-0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.68716	-0.5335	10	0.02654	T	1	.	11.7604	0.51898	0.1872:0.5299:0.2829:0.0	.	20	P02461	CO3A1_HUMAN	V	20	ENSP00000304408:I20V;ENSP00000315243:I20V	ENSP00000304408:I20V	I	+	1	0	COL3A1	189547518	0.657000	0.27393	0.826000	0.32828	0.947000	0.59692	-0.539000	0.06113	-0.508000	0.06540	-0.313000	0.08912	ATT		0.413	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		7	107	0	0	0	0.001984	0	7	107				
COL5A2	1290	broad.mit.edu	37	2	189904155	189904155	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:189904155C>A	ENST00000374866.3	-	51	4042	c.3768G>T	c.(3766-3768)gcG>gcT	p.A1256A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1256					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.A1256A(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CATCAGGAGCCGCCTGATCTT	0.527																																							uc002uqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(3766-3768)GCG>GCT		alpha 2 type V collagen preproprotein							77.0	69.0	71.0					2																	189904155		2203	4300	6503	SO:0001819	synonymous_variant	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189904155C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3768G>T	2.37:g.189904155C>A			Somatic				COL5A2_uc010frx.2_Silent_p.A832A	p.A1256A	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		51	4043	-			1256					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	c.3768G>T	CCDS33350.1																																																																																				0.527	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		9	49	1	0	7.48243e-07	0.006214	1.13127e-06	9	49				
PMS1	5378	broad.mit.edu	37	2	190660540	190660540	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:190660540G>T	ENST00000441310.2	+	3	411	c.178G>T	c.(178-180)Ggt>Tgt	p.G60C	PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000432292.3_Intron|PMS1_ENST00000447232.2_Missense_Mutation_p.G60C|PMS1_ENST00000409985.1_Missense_Mutation_p.G60C|PMS1_ENST00000409823.3_Missense_Mutation_p.G60C|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000374826.4_Missense_Mutation_p.G60C	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	60					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.G60C(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TAACGGGGAGGGTATCAAGGC	0.328			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															uc002urh.3		NA	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	Mis|N	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)			E		colorectal|endometrial|ovarian			1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(178-180)GGT>TGT	Direct_reversal_of_damage|MMR	postmeiotic segregation 1 isoform a							89.0	88.0	89.0					2																	190660540		2203	4300	6503	SO:0001583	missense	5378				mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding	g.chr2:190660540G>T		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.178G>T	2.37:g.190660540G>T	ENSP00000406490:p.Gly60Cys		Somatic				PMS1_uc010zga.1_Missense_Mutation_p.G60C|PMS1_uc010zgb.1_Intron|PMS1_uc002urk.3_Missense_Mutation_p.G60C|PMS1_uc002uri.3_Missense_Mutation_p.G60C|PMS1_uc010zgc.1_5'UTR|PMS1_uc010zgd.1_Intron|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.G60C|PMS1_uc010frz.2_Missense_Mutation_p.G60C|PMS1_uc010zfz.1_Missense_Mutation_p.G60C	p.G60C	NM_000534	NP_000525	WXS	Illumina HiSeq	Unspecified	P54277	PMS1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)		3	707	+			60					D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	37	c.178G>T	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	G	31	5.079611	0.94050	.	.	ENSG00000064933	ENST00000441310;ENST00000409985;ENST00000409823;ENST00000374826;ENST00000424766;ENST00000447232;ENST00000420421	D;D;D;D;D;D;D	0.99771	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-6.71	5.78	5.78	0.91487	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.99904	0.9954	H	0.99325	4.515	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96255	0.9186	10	0.87932	D	0	-20.1922	20.0159	0.97477	0.0:0.0:1.0:0.0	.	60;60;60;60;60;60;60	B4DMF4;E9PC40;Q5FBZ4;Q5FBZ9;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	C	60	ENSP00000406490:G60C;ENSP00000386623:G60C;ENSP00000387125:G60C;ENSP00000363959:G60C;ENSP00000410082:G60C;ENSP00000401064:G60C;ENSP00000391136:G60C	ENSP00000343888:G60C	G	+	1	0	PMS1	190368785	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	9.814000	0.99346	2.743000	0.94032	0.637000	0.83480	GGT		0.328	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2			7	72	1	0	2.0095e-06	0.001984	2.9334e-06	7	72				
DNAH7	56171	broad.mit.edu	37	2	196718111	196718111	+	Nonsense_Mutation	SNP	C	C	A	rs368479769		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:196718111C>A	ENST00000312428.6	-	46	8837	c.8737G>T	c.(8737-8739)Gga>Tga	p.G2913*		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2913					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.G2913*(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GCAACCACTCCGGAGGAAATG	0.512																																							uc002utj.3		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(10)|ovary(2)	12						c.(8737-8739)GGA>TGA		dynein, axonemal, heavy chain 7							105.0	104.0	104.0					2																	196718111		1986	4172	6158	SO:0001587	stop_gained	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196718111C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8737G>T	2.37:g.196718111C>A	ENSP00000311273:p.Gly2913*		Somatic					p.G2913*	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			46	8838	-			2913					B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Nonsense_Mutation	SNP	ENST00000312428.6	37	c.8737G>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	49	15.017164	0.99819	.	.	ENSG00000118997	ENST00000312428	.	.	.	5.55	5.55	0.83447	.	0.060203	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6982	0.96039	0.0:1.0:0.0:0.0	.	.	.	.	X	2913	.	ENSP00000311273:G2913X	G	-	1	0	DNAH7	196426356	1.000000	0.71417	0.265000	0.24526	0.013000	0.08279	7.578000	0.82498	2.894000	0.99253	0.655000	0.94253	GGA		0.512	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		22	69	1	0	7.41877e-09	0.001882	1.22894e-08	22	69				
RFTN2	130132	broad.mit.edu	37	2	198436886	198436886	+	Missense_Mutation	SNP	C	C	G	rs115896530	byFrequency	TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:198436886C>G	ENST00000295049.4	-	9	1888	c.1352G>C	c.(1351-1353)cGc>cCc	p.R451P		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	451					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)		p.R451P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						GGGAGAAAGGCGGCACTCCTC	0.527																																							uc002uuo.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1351-1353)CGC>CCC		raftlin family member 2							191.0	157.0	168.0					2																	198436886		2203	4300	6503	SO:0001583	missense	130132					plasma membrane		g.chr2:198436886C>G	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.1352G>C	2.37:g.198436886C>G	ENSP00000295049:p.Arg451Pro		Somatic					p.R451P	NM_144629	NP_653230	WXS	Illumina HiSeq	Unspecified	Q52LD8	RFTN2_HUMAN			9	1754	-			451					Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	37	c.1352G>C	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	C	8.551	0.875446	0.17395	.	.	ENSG00000162944	ENST00000295049;ENST00000454447	T;T	0.43688	0.94;0.98	4.84	-2.76	0.05896	.	2.255570	0.01628	N	0.023413	T	0.21962	0.0529	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06516	-1.0822	10	0.23891	T	0.37	3.9967	1.584	0.02640	0.2335:0.1267:0.4108:0.229	.	451	Q52LD8	RFTN2_HUMAN	P	451;143	ENSP00000295049:R451P;ENSP00000387459:R143P	ENSP00000295049:R451P	R	-	2	0	RFTN2	198145131	0.001000	0.12720	0.000000	0.03702	0.050000	0.14768	-0.542000	0.06091	-0.192000	0.10432	-1.238000	0.01547	CGC		0.527	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629		5	111	0	0	0	0.001168	0	5	111				
EEF1B2	1933	broad.mit.edu	37	2	207026077	207026077	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:207026077G>T	ENST00000392222.2	+	3	586	c.211G>T	c.(211-213)Gga>Tga	p.G71*	SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank|EEF1B2_ENST00000392221.1_Nonsense_Mutation_p.G71*|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Nonsense_Mutation_p.G71*|NDUFS1_ENST00000423725.1_5'Flank|SNORA41_ENST00000384675.1_RNA	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	71	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.G71*(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AAGCCTGCCAGGAGTGAAGAA	0.373																																							uc002vbf.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(211-213)GGA>TGA		eukaryotic translation elongation factor 1 beta							138.0	133.0	135.0					2																	207026077		2203	4300	6503	SO:0001587	stop_gained	1933					cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity	g.chr2:207026077G>T	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.211G>T	2.37:g.207026077G>T	ENSP00000376056:p.Gly71*		Somatic				NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Nonsense_Mutation_p.G71*|EEF1B2_uc002vbh.1_Nonsense_Mutation_p.G71*|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	p.G71*	NM_001037663	NP_001032752	WXS	Illumina HiSeq	Unspecified	P24534	EF1B_HUMAN			4	369	+			71			GST C-terminal.		A8K795|Q6IBH9	Nonsense_Mutation	SNP	ENST00000392222.2	37	c.211G>T	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437586	0.96168	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.0476	18.6581	0.91462	0.0:0.0:1.0:0.0	.	.	.	.	X	71	.	ENSP00000236957:G71X	G	+	1	0	EEF1B2	206734322	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.617000	0.90927	2.413000	0.81919	0.555000	0.69702	GGA		0.373	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663		9	106	1	0	1.11149e-13	0.008291	2.05572e-13	9	106				
EEF1B2	1933	broad.mit.edu	37	2	207026150	207026150	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:207026150G>C	ENST00000392222.2	+	3	659	c.284G>C	c.(283-285)aGt>aCt	p.S95T	SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S95T|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.S95T|NDUFS1_ENST00000423725.1_5'Flank|SNORA41_ENST00000384675.1_RNA	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	95					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S95T(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						GCTACAGATAGTAAAGATGAT	0.453																																							uc002vbf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)AGT>ACT		eukaryotic translation elongation factor 1 beta							180.0	165.0	170.0					2																	207026150		2203	4297	6500	SO:0001583	missense	1933					cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity	g.chr2:207026150G>C	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.284G>C	2.37:g.207026150G>C	ENSP00000376056:p.Ser95Thr		Somatic				NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Missense_Mutation_p.S95T|EEF1B2_uc002vbh.1_Missense_Mutation_p.S95T|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	p.S95T	NM_001037663	NP_001032752	WXS	Illumina HiSeq	Unspecified	P24534	EF1B_HUMAN			4	442	+			95					A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	c.284G>C	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096677	0.36952	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.17	4.27	0.50696	.	0.393803	0.33253	N	0.005113	T	0.34454	0.0898	L	0.53249	1.67	0.24611	N	0.993726	B	0.16603	0.018	B	0.18263	0.021	T	0.21381	-1.0247	10	0.19147	T	0.46	-1.3429	8.6223	0.33868	0.0788:0.3039:0.6174:0.0	.	95	P24534	EF1B_HUMAN	T	95	ENSP00000236957:S95T;ENSP00000376055:S95T;ENSP00000376056:S95T;ENSP00000407730:S95T	ENSP00000236957:S95T	S	+	2	0	EEF1B2	206734395	1.000000	0.71417	0.918000	0.36340	0.986000	0.74619	1.535000	0.36061	1.137000	0.42214	0.555000	0.69702	AGT		0.453	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663		11	133	0	0	0	0.000978	0	11	133				
ATIC	471	broad.mit.edu	37	2	216214301	216214301	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:216214301G>T	ENST00000236959.9	+	16	2028	c.1702G>T	c.(1702-1704)Gac>Tac	p.D568Y	ATIC_ENST00000540518.1_Missense_Mutation_p.D509Y|ATIC_ENST00000435675.1_Missense_Mutation_p.D567Y	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	568					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)	p.D568Y(1)	ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	TTCTGCTGCTGACAAAGTTGT	0.473			T	ALK	ALCL																																		uc002vex.3		NA		Dom	yes		2	2q35	471	T	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase			L	ALK		ALCL	ATIC/ALK(24)	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29						c.(1702-1704)GAC>TAC		5-aminoimidazole-4-carboxamide ribonucleotide	Tetrahydrofolic acid(DB00116)						165.0	144.0	152.0					2																	216214301		2203	4300	6503	SO:0001583	missense	471				IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity	g.chr2:216214301G>T		CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.1702G>T	2.37:g.216214301G>T	ENSP00000236959:p.Asp568Tyr		Somatic				ATIC_uc010zjo.1_Missense_Mutation_p.D509Y|ATIC_uc002vey.3_Missense_Mutation_p.D567Y	p.D568Y	NM_004044	NP_004035	WXS	Illumina HiSeq	Unspecified	P31939	PUR9_HUMAN		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	16	1876	+		Renal(323;0.229)	568					A8K202|E9PBU3|Q13856|Q53S28	Missense_Mutation	SNP	ENST00000236959.9	37	c.1702G>T	CCDS2398.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078126	0.76528	.	.	ENSG00000138363	ENST00000236959;ENST00000540518;ENST00000435675;ENST00000442048	D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86	6.16	5.28	0.74379	AICAR transformylase domain (1);Cytidine deaminase-like (1);	0.042765	0.85682	N	0.000000	D	0.97321	0.9124	H	0.98155	4.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98939	1.0790	10	0.87932	D	0	-22.9728	16.8503	0.85992	0.0:0.0:0.8704:0.1296	.	567;568	E9PBU3;P31939	.;PUR9_HUMAN	Y	568;509;567;83	ENSP00000236959:D568Y;ENSP00000440523:D509Y;ENSP00000415935:D567Y;ENSP00000391399:D83Y	ENSP00000236959:D568Y	D	+	1	0	ATIC	215922546	1.000000	0.71417	0.282000	0.24776	0.580000	0.36256	9.750000	0.98875	1.586000	0.49944	0.650000	0.86243	GAC		0.473	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256610.1	NM_004044		5	111	1	0	1.024e-07	0.000602	1.6324e-07	5	111				
DNPEP	23549	broad.mit.edu	37	2	220246787	220246787	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:220246787G>A	ENST00000273075.4	-	11	1231	c.1011C>T	c.(1009-1011)tgC>tgT	p.C337C	DNPEP_ENST00000373972.1_Silent_p.C262C|DNPEP_ENST00000523282.1_Silent_p.C345C|DNPEP_ENST00000490371.1_5'Flank	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	327					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C337C(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCGGGTGCTGGCACGAGGCTG	0.592																																							uc010zlg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1033-1035)TGC>TGT		aspartyl aminopeptidase	L-Glutamic Acid(DB00142)						59.0	69.0	66.0					2																	220246787		2147	4253	6400	SO:0001819	synonymous_variant	23549				peptide metabolic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding	g.chr2:220246787G>A		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.1011C>T	2.37:g.220246787G>A			Somatic				DNPEP_uc010zlf.1_RNA|DNPEP_uc002vle.2_Silent_p.C337C|DNPEP_uc002vlf.1_Silent_p.C323C|DNPEP_uc002vlh.2_Silent_p.C284C|DNPEP_uc002vli.1_Silent_p.C284C	p.C345C	NM_012100	NP_036232	WXS	Illumina HiSeq	Unspecified	Q9ULA0	DNPEP_HUMAN		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	11	1117	-		Renal(207;0.0474)	327					Q9BW44|Q9NUV5	Silent	SNP	ENST00000273075.4	37	c.1035C>T	CCDS42823.1																																																																																				0.592	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100		3	32	0	0	0	0.004672	0	3	32				
SPEG	10290	broad.mit.edu	37	2	220354583	220354583	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr2:220354583G>C	ENST00000312358.7	+	36	8975	c.8843G>C	c.(8842-8844)aGc>aCc	p.S2948T	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2948	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S2948T(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGTCCCCGAAGCTCTCCCAGG	0.657																																							uc010fwg.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(8842-8844)AGC>ACC		SPEG complex locus							33.0	35.0	34.0					2																	220354583		1885	4121	6006	SO:0001583	missense	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220354583G>C	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8843G>C	2.37:g.220354583G>C	ENSP00000311684:p.Ser2948Thr		Somatic					p.S2948T	NM_005876	NP_005867	WXS	Illumina HiSeq	Unspecified	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	36	8843	+		Renal(207;0.0183)	2948			Pro-rich.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.8843G>C	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	0.077	-1.190366	0.01607	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.64991	-0.13	3.48	-0.931	0.10438	.	0.759670	0.11161	N	0.593073	T	0.33118	0.0852	N	0.08118	0	0.40913	D	0.984246	B	0.02656	0.0	B	0.04013	0.001	T	0.08659	-1.0711	10	0.22706	T	0.39	.	3.3626	0.07192	0.095:0.3183:0.4232:0.1634	.	2948	Q15772	SPEG_HUMAN	T	2948	ENSP00000311684:S2948T	ENSP00000265327:S2948T	S	+	2	0	SPEG	220062827	0.002000	0.14202	0.002000	0.10522	0.108000	0.19459	0.239000	0.18023	-0.482000	0.06782	0.558000	0.71614	AGC		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		3	43	0	0	0	0.004672	0	3	43				
SNRPB	6628	broad.mit.edu	37	20	2446399	2446399	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr20:2446399C>A	ENST00000438552.2	-	3	384	c.222G>T	c.(220-222)ggG>ggT	p.G74G	SNRPB_ENST00000381342.2_Silent_p.G74G|SNRPB_ENST00000339610.6_5'UTR|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	74					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)	p.G74G(1)		kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						CCAGATTCTCCCCTCGCAGCA	0.522																																							uc002wfz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(220-222)GGG>GGT		small nuclear ribonucleoprotein polypeptide B/B'							146.0	123.0	130.0					20																	2446399		2203	4300	6503	SO:0001819	synonymous_variant	6628				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|protein binding|RNA binding	g.chr20:2446399C>A		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.222G>T	20.37:g.2446399C>A			Somatic				SNRPB_uc002wga.1_Silent_p.G74G|SNRPB_uc010zpv.1_5'UTR|SNRPB_uc002wgb.2_Silent_p.G74G|SNORD119_uc010gam.1_5'Flank	p.G74G	NM_198216	NP_937859	WXS	Illumina HiSeq	Unspecified	P14678	RSMB_HUMAN			3	385	-			74					Q15490|Q6IB35|Q9UIS5	Silent	SNP	ENST00000438552.2	37	c.222G>T	CCDS13026.1																																																																																				0.522	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077585.2			6	71	1	0	5.9392e-07	0.001168	9.05134e-07	6	71				
PLCB1	23236	broad.mit.edu	37	20	8717720	8717720	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr20:8717720G>T	ENST00000338037.6	+	20	2116	c.2089G>T	c.(2089-2091)Gtg>Ttg	p.V697L	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.V697L|PLCB1_ENST00000378637.2_Missense_Mutation_p.V697L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	697	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.V697L(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TGGGACTTACGTGGAAGTAGA	0.358																																							uc002wnb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2089-2091)GTG>TTG		phosphoinositide-specific phospholipase C beta 1							121.0	117.0	119.0					20																	8717720		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8717720G>T	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2089G>T	20.37:g.8717720G>T	ENSP00000338185:p.Val697Leu		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.V596L|PLCB1_uc002wna.2_Missense_Mutation_p.V697L|PLCB1_uc002wnc.1_Missense_Mutation_p.V596L|PLCB1_uc002wnd.1_Missense_Mutation_p.V274L	p.V697L	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			20	2092	+			697			C2.		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2089G>T	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979556	0.74360	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000338061;ENST00000439627	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.63189	0.2490	M	0.93808	3.46	0.80722	D	1	D;P	0.56035	0.974;0.941	P;P	0.56648	0.803;0.702	T	0.74034	-0.3794	10	0.87932	D	0	.	19.6011	0.95561	0.0:0.0:1.0:0.0	.	697;697	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	L	697;697;697;617;617;43;16	ENSP00000367908:V697L;ENSP00000338185:V697L;ENSP00000367904:V697L;ENSP00000391162:V16L	ENSP00000338185:V697L	V	+	1	0	PLCB1	8665720	1.000000	0.71417	0.983000	0.44433	0.255000	0.26057	9.813000	0.99286	2.703000	0.92315	0.557000	0.71058	GTG		0.358	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			10	86	1	0	3.86212e-05	0.008291	5.02207e-05	10	86				
CEP250	11190	broad.mit.edu	37	20	34091626	34091626	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr20:34091626G>C	ENST00000397527.1	+	30	6149	c.5429G>C	c.(5428-5430)aGa>aCa	p.R1810T	CEP250_ENST00000342580.4_Missense_Mutation_p.R1754T	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1810	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R1810T(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GAGGCCCAGAGAGCCCTAGCC	0.597																																							uc002xcm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(5428-5430)AGA>ACA		centrosomal protein 2							55.0	58.0	57.0					20																	34091626		2203	4300	6503	SO:0001583	missense	11190				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding	g.chr20:34091626G>C	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5429G>C	20.37:g.34091626G>C	ENSP00000380661:p.Arg1810Thr		Somatic				CEP250_uc010zve.1_Missense_Mutation_p.R1178T	p.R1810T	NM_007186	NP_009117	WXS	Illumina HiSeq	Unspecified	Q9BV73	CP250_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0106)		31	6100	+	Lung NSC(9;0.00156)|all_lung(11;0.00243)		1810			Gln/Glu-rich.|Potential.		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	c.5429G>C	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	G	9.203	1.028893	0.19512	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.47869	2.89;2.87;0.83	4.81	2.72	0.32119	.	0.408695	0.23896	N	0.043498	T	0.44623	0.1302	M	0.72479	2.2	0.09310	N	0.999999	P	0.48694	0.914	P	0.45881	0.496	T	0.28808	-1.0032	10	0.27082	T	0.32	.	4.4085	0.11421	0.2407:0.0:0.5801:0.1792	.	1810	Q9BV73	CP250_HUMAN	T	1810;1754;298	ENSP00000380661:R1810T;ENSP00000341541:R1754T;ENSP00000395992:R298T	ENSP00000341541:R1754T	R	+	2	0	CEP250	33555040	0.003000	0.15002	0.911000	0.35937	0.413000	0.31143	0.311000	0.19380	1.257000	0.44085	0.563000	0.77884	AGA		0.597	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186		10	44	0	0	0	0.006214	0	10	44				
RALGAPB	57148	broad.mit.edu	37	20	37177415	37177415	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr20:37177415A>T	ENST00000262879.6	+	20	3270	c.2986A>T	c.(2986-2988)Aga>Tga	p.R996*	RALGAPB_ENST00000397042.3_Nonsense_Mutation_p.R992*|RALGAPB_ENST00000397038.1_Nonsense_Mutation_p.R774*|RALGAPB_ENST00000397040.1_Nonsense_Mutation_p.R996*			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	996					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.R996*(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TCTTTTACCCAGAGGAGCAAA	0.408																																							uc002xiw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(2986-2988)AGA>TGA		Ral GTPase activating protein, beta subunit							91.0	92.0	92.0					20																	37177415		2203	4300	6503	SO:0001587	stop_gained	57148				activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:37177415A>T	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.2986A>T	20.37:g.37177415A>T	ENSP00000262879:p.Arg996*		Somatic				RALGAPB_uc002xix.2_Nonsense_Mutation_p.R992*|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Nonsense_Mutation_p.R774*	p.R996*	NM_020336	NP_065069	WXS	Illumina HiSeq	Unspecified	Q86X10	RLGPB_HUMAN			20	3243	+			996					A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Nonsense_Mutation	SNP	ENST00000262879.6	37	c.2986A>T	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	A	47	13.644710	0.99754	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.82	4.71	0.59529	.	0.043570	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.156	0.59518	0.8665:0.1335:0.0:0.0	.	.	.	.	X	996;992;774;996;824	.	ENSP00000262879:R996X	R	+	1	2	RALGAPB	36610829	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.825000	0.55730	1.008000	0.39264	-0.323000	0.08544	AGA		0.408	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336		5	100	0	0	0	0.001168	0	5	100				
MRGBP	55257	broad.mit.edu	37	20	61430905	61430905	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr20:61430905C>G	ENST00000370487.3	+	5	596	c.525C>G	c.(523-525)gaC>gaG	p.D175E	OGFR-AS1_ENST00000431361.1_RNA	NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	175					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D175E(1)									AAGGCGCAGACAAGCGGAAGC	0.552																																							uc002ydi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)GAC>GAG		MRG-binding protein							99.0	105.0	103.0					20																	61430905		2203	4300	6503	SO:0001583	missense	55257				chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex		g.chr20:61430905C>G	AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.525C>G	20.37:g.61430905C>G	ENSP00000359518:p.Asp175Glu		Somatic					p.D175E	NM_018270	NP_060740	WXS	Illumina HiSeq	Unspecified	Q9NV56	MRGBP_HUMAN			5	596	+	Breast(26;3.65e-08)		175					A8C4L5	Missense_Mutation	SNP	ENST00000370487.3	37	c.525C>G	CCDS13503.1	.	.	.	.	.	.	.	.	.	.	C	5.181	0.219016	0.09810	.	.	ENSG00000101189	ENST00000370487	.	.	.	5.47	5.47	0.80525	.	0.168888	0.52532	D	0.000070	T	0.31327	0.0793	N	0.19112	0.55	0.39517	D	0.968452	B	0.23540	0.087	B	0.20577	0.03	T	0.18116	-1.0347	9	0.02654	T	1	-34.243	10.4622	0.44585	0.0:0.8804:0.0:0.1196	.	175	Q9NV56	MRGBP_HUMAN	E	175	.	ENSP00000359518:D175E	D	+	3	2	C20orf20	60901350	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	1.524000	0.35942	2.552000	0.86080	0.655000	0.94253	GAC		0.552	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080080.1	NM_018270		4	84	0	0	0	0.000248	0	4	84				
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000398137.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																		uc002zda.1		NA		Dom	yes		21	21q22.3	7307		U2 small nuclear RNA auxiliary factor 1			L					57	Substitution - Missense(57)		haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)		0						c.(100-102)TCT>TTT		U2 small nuclear RNA auxillary factor 1 isoform		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe		Somatic				U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.S34F|U2AF1_uc010gpi.1_Missense_Mutation_p.S34F|U2AF1_uc002zdc.1_Missense_Mutation_p.S34F	p.S34F	NM_001025203	NP_001020374	WXS	Illumina HiSeq	Unspecified	Q01081	U2AF1_HUMAN			2	185	-			34			C3H1-type 1.		Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	c.101C>T	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758		8	22	0	0	0	0.006214	0	8	22				
PCBP3	54039	broad.mit.edu	37	21	47359949	47359949	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr21:47359949A>T	ENST00000400314.1	+	15	1253	c.915A>T	c.(913-915)atA>atT	p.I305I	PCBP3_ENST00000400304.1_Silent_p.I295I|PCBP3_ENST00000400310.1_Silent_p.I285I|PCBP3_ENST00000449640.1_Silent_p.I305I|PCBP3_ENST00000400308.1_Silent_p.I279I|PCBP3_ENST00000400309.1_Silent_p.I304I			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	305	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.I305I(1)|p.I273I(1)		biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		TCTAGCTAATAGGCTGCATAA	0.567																																							uc002zhq.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(913-915)ATA>ATT		poly(rC) binding protein 3 isoform 1							62.0	63.0	63.0					21																	47359949		1950	4147	6097	SO:0001819	synonymous_variant	54039				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding	g.chr21:47359949A>T	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.915A>T	21.37:g.47359949A>T			Somatic				PCBP3_uc002zhp.1_Silent_p.I285I|PCBP3_uc002zhs.1_Silent_p.I279I|PCBP3_uc002zhr.1_Silent_p.I304I|PCBP3_uc002zht.1_Silent_p.I295I	p.I305I	NM_020528	NP_065389	WXS	Illumina HiSeq	Unspecified	P57721	PCBP3_HUMAN		Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)	13	1040	+	all_hematologic(128;0.24)		305			KH 3.		A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Silent	SNP	ENST00000400314.1	37	c.915A>T	CCDS42974.2																																																																																				0.567	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2			5	77	0	0	0	0.000602	0	5	77				
MICAL3	57553	broad.mit.edu	37	22	18387502	18387502	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr22:18387502C>T	ENST00000441493.2	-	3	720	c.368G>A	c.(367-369)cGc>cAc	p.R123H	MICAL3_ENST00000383094.3_Missense_Mutation_p.R123H|MICAL3_ENST00000400561.2_Missense_Mutation_p.R123H|MICAL3_ENST00000585038.1_Missense_Mutation_p.R123H|MICAL3_ENST00000414725.2_Missense_Mutation_p.R123H|MICAL3_ENST00000429452.1_Missense_Mutation_p.R123H|MICAL3_ENST00000444520.1_Missense_Mutation_p.R123H|MICAL3_ENST00000207726.7_Missense_Mutation_p.R123H	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	123	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GACGTTGTTGCGGGAGAAGGC	0.527																																							uc002zng.3		NA																	0					0						c.(367-369)CGC>CAC		microtubule associated monoxygenase, calponin							188.0	167.0	173.0					22																	18387502		1568	3582	5150	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18387502C>T	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.368G>A	22.37:g.18387502C>T	ENSP00000416015:p.Arg123His		Somatic				MICAL3_uc011agl.1_Missense_Mutation_p.R123H|MICAL3_uc002znh.2_Missense_Mutation_p.R123H|MICAL3_uc002znj.1_5'Flank|MICAL3_uc002znk.1_Missense_Mutation_p.R123H|MICAL3_uc002znl.1_5'UTR|MICAL3_uc010grf.2_Missense_Mutation_p.R123H|MICAL3_uc011agm.1_Missense_Mutation_p.R123H	p.R123H	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	3	721	-		all_epithelial(15;0.198)	123					B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.368G>A	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	35	5.552677	0.96501	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726;ENST00000424046	T;T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96;3.12	5.62	5.62	0.85841	Monooxygenase, FAD-binding (1);	0.000000	0.85682	D	0.000000	T	0.45478	0.1344	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.996;1.0;0.999;0.997	T	0.32771	-0.9894	10	0.87932	D	0	.	19.6632	0.95882	0.0:1.0:0.0:0.0	.	123;123;123;123;123	B4DJ91;B2RXJ5;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	H	123	ENSP00000416015:R123H;ENSP00000414846:R123H;ENSP00000383406:R123H;ENSP00000410315:R123H;ENSP00000391827:R123H;ENSP00000372574:R123H;ENSP00000207726:R123H;ENSP00000406193:R123H	ENSP00000207726:R123H	R	-	2	0	XXbac-B461K10.4;MICAL3	16767502	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.625000	0.88918	0.655000	0.94253	CGC		0.527	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			26	152	0	0	0	0.00632	0	26	152				
PEX26	55670	broad.mit.edu	37	22	18562679	18562679	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr22:18562679C>A	ENST00000329627.7	+	3	476	c.270C>A	c.(268-270)atC>atA	p.I90I	XXbac-B476C20.9_ENST00000607927.1_RNA|PEX26_ENST00000399744.3_Silent_p.I90I|PEX26_ENST00000428061.2_Silent_p.I90I|XXbac-B476C20.9_ENST00000426483.1_RNA	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	90					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.I90I(1)		breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TTGTGGGGATCCAGGCCCTGG	0.527																																							uc002znp.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(268-270)ATC>ATA		peroxisome biogenesis factor 26							168.0	150.0	156.0					22																	18562679		2203	4300	6503	SO:0001819	synonymous_variant	55670				protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding	g.chr22:18562679C>A	AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.270C>A	22.37:g.18562679C>A			Somatic				TUBA8_uc002znr.2_5'UTR|PEX26_uc002znq.3_Silent_p.I90I|uc002zns.2_5'Flank|PEX26_uc002znt.2_Silent_p.I90I	p.I90I	NM_017929	NP_060399	WXS	Illumina HiSeq	Unspecified	Q7Z412	PEX26_HUMAN			3	479	+			90			Cytoplasmic (Potential).		F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Silent	SNP	ENST00000329627.7	37	c.270C>A	CCDS13750.1																																																																																				0.527	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314644.3	NM_017929		23	104	1	0	2.39556e-15	0.00278	4.51837e-15	23	104				
TBX1	6899	broad.mit.edu	37	22	19752613	19752613	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr22:19752613G>T	ENST00000329705.7	+	6	946	c.817G>T	c.(817-819)Gtc>Ttc	p.V273F	TBX1_ENST00000332710.4_Missense_Mutation_p.V273F|TBX1_ENST00000359500.3_Missense_Mutation_p.V273F	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	273					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)	p.V273F(3)		breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				ATTCACCGCGGTCACTGCCTA	0.547																																							uc002zqb.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|breast(1)	2						c.(817-819)GTC>TTC		T-box 1 isoform A							89.0	86.0	87.0					22																	19752613		2203	4300	6503	SO:0001583	missense	6899				embryonic viscerocranium morphogenesis|heart development|parathyroid gland development|pharyngeal system development|regulation of transcription from RNA polymerase II promoter|soft palate development|thymus development	nucleus	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:19752613G>T	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.817G>T	22.37:g.19752613G>T	ENSP00000331176:p.Val273Phe		Somatic				TBX1_uc002zqa.1_Missense_Mutation_p.V273F|TBX1_uc002zqc.2_Missense_Mutation_p.V273F	p.V273F	NM_080646	NP_542377	WXS	Illumina HiSeq	Unspecified	O43435	TBX1_HUMAN			6	946	+	Colorectal(54;0.0993)	all_lung(157;3.05e-06)	273			T-box.		C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	ENST00000329705.7	37	c.817G>T	CCDS13766.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684605	0.88639	.	.	ENSG00000184058	ENST00000332710;ENST00000329705;ENST00000359500	D;D;D	0.94793	-3.52;-3.52;-3.52	4.18	4.18	0.49190	p53-like transcription factor, DNA-binding (1);	0.000000	0.64402	D	0.000001	D	0.98277	0.9429	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.99785	1.1029	10	0.87932	D	0	.	16.2707	0.82616	0.0:0.0:1.0:0.0	.	273;273;273	Q152R5;O43435;D9ZGG0	.;TBX1_HUMAN;.	F	273	ENSP00000331791:V273F;ENSP00000331176:V273F;ENSP00000352483:V273F	ENSP00000331176:V273F	V	+	1	0	TBX1	18132613	1.000000	0.71417	0.888000	0.34837	0.645000	0.38454	9.522000	0.98032	2.174000	0.68829	0.491000	0.48974	GTC		0.547	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647		4	52	1	0	8.12818e-05	0.001984	0.000103228	4	52				
NEFH	4744	broad.mit.edu	37	22	29885226	29885226	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr22:29885226C>G	ENST00000310624.6	+	4	1630	c.1597C>G	c.(1597-1599)Cca>Gca	p.P533A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	533	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P533A(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GGCCAAGTCCCCAGAGAAGGA	0.557																																							uc003afo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1597-1599)CCA>GCA		neurofilament, heavy polypeptide 200kDa							58.0	64.0	62.0					22																	29885226		2203	4300	6503	SO:0001583	missense	4744				cell death|nervous system development	neurofilament		g.chr22:29885226C>G		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1597C>G	22.37:g.29885226C>G	ENSP00000311997:p.Pro533Ala		Somatic				NEFH_uc003afp.2_5'Flank	p.P533A	NM_021076	NP_066554	WXS	Illumina HiSeq	Unspecified	P12036	NFH_HUMAN			4	1668	+			533			30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.|2.		B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	c.1597C>G	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	C	9.784	1.175995	0.21704	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.84800	-1.9	5.38	5.38	0.77491	.	0.000000	0.52532	D	0.000066	D	0.86924	0.6050	L	0.59436	1.845	0.44188	D	0.997001	D	0.56968	0.978	P	0.52957	0.714	D	0.87937	0.2714	10	0.87932	D	0	.	11.6917	0.51519	0.1767:0.8232:0.0:0.0	.	533	P12036	NFH_HUMAN	A	533	ENSP00000311997:P533A	ENSP00000311997:P533A	P	+	1	0	NEFH	28215226	0.841000	0.29509	0.887000	0.34795	0.022000	0.10575	3.304000	0.51866	2.537000	0.85549	0.655000	0.94253	CCA		0.557	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076		4	44	0	0	0	0.000248	0	4	44				
MYH9	4627	broad.mit.edu	37	22	36684363	36684364	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr22:36684363_36684364CC>AA	ENST00000216181.5	-	34	5096_5097	c.4866_4867GG>TT	c.(4864-4869)ctGGag>ctTTag	p.E1623*	MYH9_ENST00000475726.1_5'Flank	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1623					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.E1623*(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						ATGTGCGCCTCCAGGTCCTTCA	0.658			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		1	Substitution - Nonsense(1)		lung(1)	breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(4864-4869)CTGGAG>CTTTAG		myosin, heavy polypeptide 9, non-muscle																																				SO:0001587	stop_gained	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36684363_36684364CC>AA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4866_4867delinsAA	22.37:g.36684363_36684364delinsAA	ENSP00000216181:p.Glu1623*		Somatic					p.E1623*	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			34	5097_5098	-			1623			Potential.		A8K6E4|O60805|Q60FE2|Q86T83	Nonsense_Mutation	DNP	ENST00000216181.5	37	c.4866_4867GG>TT	CCDS13927.1																																																																																				0.658	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		9	74	0	0	0	0.004672	0	9	74				
ZNF385D	79750	broad.mit.edu	37	3	21706497	21706497	+	Missense_Mutation	SNP	G	G	T	rs181361410		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:21706497G>T	ENST00000281523.2	-	2	564	c.46C>A	c.(46-48)Ctc>Atc	p.L16I	ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	16						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.L16I(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						AGGGCCGGGAGAGCAGGACTC	0.512																																							uc003cce.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|skin(2)|ovary(1)	5						c.(46-48)CTC>ATC		zinc finger protein 385D							70.0	66.0	67.0					3																	21706497		2203	4300	6503	SO:0001583	missense	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21706497G>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.46C>A	3.37:g.21706497G>T	ENSP00000281523:p.Leu16Ile		Somatic				ZNF385D_uc010hfb.1_Intron	p.L16I	NM_024697	NP_078973	WXS	Illumina HiSeq	Unspecified	Q9H6B1	Z385D_HUMAN			2	454	-			16						Missense_Mutation	SNP	ENST00000281523.2	37	c.46C>A	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728197	0.89390	.	.	ENSG00000151789	ENST00000281523	T	0.35973	1.28	5.62	5.62	0.85841	.	0.072743	0.56097	D	0.000026	T	0.55226	0.1907	L	0.54323	1.7	0.33389	D	0.575936	P	0.52842	0.956	P	0.62184	0.899	T	0.64037	-0.6501	10	0.59425	D	0.04	-6.7106	18.6348	0.91372	0.0:0.0:1.0:0.0	.	16	Q9H6B1	Z385D_HUMAN	I	16	ENSP00000281523:L16I	ENSP00000281523:L16I	L	-	1	0	ZNF385D	21681501	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.436000	0.66538	2.651000	0.90000	0.591000	0.81541	CTC		0.512	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697		8	24	1	0	1.76689e-08	0.006214	2.88921e-08	8	24				
ARPP21	10777	broad.mit.edu	37	3	35833950	35833950	+	Missense_Mutation	SNP	C	C	A	rs369106158		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:35833950C>A	ENST00000187397.4	+	19	2565	c.2109C>A	c.(2107-2109)aaC>aaA	p.N703K	ARPP21_ENST00000458225.1_Missense_Mutation_p.N704K|ARPP21_ENST00000337271.5_Missense_Mutation_p.N684K|ARPP21_ENST00000417925.1_Missense_Mutation_p.N704K|ARPP21_ENST00000444190.1_Missense_Mutation_p.N684K|ARPP21_ENST00000476052.1_3'UTR	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	703	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.N703K(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AGAGTCAGAACGTGATAAATA	0.463																																							uc003cgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2107-2109)AAC>AAA		cyclic AMP-regulated phosphoprotein, 21 kD		T	LYS/ASN	0,4406		0,0,2203	160.0	147.0	152.0		2109	-1.7	0.0	3		152	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARPP21	NM_016300.4	94	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	benign	703/813	35833950	1,13005	2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35833950C>A	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2109C>A	3.37:g.35833950C>A	ENSP00000187397:p.Asn703Lys		Somatic				ARPP21_uc003cga.2_Missense_Mutation_p.N684K|ARPP21_uc011axy.1_Missense_Mutation_p.N704K|ARPP21_uc003cgf.2_Missense_Mutation_p.N539K|ARPP21_uc003cgg.2_Missense_Mutation_p.N226K	p.N703K	NM_016300	NP_057384	WXS	Illumina HiSeq	Unspecified	Q9UBL0	ARP21_HUMAN			19	2373	+			703			Gln-rich.		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.2109C>A	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	c	11.53	1.666543	0.29604	0.0	1.16E-4	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.71	-1.73	0.08081	.	0.587686	0.18885	N	0.128474	T	0.27559	0.0677	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.33448	0.03;0.412;0.018;0.03	B;B;B;B	0.35727	0.087;0.209;0.037;0.087	T	0.24261	-1.0165	10	0.20519	T	0.43	-1.4601	6.6069	0.22729	0.0:0.4895:0.1128:0.3977	.	704;226;703;684	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	K	704;684;684;703;704	ENSP00000414351:N704K;ENSP00000337792:N684K;ENSP00000405276:N684K;ENSP00000187397:N703K;ENSP00000412326:N704K	ENSP00000187397:N703K	N	+	3	2	ARPP21	35808954	0.005000	0.15991	0.018000	0.16275	0.768000	0.43524	-0.056000	0.11787	-0.732000	0.04856	-0.119000	0.15052	AAC		0.463	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		23	137	1	0	1.96895e-08	0.00278	3.20585e-08	23	137				
SETD2	29072	broad.mit.edu	37	3	47158152	47158152	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:47158152C>A	ENST00000409792.3	-	4	4589	c.4547G>T	c.(4546-4548)tGt>tTt	p.C1516F		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1516	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.C1013F(1)|p.C1516F(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCTTCCCCACATGCTATTTC	0.353			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		2	Substitution - Missense(2)		lung(2)	kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4546-4548)TGT>TTT		SET domain containing 2							129.0	128.0	128.0					3																	47158152		2203	4300	6503	SO:0001583	missense	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47158152C>A	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4547G>T	3.37:g.47158152C>A	ENSP00000386759:p.Cys1516Phe		Somatic				SETD2_uc003cqv.2_Missense_Mutation_p.C1505F	p.C1516F	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	4	4600	-		Acute lymphoblastic leukemia(5;0.0169)	1516			AWS.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	c.4547G>T	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818878	0.90873	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	T	0.80214	-1.35	5.93	5.93	0.95920	AWS (2);	0.000000	0.64402	D	0.000007	D	0.93867	0.8038	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95071	0.8204	10	0.87932	D	0	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	1516;1516	F2Z317;Q9BYW2	.;SETD2_HUMAN	F	1516	ENSP00000386759:C1516F	ENSP00000386759:C1516F	C	-	2	0	SETD2	47133156	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	7.794000	0.85869	2.814000	0.96858	0.591000	0.81541	TGT		0.353	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		16	119	1	0	2.23348e-06	0.004007	3.24793e-06	16	119				
COL7A1	1294	broad.mit.edu	37	3	48617237	48617237	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:48617237C>A	ENST00000328333.8	-	57	5242	c.5135G>T	c.(5134-5136)gGa>gTa	p.G1712V	MIR711_ENST00000390201.1_RNA|COL7A1_ENST00000454817.1_Missense_Mutation_p.G1712V	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1712	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G1712V(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGCTCCAGGTCCTGTGTCTAC	0.582																																							uc003ctz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(5134-5136)GGA>GTA		alpha 1 type VII collagen precursor							68.0	74.0	72.0					3																	48617237		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48617237C>A	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.5135G>T	3.37:g.48617237C>A	ENSP00000332371:p.Gly1712Val		Somatic				MIR711_hsa-mir-711|MI0012488_5'Flank	p.G1712V	NM_000094	NP_000085	WXS	Illumina HiSeq	Unspecified	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	57	5136	-			1712			Triple-helical region.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.5135G>T	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	9.929	1.214320	0.22289	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.99186	-5.53;-5.53	4.49	1.58	0.23477	.	0.320881	0.21898	N	0.067497	D	0.99208	0.9725	M	0.93283	3.4	0.19575	N	0.999963	D	0.76494	0.999	D	0.72625	0.978	D	0.96596	0.9441	10	0.62326	D	0.03	.	6.189	0.20513	0.0:0.5479:0.2842:0.1679	.	1712	Q02388	CO7A1_HUMAN	V	1712	ENSP00000332371:G1712V;ENSP00000412569:G1712V	ENSP00000332371:G1712V	G	-	2	0	COL7A1	48592241	0.016000	0.18221	0.002000	0.10522	0.095000	0.18619	0.365000	0.20348	0.213000	0.20722	-0.140000	0.14226	GGA		0.582	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		5	67	1	0	3.59834e-05	0.001168	4.72747e-05	5	67				
PDZRN3	23024	broad.mit.edu	37	3	73651529	73651529	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:73651529C>A	ENST00000263666.4	-	3	1008	c.894G>T	c.(892-894)ctG>ctT	p.L298L	PDZRN3_ENST00000308537.4_Silent_p.L298L	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	298	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L298L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CATGAATTTGCAGGCCTCCTT	0.433																																							uc003dpl.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(892-894)CTG>CTT		PDZ domain containing ring finger 3							230.0	217.0	221.0					3																	73651529		2203	4300	6503	SO:0001819	synonymous_variant	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73651529C>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.894G>T	3.37:g.73651529C>A			Somatic					p.L298L	NM_015009	NP_055824	WXS	Illumina HiSeq	Unspecified	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	3	990	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	298			PDZ 1.		A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	c.894G>T	CCDS33789.1																																																																																				0.433	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		14	243	1	0	6.31663e-08	0.003163	1.01119e-07	14	243				
NSUN3	63899	broad.mit.edu	37	3	93813893	93813893	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:93813893C>T	ENST00000314622.4	+	5	849	c.638C>T	c.(637-639)cCg>cTg	p.P213L		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	213							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.P213L(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						GTGGATGCTCCGTGTTCAAAT	0.408																																							uc003drl.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(637-639)CCG>CTG		NOL1/NOP2/Sun domain family, member 3							179.0	162.0	168.0					3																	93813893		2203	4300	6503	SO:0001583	missense	63899						methyltransferase activity	g.chr3:93813893C>T	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.638C>T	3.37:g.93813893C>T	ENSP00000318986:p.Pro213Leu		Somatic					p.P213L	NM_022072	NP_071355	WXS	Illumina HiSeq	Unspecified	Q9H649	NSUN3_HUMAN			5	754	+			213					Q6PG41|Q8IXG9|Q9H6M2	Missense_Mutation	SNP	ENST00000314622.4	37	c.638C>T	CCDS2927.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858514	0.91433	.	.	ENSG00000178694	ENST00000314622	T	0.53857	0.6	5.93	5.93	0.95920	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.000000	0.85682	D	0.000000	D	0.85687	0.5754	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91094	0.4909	10	0.87932	D	0	-16.5888	20.3465	0.98790	0.0:1.0:0.0:0.0	.	213	Q9H649	NSUN3_HUMAN	L	213	ENSP00000318986:P213L	ENSP00000318986:P213L	P	+	2	0	NSUN3	95296583	1.000000	0.71417	0.991000	0.47740	0.814000	0.46013	6.043000	0.71004	2.798000	0.96311	0.655000	0.94253	CCG		0.408	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	NM_022072		9	140	0	0	0	0.004482	0	9	140				
OR5K1	26339	broad.mit.edu	37	3	98188926	98188926	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:98188926G>T	ENST00000332650.5	+	1	603	c.506G>T	c.(505-507)tGt>tTt	p.C169F		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C169F(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTAGTTTTCTGTGGATCGAAT	0.398																																							uc003dsm.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(505-507)TGT>TTT		olfactory receptor, family 5, subfamily K,							241.0	244.0	243.0					3																	98188926		2202	4300	6502	SO:0001583	missense	26339				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98188926G>T	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.506G>T	3.37:g.98188926G>T	ENSP00000373193:p.Cys169Phe		Somatic					p.C169F	NM_001004736	NP_001004736	WXS	Illumina HiSeq	Unspecified	Q8NHB7	OR5K1_HUMAN			1	506	+			169			Extracellular (Potential).		B9EGY5|Q6IF46	Missense_Mutation	SNP	ENST00000332650.5	37	c.506G>T	CCDS43115.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564816	0.45694	.	.	ENSG00000232382	ENST00000332650	T	0.00249	8.44	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000251	T	0.00875	0.0029	M	0.93197	3.39	0.33538	D	0.594485	D	0.89917	1.0	D	0.80764	0.994	T	0.38415	-0.9662	10	0.87932	D	0	-15.4997	16.5011	0.84256	0.0:0.0:1.0:0.0	.	169	Q8NHB7	OR5K1_HUMAN	F	169	ENSP00000373193:C169F	ENSP00000373193:C169F	C	+	2	0	OR5K1	99671616	1.000000	0.71417	1.000000	0.80357	0.333000	0.28666	5.939000	0.70179	2.483000	0.83821	0.563000	0.77884	TGT		0.398	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1			11	303	1	0	6.40141e-05	0.000978	8.23965e-05	11	303				
MORC1	27136	broad.mit.edu	37	3	108698378	108698378	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:108698378G>T	ENST00000483760.1	-	23	2441	c.2398C>A	c.(2398-2400)Ctg>Atg	p.L800M	MORC1_ENST00000232603.5_Missense_Mutation_p.L821M					MORC family CW-type zinc finger 1									p.L821M(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTAGACTTCAGTTTTCTCACT	0.403																																							uc003dxl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(2461-2463)CTG>ATG		MORC family CW-type zinc finger 1							117.0	123.0	121.0					3																	108698378		2203	4300	6503	SO:0001583	missense	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108698378G>T	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2398C>A	3.37:g.108698378G>T	ENSP00000417282:p.Leu800Met		Somatic				MORC1_uc011bhn.1_Missense_Mutation_p.L800M	p.L821M	NM_014429	NP_055244	WXS	Illumina HiSeq	Unspecified	Q86VD1	MORC1_HUMAN			24	2548	-			821						Missense_Mutation	SNP	ENST00000483760.1	37	c.2461C>A		.	.	.	.	.	.	.	.	.	.	G	11.81	1.749248	0.30955	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.19394	2.15;2.16	5.07	4.2	0.49525	.	0.000000	0.33670	N	0.004664	T	0.31199	0.0789	L	0.34521	1.04	0.31885	N	0.617943	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.25467	-1.0131	10	0.45353	T	0.12	-8.9862	8.8879	0.35414	0.099:0.0:0.901:0.0	.	800;821	E7ERX1;Q86VD1	.;MORC1_HUMAN	M	821;800	ENSP00000232603:L821M;ENSP00000417282:L800M	ENSP00000232603:L821M	L	-	1	2	MORC1	110181068	1.000000	0.71417	0.997000	0.53966	0.062000	0.15995	1.294000	0.33365	1.378000	0.46305	0.655000	0.94253	CTG		0.403	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			6	150	1	0	0.00198382	0.001984	0.00237684	6	150				
MORC1	27136	broad.mit.edu	37	3	108819311	108819311	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:108819311C>A	ENST00000483760.1	-	5	310	c.267G>T	c.(265-267)cgG>cgT	p.R89R	MORC1_ENST00000232603.5_Silent_p.R89R|MORC1-AS1_ENST00000480826.1_RNA					MORC family CW-type zinc finger 1									p.R89R(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AGGTTGACAGCCGTTTTTTGG	0.393																																							uc003dxl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(265-267)CGG>CGT		MORC family CW-type zinc finger 1							185.0	184.0	185.0					3																	108819311		2203	4300	6503	SO:0001819	synonymous_variant	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108819311C>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.267G>T	3.37:g.108819311C>A			Somatic				MORC1_uc011bhn.1_Silent_p.R89R	p.R89R	NM_014429	NP_055244	WXS	Illumina HiSeq	Unspecified	Q86VD1	MORC1_HUMAN			5	354	-			89						Silent	SNP	ENST00000483760.1	37	c.267G>T																																																																																					0.393	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			11	121	1	0	2.80697e-09	0.000978	4.67012e-09	11	121				
KIAA2018	205717	broad.mit.edu	37	3	113378249	113378249	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:113378249A>T	ENST00000478658.1	-	5	2297	c.2280T>A	c.(2278-2280)ccT>ccA	p.P760P	KIAA2018_ENST00000316407.4_Silent_p.P760P|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	760						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.P760P(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTGTTGTCACAGGAGGTGCTG	0.393																																							uc003eam.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(2278-2280)CCT>CCA		hypothetical protein LOC205717							94.0	87.0	89.0					3																	113378249		1962	4148	6110	SO:0001819	synonymous_variant	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113378249A>T	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2280T>A	3.37:g.113378249A>T			Somatic				KIAA2018_uc003eal.2_Silent_p.P704P	p.P760P	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	2691	-			760					Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	c.2280T>A	CCDS43133.1																																																																																				0.393	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		7	80	0	0	0	0.001984	0	7	80				
TIMMDC1	51300	broad.mit.edu	37	3	119242481	119242481	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:119242481C>G	ENST00000494664.1	+	7	938	c.736C>G	c.(736-738)Ctc>Gtc	p.L246V	TIMMDC1_ENST00000493694.1_Missense_Mutation_p.L112V	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	246						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.L246V(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						TACTGAGCACCTCCCTGAGAA	0.348																																							uc003ecn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(736-738)CTC>GTC		hypothetical protein LOC51300							109.0	115.0	113.0					3																	119242481		2203	4300	6503	SO:0001583	missense	51300					integral to membrane|mitochondrial inner membrane	protein transporter activity	g.chr3:119242481C>G	AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.736C>G	3.37:g.119242481C>G	ENSP00000418803:p.Leu246Val		Somatic				C3orf1_uc003eco.2_RNA|C3orf1_uc003ecp.2_RNA	p.L246V	NM_016589	NP_057673	WXS	Illumina HiSeq	Unspecified	Q9NPL8	TIDC1_HUMAN		GBM - Glioblastoma multiforme(114;0.186)	7	949	+			246					D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	ENST00000494664.1	37	c.736C>G	CCDS33831.1	.	.	.	.	.	.	.	.	.	.	C	6.997	0.554047	0.13374	.	.	ENSG00000113845	ENST00000494664;ENST00000493694	T;T	0.57752	0.99;0.38	5.54	3.68	0.42216	.	0.157960	0.40640	N	0.001056	T	0.38453	0.1041	L	0.37750	1.13	0.37930	D	0.93196	B	0.23540	0.087	B	0.17433	0.018	T	0.35699	-0.9778	10	0.35671	T	0.21	-7.5556	8.303	0.32025	0.168:0.6488:0.1832:0.0	.	246	Q9NPL8	TIDC1_HUMAN	V	246;112	ENSP00000418803:L246V;ENSP00000419510:L112V	ENSP00000419510:L112V	L	+	1	0	TIMMDC1	120725171	0.660000	0.27420	0.905000	0.35620	0.065000	0.16274	0.837000	0.27558	1.573000	0.49748	0.650000	0.86243	CTC		0.348	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3	NM_016589		25	87	0	0	0	0.003954	0	25	87				
STXBP5L	9515	broad.mit.edu	37	3	120959336	120959336	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:120959336C>G	ENST00000273666.6	+	14	1653	c.1382C>G	c.(1381-1383)cCa>cGa	p.P461R	STXBP5L_ENST00000492541.1_Missense_Mutation_p.P461R|STXBP5L_ENST00000472879.1_Missense_Mutation_p.P461R|STXBP5L_ENST00000471454.1_Missense_Mutation_p.P461R|STXBP5L_ENST00000497029.1_Missense_Mutation_p.P461R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	461					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P461R(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CAAACATATCCAGAAATTATT	0.333																																							uc003eec.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(2)	9						c.(1381-1383)CCA>CGA		syntaxin binding protein 5-like							81.0	81.0	81.0					3																	120959336		1825	4083	5908	SO:0001583	missense	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:120959336C>G	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1382C>G	3.37:g.120959336C>G	ENSP00000273666:p.Pro461Arg		Somatic				STXBP5L_uc011bji.1_Missense_Mutation_p.P461R	p.P461R	NM_014980	NP_055795	WXS	Illumina HiSeq	Unspecified	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	14	1522	+			461			WD 8.		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	c.1382C>G	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855299	0.71719	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.62498	0.57;0.02;0.02;0.57;0.02;0.02	5.21	5.21	0.72293	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.054252	0.85682	D	0.000000	T	0.64929	0.2643	L	0.28458	0.855	0.80722	D	1	D;D	0.59767	0.986;0.986	D;D	0.64877	0.93;0.93	T	0.56245	-0.8011	10	0.02654	T	1	-5.7678	18.9528	0.92646	0.0:1.0:0.0:0.0	.	461;461	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	461	ENSP00000273666:P461R;ENSP00000420019:P461R;ENSP00000419627:P461R;ENSP00000420287:P461R;ENSP00000420666:P461R;ENSP00000420167:P461R	ENSP00000273666:P461R	P	+	2	0	STXBP5L	122442026	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.627000	0.83176	2.716000	0.92895	0.561000	0.74099	CCA		0.333	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			3	57	0	0	0	0.000248	0	3	57				
COL6A5	256076	broad.mit.edu	37	3	130095427	130095427	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:130095427G>T	ENST00000432398.2	+	3	909	c.415G>T	c.(415-417)Gtg>Ttg	p.V139L	COL6A5_ENST00000265379.6_Missense_Mutation_p.V139L	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	139	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.V139L(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCCAATTTTGGTGGTCCTGGC	0.532																																							uc010htj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(415-417)GTG>TTG		collagen, type XXIX, alpha 1							54.0	58.0	57.0					3																	130095427		692	1591	2283	SO:0001583	missense	256076				axon guidance|cell adhesion	collagen		g.chr3:130095427G>T	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.415G>T	3.37:g.130095427G>T	ENSP00000390895:p.Val139Leu		Somatic				COL29A1_uc010hti.1_RNA	p.V139L	NM_153264	NP_694996	WXS	Illumina HiSeq	Unspecified	A8TX70	CO6A5_HUMAN			3	909	+			139			Nonhelical region.|VWFA 1.		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37	c.415G>T		.	.	.	.	.	.	.	.	.	.	G	12.48	1.950310	0.34377	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.81739	-1.53;-1.53	5.14	5.14	0.70334	.	.	.	.	.	D	0.85392	0.5686	L	0.52266	1.64	0.27389	N	0.955191	D	0.64830	0.994	D	0.70016	0.967	T	0.76556	-0.2916	9	0.33940	T	0.23	.	11.9715	0.53065	0.085:0.0:0.915:0.0	.	139	A8TX70-2	.	L	139	ENSP00000390895:V139L;ENSP00000265379:V139L	ENSP00000265379:V139L	V	+	1	0	COL6A5	131578117	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	2.191000	0.42640	2.552000	0.86080	0.557000	0.71058	GTG		0.532	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264		3	22	1	0	0.004672	0.004672	0.00546022	3	22				
PPM1L	151742	broad.mit.edu	37	3	160786690	160786690	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:160786690C>T	ENST00000498165.1	+	4	929	c.828C>T	c.(826-828)aaC>aaT	p.N276N	PPM1L_ENST00000464260.1_Silent_p.N97N|PPM1L_ENST00000295839.9_Silent_p.N149N|PPM1L_ENST00000480117.1_3'UTR	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	276	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.N97N(1)|p.N276N(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AAAATCTCAACGTGGTCATCC	0.517																																					Pancreas(86;250 1994 13715 43211)	Pancreas(86;250 1994 13715 43211)	uc003fdr.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(826-828)AAC>AAT		protein phosphatase 1 (formerly 2C)-like							97.0	90.0	92.0					3																	160786690		2203	4300	6503	SO:0001819	synonymous_variant	151742				protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr3:160786690C>T	AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.828C>T	3.37:g.160786690C>T			Somatic				PPM1L_uc003fds.2_Silent_p.N97N|PPM1L_uc003fdt.2_Silent_p.N149N|PPM1L_uc010hwf.2_RNA	p.N276N	NM_139245	NP_640338	WXS	Illumina HiSeq	Unspecified	Q5SGD2	PPM1L_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)		4	929	+			276			Cytoplasmic (Potential).|PP2C-like.		Q2M3J2|Q96NM7	Silent	SNP	ENST00000498165.1	37	c.828C>T	CCDS33886.1																																																																																				0.517	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245		5	77	0	0	0	0.000602	0	5	77				
SI	6476	broad.mit.edu	37	3	164777707	164777707	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:164777707C>G	ENST00000264382.3	-	10	1191	c.1129G>C	c.(1129-1131)Gaa>Caa	p.E377Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	377	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.E377Q(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGCCAGCTTCCCGGTTTCTC	0.383										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(1129-1131)GAA>CAA		sucrase-isomaltase	Acarbose(DB00284)						211.0	234.0	226.0					3																	164777707		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164777707C>G	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1129G>C	3.37:g.164777707C>G	ENSP00000264382:p.Glu377Gln	HNSCC(35;0.089)	Somatic					p.E377Q	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			10	1191	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	377			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.1129G>C	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	2.525	-0.309863	0.05458	.	.	ENSG00000090402	ENST00000264382	D	0.93859	-3.3	5.76	5.76	0.90799	Glycoside hydrolase, superfamily (1);	0.700302	0.15093	N	0.280946	D	0.89914	0.6853	L	0.39326	1.205	0.09310	N	1	B	0.18863	0.031	B	0.18263	0.021	T	0.75216	-0.3396	10	0.13853	T	0.58	.	16.954	0.86253	0.0:0.8727:0.1273:0.0	.	377	P14410	SUIS_HUMAN	Q	377	ENSP00000264382:E377Q	ENSP00000264382:E377Q	E	-	1	0	SI	166260401	0.172000	0.23043	0.016000	0.15963	0.193000	0.23685	2.745000	0.47459	2.724000	0.93272	0.585000	0.79938	GAA		0.383	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		31	501	0	0	0	0.003271	0	31	501				
CLDN11	5010	broad.mit.edu	37	3	170140986	170140986	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:170140986G>T	ENST00000064724.3	+	2	464	c.262G>T	c.(262-264)Gcc>Tcc	p.A88S	CLDN11_ENST00000486975.1_Missense_Mutation_p.A88S|CLDN11_ENST00000451576.1_Missense_Mutation_p.A88S|CLDN11_ENST00000489485.1_3'UTR	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	88					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.A88S(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			GATGATTGCTGCCTCGGTCCT	0.617																																							uc003fgx.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(262-264)GCC>TCC		claudin 11							149.0	144.0	146.0					3																	170140986		2203	4300	6503	SO:0001583	missense	5010				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr3:170140986G>T	AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.262G>T	3.37:g.170140986G>T	ENSP00000064724:p.Ala88Ser		Somatic				CLDN11_uc011bpt.1_Missense_Mutation_p.A88S|CLDN11_uc003fgy.2_Missense_Mutation_p.A4S	p.A88S	NM_005602	NP_005593	WXS	Illumina HiSeq	Unspecified	O75508	CLD11_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		2	464	+	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		88			Helical; (Potential).		B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	37	c.262G>T	CCDS3213.1	.	.	.	.	.	.	.	.	.	.	G	6.055	0.378564	0.11466	.	.	ENSG00000013297	ENST00000064724;ENST00000486975;ENST00000451576	D;D;D	0.87650	-2.28;-2.28;-2.28	5.66	5.66	0.87406	.	0.216527	0.47455	D	0.000228	T	0.80534	0.4641	N	0.16166	0.38	0.45076	D	0.998098	P;B	0.48089	0.905;0.001	P;B	0.47376	0.545;0.013	T	0.78969	-0.1994	10	0.27082	T	0.32	.	13.0126	0.58739	0.0736:0.0:0.9264:0.0	.	88;88	B4DFI2;O75508	.;CLD11_HUMAN	S	88	ENSP00000064724:A88S;ENSP00000417434:A88S;ENSP00000410185:A88S	ENSP00000064724:A88S	A	+	1	0	CLDN11	171623680	1.000000	0.71417	0.945000	0.38365	0.143000	0.21401	5.396000	0.66297	2.675000	0.91044	0.557000	0.71058	GCC		0.617	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602		17	155	1	0	5.35267e-07	0.007413	8.19022e-07	17	155				
OSTN	344901	broad.mit.edu	37	3	190967879	190967879	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:190967879G>C	ENST00000339051.1	+	3	371	c.371G>C	c.(370-372)gGt>gCt	p.G124A	OSTN_ENST00000445281.1_Intron	NM_198184.1	NP_937827.1	P61366	OSTN_HUMAN	osteocrin	124					cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|endochondral bone growth (GO:0003416)|negative regulation of glucose import (GO:0046325)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of cGMP biosynthetic process (GO:0030828)	extracellular space (GO:0005615)		p.G124A(1)		kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|skin(2)	13	all_cancers(143;6.79e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000254)		GATCGGATTGGTAGAAACCGG	0.353																																							uc011bsn.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(370-372)GGT>GCT		osteocrin precursor							114.0	119.0	117.0					3																	190967879		2203	4300	6503	SO:0001583	missense	344901				cell differentiation|multicellular organismal development|ossification		hormone activity	g.chr3:190967879G>C	AY398681	CCDS3299.1	3q29	2004-01-22			ENSG00000188729	ENSG00000188729			29961	protein-coding gene	gene with protein product		610280				14523025	Standard	NM_198184		Approved		uc011bsn.2	P61366	OTTHUMG00000156190	ENST00000339051.1:c.371G>C	3.37:g.190967879G>C	ENSP00000342356:p.Gly124Ala		Somatic					p.G124A	NM_198184	NP_937827	WXS	Illumina HiSeq	Unspecified	P61366	OSTN_HUMAN	LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000254)	3	371	+	all_cancers(143;6.79e-09)|Ovarian(172;0.103)		124					A1A4U3	Missense_Mutation	SNP	ENST00000339051.1	37	c.371G>C	CCDS3299.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007941	0.75046	.	.	ENSG00000188729	ENST00000339051	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.76637	0.4015	M	0.61703	1.905	0.48511	D	0.999668	D	0.76494	0.999	D	0.91635	0.999	T	0.78481	-0.2187	9	0.87932	D	0	-35.5641	14.9373	0.70967	0.0:0.0:1.0:0.0	.	124	P61366	OSTN_HUMAN	A	124	.	ENSP00000342356:G124A	G	+	2	0	OSTN	192450573	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.724000	0.61972	2.601000	0.87937	0.655000	0.94253	GGT		0.353	OSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343350.1	NM_198184		7	105	0	0	0	0.006214	0	7	105				
MFI2	4241	broad.mit.edu	37	3	196749841	196749841	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:196749841T>A	ENST00000296350.5	-	5	744	c.631A>T	c.(631-633)Agc>Tgc	p.S211C	MFI2_ENST00000296351.4_Missense_Mutation_p.S211C	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	211	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)	p.S211C(2)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		AAGGCCCCGCTGTAGTCGTAG	0.627																																							uc003fxk.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(631-633)AGC>TGC		melanoma-associated antigen p97 isoform 1							50.0	60.0	57.0					3																	196749841		2203	4300	6503	SO:0001583	missense	4241				cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding	g.chr3:196749841T>A		CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.631A>T	3.37:g.196749841T>A	ENSP00000296350:p.Ser211Cys		Somatic				MFI2_uc003fxl.3_Missense_Mutation_p.S211C|MFI2_uc011bua.1_Silent_p.T183T	p.S211C	NM_005929	NP_005920	WXS	Illumina HiSeq	Unspecified	P08582	TRFM_HUMAN	Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)	5	744	-	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		211			Transferrin-like 1.		Q9BQE2	Missense_Mutation	SNP	ENST00000296350.5	37	c.631A>T	CCDS3325.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.301153	0.81136	.	.	ENSG00000163975	ENST00000296350;ENST00000296351	T;T	0.39787	1.06;1.06	5.77	5.77	0.91146	.	0.135935	0.64402	D	0.000001	T	0.70919	0.3279	M	0.91818	3.245	0.40834	D	0.983611	D;D	0.89917	1.0;1.0	D;D	0.77557	0.986;0.99	T	0.78792	-0.2065	10	0.72032	D	0.01	-43.0372	13.8434	0.63453	0.0:0.0:0.0:1.0	.	211;211	Q53XS6;P08582	.;TRFM_HUMAN	C	211	ENSP00000296350:S211C;ENSP00000296351:S211C	ENSP00000296350:S211C	S	-	1	0	MFI2	198234238	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.402000	0.59722	2.200000	0.70718	0.459000	0.35465	AGC		0.627	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340458.1			5	93	0	0	0	0.000602	0	5	93				
LYAR	55646	broad.mit.edu	37	4	4276496	4276496	+	Splice_Site	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:4276496C>A	ENST00000343470.4	-	7	670	c.430G>T	c.(430-432)Gaa>Taa	p.E144*	LYAR_ENST00000452476.1_Splice_Site_p.E144*	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	144						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E144*(1)		endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTGACTGGTTCCTTATCATTA	0.418																																							uc011bvy.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(430-432)GAA>TAA		Ly1 antibody reactive homolog							147.0	135.0	139.0					4																	4276496		2203	4300	6503	SO:0001630	splice_region_variant	55646					nucleolus	metal ion binding|protein binding	g.chr4:4276496C>A	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.430-1G>T	4.37:g.4276496C>A			Somatic				LYAR_uc011bvx.1_Nonsense_Mutation_p.E27*|LYAR_uc003ght.2_Nonsense_Mutation_p.E144*	p.E144*	NM_001145725	NP_001139197	WXS	Illumina HiSeq	Unspecified	Q9NX58	LYAR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	7	573	-			144					D3DVS4|Q6FI78|Q9NYS1	Nonsense_Mutation	SNP	ENST00000343470.4	37	c.430G>T	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999294	0.93227	.	.	ENSG00000145220	ENST00000343470;ENST00000452476	.	.	.	4.77	4.77	0.60923	.	0.515454	0.22443	N	0.059989	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-13.8841	16.9327	0.86195	0.0:1.0:0.0:0.0	.	.	.	.	X	144	.	ENSP00000345917:E144X	E	-	1	0	LYAR	4327397	0.990000	0.36364	0.711000	0.30485	0.029000	0.11900	2.347000	0.44036	2.373000	0.80994	0.655000	0.94253	GAA		0.418	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	Nonsense_Mutation	6	94	1	0	8.12818e-05	0.001984	0.000103228	6	94				
CCDC96	257236	broad.mit.edu	37	4	7043210	7043210	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:7043210C>A	ENST00000310085.4	-	1	1518	c.1456G>T	c.(1456-1458)Gag>Tag	p.E486*	TADA2B_ENST00000310074.7_5'Flank|TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	486								p.E486*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CGCAGCCCCTCTCGGGCTTGC	0.557																																							uc003gjv.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1456-1458)GAG>TAG		coiled-coil domain containing 96							154.0	150.0	152.0					4																	7043210		2203	4300	6503	SO:0001587	stop_gained	257236							g.chr4:7043210C>A	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.1456G>T	4.37:g.7043210C>A	ENSP00000309285:p.Glu486*		Somatic				TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	p.E486*	NM_153376	NP_699207	WXS	Illumina HiSeq	Unspecified	Q2M329	CCD96_HUMAN			1	1519	-			486					Q8N2I7	Nonsense_Mutation	SNP	ENST00000310085.4	37	c.1456G>T	CCDS3395.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656014	0.67586	.	.	ENSG00000173013	ENST00000310085	.	.	.	3.55	3.55	0.40652	.	0.295771	0.26571	N	0.023634	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-26.8595	14.9128	0.70770	0.0:1.0:0.0:0.0	.	.	.	.	X	486	.	ENSP00000309285:E486X	E	-	1	0	CCDC96	7094111	0.979000	0.34478	0.058000	0.19502	0.148000	0.21650	2.766000	0.47629	1.817000	0.53016	0.462000	0.41574	GAG		0.557	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376		27	159	1	0	2.12542e-12	0.00632	3.83784e-12	27	159				
SORCS2	57537	broad.mit.edu	37	4	7717039	7717039	+	Splice_Site	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:7717039G>T	ENST00000507866.2	+	17	2361		c.e17+1		SORCS2_ENST00000329016.9_Splice_Site	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2						neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.G601G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GCAGCCTTGGGTGAGTGTGGG	0.627																																							uc003gkb.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.e17+1		VPS10 domain receptor protein SORCS 2 precursor							69.0	74.0	72.0					4																	7717039		1997	4148	6145	SO:0001630	splice_region_variant	57537					integral to membrane	neuropeptide receptor activity	g.chr4:7717039G>T	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2252+1G>T	4.37:g.7717039G>T			Somatic				SORCS2_uc011bwi.1_Splice_Site_p.G579_splice	p.G751_splice	NM_020777	NP_065828	WXS	Illumina HiSeq	Unspecified	Q96PQ0	SORC2_HUMAN			17	2252	+								Q9P2L7	Splice_Site	SNP	ENST00000507866.2	37	c.2252_splice	CCDS47008.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018217	0.75275	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0467	0.80725	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SORCS2	7767939	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.655000	0.83696	2.064000	0.61679	0.655000	0.94253	.		0.627	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	Intron	3	45	1	0	0.004672	0.004672	0.00546022	3	45				
GPR125	166647	broad.mit.edu	37	4	22425944	22425944	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:22425944T>C	ENST00000334304.5	-	11	1744	c.1475A>G	c.(1474-1476)aAc>aGc	p.N492S	GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000502482.1_Missense_Mutation_p.N492S|GPR125_ENST00000508133.1_Missense_Mutation_p.N266S	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	492					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.N492S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CAACATGATGTTACTTGCAAT	0.458																																							uc003gqm.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1474-1476)AAC>AGC		G protein-coupled receptor 125 precursor							139.0	122.0	128.0					4																	22425944		2203	4300	6503	SO:0001583	missense	166647				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity	g.chr4:22425944T>C	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1475A>G	4.37:g.22425944T>C	ENSP00000334952:p.Asn492Ser		Somatic				GPR125_uc010ieo.1_Missense_Mutation_p.N366S|GPR125_uc003gqn.1_Missense_Mutation_p.N266S|GPR125_uc003gqo.2_Missense_Mutation_p.N492S	p.N492S	NM_145290	NP_660333	WXS	Illumina HiSeq	Unspecified	Q8IWK6	GP125_HUMAN			11	1740	-		Breast(46;0.198)	492			Extracellular (Potential).		Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	c.1475A>G	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.206720	0.79127	.	.	ENSG00000152990	ENST00000334304;ENST00000508133;ENST00000502482	T;T;T	0.49720	0.77;0.77;0.77	5.52	5.52	0.82312	.	0.042810	0.85682	D	0.000000	T	0.62196	0.2408	L	0.43152	1.355	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;0.996;0.993	D;D;D;P	0.97110	0.996;1.0;0.98;0.757	T	0.65290	-0.6204	10	0.87932	D	0	-22.5888	15.6388	0.76977	0.0:0.0:0.0:1.0	.	367;492;266;492	Q8IWK6-3;Q8IWK6-2;Q8IWK6-4;Q8IWK6	.;.;.;GP125_HUMAN	S	492;266;492	ENSP00000334952:N492S;ENSP00000422606:N266S;ENSP00000421006:N492S	ENSP00000334952:N492S	N	-	2	0	GPR125	22035042	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.478000	0.81082	2.101000	0.63845	0.459000	0.35465	AAC		0.458	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			10	178	0	0	0	0.006214	0	10	178				
ARAP2	116984	broad.mit.edu	37	4	36161127	36161127	+	Splice_Site	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:36161127C>A	ENST00000303965.4	-	14	2932	c.2443G>T	c.(2443-2445)Gct>Tct	p.A815S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	815					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.A815S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GCACATAGAGCCTGGTCATTA	0.393																																							uc003gsq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(2443-2445)GCT>TCT		ArfGAP with RhoGAP domain, ankyrin repeat and PH							57.0	58.0	57.0					4																	36161127		2203	4300	6503	SO:0001630	splice_region_variant	116984				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding	g.chr4:36161127C>A	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.2443-1G>T	4.37:g.36161127C>A			Somatic					p.A815S	NM_015230	NP_056045	WXS	Illumina HiSeq	Unspecified	Q8WZ64	ARAP2_HUMAN			14	2781	-			815					Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	c.2443G>T	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854676	0.91355	.	.	ENSG00000047365	ENST00000303965	T	0.09073	3.02	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.30823	0.0777	M	0.65498	2.005	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.00067	-1.2142	10	0.59425	D	0.04	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	815	Q8WZ64	ARAP2_HUMAN	S	815	ENSP00000302895:A815S	ENSP00000302895:A815S	A	-	1	0	ARAP2	35837522	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.190000	0.77755	2.894000	0.99253	0.591000	0.81541	GCT		0.393	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	Missense_Mutation	7	57	1	0	0.00198382	0.001984	0.00237684	7	57				
LRRC66	339977	broad.mit.edu	37	4	52862092	52862092	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:52862092C>A	ENST00000343457.3	-	4	1102	c.1096G>T	c.(1096-1098)Ggc>Tgc	p.G366C		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	366						integral component of membrane (GO:0016021)		p.G366C(2)		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TCTTTTTTGCCGGCAGCCTGC	0.592																																							uc003gzi.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1096-1098)GGC>TGC		leucine rich repeat containing 66							34.0	37.0	36.0					4																	52862092		1972	4158	6130	SO:0001583	missense	339977					integral to membrane		g.chr4:52862092C>A	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1096G>T	4.37:g.52862092C>A	ENSP00000341944:p.Gly366Cys		Somatic					p.G366C	NM_001024611	NP_001019782	WXS	Illumina HiSeq	Unspecified	Q68CR7	LRC66_HUMAN			4	1109	-			366						Missense_Mutation	SNP	ENST00000343457.3	37	c.1096G>T	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.391232	0.42410	.	.	ENSG00000188993	ENST00000343457	T	0.48201	0.82	4.42	-2.55	0.06288	.	1.683770	0.03113	N	0.162707	T	0.47469	0.1447	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	P	0.52881	0.712	T	0.43523	-0.9386	10	0.62326	D	0.03	-0.0036	1.6513	0.02772	0.1348:0.3635:0.1327:0.369	.	366	Q68CR7	LRC66_HUMAN	C	366	ENSP00000341944:G366C	ENSP00000341944:G366C	G	-	1	0	LRRC66	52556849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.838000	0.04372	-0.204000	0.10235	-0.373000	0.07131	GGC		0.592	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		3	37	1	0	0.004672	0.004672	0.00546022	3	37				
SPATA18	132671	broad.mit.edu	37	4	52948665	52948665	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:52948665A>T	ENST00000295213.4	+	10	1842	c.1468A>T	c.(1468-1470)Aga>Tga	p.R490*	SPATA18_ENST00000419395.2_Nonsense_Mutation_p.R458*	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	490					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.R490*(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGTCACCAGGAGAGGGGCTTT	0.453																																							uc003gzl.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|skin(2)	4						c.(1468-1470)AGA>TGA		spermatogenesis associated 18 homolog							142.0	131.0	135.0					4																	52948665		2203	4300	6503	SO:0001587	stop_gained	132671				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding	g.chr4:52948665A>T	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.1468A>T	4.37:g.52948665A>T	ENSP00000295213:p.Arg490*		Somatic				SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Nonsense_Mutation_p.R458*|SPATA18_uc003gzk.1_Nonsense_Mutation_p.R490*	p.R490*	NM_145263	NP_660306	WXS	Illumina HiSeq	Unspecified	Q8TC71	MIEAP_HUMAN	GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)		10	1746	+			490					B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Nonsense_Mutation	SNP	ENST00000295213.4	37	c.1468A>T	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	A	38	7.285276	0.98186	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	.	.	.	6.08	4.86	0.63082	.	0.045197	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.6688	11.5753	0.50858	0.8505:0.1495:0.0:0.0	.	.	.	.	X	490;458	.	ENSP00000295213:R490X	R	+	1	2	SPATA18	52643422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.228000	0.65310	1.073000	0.40885	0.533000	0.62120	AGA		0.453	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		8	138	0	0	0	0.006214	0	8	138				
EPHA5	2044	broad.mit.edu	37	4	66230911	66230911	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:66230911C>T	ENST00000273854.3	-	12	2660	c.2060G>A	c.(2059-2061)gGt>gAt	p.G687D	EPHA5_ENST00000432638.2_Missense_Mutation_p.G524D|EPHA5_ENST00000511294.1_Missense_Mutation_p.G688D|EPHA5_ENST00000354839.4_Missense_Mutation_p.G665D	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	687	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.G687D(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ACAAACTTCACCAAATTCACC	0.353										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2059-2061)GGT>GAT		ephrin receptor EphA5 isoform a precursor							102.0	108.0	106.0					4																	66230911		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66230911C>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2060G>A	4.37:g.66230911C>T	ENSP00000273854:p.Gly687Asp	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.G619D|EPHA5_uc003hcz.2_Missense_Mutation_p.G665D|EPHA5_uc011cah.1_Missense_Mutation_p.G688D|EPHA5_uc011cai.1_Missense_Mutation_p.G666D|EPHA5_uc003hda.2_Missense_Mutation_p.G688D	p.G687D	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			12	2253	-			687			ATP (By similarity).|Cytoplasmic (Potential).|Protein kinase.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2060G>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702159	0.88924	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	5.97	5.13	0.70059	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000036	D	0.94604	0.8261	H	0.99712	4.72	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96881	0.9646	10	0.87932	D	0	.	14.9432	0.71009	0.0:0.9319:0.0:0.0681	.	666;688;665;687	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	D	687;524;665;688	ENSP00000273854:G687D;ENSP00000389208:G524D;ENSP00000346899:G665D;ENSP00000427638:G688D	ENSP00000273854:G687D	G	-	2	0	EPHA5	65913506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	1.537000	0.49254	0.650000	0.86243	GGT		0.353	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		7	94	0	0	0	0.001984	0	7	94				
UGT2B27P	54569	broad.mit.edu	37	4	69885531	69885531	+	IGR	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:69885531G>A								UGT2A3 (68022 upstream) : UGT2B7 (31662 downstream)																							TACGTAGGAAGGAGGGAAAAT	0.408																																						Melanoma(133;755 1763 25578 26334 46021)	uc011cao.1		NA																	0				skin(3)|ovary(2)	5						c.(457-459)CCT>CTT		RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;							55.0	46.0	48.0					4																	69885531		692	1591	2283	SO:0001628	intergenic_variant	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69885531G>A																													4.37:g.69885531G>A			Somatic				UGT2B10_uc011can.1_Intron	p.P153L			WXS	Illumina HiSeq	Unspecified	P36537	UDB10_HUMAN			4	594	-			190						Missense_Mutation	SNP		37	c.458C>T																																																																																				0	0.408									6	136	0	0	0	0.001984	0	6	136				
ANK2	287	broad.mit.edu	37	4	114264221	114264221	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:114264221C>A	ENST00000357077.4	+	34	4224	c.4171C>A	c.(4171-4173)Cca>Aca	p.P1391T	ANK2_ENST00000510275.2_Missense_Mutation_p.P43T|ANK2_ENST00000506722.1_Missense_Mutation_p.P1382T|ANK2_ENST00000509550.1_Missense_Mutation_p.P567T|ANK2_ENST00000264366.6_Missense_Mutation_p.P1358T|ANK2_ENST00000394537.3_Missense_Mutation_p.P1391T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1391	UPA domain.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P1391T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAACTTGGTACCATTAACTAA	0.333																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(4171-4173)CCA>ACA		ankyrin 2 isoform 1							170.0	165.0	167.0					4																	114264221		2203	4299	6502	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114264221C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4171C>A	4.37:g.114264221C>A	ENSP00000349588:p.Pro1391Thr		Somatic				ANK2_uc003ibd.3_Missense_Mutation_p.P1382T|ANK2_uc003ibf.3_Missense_Mutation_p.P1391T|ANK2_uc011cgc.1_Missense_Mutation_p.P567T|ANK2_uc003ibg.3_Missense_Mutation_p.P386T|ANK2_uc003ibh.3_Missense_Mutation_p.P65T|ANK2_uc011cgb.1_Missense_Mutation_p.P1406T	p.P1391T	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	34	4271	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	1358					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.4171C>A	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.0|26.0	4.695388|4.695388	0.88830|0.88830	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275|ENST00000514960	T;T;T;T;T;T;T;T|.	0.27256|.	1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.000000|.	0.53938|.	D|.	0.000048|.	T|T	0.76321|0.76321	0.3971|0.3971	M|M	0.71871|0.71871	2.18|2.18	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.997;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.998;0.999;0.966;0.999;1.0;1.0;1.0|.	T|T	0.74951|0.74951	-0.3489|-0.3489	10|5	0.87932|.	D|.	0|.	.|.	19.3976|19.3976	0.94612|0.94612	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	567;1358;437;403;1391;1391;1382|.	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;ANK2_HUMAN;.;.;.;.;.|.	T|N	1304;1382;437;1406;1391;1391;1358;1382;567;43|403	ENSP00000421011:P1304T;ENSP00000421067:P1382T;ENSP00000424722:P1406T;ENSP00000378044:P1391T;ENSP00000349588:P1391T;ENSP00000264366:P1358T;ENSP00000426944:P567T;ENSP00000421023:P43T|.	ENSP00000264366:P1358T|.	P|T	+|+	1|2	0|0	ANK2|ANK2	114483670|114483670	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.936000|0.936000	0.57629|0.57629	7.818000|7.818000	0.86416|0.86416	2.575000|2.575000	0.86900|0.86900	0.650000|0.650000	0.86243|0.86243	CCA|ACC		0.333	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		9	87	1	0	7.48243e-07	0.006214	1.13127e-06	9	87				
ADAD1	132612	broad.mit.edu	37	4	123333934	123333934	+	Missense_Mutation	SNP	C	C	A	rs369880304		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:123333934C>A	ENST00000296513.2	+	10	1404	c.1219C>A	c.(1219-1221)Cag>Aag	p.Q407K	ADAD1_ENST00000388724.2_Missense_Mutation_p.Q396K|ADAD1_ENST00000388725.2_Missense_Mutation_p.Q389K	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	407	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.			Q -> R (in Ref. 1; BAC04125). {ECO:0000305}.	multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)	p.Q407K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TCATTTTATACAGCCAGTTTA	0.403																																							uc003ieo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1219-1221)CAG>AAG		adenosine deaminase domain containing 1							193.0	183.0	186.0					4																	123333934		2203	4300	6503	SO:0001583	missense	132612				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding	g.chr4:123333934C>A	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1219C>A	4.37:g.123333934C>A	ENSP00000296513:p.Gln407Lys		Somatic				ADAD1_uc003iep.2_Missense_Mutation_p.Q396K|ADAD1_uc003ieq.2_Missense_Mutation_p.Q389K	p.Q407K	NM_139243	NP_640336	WXS	Illumina HiSeq	Unspecified	Q96M93	ADAD1_HUMAN			10	1451	+			407	Q -> R (in Ref. 1; BAC04125).		A to I editase.		A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	37	c.1219C>A	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186502	0.57909	.	.	ENSG00000164113	ENST00000296513;ENST00000388724;ENST00000388725	D;D;D	0.93247	-3.19;-3.19;-3.19	5.57	5.57	0.84162	Adenosine deaminase/editase (3);	0.127023	0.51477	D	0.000087	D	0.92880	0.7735	L	0.47016	1.485	0.33512	D	0.591271	P;D	0.54047	0.723;0.964	B;P	0.49887	0.343;0.625	D	0.95070	0.8203	10	0.48119	T	0.1	-1.4572	16.0748	0.80962	0.0:0.8569:0.1431:0.0	.	396;407	Q96M93-2;Q96M93	.;ADAD1_HUMAN	K	407;396;389	ENSP00000296513:Q407K;ENSP00000373376:Q396K;ENSP00000373377:Q389K	ENSP00000296513:Q407K	Q	+	1	0	ADAD1	123553384	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.283000	0.58977	2.624000	0.88883	0.655000	0.94253	CAG		0.403	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243		14	153	1	0	5.01169e-05	0.00499	6.47273e-05	14	153				
PCDH10	57575	broad.mit.edu	37	4	134072013	134072013	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:134072013G>C	ENST00000264360.5	+	1	1544	c.718G>C	c.(718-720)Gtg>Ctg	p.V240L	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	240	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V240L(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CACCATCCGAGTGCTGGACTC	0.642																																							uc003iha.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(718-720)GTG>CTG		protocadherin 10 isoform 1 precursor							75.0	72.0	73.0					4																	134072013		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134072013G>C	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.718G>C	4.37:g.134072013G>C	ENSP00000264360:p.Val240Leu		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.V240L	p.V240L	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	1544	+			240			Extracellular (Potential).|Cadherin 2.		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.718G>C	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046848	0.75846	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.37235	1.21	4.45	4.45	0.53987	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.39687	N	0.001290	T	0.64951	0.2645	M	0.84948	2.725	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.83275	0.97;0.996	T	0.72849	-0.4168	10	0.87932	D	0	.	16.9352	0.86201	0.0:0.0:1.0:0.0	.	240;240	Q9P2E7;Q96SF0	PCD10_HUMAN;.	L	240	ENSP00000264360:V240L	ENSP00000264360:V240L	V	+	1	0	PCDH10	134291463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.427000	0.97472	2.289000	0.77006	0.556000	0.70494	GTG		0.642	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		8	73	0	0	0	0.004482	0	8	73				
GALNTL6	442117	broad.mit.edu	37	4	172735814	172735814	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:172735814G>A	ENST00000506823.1	+	2	740	c.83G>A	c.(82-84)tGg>tAg	p.W28*	GALNTL6_ENST00000511251.1_Nonsense_Mutation_p.W28*	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	28					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.W28*(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GTTGGTCTCTGGTCTCTGTAC	0.483																																							uc003isv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(82-84)TGG>TAG		N-acetylgalactosaminyltransferase-like 6							105.0	103.0	104.0					4																	172735814		2203	4300	6503	SO:0001587	stop_gained	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:172735814G>A		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.83G>A	4.37:g.172735814G>A	ENSP00000423313:p.Trp28*		Somatic					p.W28*	NM_001034845	NP_001030017	WXS	Illumina HiSeq	Unspecified	Q49A17	GLTL6_HUMAN			2	819	+			28			Helical; Signal-anchor for type II membrane protein; (Potential).		Q2L4S6	Nonsense_Mutation	SNP	ENST00000506823.1	37	c.83G>A	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	G	43	10.215078	0.99361	.	.	ENSG00000174473	ENST00000511251;ENST00000506823;ENST00000404275	.	.	.	5.9	5.9	0.94986	.	0.000000	0.37857	N	0.001905	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	19.2604	0.93966	0.0:0.0:1.0:0.0	.	.	.	.	X	28	.	ENSP00000385382:W28X	W	+	2	0	GALNTL6	172972389	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.583000	0.82559	2.793000	0.96121	0.563000	0.77884	TGG		0.483	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		4	43	0	0	0	0.000248	0	4	43				
TENM3	55714	broad.mit.edu	37	4	183652148	183652149	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr4:183652148_183652149CC>AA	ENST00000511685.1	+	16	2946_2947	c.2823_2824CC>AA	c.(2821-2826)acCCta>acAAta	p.L942I	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.L942I			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	942					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L942I(1)									TGATGGATACCCTAGTCATGAA	0.426																																							uc003ivd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2821-2826)ACCCTA>ACAATA		odz, odd Oz/ten-m homolog 3																																				SO:0001583	missense	55714				signal transduction	integral to membrane		g.chr4:183652148_183652149CC>AA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	Exception_encountered	4.37:g.183652148_183652149delinsAA	ENSP00000424226:p.Leu942Ile		Somatic				ODZ3_uc003ive.1_Missense_Mutation_p.L348I	p.L942I	NM_001080477	NP_001073946	WXS	Illumina HiSeq	Unspecified	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	15	2860_2861	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	942			Extracellular (Potential).		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	DNP	ENST00000511685.1	37	c.2823_2824CC>AA	CCDS47165.1																																																																																				0.426	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			7	62	0	0	0	0.004672	0	7	62				
ICE1	23379	broad.mit.edu	37	5	5462198	5462198	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:5462198G>A	ENST00000296564.7	+	13	2973	c.2751G>A	c.(2749-2751)gaG>gaA	p.E917E		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		917					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.E917E(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ACATCACGGAGGTGGCTGCTG	0.398																																							uc003jdm.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(2749-2751)GAG>GAA		hypothetical protein LOC23379							74.0	72.0	73.0					5																	5462198		1845	4112	5957	SO:0001819	synonymous_variant	23379							g.chr5:5462198G>A																												ENST00000296564.7:c.2751G>A	5.37:g.5462198G>A			Somatic					p.E917E	NM_015325	NP_056140	WXS	Illumina HiSeq	Unspecified	Q9Y2F5	K0947_HUMAN			13	2973	+			917					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	c.2751G>A	CCDS47187.1																																																																																				0.398	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			5	104	0	0	0	0.000602	0	5	104				
SEMA5A	9037	broad.mit.edu	37	5	9063002	9063002	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:9063002G>T	ENST00000382496.5	-	18	3180	c.2515C>A	c.(2515-2517)Cca>Aca	p.P839T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	839	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.P839T(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CACTTACCTGGGCAGGGCAAA	0.512																																							uc003jek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2515-2517)CCA>ACA		semaphorin 5A precursor							75.0	65.0	68.0					5																	9063002		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9063002G>T	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2515C>A	5.37:g.9063002G>T	ENSP00000371936:p.Pro839Thr		Somatic					p.P839T	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			18	3227	-			839			TSP type-1 5.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.2515C>A	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428477	0.83667	.	.	ENSG00000112902	ENST00000382496	T	0.62232	0.04	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.79598	0.4473	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76479	-0.2944	10	0.25751	T	0.34	.	17.2182	0.86950	0.0:0.0:1.0:0.0	.	839	Q13591	SEM5A_HUMAN	T	839	ENSP00000371936:P839T	ENSP00000371936:P839T	P	-	1	0	SEMA5A	9116002	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.550000	0.98110	2.659000	0.90383	0.655000	0.94253	CCA		0.512	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			22	65	1	0	1.85244e-09	0.00333	3.1368e-09	22	65				
PRDM9	56979	broad.mit.edu	37	5	23522490	23522490	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:23522490G>A	ENST00000296682.3	+	7	768	c.586G>A	c.(586-588)Gag>Aag	p.E196K		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	196					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.E196K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAGGTCAGCGAGCCGCAGGA	0.458										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(586-588)GAG>AAG		PR domain containing 9							137.0	148.0	145.0					5																	23522490		2009	4189	6198	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522490G>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.586G>A	5.37:g.23522490G>A	ENSP00000296682:p.Glu196Lys	HNSCC(3;0.000094)	Somatic					p.E196K	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			7	768	+			196					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.586G>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366779	0.41902	.	.	ENSG00000164256	ENST00000296682	T	0.43688	0.94	3.48	2.59	0.31030	SSXRD motif (1);	.	.	.	.	T	0.23572	0.0570	L	0.27053	0.805	0.29210	N	0.874615	P	0.36647	0.563	B	0.25140	0.058	T	0.18999	-1.0319	9	0.87932	D	0	-15.0531	5.8552	0.18716	0.1488:0.0:0.8512:0.0	.	196	Q9NQV7	PRDM9_HUMAN	K	196	ENSP00000296682:E196K	ENSP00000296682:E196K	E	+	1	0	PRDM9	23558247	0.983000	0.35010	0.999000	0.59377	0.804000	0.45430	2.289000	0.43523	1.901000	0.55032	0.597000	0.82753	GAG		0.458	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		32	221	0	0	0	0.004878	0	32	221				
RXFP3	51289	broad.mit.edu	37	5	33936931	33936931	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:33936931C>T	ENST00000330120.3	+	1	441	c.86C>T	c.(85-87)cCg>cTg	p.P29L		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	29					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.P29L(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						AGTCTGGTCCCGGACCTTCTG	0.632																																							uc003jic.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(85-87)CCG>CTG		relaxin/insulin-like family peptide receptor 3							77.0	84.0	82.0					5																	33936931		2203	4300	6503	SO:0001583	missense	51289					integral to plasma membrane	N-formyl peptide receptor activity	g.chr5:33936931C>T	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.86C>T	5.37:g.33936931C>T	ENSP00000328708:p.Pro29Leu		Somatic					p.P29L	NM_016568	NP_057652	WXS	Illumina HiSeq	Unspecified	Q9NSD7	RL3R1_HUMAN			1	443	+			29			Extracellular (Potential).		Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	c.86C>T	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.624101	0.46840	.	.	ENSG00000182631	ENST00000330120	T	0.73681	-0.77	5.43	4.51	0.55191	.	0.236200	0.27797	N	0.017820	T	0.59797	0.2220	N	0.24115	0.695	0.19575	N	0.999967	B	0.18968	0.032	B	0.10450	0.005	T	0.55685	-0.8102	10	0.87932	D	0	-29.9512	10.1294	0.42669	0.139:0.781:0.0:0.0799	.	29	Q9NSD7	RL3R1_HUMAN	L	29	ENSP00000328708:P29L	ENSP00000328708:P29L	P	+	2	0	RXFP3	33972688	0.224000	0.23674	0.820000	0.32676	0.607000	0.37147	0.913000	0.28611	2.704000	0.92352	0.655000	0.94253	CCG		0.632	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568		10	82	0	0	0	0.000978	0	10	82				
EGFLAM	133584	broad.mit.edu	37	5	38425138	38425138	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:38425138C>A	ENST00000354891.3	+	13	2100	c.1754C>A	c.(1753-1755)gCc>gAc	p.A585D	EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000322350.5_Missense_Mutation_p.A585D|EGFLAM_ENST00000336740.6_Missense_Mutation_p.A351D|EGFLAM_ENST00000397202.2_5'UTR	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	585	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.A585D(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GCAATCAAAGCCGACTCCTAC	0.473																																					Colon(62;485 1295 3347 17454)	Colon(62;485 1295 3347 17454)	uc003jlc.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(3)|skin(3)|ovary(1)	7						c.(1753-1755)GCC>GAC		EGF-like, fibronectin type III and laminin G							183.0	173.0	176.0					5																	38425138		2203	4300	6503	SO:0001583	missense	133584					cell junction|proteinaceous extracellular matrix|synapse		g.chr5:38425138C>A	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1754C>A	5.37:g.38425138C>A	ENSP00000346964:p.Ala585Asp		Somatic				EGFLAM_uc003jlb.1_Missense_Mutation_p.A585D|EGFLAM_uc003jle.1_Missense_Mutation_p.A351D|EGFLAM_uc003jlf.1_5'UTR	p.A585D	NM_152403	NP_689616	WXS	Illumina HiSeq	Unspecified	Q63HQ2	EGFLA_HUMAN			13	2078	+	all_lung(31;0.000385)		585			EGF-like 2.		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	c.1754C>A	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215237	0.95104	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	D;D;D	0.92048	-2.96;-2.96;-2.96	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase, subgroup (1);EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93265	0.7854	N	0.20445	0.575	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.34	D;D;B	0.91635	0.995;0.999;0.234	D	0.93580	0.6912	10	0.52906	T	0.07	-11.7422	20.2983	0.98569	0.0:1.0:0.0:0.0	.	351;585;585	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	D	585;585;351;351	ENSP00000346964:A585D;ENSP00000313084:A585D;ENSP00000337607:A351D	ENSP00000313084:A585D	A	+	2	0	EGFLAM	38460895	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	7.081000	0.76844	2.802000	0.96397	0.655000	0.94253	GCC		0.473	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403		59	121	1	0	9.53978e-28	0.00361	1.86393e-27	59	121				
ZNF131	7690	broad.mit.edu	37	5	43161516	43161516	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:43161516G>T	ENST00000399534.1	+	5	581	c.537G>T	c.(535-537)gtG>gtT	p.V179V	ZNF131_ENST00000505606.2_Silent_p.V179V|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000509634.1_Silent_p.V179V|ZNF131_ENST00000306938.4_Silent_p.V179V|ZNF131_ENST00000509156.1_Silent_p.V179V			P52739	ZN131_HUMAN	zinc finger protein 131	179					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V179V(1)		breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						CCATTGAAGTGGAAGATGAAG	0.443																																							uc011cpw.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(535-537)GTG>GTT		zinc finger protein 131							102.0	92.0	95.0					5																	43161516		1941	4138	6079	SO:0001819	synonymous_variant	7690					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr5:43161516G>T	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.537G>T	5.37:g.43161516G>T			Somatic				ZNF131_uc010ivl.1_Silent_p.V179V|ZNF131_uc003jnj.3_5'UTR|ZNF131_uc003jnk.2_Silent_p.V179V|ZNF131_uc003jnn.3_5'UTR|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	p.V179V	NM_003432	NP_003423	WXS	Illumina HiSeq	Unspecified	P52739	ZN131_HUMAN			5	573	+			179					B4DRL3|Q6PIF0	Silent	SNP	ENST00000399534.1	37	c.537G>T																																																																																					0.443	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432		5	99	1	0	3.59834e-05	0.001168	4.72747e-05	5	99				
HMGCR	3156	broad.mit.edu	37	5	74655898	74655898	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:74655898G>T	ENST00000287936.4	+	19	2702	c.2546G>T	c.(2545-2547)gGg>gTg	p.G849V	HMGCR_ENST00000511206.1_Missense_Mutation_p.G849V|HMGCR_ENST00000343975.5_Missense_Mutation_p.G796V	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	849	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)	p.G849V(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GTAATGGCTGGGGAATTGTCA	0.478																																							uc003kdp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2545-2547)GGG>GTG		3-hydroxy-3-methylglutaryl-Coenzyme A reductase	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)						128.0	126.0	127.0					5																	74655898		2203	4300	6503	SO:0001583	missense	3156				cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding	g.chr5:74655898G>T		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.2546G>T	5.37:g.74655898G>T	ENSP00000287936:p.Gly849Val		Somatic				HMGCR_uc011cst.1_Missense_Mutation_p.G869V|HMGCR_uc003kdq.2_Missense_Mutation_p.G796V|HMGCR_uc010izo.2_Missense_Mutation_p.G119V|HMGCR_uc010izp.2_Missense_Mutation_p.G72V	p.G849V	NM_000859	NP_000850	WXS	Illumina HiSeq	Unspecified	P04035	HMDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	19	2702	+		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)	849			Catalytic.		B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	c.2546G>T	CCDS4027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.638202|4.638202	0.87760|0.87760	.|.	.|.	ENSG00000113161|ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975;ENST00000429286;ENST00000511986|ENST00000509085	T;T;T;T|T	0.52526|0.52754	0.67;0.67;0.67;0.66|0.65	5.7|5.7	5.7|5.7	0.88788|0.88788	Hydroxymethylglutaryl-CoA reductase, class I/II, catalytic domain (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.81432|0.81432	0.4821|0.4821	H|H	0.97635|0.97635	4.045|4.045	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;1.0;1.0|.	D|D	0.87657|0.87657	0.2532|0.2532	10|8	0.87932|0.87932	D|D	0|0	-16.8697|-16.8697	19.8383|19.8383	0.96670|0.96670	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	849;780;226;796;849|.	B2R649;B7Z3Y9;B4DSB1;P04035-2;P04035|.	.;.;.;.;HMDH_HUMAN|.	V|W	849;780;849;796;226;76|126	ENSP00000426745:G849V;ENSP00000287936:G849V;ENSP00000340816:G796V;ENSP00000420871:G76V|ENSP00000421378:G126W	ENSP00000287936:G849V|ENSP00000421378:G126W	G|G	+|+	2|1	0|0	HMGCR|HMGCR	74691654|74691654	1.000000|1.000000	0.71417|0.71417	0.973000|0.973000	0.42090|0.42090	0.672000|0.672000	0.39443|0.39443	9.869000|9.869000	0.99810|0.99810	2.683000|2.683000	0.91414|0.91414	0.650000|0.650000	0.86243|0.86243	GGG|GGG		0.478	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2			11	112	1	0	3.86212e-05	0.008291	5.02207e-05	11	112				
AGGF1	55109	broad.mit.edu	37	5	76342310	76342310	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:76342310A>G	ENST00000312916.7	+	6	1391	c.1009A>G	c.(1009-1011)Act>Gct	p.T337A		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	337					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)	p.T337A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		CACTGTTCCAACTAGTGGAAA	0.363																																							uc003ket.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1009-1011)ACT>GCT		angiogenic factor VG5Q							111.0	120.0	117.0					5																	76342310		2203	4300	6503	SO:0001583	missense	55109				angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding	g.chr5:76342310A>G	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.1009A>G	5.37:g.76342310A>G	ENSP00000316109:p.Thr337Ala		Somatic					p.T337A	NM_018046	NP_060516	WXS	Illumina HiSeq	Unspecified	Q8N302	AGGF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)	6	1369	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)	337					O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	37	c.1009A>G	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.925383	0.00493	.	.	ENSG00000164252	ENST00000312916	T	0.35605	1.3	4.76	2.91	0.33838	.	1.486030	0.04156	N	0.322122	T	0.17831	0.0428	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.25537	-1.0129	10	0.08837	T	0.75	-11.9932	4.1611	0.10284	0.2514:0.1886:0.56:0.0	.	337	Q8N302	AGGF1_HUMAN	A	337	ENSP00000316109:T337A	ENSP00000316109:T337A	T	+	1	0	AGGF1	76378066	0.000000	0.05858	0.530000	0.27963	0.034000	0.12701	0.084000	0.14891	0.405000	0.25532	-0.202000	0.12741	ACT		0.363	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046		43	146	0	0	0	0.002222	0	43	146				
RASGRF2	5924	broad.mit.edu	37	5	80409612	80409612	+	Silent	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:80409612T>C	ENST00000265080.4	+	15	2410	c.2343T>C	c.(2341-2343)acT>acC	p.T781T	CTD-2193P3.2_ENST00000508993.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	781					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T781T(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CACCACACACTGGTCAGATAC	0.552																																							uc003kha.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(2341-2343)ACT>ACC		Ras protein-specific guanine							83.0	84.0	84.0					5																	80409612		2203	4300	6503	SO:0001819	synonymous_variant	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80409612T>C	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2343T>C	5.37:g.80409612T>C			Somatic				RASGRF2_uc011ctn.1_RNA	p.T781T	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	15	2343	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	781					B9EG89|Q9UK56	Silent	SNP	ENST00000265080.4	37	c.2343T>C	CCDS4052.1																																																																																				0.552	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		6	62	0	0	0	0.001984	0	6	62				
LOX	4015	broad.mit.edu	37	5	121409740	121409740	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:121409740G>T	ENST00000231004.4	-	4	1302	c.1003C>A	c.(1003-1005)Cac>Aac	p.H335N	LOX_ENST00000513319.1_5'UTR|SRFBP1_ENST00000504881.1_Intron	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	335	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)	p.H335N(1)		endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		AATCGCCTGTGGTAGCCATAG	0.498																																							uc003ksu.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1003-1005)CAC>AAC		lysyl oxidase preproprotein							194.0	180.0	185.0					5																	121409740		2203	4300	6503	SO:0001583	missense	4015				protein modification process	extracellular space	copper ion binding|protein-lysine 6-oxidase activity	g.chr5:121409740G>T		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.1003C>A	5.37:g.121409740G>T	ENSP00000231004:p.His335Asn		Somatic				LOX_uc010jcp.2_Missense_Mutation_p.H38N|LOX_uc010jcq.2_Missense_Mutation_p.H38N|LOX_uc011cwk.1_Missense_Mutation_p.H105N|LOX_uc010jcr.2_Missense_Mutation_p.H38N	p.H335N	NM_002317	NP_002308	WXS	Illumina HiSeq	Unspecified	P28300	LYOX_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)	4	1378	-		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	335			Lysyl-oxidase like.		B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	c.1003C>A	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629355	0.46944	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.29397	1.57	5.98	3.98	0.46160	.	0.101533	0.64402	D	0.000001	T	0.26011	0.0634	L	0.43923	1.385	0.35674	D	0.813523	B	0.17038	0.02	B	0.32090	0.14	T	0.29640	-1.0005	10	0.54805	T	0.06	.	4.2273	0.10587	0.4375:0.0:0.5625:0.0	.	335	P28300	LYOX_HUMAN	N	335;295	ENSP00000231004:H335N	ENSP00000231004:H335N	H	-	1	0	LOX	121437639	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.489000	0.66875	1.540000	0.49301	0.650000	0.86243	CAC		0.498	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2			24	254	1	0	3.28513e-13	0.003954	6.01747e-13	24	254				
PCDHA7	56141	broad.mit.edu	37	5	140215057	140215057	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:140215057C>A	ENST00000525929.1	+	1	1089	c.1089C>A	c.(1087-1089)gcC>gcA	p.A363A	PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000378125.3_Silent_p.A363A|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	363	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A363A(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAGGACGCCCAACCAGGTA	0.507																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(1087-1089)GCC>GCA		protocadherin alpha 7 isoform 1 precursor							166.0	152.0	157.0					5																	140215057		2203	4300	6503	SO:0001819	synonymous_variant	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215057C>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1089C>A	5.37:g.140215057C>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Silent_p.A363A	p.A363A	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1089	+			363			Cadherin 4.|Extracellular (Potential).		O75282	Silent	SNP	ENST00000525929.1	37	c.1089C>A	CCDS54918.1																																																																																				0.507	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		8	170	1	0	0.00448238	0.004482	0.00528727	8	170				
PCDHB14	56122	broad.mit.edu	37	5	140604624	140604625	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:140604624_140604625TC>AA	ENST00000239449.4	+	1	1547_1548	c.1547_1548TC>AA	c.(1546-1548)cTC>cAA	p.L516Q	PCDHB14_ENST00000515856.2_Missense_Mutation_p.L363Q	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	516	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L516Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTTGCCCTCAGGTCGCTGG	0.678																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1546-1548)CTC>CAA		protocadherin beta 14 precursor																																				SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140604624_140604625TC>AA	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	Exception_encountered	5.37:g.140604624_140604625delinsAA	ENSP00000239449:p.Leu516Gln		Somatic				PCDHB14_uc011dal.1_Missense_Mutation_p.L363Q	p.L516Q	NM_018934	NP_061757	WXS	Illumina HiSeq	Unspecified	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1547_1548	+			516			Extracellular (Potential).|Cadherin 5.		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	DNP	ENST00000239449.4	37	c.1547_1548TC>AA	CCDS4256.1																																																																																				0.678	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		10	129	0	0	0	0.004672	0	10	129				
PCDHGA1	56114	broad.mit.edu	37	5	140711999	140711999	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:140711999A>T	ENST00000517417.1	+	1	1748	c.1748A>T	c.(1747-1749)gAg>gTg	p.E583V	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.E583V	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	583	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E583V(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCCGCAGAGCCCGGCTAC	0.672																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(1747-1749)GAG>GTG		protocadherin gamma subfamily A, 1 isoform 1							60.0	72.0	68.0					5																	140711999		2202	4300	6502	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711999A>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1748A>T	5.37:g.140711999A>T	ENSP00000431083:p.Glu583Val		Somatic				PCDHGA1_uc011dan.1_Missense_Mutation_p.E583V	p.E583V	NM_018912	NP_061735	WXS	Illumina HiSeq	Unspecified	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1748	+			583			Extracellular (Potential).|Cadherin 6.		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.1748A>T	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177969	0.38413	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.51574	0.7;0.7	4.05	4.05	0.47172	Cadherin (3);Cadherin-like (1);	0.000000	0.49916	D	0.000137	T	0.59582	0.2204	L	0.46819	1.47	0.25112	N	0.990707	D;D	0.71674	0.997;0.998	D;D	0.74674	0.972;0.984	T	0.52771	-0.8531	10	0.87932	D	0	.	12.4237	0.55534	1.0:0.0:0.0:0.0	.	583;583	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	V	583	ENSP00000431083:E583V;ENSP00000367345:E583V	ENSP00000367345:E583V	E	+	2	0	PCDHGA1	140692183	0.379000	0.25123	0.936000	0.37596	0.136000	0.21042	2.483000	0.45233	1.831000	0.53308	0.528000	0.53228	GAG		0.672	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		11	120	0	0	0	0.000978	0	11	120				
PCDHGA8	9708	broad.mit.edu	37	5	140774290	140774290	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:140774290C>A	ENST00000398604.2	+	1	1910	c.1910C>A	c.(1909-1911)gCg>gAg	p.A637E	PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A637E(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAGAGATGCGCTCAAGCAG	0.682																																							uc003lkd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1909-1911)GCG>GAG		protocadherin gamma subfamily A, 8 isoform 1							29.0	34.0	32.0					5																	140774290		2189	4276	6465	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140774290C>A	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1910C>A	5.37:g.140774290C>A	ENSP00000381605:p.Ala637Glu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A637E	p.A637E	NM_032088	NP_114477	WXS	Illumina HiSeq	Unspecified	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2808	+			637			Extracellular (Potential).|Cadherin 6.		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.1910C>A	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	15.06	2.719727	0.48728	.	.	ENSG00000253767	ENST00000398604	T	0.49432	0.78	5.02	1.22	0.21188	Cadherin (4);Cadherin-like (1);	0.000000	0.31010	U	0.008440	T	0.47930	0.1472	L	0.45581	1.43	0.09310	N	1	P;P	0.42871	0.792;0.753	P;B	0.50490	0.642;0.38	T	0.41052	-0.9530	10	0.87932	D	0	.	8.8079	0.34950	0.0:0.628:0.0:0.372	.	637;637	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	E	637	ENSP00000381605:A637E	ENSP00000381605:A637E	A	+	2	0	PCDHGA8	140754474	0.000000	0.05858	0.003000	0.11579	0.993000	0.82548	-0.231000	0.09069	0.192000	0.20272	0.650000	0.86243	GCG		0.682	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		6	38	1	0	0.00116845	0.001168	0.00142685	6	38				
PCDHGA8	9708	broad.mit.edu	37	5	140774680	140774680	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:140774680A>C	ENST00000398604.2	+	1	2300	c.2300A>C	c.(2299-2301)cAc>cCc	p.H767P	PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	767					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H767P(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGAAGAGTCACCTGATCTTT	0.507																																							uc003lkd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2299-2301)CAC>CCC		protocadherin gamma subfamily A, 8 isoform 1							84.0	89.0	87.0					5																	140774680		2199	4299	6498	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140774680A>C	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.2300A>C	5.37:g.140774680A>C	ENSP00000381605:p.His767Pro		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.H767P	p.H767P	NM_032088	NP_114477	WXS	Illumina HiSeq	Unspecified	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	3198	+			767			Cytoplasmic (Potential).		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.2300A>C	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	10.83	1.461390	0.26248	.	.	ENSG00000253767	ENST00000398604	T	0.46063	0.88	4.5	4.5	0.54988	.	0.297289	0.17950	U	0.156545	T	0.57636	0.2067	M	0.93283	3.4	0.32104	N	0.590151	B;B	0.26547	0.024;0.152	B;B	0.31290	0.127;0.085	T	0.69281	-0.5186	10	0.59425	D	0.04	.	13.676	0.62454	1.0:0.0:0.0:0.0	.	767;767	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	P	767	ENSP00000381605:H767P	ENSP00000381605:H767P	H	+	2	0	PCDHGA8	140754864	0.975000	0.34042	0.270000	0.24601	0.118000	0.20060	7.929000	0.87595	1.905000	0.55150	0.533000	0.62120	CAC		0.507	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		16	90	0	0	0	0.006122	0	16	90				
RBM27	54439	broad.mit.edu	37	5	145665588	145665588	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:145665588A>G	ENST00000265271.5	+	21	3344	c.3178A>G	c.(3178-3180)Aga>Gga	p.R1060G	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	1060					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R1060G(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCATGGCGAAGATGAAATCT	0.308																																							uc003lnz.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|pancreas(1)	3						c.(3178-3180)AGA>GGA		RNA binding motif protein 27							114.0	99.0	103.0					5																	145665588		1568	3582	5150	SO:0001583	missense	54439				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr5:145665588A>G	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.3178A>G	5.37:g.145665588A>G	ENSP00000265271:p.Arg1060Gly		Somatic					p.R1060G	NM_018989	NP_061862	WXS	Illumina HiSeq	Unspecified	Q9P2N5	RBM27_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		21	3344	+			1060					Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	c.3178A>G	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244284	0.59103	.	.	ENSG00000091009	ENST00000265271	T	0.80653	-1.4	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.88847	0.6548	M	0.74467	2.265	0.58432	D	0.999998	D	0.57899	0.981	D	0.67231	0.95	D	0.90207	0.4261	10	0.87932	D	0	.	15.6228	0.76820	1.0:0.0:0.0:0.0	.	1060	Q9P2N5	RBM27_HUMAN	G	1060	ENSP00000265271:R1060G	ENSP00000265271:R1060G	R	+	1	2	RBM27	145645781	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.314000	0.65804	2.082000	0.62665	0.397000	0.26171	AGA		0.308	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128		5	68	0	0	0	0.000602	0	5	68				
OR2J2	26707	broad.mit.edu	37	6	29141761	29141761	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:29141761G>T	ENST00000377167.2	+	1	451	c.349G>T	c.(349-351)Gtg>Ttg	p.V117L		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V117L(1)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						TGTCCTACTGGTGGTGATGTC	0.488																																							uc011dlm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(349-351)GTG>TTG		olfactory receptor, family 2, subfamily J,							289.0	271.0	277.0					6																	29141761		2078	4201	6279	SO:0001583	missense	26707				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29141761G>T		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.349G>T	6.37:g.29141761G>T	ENSP00000366372:p.Val117Leu		Somatic					p.V117L	NM_030905	NP_112167	WXS	Illumina HiSeq	Unspecified	O76002	OR2J2_HUMAN			1	451	+			117			Helical; Name=3; (Potential).		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	c.349G>T	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	G	3.428	-0.116630	0.06838	.	.	ENSG00000204700	ENST00000377167	T	0.01335	5.0	2.3	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00608	0.0020	L	0.46614	1.455	0.09310	N	1	B	0.19073	0.033	B	0.19946	0.027	T	0.45175	-0.9279	9	0.66056	D	0.02	.	6.2142	0.20646	0.289:0.0:0.711:0.0	.	117	O76002	OR2J2_HUMAN	L	117	ENSP00000366372:V117L	ENSP00000366372:V117L	V	+	1	0	OR2J2	29249740	0.000000	0.05858	0.878000	0.34440	0.280000	0.26924	-0.007000	0.12810	0.276000	0.22118	0.205000	0.17691	GTG		0.488	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			71	366	1	0	4.29146e-36	0.00361	8.51586e-36	71	366				
HLA-DQA2	3118	broad.mit.edu	37	6	32712989	32712989	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:32712989G>A	ENST00000374940.3	+	2	238	c.136G>A	c.(136-138)Ggc>Agc	p.G46S		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	46	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)	p.G46S(1)		endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	CGGTCCCTCTGGCCAGTACAC	0.498																																							uc003obx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)GGC>AGC		major histocompatibility complex, class II, DQ	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						199.0	194.0	195.0					6																	32712989		1511	2709	4220	SO:0001583	missense	3118				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity	g.chr6:32712989G>A		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.136G>A	6.37:g.32712989G>A	ENSP00000364076:p.Gly46Ser		Somatic					p.G46S	NM_020056	NP_064440	WXS	Illumina HiSeq	Unspecified	P01906	DQA2_HUMAN			2	194	+			46			Extracellular (Potential).|Alpha-1.		A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	ENST00000374940.3	37	c.136G>A	CCDS4753.1	.	.	.	.	.	.	.	.	.	.	.	13.41	2.229408	0.39399	.	.	ENSG00000237541	ENST00000374940	T	0.01005	5.45	3.2	3.2	0.36748	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	0.209202	0.41097	U	0.000941	T	0.01940	0.0061	M	0.87269	2.87	0.19300	N	0.999976	D	0.60160	0.987	P	0.57911	0.829	T	0.23762	-1.0179	10	0.87932	D	0	.	10.0095	0.41977	0.0:0.0:1.0:0.0	.	46	P01906	DQA2_HUMAN	S	46	ENSP00000364076:G46S	ENSP00000364076:G46S	G	+	1	0	HLA-DQA2	32820967	0.980000	0.34600	0.117000	0.21633	0.002000	0.02628	3.993000	0.56987	1.773000	0.52216	0.390000	0.25778	GGC		0.498	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056		27	140	0	0	0	0.00632	0	27	140				
DNAH8	1769	broad.mit.edu	37	6	38818065	38818065	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:38818065A>T	ENST00000359357.3	+	36	4841	c.4587A>T	c.(4585-4587)atA>atT	p.I1529I	DNAH8_ENST00000449981.2_Silent_p.I1746I|DNAH8_ENST00000441566.1_Silent_p.I1529I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1529					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I1529I(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGTCTTGGATAAAAATAATGC	0.363																																							uc003ooe.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(4585-4587)ATA>ATT		dynein, axonemal, heavy polypeptide 8							113.0	111.0	112.0					6																	38818065		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38818065A>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4587A>T	6.37:g.38818065A>T			Somatic					p.I1529I	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					36	5187	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.4587A>T																																																																																					0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		15	73	0	0	0	0.004007	0	15	73				
FRS3	10817	broad.mit.edu	37	6	41740639	41740639	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:41740639C>A	ENST00000373018.3	-	5	563	c.312G>T	c.(310-312)ctG>ctT	p.L104L	FRS3_ENST00000259748.2_Silent_p.L104L	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	104	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)	p.L104L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCACTGCATCAGATCCTGAA	0.527																																							uc003orc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(310-312)CTG>CTT		fibroblast growth factor receptor substrate 3							119.0	114.0	116.0					6																	41740639		2203	4300	6503	SO:0001819	synonymous_variant	10817				fibroblast growth factor receptor signaling pathway	plasma membrane	fibroblast growth factor receptor binding|insulin receptor binding	g.chr6:41740639C>A	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.312G>T	6.37:g.41740639C>A			Somatic					p.L104L	NM_006653	NP_006644	WXS	Illumina HiSeq	Unspecified	O43559	FRS3_HUMAN	Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		5	556	-	Ovarian(28;0.0355)|Colorectal(47;0.121)		104			IRS-type PTB.		Q5T3D5	Silent	SNP	ENST00000373018.3	37	c.312G>T	CCDS4860.1																																																																																				0.527	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653		5	76	1	0	1.23904e-05	0.000602	1.71041e-05	5	76				
PKHD1	5314	broad.mit.edu	37	6	51920529	51920529	+	Splice_Site	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:51920529T>C	ENST00000371117.3	-	19	1969		c.e19-2		PKHD1_ENST00000340994.4_Splice_Site	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.?(2)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTTCTGGGCCTGGATGCAGTT	0.483																																							uc003pah.1		NA																	2	Unknown(2)		lung(2)	lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.e19-1		fibrocystin isoform 1							48.0	48.0	48.0					6																	51920529		2203	4300	6503	SO:0001630	splice_region_variant	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51920529T>C	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1694-2A>G	6.37:g.51920529T>C			Somatic				PKHD1_uc003pai.2_Splice_Site_p.G565_splice	p.G565_splice	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			19	1970	-	Lung NSC(77;0.0605)							Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Splice_Site	SNP	ENST00000371117.3	37	c.1694_splice	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269524	0.40095	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1077	0.48212	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKHD1	52028488	1.000000	0.71417	0.608000	0.28969	0.025000	0.11179	3.387000	0.52501	2.198000	0.70561	0.482000	0.46254	.		0.483	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	Intron	4	25	0	0	0	0.000248	0	4	25				
BAI3	577	broad.mit.edu	37	6	69349092	69349092	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:69349092G>T	ENST00000370598.1	+	3	1346	c.525G>T	c.(523-525)ttG>ttT	p.L175F		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	175					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L175F(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GTACTTGGTTGGAGAGCTGCT	0.423																																							uc003pev.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(523-525)TTG>TTT		brain-specific angiogenesis inhibitor 3							75.0	76.0	76.0					6																	69349092		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69349092G>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.525G>T	6.37:g.69349092G>T	ENSP00000359630:p.Leu175Phe		Somatic				BAI3_uc010kak.2_Missense_Mutation_p.L175F	p.L175F	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			3	973	+		all_lung(197;0.212)	175			Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.525G>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471624	0.43942	.	.	ENSG00000135298	ENST00000370598	T	0.23754	1.89	5.23	4.35	0.52113	.	0.000000	0.53938	D	0.000059	T	0.25457	0.0619	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.04360	-1.0957	10	0.56958	D	0.05	.	10.6824	0.45821	0.1492:0.0:0.8508:0.0	.	175	O60242	BAI3_HUMAN	F	175	ENSP00000359630:L175F	ENSP00000359630:L175F	L	+	3	2	BAI3	69405813	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.584000	0.60971	1.316000	0.45131	0.655000	0.94253	TTG		0.423	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			14	82	1	0	0.00316338	0.003163	0.0037664	14	82				
GPRC6A	222545	broad.mit.edu	37	6	117127972	117127972	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:117127972C>G	ENST00000310357.3	-	3	917	c.896G>C	c.(895-897)tGg>tCg	p.W299S	GPRC6A_ENST00000530250.1_Intron|GPRC6A_ENST00000368549.3_Missense_Mutation_p.W299S	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	299					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W299S(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		ACTAGCAATCCACATCTTATT	0.353																																							uc003pxj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(895-897)TGG>TCG		G protein-coupled receptor, family C, group 6,							104.0	104.0	104.0					6																	117127972		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117127972C>G	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.896G>C	6.37:g.117127972C>G	ENSP00000309493:p.Trp299Ser		Somatic				GPRC6A_uc003pxk.1_Intron|GPRC6A_uc003pxl.1_Missense_Mutation_p.W299S	p.W299S	NM_148963	NP_683766	WXS	Illumina HiSeq	Unspecified	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	3	918	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	299			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.896G>C	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.726743	0.69074	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.85484	-1.99;-1.99	6.16	6.16	0.99307	Extracellular ligand-binding receptor (1);	0.000000	0.49916	D	0.000132	D	0.93993	0.8076	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93771	0.7075	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	299;299	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	S	299	ENSP00000309493:W299S;ENSP00000357537:W299S	ENSP00000309493:W299S	W	-	2	0	GPRC6A	117234665	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	5.821000	0.69257	2.937000	0.99478	0.650000	0.86243	TGG		0.353	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			5	73	0	0	0	0.000602	0	5	73				
TAAR8	83551	broad.mit.edu	37	6	132874369	132874369	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:132874369G>T	ENST00000275200.1	+	1	538	c.538G>T	c.(538-540)Gta>Tta	p.V180L		NM_053278.1	NP_444508.1	Q969N4	TAAR8_HUMAN	trace amine associated receptor 8	180					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.V180L(1)		endometrium(3)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)		GGAGGAATTAGTAAGTGCTCT	0.453																																							uc011ecj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(538-540)GTA>TTA		trace amine associated receptor 8							280.0	277.0	278.0					6																	132874369		2203	4300	6503	SO:0001583	missense	83551					plasma membrane	G-protein coupled receptor activity	g.chr6:132874369G>T	AF380193	CCDS5154.1	6q23.2	2014-05-14	2005-02-23	2005-02-24	ENSG00000146385	ENSG00000146385		"""GPCR / Class A : Trace amine associated receptors"""	14964	protein-coding gene	gene with protein product		606927	"""trace amine receptor 5"""	GPR102, TRAR5		11574155, 15718104	Standard	NM_053278		Approved	TA5, TAR5	uc011ecj.2	Q969N4	OTTHUMG00000015586	ENST00000275200.1:c.538G>T	6.37:g.132874369G>T	ENSP00000275200:p.Val180Leu		Somatic					p.V180L	NM_053278	NP_444508	WXS	Illumina HiSeq	Unspecified	Q969N4	TAAR8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)	1	538	+	Breast(56;0.112)		180			Extracellular (Potential).		Q5VUQ0	Missense_Mutation	SNP	ENST00000275200.1	37	c.538G>T	CCDS5154.1	.	.	.	.	.	.	.	.	.	.	G	6.713	0.500332	0.12762	.	.	ENSG00000146385	ENST00000275200	T	0.37235	1.21	4.72	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.108090	0.37095	N	0.002255	T	0.11196	0.0273	M	0.62088	1.915	0.09310	N	1	B	0.06786	0.001	B	0.15484	0.013	T	0.34054	-0.9844	10	0.10111	T	0.7	-11.9076	5.8003	0.18410	0.1422:0.0:0.5788:0.279	.	180	Q969N4	TAAR8_HUMAN	L	180	ENSP00000275200:V180L	ENSP00000275200:V180L	V	+	1	0	TAAR8	132916062	0.000000	0.05858	0.015000	0.15790	0.906000	0.53458	0.493000	0.22451	0.659000	0.30945	0.655000	0.94253	GTA		0.453	TAAR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042262.1	NM_053278		51	227	1	0	4.78724e-31	0.00361	9.45046e-31	51	227				
BCLAF1	9774	broad.mit.edu	37	6	136599712	136599712	+	Missense_Mutation	SNP	T	T	C	rs377684031		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:136599712T>C	ENST00000531224.1	-	4	559	c.307A>G	c.(307-309)Agg>Ggg	p.R103G	BCLAF1_ENST00000527536.1_Missense_Mutation_p.R103G|BCLAF1_ENST00000530767.1_Missense_Mutation_p.R103G|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R101G|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R101G|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R101G	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	103					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R103G(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTAGGACTCCTAGAGTGCCTT	0.473																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(307-309)AGG>GGG		BCL2-associated transcription factor 1 isoform							147.0	145.0	145.0					6																	136599712		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599712T>C	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.307A>G	6.37:g.136599712T>C	ENSP00000435210:p.Arg103Gly		Somatic				BCLAF1_uc003qgw.1_Missense_Mutation_p.R103G|BCLAF1_uc003qgy.1_Missense_Mutation_p.R101G|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R101G	p.R103G	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	560	-	Colorectal(23;0.24)		103					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.307A>G	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369843	0.24771	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14640	2.9;2.9;2.9;2.49;2.9;2.9;2.71	5.21	2.6	0.31112	.	0.000000	0.64402	D	0.000007	T	0.15219	0.0367	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.57899	0.981;0.981;0.981;0.981	D;D;D;D	0.66351	0.943;0.943;0.943;0.943	T	0.01440	-1.1354	10	0.52906	T	0.07	-8.1884	12.9454	0.58369	0.0:0.0:0.4561:0.5439	.	101;101;103;103	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	G	103;101;103;103;101;101;103	ENSP00000435210:R103G;ENSP00000229446:R101G;ENSP00000435441:R103G;ENSP00000436501:R103G;ENSP00000434826:R101G;ENSP00000376159:R101G;ENSP00000431734:R103G	ENSP00000229446:R101G	R	-	1	2	BCLAF1	136641405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.521000	0.35910	0.902000	0.36520	0.455000	0.32223	AGG		0.473	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		14	259	0	0	0	0.003163	0	14	259				
MAP3K5	4217	broad.mit.edu	37	6	137018358	137018358	+	Splice_Site	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:137018358T>A	ENST00000359015.4	-	5	1334	c.974A>T	c.(973-975)cAg>cTg	p.Q325L		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	325					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.Q325L(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TCTTCTCACCTGGATATCTCT	0.393																																							uc003qhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(973-975)CAG>CTG		mitogen-activated protein kinase kinase kinase							69.0	74.0	72.0					6																	137018358		2202	4300	6502	SO:0001630	splice_region_variant	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:137018358T>A	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.975+1A>T	6.37:g.137018358T>A			Somatic				MAP3K5_uc011edk.1_Missense_Mutation_p.Q170L|MAP3K5_uc010kgw.1_Missense_Mutation_p.Q325L	p.Q325L	NM_005923	NP_005914	WXS	Illumina HiSeq	Unspecified	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	5	1335	-	Colorectal(23;0.24)		325					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.974A>T	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.490725	0.84962	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.12984	2.63	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.34308	0.0893	M	0.84948	2.725	0.80722	D	1	D;D;D	0.69078	0.992;0.997;0.994	D;D;D	0.80764	0.968;0.994;0.988	T	0.32455	-0.9906	10	0.87932	D	0	.	15.9396	0.79745	0.0:0.0:0.0:1.0	.	405;170;325	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	L	325;405	ENSP00000351908:Q325L	ENSP00000351908:Q325L	Q	-	2	0	MAP3K5	137060051	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.655000	0.83696	2.227000	0.72691	0.482000	0.46254	CAG		0.393	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		Missense_Mutation	7	50	0	0	0	0.001984	0	7	50				
TULP4	56995	broad.mit.edu	37	6	158923658	158923658	+	Missense_Mutation	SNP	G	G	A	rs143675661		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr6:158923658G>A	ENST00000367097.3	+	13	4320	c.2963G>A	c.(2962-2964)cGg>cAg	p.R988Q	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	988					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R988Q(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GCTACCCTGCGGAGGAACAAC	0.711																																							uc003qrf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2962-2964)CGG>CAG		tubby like protein 4 isoform 1			,GLN/ARG	0,4392		0,0,2196	14.0	16.0	15.0		,2963	4.4	1.0	6	dbSNP_134	15	2,8572		0,2,4285	yes	intron,missense	TULP4	NM_001007466.1,NM_020245.3	,43	0,2,6481	AA,AG,GG		0.0233,0.0,0.0154	,probably-damaging	,988/1544	158923658	2,12964	2196	4287	6483	SO:0001583	missense	56995				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:158923658G>A		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2963G>A	6.37:g.158923658G>A	ENSP00000356064:p.Arg988Gln		Somatic				TULP4_uc003qrg.2_Intron	p.R988Q	NM_020245	NP_064630	WXS	Illumina HiSeq	Unspecified	Q9NRJ4	TULP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	13	4320	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	988					Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	c.2963G>A	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090567	0.76756	0.0	2.33E-4	ENSG00000130338	ENST00000367097	T	0.71461	-0.57	4.39	4.39	0.52855	.	0.054364	0.64402	D	0.000001	T	0.62612	0.2442	L	0.59436	1.845	0.80722	D	1	D	0.54397	0.966	B	0.43889	0.435	T	0.71938	-0.4441	10	0.87932	D	0	-23.1292	17.2984	0.87175	0.0:0.0:1.0:0.0	.	988	Q9NRJ4	TULP4_HUMAN	Q	988	ENSP00000356064:R988Q	ENSP00000356064:R988Q	R	+	2	0	TULP4	158843646	1.000000	0.71417	0.979000	0.43373	0.883000	0.51084	6.986000	0.76200	2.156000	0.67533	0.491000	0.48974	CGG		0.711	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245		6	26	0	0	0	0.001168	0	6	26				
HOXA1	3198	broad.mit.edu	37	7	27134270	27134270	+	Missense_Mutation	SNP	A	A	T	rs41311763		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:27134270A>T	ENST00000343060.4	-	2	858	c.797T>A	c.(796-798)cTg>cAg	p.L266Q	HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000495032.1_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	266					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L266Q(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTTGAGCTGCAGGGATGCAGC	0.567																																							uc003sye.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(796-798)CTG>CAG		homeobox A1 isoform a							121.0	100.0	107.0					7																	27134270		2203	4300	6503	SO:0001583	missense	3198					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27134270A>T		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.797T>A	7.37:g.27134270A>T	ENSP00000343246:p.Leu266Gln		Somatic				HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	p.L266Q	NM_005522	NP_005513	WXS	Illumina HiSeq	Unspecified	P49639	HXA1_HUMAN			2	891	-			266			Homeobox.		A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	c.797T>A	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.933630	0.73442	.	.	ENSG00000105991	ENST00000343060	D	0.98296	-4.85	5.31	5.31	0.75309	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.132988	0.51477	D	0.000081	D	0.99521	0.9829	H	0.99794	4.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97549	1.0091	10	0.87932	D	0	.	15.268	0.73678	1.0:0.0:0.0:0.0	.	266	P49639	HXA1_HUMAN	Q	266	ENSP00000343246:L266Q	ENSP00000343246:L266Q	L	-	2	0	HOXA1	27100795	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.281000	0.95811	2.019000	0.59389	0.533000	0.62120	CTG		0.567	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			6	100	0	0	0	0.001984	0	6	100				
POU6F2	11281	broad.mit.edu	37	7	39500186	39500186	+	Silent	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:39500186G>C	ENST00000403058.1	+	10	1597	c.1443G>C	c.(1441-1443)ctG>ctC	p.L481L	POU6F2_ENST00000559001.1_Silent_p.L426L|POU6F2_ENST00000518318.2_Silent_p.L481L	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	481	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L481L(1)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GGGTTAATCTGGAGGAGATCC	0.512																																							uc003thb.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1441-1443)CTG>CTC		POU class 6 homeobox 2 isoform 1							59.0	52.0	54.0					7																	39500186		2203	4300	6503	SO:0001819	synonymous_variant	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39500186G>C	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1443G>C	7.37:g.39500186G>C			Somatic					p.L481L	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			9	1485	+			481			POU-specific.		A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	37	c.1443G>C	CCDS34620.2																																																																																				0.512	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		6	24	0	0	0	0.001168	0	6	24				
POM121L12	285877	broad.mit.edu	37	7	53104090	53104090	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:53104090C>A	ENST00000408890.4	+	1	742	c.726C>A	c.(724-726)ccC>ccA	p.P242P		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	242								p.P242P(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GCCTCGGCCCCTGGAGCCTCA	0.647																																							uc003tpz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(724-726)CCC>CCA		POM121 membrane glycoprotein-like 12							45.0	53.0	50.0					7																	53104090		1976	4140	6116	SO:0001819	synonymous_variant	285877							g.chr7:53104090C>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.726C>A	7.37:g.53104090C>A			Somatic					p.P242P	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	742	+			242					Q8NDI9	Silent	SNP	ENST00000408890.4	37	c.726C>A	CCDS43584.1																																																																																				0.647	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		6	43	1	0	2.0095e-06	0.001984	2.9334e-06	6	43				
KIAA1324L	222223	broad.mit.edu	37	7	86526823	86526823	+	Splice_Site	SNP	T	T	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:86526823T>G	ENST00000450689.2	-	19	2869	c.2684A>C	c.(2683-2685)cAg>cCg	p.Q895P	KIAA1324L_ENST00000416314.1_Splice_Site_p.Q728P|KIAA1324L_ENST00000297222.6_Splice_Site_p.Q655P|KIAA1324L_ENST00000444627.1_Splice_Site_p.Q824P	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	895						integral component of membrane (GO:0016021)		p.Q655P(1)|p.Q895P(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ATCCCTTACCTGAAATCCTCT	0.468																																							uc011kha.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(1)	7						c.(2683-2685)CAG>CCG		hypothetical protein LOC222223 isoform 1							104.0	102.0	103.0					7																	86526823		2203	4300	6503	SO:0001630	splice_region_variant	222223					integral to membrane		g.chr7:86526823T>G	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2685+1A>C	7.37:g.86526823T>G			Somatic				KIAA1324L_uc003uif.1_Missense_Mutation_p.Q655P|KIAA1324L_uc011kgz.1_Missense_Mutation_p.Q781P|KIAA1324L_uc003uie.2_Missense_Mutation_p.Q728P	p.Q895P	NM_001142749	NP_001136221	WXS	Illumina HiSeq	Unspecified	A8MWY0	K132L_HUMAN			19	2869	-	Esophageal squamous(14;0.0058)		895			Extracellular (Potential).		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	c.2684A>C	CCDS47632.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566668	0.86439	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.22336	2.24;1.99;1.96;1.99	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	M	0.82323	2.585	0.80722	D	1	P;D;D	0.76494	0.839;0.999;0.999	P;D;D	0.67548	0.479;0.952;0.952	T	0.54906	-0.8223	10	0.66056	D	0.02	.	14.9532	0.71091	0.0:0.0:0.0:1.0	.	895;655;728	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	P	895;655;824;728	ENSP00000413445:Q895P;ENSP00000297222:Q655P;ENSP00000397377:Q824P;ENSP00000402390:Q728P	ENSP00000297222:Q655P	Q	-	2	0	KIAA1324L	86364759	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.040000	0.89188	2.134000	0.65973	0.528000	0.53228	CAG		0.468	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	Missense_Mutation	5	106	0	0	0	0.000602	0	5	106				
OR2AE1	81392	broad.mit.edu	37	7	99474394	99474394	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:99474394C>A	ENST00000316368.2	-	1	286	c.263G>T	c.(262-264)gGc>gTc	p.G88V		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G88V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					AGATTTCTTGCCAGATAGGTA	0.463																																							uc003usc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(262-264)GGC>GTC		olfactory receptor, family 2, subfamily AE,							112.0	95.0	101.0					7																	99474394		2203	4300	6503	SO:0001583	missense	81392				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:99474394C>A	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.263G>T	7.37:g.99474394C>A	ENSP00000313936:p.Gly88Val		Somatic					p.G88V	NM_001005276	NP_001005276	WXS	Illumina HiSeq	Unspecified	Q8NHA4	O2AE1_HUMAN			1	263	-	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)		88			Extracellular (Potential).		B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	37	c.263G>T	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367585	0.24771	.	.	ENSG00000244623	ENST00000316368	T	0.03772	3.81	3.63	2.74	0.32292	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	D	0.000971	T	0.19127	0.0459	M	0.80982	2.52	0.18873	N	0.999986	D	0.89917	1.0	D	0.91635	0.999	T	0.01165	-1.1431	10	0.87932	D	0	.	9.5523	0.39317	0.0:0.8918:0.0:0.1082	.	88	Q8NHA4	O2AE1_HUMAN	V	88	ENSP00000313936:G88V	ENSP00000313936:G88V	G	-	2	0	OR2AE1	99312330	0.000000	0.05858	0.047000	0.18901	0.266000	0.26442	-0.092000	0.11129	1.101000	0.41535	0.501000	0.49751	GGC		0.463	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1			16	69	1	0	6.94344e-10	0.006122	1.1863e-09	16	69				
ZAN	7455	broad.mit.edu	37	7	100388611	100388611	+	RNA	SNP	G	G	T	rs370429370		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:100388611G>T	ENST00000348028.3	+	0	7569				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G2468*(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGGCCTGTGCGGAAACTACGA	0.552																																							uc003uwj.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(7405-7407)GGA>TGA		zonadhesin isoform 3							63.0	71.0	68.0					7																	100388611		2174	4281	6455			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100388611G>T	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100388611G>T			Somatic				ZAN_uc003uwk.2_Nonsense_Mutation_p.G2469*|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Intron	p.G2469*	NM_003386	NP_003377	WXS	Illumina HiSeq	Unspecified	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		41	7570	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		2469			VWFD 4.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	ENST00000348028.3	37	c.7405G>T		.	.	.	.	.	.	.	.	.	.	G	46	12.550686	0.99677	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	.	.	.	4.23	4.23	0.50019	.	0.000000	0.50627	D	0.000120	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.8123	0.57647	0.0:0.0:1.0:0.0	.	.	.	.	X	2468	.	ENSP00000445091:G2468X	G	+	1	0	ZAN	100226547	1.000000	0.71417	0.765000	0.31456	0.012000	0.07955	7.206000	0.77891	2.287000	0.76781	0.555000	0.69702	GGA		0.552	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		4	10	1	0	2.56e-06	0.000248	3.6806e-06	4	10				
SLC12A9	56996	broad.mit.edu	37	7	100457848	100457848	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:100457848G>A	ENST00000354161.3	+	9	1337	c.1212G>A	c.(1210-1212)ctG>ctA	p.L404L	SLC12A9_ENST00000428758.1_Silent_p.L404L|SLC12A9_ENST00000475623.1_3'UTR|SLC12A9_ENST00000415287.1_Silent_p.L315L|SLC12A9_ENST00000540482.1_Silent_p.L404L|SLC12A9_ENST00000275729.3_Silent_p.L315L	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	404					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.L404L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTTGGGGCCTGGTGCAGGTGA	0.567																																							uc003uwp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1210-1212)CTG>CTA		solute carrier family 12 (potassium/chloride							43.0	42.0	43.0					7																	100457848		2203	4300	6503	SO:0001819	synonymous_variant	56996					integral to membrane|plasma membrane	cation:chloride symporter activity	g.chr7:100457848G>A	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1212G>A	7.37:g.100457848G>A			Somatic				SLC12A9_uc003uwq.2_Silent_p.L315L|SLC12A9_uc011kki.1_5'UTR|SLC12A9_uc003uwr.2_Silent_p.L140L|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_Silent_p.L140L|SLC12A9_uc003uwv.2_5'UTR	p.L404L	NM_020246	NP_064631	WXS	Illumina HiSeq	Unspecified	Q9BXP2	S12A9_HUMAN			9	1354	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		404			Helical; (Potential).		B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Silent	SNP	ENST00000354161.3	37	c.1212G>A	CCDS5707.1																																																																																				0.567	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246		8	37	0	0	0	0.00308	0	8	37				
MUC17	140453	broad.mit.edu	37	7	100680748	100680748	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:100680748C>T	ENST00000306151.4	+	3	6115	c.6051C>T	c.(6049-6051)acC>acT	p.T2017T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2017	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T2017T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTCCTGCCACCACTTCTACTG	0.522																																							uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(6049-6051)ACC>ACT		mucin 17 precursor							212.0	202.0	205.0					7																	100680748		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100680748C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6051C>T	7.37:g.100680748C>T			Somatic				MUC17_uc010lho.1_RNA	p.T2017T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	6104	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2017			Extracellular (Potential).|32.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.6051C>T	CCDS34711.1																																																																																				0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		36	298	0	0	0	0.00361	0	36	298				
CBLL1	79872	broad.mit.edu	37	7	107399240	107399240	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:107399240C>T	ENST00000440859.3	+	6	1560	c.1093C>T	c.(1093-1095)Cct>Tct	p.P365S	CBLL1_ENST00000222597.2_Missense_Mutation_p.P364S	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	365	Pro-rich.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P365S(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						TGCAGGTACTCCTCACTTGGT	0.527																																							uc003veq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(1093-1095)CCT>TCT		Cas-Br-M (murine) ecotropic retroviral							285.0	253.0	264.0					7																	107399240		2203	4300	6503	SO:0001583	missense	79872				cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:107399240C>T	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.1093C>T	7.37:g.107399240C>T	ENSP00000401277:p.Pro365Ser		Somatic				CBLL1_uc011kme.1_Missense_Mutation_p.P244S|CBLL1_uc011kmf.1_Missense_Mutation_p.P364S	p.P365S	NM_024814	NP_079090	WXS	Illumina HiSeq	Unspecified	Q75N03	HAKAI_HUMAN			6	1423	+			365			Pro-rich.		B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	c.1093C>T	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118581	0.37436	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597;ENST00000420796	T;T;T	0.36157	1.36;1.36;1.27	4.96	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.33147	0.0853	L	0.41236	1.265	0.80722	D	1	P;P	0.50819	0.939;0.939	B;B	0.42916	0.402;0.402	T	0.17992	-1.0351	10	0.59425	D	0.04	-1.7298	14.6979	0.69134	0.1464:0.8536:0.0:0.0	.	364;365	B7ZM03;Q75N03	.;HAKAI_HUMAN	S	365;244;364;315	ENSP00000401277:P365S;ENSP00000222597:P364S;ENSP00000410615:P315S	ENSP00000222597:P364S	P	+	1	0	CBLL1	107186476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.389000	0.52516	1.179000	0.42884	0.491000	0.48974	CCT		0.527	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814		14	257	0	0	0	0.00499	0	14	257				
LRRN3	54674	broad.mit.edu	37	7	110763529	110763529	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:110763529G>C	ENST00000422987.3	+	2	1532	c.701G>C	c.(700-702)gGa>gCa	p.G234A	IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.G234A|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.G234A|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	234					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G234A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GCCTTGGTTGGACTGGAAAAC	0.363																																							uc003vft.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8						c.(700-702)GGA>GCA		leucine rich repeat neuronal 3 precursor							64.0	67.0	66.0					7																	110763529		2203	4299	6502	SO:0001583	missense	54674					integral to membrane		g.chr7:110763529G>C	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.701G>C	7.37:g.110763529G>C	ENSP00000412417:p.Gly234Ala		Somatic				IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Missense_Mutation_p.G234A|LRRN3_uc003vfs.3_Missense_Mutation_p.G234A	p.G234A	NM_001099660	NP_001093130	WXS	Illumina HiSeq	Unspecified	Q9H3W5	LRRN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)	4	1747	+			234			Extracellular (Potential).|LRR 7.		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	c.701G>C	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833018	0.71258	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000015	T	0.80008	0.4545	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81022	-0.1121	10	0.72032	D	0.01	.	20.4192	0.99033	0.0:0.0:1.0:0.0	.	234	Q9H3W5	LRRN3_HUMAN	A	234	ENSP00000312001:G234A;ENSP00000397312:G234A;ENSP00000412417:G234A;ENSP00000407927:G234A	ENSP00000312001:G234A	G	+	2	0	LRRN3	110550765	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.831000	0.97527	0.650000	0.86243	GGA		0.363	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		21	70	0	0	0	0.008871	0	21	70				
ZNF277	11179	broad.mit.edu	37	7	111970197	111970197	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:111970197A>G	ENST00000361822.3	+	7	856	c.727A>G	c.(727-729)Atg>Gtg	p.M243V	AC004112.4_ENST00000411413.1_RNA|ZNF277_ENST00000450657.1_Missense_Mutation_p.M243V|AC004112.4_ENST00000431064.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	243					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.M243V(1)		breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						TAAAGATCACATGAGGAAAAA	0.323																																							uc003vge.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(727-729)ATG>GTG		zinc finger protein (C2H2 type) 277							114.0	111.0	112.0					7																	111970197		2203	4299	6502	SO:0001583	missense	11179					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:111970197A>G	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.727A>G	7.37:g.111970197A>G	ENSP00000354501:p.Met243Val		Somatic				ZNF277_uc003vgd.2_Missense_Mutation_p.M243V|ZNF277_uc003vgf.2_Missense_Mutation_p.M165V|ZNF277_uc003vgg.2_Missense_Mutation_p.M68V	p.M243V	NM_021994	NP_068834	WXS	Illumina HiSeq	Unspecified	Q9NRM2	ZN277_HUMAN			7	856	+			243			C2H2-type 1.		Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	ENST00000361822.3	37	c.727A>G	CCDS5755.2	.	.	.	.	.	.	.	.	.	.	A	24.7	4.554957	0.86231	.	.	ENSG00000198839	ENST00000361822;ENST00000425229;ENST00000450657	T;T;T	0.57595	0.39;0.39;0.39	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.78997	0.4372	M	0.91459	3.21	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.83275	0.991;0.996	T	0.82709	-0.0323	10	0.54805	T	0.06	-23.2683	16.8222	0.85835	1.0:0.0:0.0:0.0	.	243;243	Q9NRM2;G5E9M4	ZN277_HUMAN;.	V	243;155;243	ENSP00000354501:M243V;ENSP00000390359:M155V;ENSP00000402292:M243V	ENSP00000354501:M243V	M	+	1	0	ZNF277	111757433	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.993000	0.93524	2.371000	0.80710	0.533000	0.62120	ATG		0.323	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	NM_021994		7	39	0	0	0	0.00308	0	7	39				
SPAM1	6677	broad.mit.edu	37	7	123594320	123594320	+	Silent	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:123594320C>T	ENST00000439500.1	+	4	1309	c.696C>T	c.(694-696)ccC>ccT	p.P232P	SPAM1_ENST00000340011.5_Silent_p.P232P|SPAM1_ENST00000460182.1_Silent_p.P232P|SPAM1_ENST00000402183.2_Silent_p.P232P|SPAM1_ENST00000223028.7_Silent_p.P232P	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	232					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.P232P(4)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ATAAGAAACCCGGTTACAATG	0.368																																							uc003vld.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|kidney(1)	4						c.(694-696)CCC>CCT		sperm adhesion molecule 1 isoform 2	Hyaluronidase(DB00070)						89.0	92.0	91.0					7																	123594320		2203	4300	6503	SO:0001819	synonymous_variant	6677				binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity	g.chr7:123594320C>T	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.696C>T	7.37:g.123594320C>T			Somatic				SPAM1_uc003vle.2_Silent_p.P232P|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Silent_p.P232P|SPAM1_uc010lku.2_Silent_p.P232P	p.P232P	NM_153189	NP_694859	WXS	Illumina HiSeq	Unspecified	P38567	HYALP_HUMAN			4	1098	+			232					Q8TC30	Silent	SNP	ENST00000439500.1	37	c.696C>T	CCDS5791.1																																																																																				0.368	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1			17	106	0	0	0	0.004007	0	17	106				
AKR1D1	6718	broad.mit.edu	37	7	137790082	137790082	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:137790082G>C	ENST00000242375.3	+	5	528	c.486G>C	c.(484-486)ttG>ttC	p.L162F	AKR1D1_ENST00000468877.2_3'UTR|AKR1D1_ENST00000432161.1_Missense_Mutation_p.L162F|AKR1D1_ENST00000411726.2_Intron	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	162					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)	p.L162F(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	ACGCTGGCTTGGTGAAATCCC	0.488																																							uc003vtz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(484-486)TTG>TTC		aldo-keto reductase family 1, member D1							122.0	130.0	127.0					7																	137790082		2203	4300	6503	SO:0001583	missense	6718				androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding	g.chr7:137790082G>C	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.486G>C	7.37:g.137790082G>C	ENSP00000242375:p.Leu162Phe		Somatic				AKR1D1_uc011kqb.1_Missense_Mutation_p.L162F|AKR1D1_uc011kqc.1_RNA|AKR1D1_uc011kqd.1_RNA|AKR1D1_uc011kqe.1_Missense_Mutation_p.L162F|AKR1D1_uc011kqf.1_Intron|AKR1D1_uc010lmy.1_RNA	p.L162F	NM_005989	NP_005980	WXS	Illumina HiSeq	Unspecified	P51857	AK1D1_HUMAN			5	555	+			162					A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	37	c.486G>C	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074042	0.76415	.	.	ENSG00000122787	ENST00000297463;ENST00000432161;ENST00000242375	T;T	0.26518	1.73;1.73	4.71	3.82	0.43975	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.000000	0.64402	D	0.000002	T	0.53738	0.1815	M	0.88181	2.935	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.60347	-0.7281	10	0.87932	D	0	.	10.6276	0.45516	0.0959:0.0:0.9041:0.0	.	162;162	B4DPN3;P51857	.;AK1D1_HUMAN	F	40;162;162	ENSP00000389197:L162F;ENSP00000242375:L162F	ENSP00000242375:L162F	L	+	3	2	AKR1D1	137440622	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.889000	0.69766	2.613000	0.88420	0.591000	0.81541	TTG		0.488	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989		36	180	0	0	0	0.003271	0	36	180				
MGAM	8972	broad.mit.edu	37	7	141752752	141752752	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:141752752A>T	ENST00000549489.2	+	26	3222	c.3127A>T	c.(3127-3129)Act>Tct	p.T1043S	MGAM_ENST00000475668.2_Missense_Mutation_p.T1043S	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1043					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.T1043S(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTGGATGTCACTTACCATAA	0.458																																							uc003vwy.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(3127-3129)ACT>TCT		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						76.0	73.0	74.0					7																	141752752		1957	4144	6101	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141752752A>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3127A>T	7.37:g.141752752A>T	ENSP00000447378:p.Thr1043Ser		Somatic					p.T1043S	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			26	3181	+	Melanoma(164;0.0272)		1043			Lumenal (Potential).		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.3127A>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	1.633	-0.518591	0.04171	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.81415	-1.49	4.39	3.18	0.36537	Glycoside hydrolase-type carbohydrate-binding (1);	0.385935	0.19008	N	0.125159	T	0.63486	0.2515	N	0.20766	0.605	0.25228	N	0.989858	B	0.16603	0.018	B	0.17722	0.019	T	0.44997	-0.9291	10	0.13470	T	0.59	.	8.306	0.32042	0.9:0.0:0.1:0.0	.	1043	O43451	MGA_HUMAN	S	1043;1043;920	ENSP00000447378:T1043S	ENSP00000316431:T920S	T	+	1	0	MGAM	141399221	0.818000	0.29161	0.912000	0.35992	0.004000	0.04260	2.952000	0.49097	0.493000	0.27837	0.373000	0.22412	ACT		0.458	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			9	73	0	0	0	0.004482	0	9	73				
EPHB6	2051	broad.mit.edu	37	7	142564758	142564758	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:142564758G>T	ENST00000392957.2	+	11	2469	c.1682G>T	c.(1681-1683)cGg>cTg	p.R561L	EPHB6_ENST00000442129.1_Missense_Mutation_p.R561L|EPHB6_ENST00000411471.2_Missense_Mutation_p.R284L	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	561	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.R546L(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					TTCCAGGTGCGGGCCCGGACT	0.622																																							uc011kst.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(1681-1683)CGG>CTG		ephrin receptor EphB6 precursor							70.0	65.0	67.0					7																	142564758		2203	4300	6503	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142564758G>T	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1682G>T	7.37:g.142564758G>T	ENSP00000376684:p.Arg561Leu		Somatic				EPHB6_uc011ksu.1_Missense_Mutation_p.R561L|EPHB6_uc003wbs.2_Missense_Mutation_p.R269L|EPHB6_uc003wbt.2_Missense_Mutation_p.R35L|EPHB6_uc003wbu.2_Missense_Mutation_p.R269L|EPHB6_uc003wbv.2_5'Flank	p.R561L	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			11	2469	+	Melanoma(164;0.059)		561			Fibronectin type-III 2.|Extracellular (Potential).		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.1682G>T	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	33	5.206985	0.95033	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.58060	0.36;0.36;0.36	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.43416	D	0.000563	T	0.74038	0.3664	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.986	T	0.78079	-0.2344	10	0.87932	D	0	.	17.5466	0.87864	0.0:0.0:1.0:0.0	.	561;284	O15197;O15197-2	EPHB6_HUMAN;.	L	561;561;284	ENSP00000376684:R561L;ENSP00000410789:R561L;ENSP00000409061:R284L	ENSP00000376684:R561L	R	+	2	0	EPHB6	142274880	1.000000	0.71417	0.992000	0.48379	0.865000	0.49528	9.789000	0.99068	2.368000	0.80403	0.555000	0.69702	CGG		0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			8	54	1	0	0.00448238	0.004482	0.00528727	8	54				
KEL	3792	broad.mit.edu	37	7	142637620	142637620	+	IGR	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:142637620G>C	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Silent_p.G130G	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.G105G(1)|p.G130G(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TCTCAGGAGGGCCATTGAGGC	0.537																																							uc003wca.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(388-390)GGG>GGC		hypothetical protein LOC135927							221.0	194.0	203.0					7																	142637620		2203	4300	6503	SO:0001628	intergenic_variant	135927					extracellular region		g.chr7:142637620G>C	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142637620G>C			Somatic					p.G130G	NM_178829	NP_849151	WXS	Illumina HiSeq	Unspecified	Q96L11	CG034_HUMAN			2	431	+	Melanoma(164;0.059)		105					B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	c.390G>C	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	g	0.468	-0.885779	0.02511	.	.	ENSG00000165131	ENST00000458732	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	T	0.64327	0.2588	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62272	-0.6889	4	.	.	.	-0.7788	12.9346	0.58307	0.0:0.0:1.0:0.0	.	.	.	.	P	136	.	.	A	+	1	0	C7orf34	142347742	1.000000	0.71417	0.992000	0.48379	0.055000	0.15305	3.106000	0.50322	2.500000	0.84329	0.651000	0.88453	GCC		0.537	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		10	138	0	0	0	0.006214	0	10	138				
OR2F2	135948	broad.mit.edu	37	7	143632883	143632883	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:143632883G>T	ENST00000408955.2	+	1	625	c.558G>T	c.(556-558)agG>agT	p.R186S		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R186S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					CTGTGGTCAGGCTGGCTTGTG	0.488																																							uc011ktv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(556-558)AGG>AGT		olfactory receptor, family 2, subfamily F,							156.0	143.0	147.0					7																	143632883		2203	4300	6503	SO:0001583	missense	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143632883G>T		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.558G>T	7.37:g.143632883G>T	ENSP00000386222:p.Arg186Ser		Somatic					p.R186S	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	558	+	Melanoma(164;0.0903)		186			Extracellular (Potential).		A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	c.558G>T	CCDS43666.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520407	0.27211	.	.	ENSG00000221910	ENST00000408955	T	0.00069	8.77	3.49	-0.586	0.11694	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000067	T	0.00241	0.0007	L	0.38531	1.155	0.22412	N	0.999124	D	0.89917	1.0	D	0.91635	0.999	T	0.51012	-0.8759	10	0.72032	D	0.01	-20.2912	9.0642	0.36453	0.4842:0.0:0.5158:0.0	.	186	O95006	OR2F2_HUMAN	S	186	ENSP00000386222:R186S	ENSP00000386222:R186S	R	+	3	2	OR2F2	143263816	0.000000	0.05858	0.980000	0.43619	0.617000	0.37484	-2.380000	0.01066	-0.603000	0.05767	-1.579000	0.00862	AGG		0.488	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			5	103	1	0	0.00116845	0.001168	0.00142685	5	103				
OR2F2	135948	broad.mit.edu	37	7	143633190	143633190	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:143633190A>C	ENST00000408955.2	+	1	932	c.865A>C	c.(865-867)Att>Ctt	p.I289L		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I289L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					GAACCCTGTGATTTATAGTCT	0.443																																							uc011ktv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(865-867)ATT>CTT		olfactory receptor, family 2, subfamily F,							76.0	77.0	77.0					7																	143633190		2128	4265	6393	SO:0001583	missense	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143633190A>C		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.865A>C	7.37:g.143633190A>C	ENSP00000386222:p.Ile289Leu		Somatic					p.I289L	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	865	+	Melanoma(164;0.0903)		289			Helical; Name=7; (Potential).		A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	c.865A>C	CCDS43666.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.984873	0.53934	.	.	ENSG00000221910	ENST00000408955	T	0.51817	0.69	3.78	3.78	0.43462	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000159	T	0.68550	0.3013	M	0.84683	2.71	0.36126	D	0.845801	D	0.62365	0.991	D	0.72338	0.977	T	0.78602	-0.2140	10	0.87932	D	0	-29.7672	10.7947	0.46453	1.0:0.0:0.0:0.0	.	289	O95006	OR2F2_HUMAN	L	289	ENSP00000386222:I289L	ENSP00000386222:I289L	I	+	1	0	OR2F2	143264123	1.000000	0.71417	0.964000	0.40570	0.574000	0.36063	5.780000	0.68956	1.715000	0.51383	0.402000	0.26972	ATT		0.443	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			9	91	0	0	0	0.004482	0	9	91				
CNTNAP2	26047	broad.mit.edu	37	7	146829427	146829427	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:146829427C>A	ENST00000361727.3	+	8	1690	c.1174C>A	c.(1174-1176)Cag>Aag	p.Q392K		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	392					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.Q392K(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACGGCTTAACCAGGACCTGTT	0.468										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1174-1176)CAG>AAG		cell recognition molecule Caspr2 precursor							129.0	120.0	123.0					7																	146829427		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146829427C>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1174C>A	7.37:g.146829427C>A	ENSP00000354778:p.Gln392Lys	HNSCC(39;0.1)	Somatic					p.Q392K	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		8	1690	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	392			Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1174C>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	9.425	1.083999	0.20309	.	.	ENSG00000174469	ENST00000361727	T	0.78595	-1.19	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.087235	0.46442	D	0.000298	T	0.67534	0.2903	L	0.43152	1.355	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.60757	-0.7200	10	0.06494	T	0.89	.	14.0649	0.64821	0.0:0.849:0.151:0.0	.	392	Q9UHC6	CNTP2_HUMAN	K	392	ENSP00000354778:Q392K	ENSP00000354778:Q392K	Q	+	1	0	CNTNAP2	146460360	0.997000	0.39634	0.975000	0.42487	0.996000	0.88848	3.614000	0.54160	2.686000	0.91538	0.591000	0.81541	CAG		0.468	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			21	130	1	0	2.4624e-09	0.008871	4.13292e-09	21	130				
CNTNAP2	26047	broad.mit.edu	37	7	147259256	147259256	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:147259256T>A	ENST00000361727.3	+	12	2320	c.1804T>A	c.(1804-1806)Tac>Aac	p.Y602N		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	602	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.Y602N(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTGTGAAGCCTACAAACACCT	0.453										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1804-1806)TAC>AAC		cell recognition molecule Caspr2 precursor							111.0	105.0	107.0					7																	147259256		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:147259256T>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1804T>A	7.37:g.147259256T>A	ENSP00000354778:p.Tyr602Asn	HNSCC(39;0.1)	Somatic					p.Y602N	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		12	2320	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	602			Extracellular (Potential).|Fibrinogen C-terminal.		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1804T>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890184	0.91889	.	.	ENSG00000174469	ENST00000361727	T	0.25912	1.77	5.93	5.93	0.95920	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.64402	D	0.000012	T	0.58481	0.2125	M	0.90309	3.105	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.66056	-0.6018	10	0.54805	T	0.06	.	15.2071	0.73186	0.0:0.0:0.0:1.0	.	602	Q9UHC6	CNTP2_HUMAN	N	602	ENSP00000354778:Y602N	ENSP00000354778:Y602N	Y	+	1	0	CNTNAP2	146890189	1.000000	0.71417	0.943000	0.38184	0.954000	0.61252	7.877000	0.87225	2.257000	0.74773	0.533000	0.62120	TAC		0.453	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			8	60	0	0	0	0.00308	0	8	60				
CNTNAP2	26047	broad.mit.edu	37	7	147914435	147914435	+	Silent	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:147914435A>G	ENST00000361727.3	+	19	3582	c.3066A>G	c.(3064-3066)ccA>ccG	p.P1022P	CNTNAP2_ENST00000538075.1_Silent_p.P81P	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1022					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.P1022P(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTCAGGCACCAGCAACAAATG	0.493										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(3064-3066)CCA>CCG		cell recognition molecule Caspr2 precursor							122.0	122.0	122.0					7																	147914435		2203	4300	6503	SO:0001819	synonymous_variant	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:147914435A>G	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3066A>G	7.37:g.147914435A>G		HNSCC(39;0.1)	Somatic					p.P1022P	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		19	3582	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	1022			Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	37	c.3066A>G	CCDS5889.1																																																																																				0.493	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			18	93	0	0	0	0.006122	0	18	93				
KRBA1	84626	broad.mit.edu	37	7	149425649	149425649	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:149425649G>A	ENST00000485033.2	+	11	1510	c.1510G>A	c.(1510-1512)Gag>Aag	p.E504K	KRBA1_ENST00000319551.8_Missense_Mutation_p.E504K|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000255992.10_Missense_Mutation_p.E504K			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	567								p.E504K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCAGGGTCTGGAGAATTGTCT	0.582																																							uc003wfz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1510-1512)GAG>AAG		KRAB A domain containing 1							126.0	140.0	135.0					7																	149425649		2000	4166	6166	SO:0001583	missense	84626							g.chr7:149425649G>A	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1510G>A	7.37:g.149425649G>A	ENSP00000420112:p.Glu504Lys		Somatic				KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Missense_Mutation_p.E172K	p.E504K	NM_032534	NP_115923	WXS	Illumina HiSeq	Unspecified	A5PL33	KRBA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		12	1909	+	Melanoma(164;0.165)|Ovarian(565;0.177)		504					A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37	c.1510G>A		.	.	.	.	.	.	.	.	.	.	G	16.42	3.119563	0.56505	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.52526	0.66;1.12;1.12	4.72	4.72	0.59763	.	0.000000	0.40908	D	0.000999	T	0.56702	0.2003	L	0.34521	1.04	0.35455	D	0.796032	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.66476	-0.5914	10	0.52906	T	0.07	-24.8954	13.1957	0.59736	0.0:0.0:1.0:0.0	.	504;504	E7ENE9;A5PL33	.;KRBA1_HUMAN	K	504	ENSP00000255992:E504K;ENSP00000317165:E504K;ENSP00000420112:E504K	ENSP00000255992:E504K	E	+	1	0	KRBA1	149056582	1.000000	0.71417	0.988000	0.46212	0.213000	0.24496	3.011000	0.49567	2.158000	0.67659	0.655000	0.94253	GAG		0.582	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534		9	152	0	0	0	0.001368	0	9	152				
KMT2C	58508	broad.mit.edu	37	7	152008931	152008931	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr7:152008931C>G	ENST00000262189.6	-	5	909	c.691G>C	c.(691-693)Gtt>Ctt	p.V231L	KMT2C_ENST00000355193.2_Missense_Mutation_p.V231L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	231					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.V231L(2)									GGAAGCCCAACCAGACTGAGT	0.413																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(691-693)GTT>CTT		myeloid/lymphoid or mixed-lineage leukemia 3							135.0	125.0	128.0					7																	152008931		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:152008931C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.691G>C	7.37:g.152008931C>G	ENSP00000262189:p.Val231Leu		Somatic					p.V231L	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	5	910	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	231					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.691G>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375306	0.61735	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.86562	-2.13;-2.14	5.91	5.91	0.95273	.	0.000000	0.39687	N	0.001293	D	0.85936	0.5813	L	0.29908	0.895	0.80722	D	1	D	0.53312	0.959	P	0.47744	0.556	D	0.86848	0.2021	10	0.62326	D	0.03	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	231	Q8NEZ4	MLL3_HUMAN	L	231	ENSP00000262189:V231L;ENSP00000347325:V231L	ENSP00000262189:V231L	V	-	1	0	MLL3	151639864	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.684000	0.61686	2.820000	0.97059	0.650000	0.86243	GTT		0.413	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			16	89	0	0	0	0.00499	0	16	89				
RP1L1	94137	broad.mit.edu	37	8	10467307	10467307	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:10467307C>A	ENST00000382483.3	-	4	4524	c.4301G>T	c.(4300-4302)aGa>aTa	p.R1434I		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1514					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.R1434I(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGCAGAGGCTCTTCCTGCTTC	0.627																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4300-4302)AGA>ATA		retinitis pigmentosa 1-like 1							168.0	186.0	180.0					8																	10467307		1998	4162	6160	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10467307C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4301G>T	8.37:g.10467307C>A	ENSP00000371923:p.Arg1434Ile		Somatic					p.R1434I	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	4530	-			1434					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.4301G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	c	12.09	1.833816	0.32421	.	.	ENSG00000183638	ENST00000382483	T	0.04758	3.56	3.64	1.7	0.24286	.	.	.	.	.	T	0.04318	0.0119	N	0.24115	0.695	0.09310	N	1	P	0.49961	0.93	P	0.45232	0.474	T	0.43163	-0.9408	9	0.45353	T	0.12	2.8553	6.3071	0.21145	0.0:0.6893:0.1947:0.116	.	1434	A6NKC6	.	I	1434	ENSP00000371923:R1434I	ENSP00000371923:R1434I	R	-	2	0	RP1L1	10504717	0.000000	0.05858	0.002000	0.10522	0.360000	0.29518	0.063000	0.14410	0.785000	0.33685	0.556000	0.70494	AGA		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			10	373	1	0	2.17888e-05	0.006214	2.96483e-05	10	373				
PSD3	23362	broad.mit.edu	37	8	18393390	18393390	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:18393390C>A	ENST00000327040.8	-	16	3109	c.3007G>T	c.(3007-3009)Gca>Tca	p.A1003S	PSD3_ENST00000523619.1_Missense_Mutation_p.A938S|PSD3_ENST00000440756.2_Missense_Mutation_p.A1005S|PSD3_ENST00000428502.2_Missense_Mutation_p.A332S|PSD3_ENST00000286485.8_Missense_Mutation_p.A469S	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	1004					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A469S(1)|p.A1005S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TTCAGTCCTGCAGCCTCGCTT	0.498																																							uc003wza.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(3007-3009)GCA>TCA		ADP-ribosylation factor guanine nucleotide							175.0	144.0	154.0					8																	18393390		2203	4300	6503	SO:0001583	missense	23362				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity	g.chr8:18393390C>A	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.3007G>T	8.37:g.18393390C>A	ENSP00000324127:p.Ala1003Ser		Somatic				PSD3_uc003wyx.3_Missense_Mutation_p.A332S|PSD3_uc003wyy.2_Missense_Mutation_p.A469S|PSD3_uc003wyz.2_Missense_Mutation_p.A304S	p.A1003S	NM_015310	NP_056125	WXS	Illumina HiSeq	Unspecified	Q9NYI0	PSD3_HUMAN		Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)	16	3110	-			1004					A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	c.3007G>T	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	C	8.609	0.888651	0.17540	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000381690;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T	0.16743	2.97;2.98;2.32;2.98	5.8	2.61	0.31194	.	0.399249	0.14506	U	0.315460	T	0.03348	0.0097	N	0.01048	-1.04	0.09310	N	1	B;B;B;B	0.10296	0.003;0.003;0.0;0.0	B;B;B;B	0.08055	0.003;0.003;0.001;0.001	T	0.41360	-0.9513	10	0.02654	T	1	.	0.8415	0.01151	0.1914:0.3998:0.1856:0.2232	.	1003;1004;469;332	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	S	1003;1005;225;469;332;938	ENSP00000324127:A1003S;ENSP00000401704:A1005S;ENSP00000286485:A469S;ENSP00000430640:A938S	ENSP00000286485:A469S	A	-	1	0	PSD3	18437670	0.011000	0.17503	0.003000	0.11579	0.879000	0.50718	0.268000	0.18571	0.767000	0.33267	0.655000	0.94253	GCA		0.498	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310		7	102	1	0	1.06961e-07	0.00308	1.68398e-07	7	102				
REEP4	80346	broad.mit.edu	37	8	21996976	21996976	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:21996976G>T	ENST00000306306.3	-	5	838	c.370C>A	c.(370-372)Cgg>Agg	p.R124R	REEP4_ENST00000523293.1_Silent_p.R124R|REEP4_ENST00000334530.5_Silent_p.R124R	NM_025232.2	NP_079508.2	Q9H6H4	REEP4_HUMAN	receptor accessory protein 4	124					mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|nuclear envelope organization (GO:0006998)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)	microtubule binding (GO:0008017)	p.R124R(1)		kidney(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	7				Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)		TTGAGGCCCCGCTTCCCGAAG	0.662																																							uc003xau.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(370-372)CGG>AGG		receptor accessory protein 4							68.0	57.0	61.0					8																	21996976		2203	4300	6503	SO:0001819	synonymous_variant	80346					integral to membrane		g.chr8:21996976G>T	BC013048	CCDS6024.1	8p21.3	2008-05-02	2006-02-07	2006-02-07	ENSG00000168476	ENSG00000168476		"""Receptor accessory proteins"""	26176	protein-coding gene	gene with protein product		609349	"""chromosome 8 open reading frame 20"""	C8orf20		16271481, 15550249	Standard	NM_025232		Approved	FLJ22246, FLJ22277, PP432	uc003xau.1	Q9H6H4	OTTHUMG00000131491	ENST00000306306.3:c.370C>A	8.37:g.21996976G>T			Somatic				REEP4_uc010ltt.1_Silent_p.R124R|REEP4_uc011kyz.1_Silent_p.R124R	p.R124R	NM_025232	NP_079508	WXS	Illumina HiSeq	Unspecified	Q9H6H4	REEP4_HUMAN		Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)	5	823	-			124					D3DSQ9|Q86VL1|Q9H6I5|Q9HBP4	Silent	SNP	ENST00000306306.3	37	c.370C>A	CCDS6024.1																																																																																				0.662	REEP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254337.2	NM_025232		8	36	1	0	0.00448238	0.004482	0.00528727	8	36				
NRG1	3084	broad.mit.edu	37	8	32463156	32463156	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:32463156G>A	ENST00000405005.3	+	3	355	c.355G>A	c.(355-357)Gga>Aga	p.G119R	NRG1_ENST00000356819.4_Missense_Mutation_p.G119R|NRG1_ENST00000287845.5_Missense_Mutation_p.G119R|NRG1_ENST00000521670.1_Missense_Mutation_p.G119R|NRG1_ENST00000338921.4_Missense_Mutation_p.G119R|NRG1_ENST00000341377.5_Missense_Mutation_p.G119R|NRG1_ENST00000519301.1_Missense_Mutation_p.G98R|NRG1_ENST00000520407.1_Missense_Mutation_p.G334R|NRG1_ENST00000523079.1_Missense_Mutation_p.G119R|NRG1_ENST00000287842.3_Missense_Mutation_p.G119R			Q02297	NRG1_HUMAN	neuregulin 1	119	Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.G119R(2)|p.G334R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CAGCAAATTAGGAAATGACAG	0.408																																							uc003xiv.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(355-357)GGA>AGA		neuregulin 1 isoform HRG-alpha							183.0	162.0	169.0					8																	32463156		2203	4300	6503	SO:0001583	missense	3084				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr8:32463156G>A	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.355G>A	8.37:g.32463156G>A	ENSP00000384620:p.Gly119Arg		Somatic				NRG1_uc003xip.2_Missense_Mutation_p.G334R|NRG1_uc003xir.2_Missense_Mutation_p.G119R|NRG1_uc010lvl.2_Missense_Mutation_p.G119R|NRG1_uc010lvm.2_Missense_Mutation_p.G119R|NRG1_uc010lvn.2_Missense_Mutation_p.G119R|NRG1_uc003xis.2_Missense_Mutation_p.G119R|NRG1_uc011lbf.1_Missense_Mutation_p.G119R|NRG1_uc010lvo.2_Missense_Mutation_p.G119R|NRG1_uc003xiu.2_Missense_Mutation_p.G119R|NRG1_uc003xiw.2_Missense_Mutation_p.G119R|NRG1_uc003xit.2_Missense_Mutation_p.G119R|NRG1_uc010lvr.2_5'UTR|NRG1_uc010lvs.2_5'UTR|NRG1_uc010lvp.2_Missense_Mutation_p.G85R|NRG1_uc010lvq.2_Missense_Mutation_p.G85R|NRG1_uc003xix.2_Missense_Mutation_p.G9R	p.G119R	NM_013964	NP_039258	WXS	Illumina HiSeq	Unspecified	Q02297	NRG1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)	3	872	+		Breast(100;0.203)	119			Extracellular (Potential).|Ig-like C2-type.		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	c.355G>A	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057086	0.76074	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000520407;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.8	4.0	0.46444	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.672444	0.14721	N	0.302328	D	0.88815	0.6539	M	0.93507	3.425	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.997;0.998;0.999;0.999;1.0;1.0;0.998;0.998;1.0;0.998;0.998;1.0;0.992	D	0.89625	0.3851	10	0.87932	D	0	-11.3507	11.3098	0.49358	0.1435:0.0:0.8565:0.0	.	119;119;119;118;118;119;119;119;119;119;119;119;334	E9PHH4;F8W9E3;Q7RTW4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-4;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8;Q02297-9	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.;.;.	R	98;98;334;187;119;119;119;119;119;119;119;119;119	ENSP00000430053:G98R;ENSP00000429582:G98R;ENSP00000434640:G334R;ENSP00000429067:G187R;ENSP00000430120:G119R;ENSP00000343395:G119R;ENSP00000349275:G119R;ENSP00000287840:G119R;ENSP00000287845:G119R;ENSP00000340497:G119R;ENSP00000287842:G119R;ENSP00000384620:G119R;ENSP00000428828:G119R	ENSP00000287840:G119R	G	+	1	0	NRG1	32582698	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	6.256000	0.72473	1.448000	0.47680	0.650000	0.86243	GGA		0.408	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			4	91	0	0	0	0.000248	0	4	91				
RNF5P1	286140	broad.mit.edu	37	8	38458672	38458672	+	IGR	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:38458672C>T								RP11-675F6.4 (42134 upstream) : RP11-495O10.1 (99471 downstream)																							GCCCCGCTCGCGATTTGGCCC	0.617																																							uc003xly.2		NA																	0					0						c.(46-48)CGC>CAC		SubName: Full=Putative uncharacterized protein RNF5;																																				SO:0001628	intergenic_variant	286140							g.chr8:38458672C>T																													8.37:g.38458672C>T			Somatic					p.R16H	NR_003129		WXS	Illumina HiSeq	Unspecified					1	104	-									Missense_Mutation	SNP		37	c.47G>A																																																																																				0	0.617									4	30	0	0	0	0.000248	0	4	30				
ANK1	286	broad.mit.edu	37	8	41550708	41550708	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:41550708G>T	ENST00000347528.4	-	30	3627	c.3544C>A	c.(3544-3546)Caa>Aaa	p.Q1182K	ANK1_ENST00000396942.1_Missense_Mutation_p.Q1182K|ANK1_ENST00000396945.1_Missense_Mutation_p.Q1182K|ANK1_ENST00000352337.4_Missense_Mutation_p.Q1182K|ANK1_ENST00000379758.2_Missense_Mutation_p.Q1182K|ANK1_ENST00000265709.8_Missense_Mutation_p.Q1223K|ANK1_ENST00000289734.7_Missense_Mutation_p.Q1182K	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1182	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.Q1182K(1)|p.Q1223K(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CACTGGGCTTGGTCTGTTCCT	0.527																																							uc003xok.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(3544-3546)CAA>AAA		ankyrin 1 isoform 1							260.0	206.0	224.0					8																	41550708		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41550708G>T	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3544C>A	8.37:g.41550708G>T	ENSP00000339620:p.Gln1182Lys		Somatic				NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.Q498K|ANK1_uc003xoi.2_Missense_Mutation_p.Q1182K|ANK1_uc003xoj.2_Missense_Mutation_p.Q1182K|ANK1_uc003xol.2_Missense_Mutation_p.Q1182K|ANK1_uc003xom.2_Missense_Mutation_p.Q1223K	p.Q1182K	NM_020476	NP_065209	WXS	Illumina HiSeq	Unspecified	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		30	3628	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	1182					A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.3544C>A	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.41|14.41	2.525926|2.525926	0.44969|0.44969	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.|T;T;T;T;T;T;T	.|0.25250	.|1.81;1.81;1.81;1.81;1.81;1.81;1.81	4.94|4.94	4.05|4.05	0.47172|0.47172	.|.	.|0.264107	.|0.36338	.|N	.|0.002645	T|T	0.20047|0.20047	0.0482|0.0482	N|N	0.16903|0.16903	0.455|0.455	0.37711|0.37711	D|D	0.924572|0.924572	.|B;B;B;B;B;B	.|0.34399	.|0.202;0.452;0.35;0.02;0.202;0.032	.|B;B;B;B;B;B	.|0.38755	.|0.281;0.164;0.179;0.01;0.281;0.013	T|T	0.13282|0.13282	-1.0515|-1.0515	5|10	.|0.34782	.|T	.|0.22	.|.	15.5459|15.5459	0.76101|0.76101	0.0:0.1387:0.8613:0.0|0.0:0.1387:0.8613:0.0	.|.	.|1223;1182;1182;1182;1182;498	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	Q|K	503|1182;1182;1182;1182;1182;1182;1223;1182	.|ENSP00000339620:Q1182K;ENSP00000289734:Q1182K;ENSP00000369082:Q1182K;ENSP00000380149:Q1182K;ENSP00000380147:Q1182K;ENSP00000309131:Q1182K;ENSP00000265709:Q1223K	.|ENSP00000265709:Q1223K	P|Q	-|-	2|1	0|0	ANK1|ANK1	41669865|41669865	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.680000|0.680000	0.39746|0.39746	6.774000|6.774000	0.75012|0.75012	1.183000|1.183000	0.42943|0.42943	0.467000|0.467000	0.42956|0.42956	CCA|CAA		0.527	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		7	69	1	0	5.18039e-06	0.00308	7.33728e-06	7	69				
ZFHX4	79776	broad.mit.edu	37	8	77766156	77766156	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:77766156G>T	ENST00000521891.2	+	10	7447	c.6999G>T	c.(6997-6999)aaG>aaT	p.K2333N	ZFHX4_ENST00000518282.1_Missense_Mutation_p.K2307N|ZFHX4_ENST00000455469.2_Missense_Mutation_p.K2288N|ZFHX4_ENST00000050961.6_Missense_Mutation_p.K2288N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.K2317N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCAGAAAAAGCAGTGTTACA	0.423										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6862-6864)AAG>AAT		zinc finger homeodomain 4							148.0	141.0	144.0					8																	77766156		2012	4195	6207	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766156G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6999G>T	8.37:g.77766156G>T	ENSP00000430497:p.Lys2333Asn	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.K2333N|ZFHX4_uc003yaw.1_Missense_Mutation_p.K2288N	p.K2288N	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7251	+			2288			C2H2-type 15; degenerate.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6864G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439675	0.43326	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55052	0.54;0.6;0.56;0.56	4.34	2.53	0.30540	Zinc finger, C2H2 (2);	0.000000	0.46442	U	0.000295	T	0.56673	0.2001	L	0.43757	1.38	0.45403	D	0.998384	D;D;D	0.71674	0.996;0.995;0.998	D;D;D	0.67382	0.951;0.919;0.919	T	0.52117	-0.8618	10	0.32370	T	0.25	.	7.4171	0.27050	0.3331:0.0:0.6669:0.0	.	2288;2288;2333	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	N	2333;2317;2288;2288;2307	ENSP00000430497:K2333N;ENSP00000399605:K2288N;ENSP00000050961:K2288N;ENSP00000430848:K2307N	ENSP00000050961:K2288N	K	+	3	2	ZFHX4	77928711	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.050000	0.30404	1.187000	0.43000	0.650000	0.86243	AAG		0.423	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		18	115	1	0	6.33239e-15	0.001523	1.18849e-14	18	115				
CPQ	10404	broad.mit.edu	37	8	97892129	97892129	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:97892129G>T	ENST00000220763.5	+	4	955	c.745G>T	c.(745-747)Ggg>Tgg	p.G249W		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	249					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GGCTTCTCATGGGATCAAAAT	0.453																																							uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(745-747)GGG>TGG		plasma glutamate carboxypeptidase precursor							211.0	206.0	208.0					8																	97892129		2203	4300	6503	SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97892129G>T	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.745G>T	8.37:g.97892129G>T	ENSP00000220763:p.Gly249Trp		Somatic				PGCP_uc010mbe.2_Missense_Mutation_p.G249W	p.G249W	NM_016134	NP_057218	WXS	Illumina HiSeq	Unspecified	Q9Y646	PGCP_HUMAN			4	911	+	Breast(36;1.86e-05)		249					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	c.745G>T	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024428	0.54683	.	.	ENSG00000104324	ENST00000220763	T	0.56776	0.44	5.53	5.53	0.82687	.	0.057481	0.64402	D	0.000001	T	0.80110	0.4563	M	0.93763	3.455	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84855	0.0816	10	0.87932	D	0	-39.8765	17.032	0.86463	0.0:0.0:1.0:0.0	.	249;249	B5MDX4;Q9Y646	.;PGCP_HUMAN	W	249	ENSP00000220763:G249W	ENSP00000220763:G249W	G	+	1	0	AC010859.1	97961305	1.000000	0.71417	0.191000	0.23289	0.169000	0.22640	7.569000	0.82380	2.775000	0.95449	0.586000	0.80456	GGG		0.453	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		33	243	1	0	7.11191e-15	0.002836	1.32825e-14	33	243				
VPS13B	157680	broad.mit.edu	37	8	100520069	100520069	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:100520069G>T	ENST00000358544.2	+	28	4340	c.4229G>T	c.(4228-4230)aGa>aTa	p.R1410I	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Intron	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1410					protein transport (GO:0015031)			p.R1410I(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAGCTGAACAGACGCACCTTG	0.463																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(4228-4230)AGA>ATA		vacuolar protein sorting 13B isoform 5							209.0	178.0	188.0					8																	100520069		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100520069G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4229G>T	8.37:g.100520069G>T	ENSP00000351346:p.Arg1410Ile		Somatic				VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_3'UTR|VPS13B_uc003yix.1_Missense_Mutation_p.R880I	p.R1410I	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		28	4340	+	Breast(36;3.73e-07)		1410					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.4229G>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444799	0.63178	.	.	ENSG00000132549	ENST00000358544	T	0.48201	0.82	5.64	4.74	0.60224	.	0.195954	0.45606	D	0.000358	T	0.47783	0.1464	L	0.38175	1.15	0.80722	D	1	P;P	0.45827	0.867;0.79	P;B	0.47206	0.541;0.34	T	0.50550	-0.8815	10	0.59425	D	0.04	.	16.2886	0.82737	0.0:0.1328:0.8672:0.0	.	1409;1410	Q7Z7G8-6;Q7Z7G8	.;VP13B_HUMAN	I	1410	ENSP00000351346:R1410I	ENSP00000351346:R1410I	R	+	2	0	VPS13B	100589245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.687000	0.84139	1.329000	0.45376	0.591000	0.81541	AGA		0.463	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		7	81	1	0	2.0095e-06	0.001984	2.9334e-06	7	81				
ANGPT1	284	broad.mit.edu	37	8	108306234	108306234	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:108306234C>A	ENST00000520734.1	-	5	653	c.368G>T	c.(367-369)gGt>gTt	p.G123V	ANGPT1_ENST00000518386.1_5'UTR|ANGPT1_ENST00000520052.1_Missense_Mutation_p.G122V			Q15389	ANGP1_HUMAN	angiopoietin 1	323					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.G323V(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TACAGTCCAACCTCCCCCATT	0.343																																							uc003ymn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7						c.(967-969)GGT>GTT		angiopoietin 1 precursor							138.0	132.0	134.0					8																	108306234		2203	4300	6503	SO:0001583	missense	284				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding	g.chr8:108306234C>A	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.368G>T	8.37:g.108306234C>A	ENSP00000430750:p.Gly123Val		Somatic				ANGPT1_uc011lhv.1_Missense_Mutation_p.G123V|ANGPT1_uc003ymo.2_Missense_Mutation_p.G322V|ANGPT1_uc003ymp.3_Missense_Mutation_p.G122V	p.G323V	NM_001146	NP_001137	WXS	Illumina HiSeq	Unspecified	Q15389	ANGP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)		6	1436	-	Breast(1;5.06e-08)		323			Fibrinogen C-terminal.		Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37	c.968G>T		.	.	.	.	.	.	.	.	.	.	C	28.9	4.960985	0.92791	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820;ENST00000520734;ENST00000520052	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	5.89	5.89	0.94794	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.97495	0.9180	H	0.99454	4.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98591	1.0654	10	0.87932	D	0	.	20.327	0.98704	0.0:1.0:0.0:0.0	.	122;323;323	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	V	323;322;135;123;122	ENSP00000428340:G323V;ENSP00000297450:G322V;ENSP00000430750:G123V;ENSP00000429349:G122V	ENSP00000297450:G322V	G	-	2	0	ANGPT1	108375410	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.553000	0.82203	2.794000	0.96219	0.650000	0.86243	GGT		0.343	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290		5	97	1	0	0.00198382	0.001984	0.00237684	5	97				
CSMD3	114788	broad.mit.edu	37	8	114448979	114448979	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:114448979C>A	ENST00000297405.5	-	1	349	c.105G>T	c.(103-105)atG>atT	p.M35I	CSMD3_ENST00000455883.2_Missense_Mutation_p.M35I|CSMD3_ENST00000352409.3_Missense_Mutation_p.M35I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M35I(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCATTTTCTTCATCAGGATGA	0.502										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(103-105)ATG>ATT		CUB and Sushi multiple domains 3 isoform 1							159.0	161.0	160.0					8																	114448979		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:114448979C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.105G>T	8.37:g.114448979C>A	ENSP00000297405:p.Met35Ile	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc011lhx.1_Missense_Mutation_p.M35I|CSMD3_uc010mcx.1_Missense_Mutation_p.M35I|CSMD3_uc003ynx.3_Missense_Mutation_p.M35I	p.M35I	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			1	264	-			35			Cytoplasmic (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.105G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	5.358	0.251273	0.10130	.	.	ENSG00000164796	ENST00000297405;ENST00000455883;ENST00000352409	T;T;T	0.22336	2.32;1.96;2.32	5.82	3.94	0.45596	.	0.862134	0.09798	N	0.754402	T	0.12987	0.0315	N	0.08118	0	0.24841	N	0.99247	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.11329	0.001;0.0;0.006;0.0	T	0.30357	-0.9981	10	0.15952	T	0.53	.	15.3644	0.74510	0.0:0.7355:0.2645:0.0	.	35;35;35;35	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407	.;.;.;CSMD3_HUMAN	I	35	ENSP00000297405:M35I;ENSP00000412263:M35I;ENSP00000343124:M35I	ENSP00000297405:M35I	M	-	3	0	CSMD3	114518155	0.958000	0.32768	0.969000	0.41365	0.961000	0.63080	1.578000	0.36525	0.714000	0.32081	0.655000	0.94253	ATG		0.502	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		21	168	1	0	3.51602e-12	0.008871	6.25982e-12	21	168				
TG	7038	broad.mit.edu	37	8	133882039	133882039	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:133882039T>C	ENST00000220616.4	+	3	282	c.242T>C	c.(241-243)cTg>cCg	p.L81P	TG_ENST00000377869.1_Missense_Mutation_p.L81P	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	81	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.L81P(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGTGAAGTGCTGGGCAGCAGG	0.627																																							uc003ytw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15						c.(241-243)CTG>CCG		thyroglobulin precursor							56.0	54.0	55.0					8																	133882039		2203	4300	6503	SO:0001583	missense	7038				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	g.chr8:133882039T>C	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.242T>C	8.37:g.133882039T>C	ENSP00000220616:p.Leu81Pro		Somatic					p.L81P	NM_003235	NP_003226	WXS	Illumina HiSeq	Unspecified	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	3	283	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	81			Thyroglobulin type-1 1.		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	c.242T>C	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	T	0.085	-1.177577	0.01633	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.60548	0.18;0.18	5.44	4.56	0.56223	Thyroglobulin type-1 (5);	0.305630	0.28459	N	0.015279	T	0.14013	0.0339	N	0.00047	-2.435	0.46954	D	0.999268	B	0.06786	0.001	B	0.04013	0.001	T	0.41034	-0.9531	10	0.02654	T	1	.	10.8246	0.46625	0.0:0.9109:0.0:0.0891	.	81	P01266	THYG_HUMAN	P	81	ENSP00000367100:L81P;ENSP00000220616:L81P	ENSP00000220616:L81P	L	+	2	0	TG	133951221	0.447000	0.25673	0.493000	0.27502	0.173000	0.22820	3.840000	0.55843	1.270000	0.44297	-0.464000	0.05259	CTG		0.627	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		3	52	0	0	0	0.004672	0	3	52				
FAM135B	51059	broad.mit.edu	37	8	139151231	139151231	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:139151231G>C	ENST00000395297.1	-	18	4069	c.3899C>G	c.(3898-3900)aCa>aGa	p.T1300R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1300								p.T1300R(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CCACTGACCTGTTTTTTGGCT	0.443										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(3898-3900)ACA>AGA		hypothetical protein LOC51059							107.0	105.0	105.0					8																	139151231		1877	4112	5989	SO:0001583	missense	51059							g.chr8:139151231G>C	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3899C>G	8.37:g.139151231G>C	ENSP00000378710:p.Thr1300Arg	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.T1201R|FAM135B_uc003yuz.2_RNA	p.T1300R	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		18	4070	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1300					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.3899C>G	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344154	0.82022	.	.	ENSG00000147724	ENST00000395297	T	0.40476	1.03	5.48	5.48	0.80851	Domain of unknown function DUF676, lipase-like (1);	0.125337	0.53938	D	0.000047	T	0.44159	0.1280	N	0.04297	-0.235	0.47659	D	0.999482	D	0.76494	0.999	D	0.68483	0.958	T	0.59332	-0.7474	10	0.72032	D	0.01	-19.3681	18.3244	0.90248	0.0:0.0:1.0:0.0	.	1300	Q49AJ0	F135B_HUMAN	R	1300	ENSP00000378710:T1300R	ENSP00000378710:T1300R	T	-	2	0	FAM135B	139220413	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.956000	0.87863	2.586000	0.87340	0.655000	0.94253	ACA		0.443	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		15	61	0	0	0	0.003163	0	15	61				
TSTA3	7264	broad.mit.edu	37	8	144698279	144698279	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:144698279G>A	ENST00000425753.2	-	3	361	c.258C>T	c.(256-258)ttC>ttT	p.F86F	TSTA3_ENST00000529064.1_Silent_p.F86F	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	86					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)	p.F86F(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CACTTACCCAGAAGTCCAAAT	0.567																																							uc003yza.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(256-258)TTC>TTT		tissue specific transplantation antigen P35B	NADH(DB00157)						106.0	104.0	105.0					8																	144698279		2203	4300	6503	SO:0001819	synonymous_variant	7264				'de novo' GDP-L-fucose biosynthetic process|leukocyte cell-cell adhesion		coenzyme binding|electron carrier activity|GDP-4-dehydro-D-rhamnose reductase activity|GDP-L-fucose synthase activity|isomerase activity	g.chr8:144698279G>A	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.258C>T	8.37:g.144698279G>A			Somatic				TSTA3_uc003yzb.2_Silent_p.F86F|TSTA3_uc011lko.1_Silent_p.F86F	p.F86F	NM_003313	NP_003304	WXS	Illumina HiSeq	Unspecified	Q13630	FCL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		3	294	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		86					B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	ENST00000425753.2	37	c.258C>T	CCDS6408.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684653	0.29872	.	.	ENSG00000104522	ENST00000527006	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	T	0.59932	0.2230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58504	-0.7625	4	.	.	.	-21.2939	9.0933	0.36623	0.1019:0.0:0.8981:0.0	.	.	.	.	F	119	.	.	S	-	2	0	TSTA3	144769422	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.558000	0.53749	2.158000	0.67659	0.655000	0.94253	TCT		0.567	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313		4	45	0	0	0	0.000248	0	4	45				
TESK1	7016	broad.mit.edu	37	9	35606261	35606261	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:35606261A>T	ENST00000336395.5	+	3	619	c.369A>T	c.(367-369)ggA>ggT	p.G123G	TESK1_ENST00000498522.1_3'UTR|MIR4667_ENST00000578933.1_RNA	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	123	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.G123G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGCACCAGGGACAGCTGCACG	0.562																																							uc003zxa.2		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7						c.(367-369)GGA>GGT		testis-specific protein kinase 1							116.0	98.0	104.0					9																	35606261		2203	4300	6503	SO:0001819	synonymous_variant	7016				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr9:35606261A>T	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.369A>T	9.37:g.35606261A>T			Somatic				TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_5'UTR	p.G123G	NM_006285	NP_006276	WXS	Illumina HiSeq	Unspecified	Q15569	TESK1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		3	705	+			123			Protein kinase.		Q8IXZ8	Silent	SNP	ENST00000336395.5	37	c.369A>T	CCDS6580.1																																																																																				0.562	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285		8	71	0	0	0	0.006214	0	8	71				
SPATA31A6	389730	broad.mit.edu	37	9	43625022	43625022	+	Missense_Mutation	SNP	G	G	T	rs150951585	byFrequency	TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:43625022G>T	ENST00000332857.6	-	4	3693	c.3665C>A	c.(3664-3666)gCg>gAg	p.A1222E	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1222					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGCATGGTGCGCATGGCAAAG	0.493													G|||	10	0.00199681	0.0076	0.0	5008	,	,		13874	0.0		0.0	False		,,,				2504	0.0						uc011lrb.1		NA																	0					0						c.(3664-3666)GCG>GAG		hypothetical protein LOC389730							37.0	34.0	35.0					9																	43625022		614	1531	2145	SO:0001583	missense	389730					integral to membrane		g.chr9:43625022G>T		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3665C>A	9.37:g.43625022G>T	ENSP00000329825:p.Ala1222Glu		Somatic					p.A1222E	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			4	3694	-			1222						Missense_Mutation	SNP	ENST00000332857.6	37	c.3665C>A	CCDS47973.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	2.555	-0.303113	0.05495	.	.	ENSG00000185775	ENST00000332857	T	0.03386	3.95	2.03	-0.972	0.10300	.	1.834380	0.03064	N	0.156254	T	0.01627	0.0052	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.37126	-0.9719	10	0.02654	T	1	-0.3469	2.3434	0.04265	0.0:0.3204:0.3074:0.3722	.	1222	Q5VVP1	F75A6_HUMAN	E	1222	ENSP00000329825:A1222E	ENSP00000329825:A1222E	A	-	2	0	FAM75A6	43565018	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.272000	0.08560	-0.147000	0.11254	-0.932000	0.02703	GCG		0.493	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		27	551	1	0	1.13719e-10	0.008361	1.9784e-10	27	551				
TRPM6	140803	broad.mit.edu	37	9	77377968	77377968	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:77377968G>A	ENST00000360774.1	-	26	3856	c.3619C>T	c.(3619-3621)Cag>Tag	p.Q1207*	TRPM6_ENST00000361255.3_Nonsense_Mutation_p.Q1202*|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000449912.2_Nonsense_Mutation_p.Q1202*|TRPM6_ENST00000451710.3_Nonsense_Mutation_p.Q1207*|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Nonsense_Mutation_p.Q1207*	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1207					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q1207*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGTCCCACCTGGCTGTCCAAA	0.483																																							uc004ajl.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(3619-3621)CAG>TAG		transient receptor potential cation channel,							71.0	75.0	74.0					9																	77377968		2203	4300	6503	SO:0001587	stop_gained	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77377968G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3619C>T	9.37:g.77377968G>A	ENSP00000354006:p.Gln1207*		Somatic				TRPM6_uc004ajk.1_Nonsense_Mutation_p.Q1202*|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Nonsense_Mutation_p.Q163*	p.Q1207*	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			26	3857	-			1207			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Nonsense_Mutation	SNP	ENST00000360774.1	37	c.3619C>T	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	42	9.727464	0.99249	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	.	.	.	5.94	5.94	0.96194	.	0.206543	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	.	.	.	X	1207;1207;1202;1202;1207;870;870	.	ENSP00000309693:Q870X	Q	-	1	0	TRPM6	76567788	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.444000	0.97578	2.820000	0.97059	0.650000	0.86243	CAG		0.483	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		16	96	0	0	0	0.004007	0	16	96				
SEMA4D	10507	broad.mit.edu	37	9	92002517	92002517	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:92002517C>T	ENST00000450295.1	-	12	1890	c.1114G>A	c.(1114-1116)Gac>Aac	p.D372N	SEMA4D_ENST00000438547.2_Missense_Mutation_p.D372N|SEMA4D_ENST00000339861.4_Missense_Mutation_p.D372N|SEMA4D_ENST00000356444.2_Missense_Mutation_p.D372N|SEMA4D_ENST00000420987.1_Missense_Mutation_p.D372N|SEMA4D_ENST00000455551.2_Missense_Mutation_p.D372N|SEMA4D_ENST00000343780.4_Missense_Mutation_p.D372N|SEMA4D_ENST00000422704.2_Missense_Mutation_p.D372N			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	372	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.D372N(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GCCTCGCTGTCGATGCACTGC	0.572																																							uc004aqo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1114-1116)GAC>AAC		semaphorin 4D isoform 1							108.0	113.0	112.0					9																	92002517		2203	4300	6503	SO:0001583	missense	10507				anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding	g.chr9:92002517C>T	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1114G>A	9.37:g.92002517C>T	ENSP00000416523:p.Asp372Asn		Somatic				SEMA4D_uc011ltm.1_Missense_Mutation_p.D372N|SEMA4D_uc011ltn.1_RNA|SEMA4D_uc011lto.1_RNA|SEMA4D_uc004aqp.1_Missense_Mutation_p.D370N	p.D372N	NM_006378	NP_006369	WXS	Illumina HiSeq	Unspecified	Q92854	SEM4D_HUMAN			14	1686	-			372			Sema.|Extracellular (Potential).		B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	37	c.1114G>A	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	C	3.838	-0.034475	0.07543	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01;3.01;3.01	5.36	0.957	0.19613	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.123335	0.64402	N	0.000001	T	0.02929	0.0087	N	0.01649	-0.78	0.37107	D	0.900149	B;B	0.12630	0.006;0.001	B;B	0.11329	0.006;0.006	T	0.44967	-0.9293	10	0.10636	T	0.68	.	7.6401	0.28288	0.0:0.3591:0.0:0.6409	.	372;372	Q92854-2;Q92854	.;SEM4D_HUMAN	N	372	ENSP00000344923:D372N;ENSP00000391733:D372N;ENSP00000411981:D372N;ENSP00000343418:D372N;ENSP00000416523:D372N;ENSP00000405102:D372N;ENSP00000348822:D372N;ENSP00000388768:D372N	ENSP00000344923:D372N	D	-	1	0	SEMA4D	91192337	1.000000	0.71417	0.896000	0.35187	0.021000	0.10359	2.389000	0.44407	0.024000	0.15214	0.655000	0.94253	GAC		0.572	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378		5	55	0	0	0	0.001168	0	5	55				
PRPF4	9128	broad.mit.edu	37	9	116041389	116041389	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:116041389G>T	ENST00000374198.4	+	3	475	c.373G>T	c.(373-375)Ggt>Tgt	p.G125C	PRPF4_ENST00000374199.4_Missense_Mutation_p.G124C|PRPF4_ENST00000488937.1_3'UTR	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	125					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)		p.G125C(1)|p.G125S(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						TTTTGGAGAGGGTCCTGCTGA	0.418																																							uc004bgx.2		NA																	2	Substitution - Missense(2)	p.G125S(1)	lung(1)|pancreas(1)	ovary(2)|pancreas(1)	3						c.(373-375)GGT>TGT		PRP4 pre-mRNA processing factor 4 homolog							68.0	65.0	66.0					9																	116041389		2203	4300	6503	SO:0001583	missense	9128					Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding	g.chr9:116041389G>T	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.373G>T	9.37:g.116041389G>T	ENSP00000363313:p.Gly125Cys		Somatic				PRPF4_uc004bgy.2_Missense_Mutation_p.G124C	p.G125C	NM_004697	NP_004688	WXS	Illumina HiSeq	Unspecified	O43172	PRP4_HUMAN			3	423	+			125					O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	ENST00000374198.4	37	c.373G>T	CCDS6791.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424275	0.83667	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.65549	-0.16;-0.11	4.89	4.89	0.63831	Pre-mRNA processing factor 4 (PRP4)-like (1);Splicing factor motif (1);	0.216194	0.49305	D	0.000160	D	0.84334	0.5449	H	0.94582	3.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88518	0.3094	10	0.72032	D	0.01	.	15.3696	0.74551	0.0:0.0:1.0:0.0	.	140;125	Q59EL4;O43172	.;PRP4_HUMAN	C	124;125	ENSP00000363315:G124C;ENSP00000363313:G125C	ENSP00000363313:G125C	G	+	1	0	PRPF4	115081210	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.831000	0.92068	2.536000	0.85505	0.448000	0.29417	GGT		0.418	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697		9	59	1	0	3.09899e-07	0.004482	4.78022e-07	9	59				
NAIF1	203245	broad.mit.edu	37	9	130829231	130829231	+	Silent	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:130829231G>A	ENST00000373078.4	-	1	369	c.150C>T	c.(148-150)ggC>ggT	p.G50G	SLC25A25_ENST00000373068.2_5'Flank|NAIF1_ENST00000488519.1_5'Flank|SLC25A25_ENST00000373069.5_5'Flank	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	50	Required for nuclear localization and apoptosis-inducing activity.				negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G50G(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTCTCAGGATGCCGTGCCAGG	0.622																																							uc004bta.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(148-150)GGC>GGT		nuclear apoptosis inducing factor 1							57.0	59.0	58.0					9																	130829231		2203	4298	6501	SO:0001819	synonymous_variant	203245				apoptosis|induction of apoptosis	nucleus		g.chr9:130829231G>A	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.150C>T	9.37:g.130829231G>A			Somatic				NAIF1_uc004bsz.2_RNA|SLC25A25_uc004btb.2_5'Flank	p.G50G	NM_197956	NP_931045	WXS	Illumina HiSeq	Unspecified	Q69YI7	NAIF1_HUMAN			1	369	-			50			Required for nuclear localization and apoptosis-inducing activity.		B3KV81|Q8WU12	Silent	SNP	ENST00000373078.4	37	c.150C>T	CCDS6889.1																																																																																				0.622	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054330.1	NM_197956		16	80	0	0	0	0.003163	0	16	80				
MXRA5	25878	broad.mit.edu	37	X	3235811	3235811	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:3235811C>A	ENST00000217939.6	-	6	6065	c.5911G>T	c.(5911-5913)Gag>Tag	p.E1971*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1971	Ig-like C2-type 4.					extracellular vesicular exosome (GO:0070062)		p.E1971*(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCCAGACACTCCATTGCAATG	0.587																																							uc004crg.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(5911-5913)GAG>TAG		adlican precursor							85.0	71.0	76.0					X																	3235811		2203	4300	6503	SO:0001587	stop_gained	25878					extracellular region		g.chrX:3235811C>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5911G>T	X.37:g.3235811C>A	ENSP00000217939:p.Glu1971*		Somatic					p.E1971*	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			6	6068	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1971			Ig-like C2-type 4.		Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	ENST00000217939.6	37	c.5911G>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	c	46	12.502846	0.99673	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.64	3.64	0.41730	.	0.000000	0.37053	U	0.002264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	15.1211	0.72443	0.0:1.0:0.0:0.0	.	.	.	.	X	1971	.	ENSP00000217939:E1971X	E	-	1	0	MXRA5	3245811	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	5.009000	0.63998	1.443000	0.47586	0.600000	0.82982	GAG		0.587	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		4	73	1	0	0.000602214	0.000602	0.000744947	4	73				
STS	412	broad.mit.edu	37	X	7175602	7175602	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:7175602G>T	ENST00000217961.4	+	4	590	c.370G>T	c.(370-372)Gat>Tat	p.D124Y		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	124					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)	p.D124Y(1)|p.D124N(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	GCTTCTGAAGGATCAAGGTTA	0.483									Ichthyosis																														uc004cry.3		NA																	2	Substitution - Missense(2)	p.D124N(1)	lung(1)|central_nervous_system(1)	central_nervous_system(1)	1						c.(370-372)GAT>TAT		steryl-sulfatase precursor	Estrone(DB00655)						117.0	100.0	106.0					X																	7175602		2203	4299	6502	SO:0001583	missense	412	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity	g.chrX:7175602G>T	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.370G>T	X.37:g.7175602G>T	ENSP00000217961:p.Asp124Tyr		Somatic					p.D124Y	NM_000351	NP_000342	WXS	Illumina HiSeq	Unspecified	P08842	STS_HUMAN			4	615	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	124			Lumenal.		B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	c.370G>T	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	9.472	1.095962	0.20552	.	.	ENSG00000101846	ENST00000217961	D	0.94537	-3.45	3.76	-1.62	0.08372	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	1.556550	0.03488	N	0.216128	D	0.96093	0.8727	M	0.91354	3.2	0.31963	N	0.608186	P	0.51791	0.948	P	0.49922	0.626	D	0.86963	0.2093	10	0.72032	D	0.01	.	5.5406	0.17036	0.4475:0.1506:0.4019:0.0	.	124	P08842	STS_HUMAN	Y	124	ENSP00000217961:D124Y	ENSP00000217961:D124Y	D	+	1	0	STS	7185602	0.058000	0.20735	0.089000	0.20774	0.122000	0.20287	-0.280000	0.08468	-0.897000	0.03910	-0.340000	0.08031	GAT		0.483	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351		7	184	1	0	0.000157383	0.00308	0.000198553	7	184				
VCX3B	425054	broad.mit.edu	37	X	8433568	8433568	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:8433568C>A	ENST00000381032.1	+	2	384	c.77C>A	c.(76-78)cCg>cAg	p.P26Q	VCX3B_ENST00000453306.1_Missense_Mutation_p.P26Q|VCX3B_ENST00000440654.2_Missense_Mutation_p.P26Q|VCX3B_ENST00000444481.1_Missense_Mutation_p.P26Q|VCX3B_ENST00000381029.4_Missense_Mutation_p.P26Q	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	26						nucleolus (GO:0005730)|nucleus (GO:0005634)		p.P26Q(1)		NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						TCCTCTCAGCCGAGCCCCAGT	0.607																																							uc010ndo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(76-78)CCG>CAG		variable charge, X-linked 3B							60.0	33.0	43.0					X																	8433568		1360	2279	3639	SO:0001583	missense	425054					nucleolus		g.chrX:8433568C>A		CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.77C>A	X.37:g.8433568C>A	ENSP00000370420:p.Pro26Gln		Somatic				VCX3B_uc011mht.1_Missense_Mutation_p.P26Q|VCX3B_uc004csd.1_Missense_Mutation_p.P26Q	p.P26Q	NM_001001888	NP_001001888	WXS	Illumina HiSeq	Unspecified	Q9H321	VCX3B_HUMAN			2	384	+			26					C9JS46|Q4KN12	Missense_Mutation	SNP	ENST00000381032.1	37	c.77C>A	CCDS48077.2	.	.	.	.	.	.	.	.	.	.	c	0.102	-1.151005	0.01700	.	.	ENSG00000205642	ENST00000381032;ENST00000453306;ENST00000444481;ENST00000440654;ENST00000381029	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	0.421	-0.841	0.10752	.	.	.	.	.	T	0.05364	0.0142	N	0.08118	0	0.09310	N	1	P;B	0.35363	0.497;0.327	B;B	0.21151	0.033;0.025	T	0.24190	-1.0167	8	0.66056	D	0.02	.	.	.	.	.	26;26	Q9H321;E7ERZ8	VCX3B_HUMAN;.	Q	26	ENSP00000370420:P26Q;ENSP00000411785:P26Q;ENSP00000414780:P26Q;ENSP00000410372:P26Q;ENSP00000370417:P26Q	ENSP00000370417:P26Q	P	+	2	0	VCX3B	8393568	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-4.804000	0.00183	-2.112000	0.00835	-2.136000	0.00340	CCG		0.607	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1			13	94	1	0	1.02788e-11	0.00499	1.80472e-11	13	94				
WWC3	55841	broad.mit.edu	37	X	10092351	10092351	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:10092351G>C	ENST00000380861.4	+	13	2189	c.1798G>C	c.(1798-1800)Gga>Cga	p.G600R	WWC3_ENST00000454666.1_Missense_Mutation_p.G600R	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	600					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.G600R(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GGCCAGTAACGGAGATCCCCA	0.607																																							uc004csx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1798-1800)GGA>CGA		WWC family member 3							113.0	94.0	101.0					X																	10092351		2203	4300	6503	SO:0001583	missense	55841							g.chrX:10092351G>C	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1798G>C	X.37:g.10092351G>C	ENSP00000370242:p.Gly600Arg		Somatic				WWC3_uc010nds.2_Missense_Mutation_p.G264R|WWC3_uc010ndt.2_RNA	p.G600R	NM_015691	NP_056506	WXS	Illumina HiSeq	Unspecified	Q9ULE0	WWC3_HUMAN			13	1996	+			600					A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	c.1798G>C	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	G	7.766	0.706422	0.15239	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.18960	2.18;2.18	5.28	4.1	0.47936	C2 calcium/lipid-binding domain, CaLB (1);	0.540257	0.21370	N	0.075647	T	0.13329	0.0323	N	0.24115	0.695	0.23050	N	0.998373	B	0.19817	0.039	B	0.17098	0.017	T	0.26643	-1.0097	9	.	.	.	-2.7723	9.746	0.40446	0.1262:0.0:0.8738:0.0	.	600	Q9ULE0	WWC3_HUMAN	R	600;600;95	ENSP00000370242:G600R;ENSP00000399584:G600R	.	G	+	1	0	WWC3	10052351	1.000000	0.71417	0.007000	0.13788	0.050000	0.14768	4.882000	0.63121	0.716000	0.32124	0.513000	0.50165	GGA		0.607	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		7	65	0	0	0	0.001984	0	7	65				
PRPS2	5634	broad.mit.edu	37	X	12828215	12828215	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:12828215C>A	ENST00000380668.5	+	4	608	c.480C>A	c.(478-480)gcC>gcA	p.A160A	PRPS2_ENST00000398491.2_Silent_p.A163A|PRPS2_ENST00000489404.1_Silent_p.A160A	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	160					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.A160A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						AAAACATTGCCGAGTGGAAGA	0.468																																							uc004cvb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(478-480)GCC>GCA		phosphoribosyl pyrophosphate synthetase 2							118.0	100.0	106.0					X																	12828215		2203	4300	6503	SO:0001819	synonymous_variant	5634				nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chrX:12828215C>A	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.480C>A	X.37:g.12828215C>A			Somatic				PRPS2_uc004cva.2_Silent_p.A163A|PRPS2_uc010nec.2_Silent_p.A96A	p.A160A	NM_002765	NP_002756	WXS	Illumina HiSeq	Unspecified	P11908	PRPS2_HUMAN			4	604	+			160					Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Silent	SNP	ENST00000380668.5	37	c.480C>A	CCDS14150.1																																																																																				0.468	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765		9	119	1	0	1.76689e-08	0.006214	2.88921e-08	9	119				
CNKSR2	22866	broad.mit.edu	37	X	21627613	21627613	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:21627613G>C	ENST00000379510.3	+	20	2606	c.2570G>C	c.(2569-2571)tGt>tCt	p.C857S	CNKSR2_ENST00000425654.2_Missense_Mutation_p.C827S|CNKSR2_ENST00000543067.1_Missense_Mutation_p.C808S|CNKSR2_ENST00000279451.4_Missense_Mutation_p.C857S	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	857					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.C857S(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AACCATTGCTGTCTGAATGCT	0.552																																							uc004czx.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(2569-2571)TGT>TCT		connector enhancer of kinase suppressor of Ras							76.0	66.0	69.0					X																	21627613		2203	4300	6503	SO:0001583	missense	22866				regulation of signal transduction	cytoplasm|membrane	protein binding	g.chrX:21627613G>C	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2570G>C	X.37:g.21627613G>C	ENSP00000368824:p.Cys857Ser		Somatic				CNKSR2_uc004czw.2_Missense_Mutation_p.C857S|CNKSR2_uc011mjn.1_Missense_Mutation_p.C808S|CNKSR2_uc011mjo.1_Missense_Mutation_p.C827S|CNKSR2_uc004czy.2_Missense_Mutation_p.C449S	p.C857S	NM_014927	NP_055742	WXS	Illumina HiSeq	Unspecified	Q8WXI2	CNKR2_HUMAN			20	2606	+			857					B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	c.2570G>C	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	9.736	1.163631	0.21538	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.17213	2.57;2.29;2.3;2.59	5.85	5.85	0.93711	.	0.201644	0.53938	D	0.000048	T	0.14270	0.0345	L	0.29908	0.895	0.38122	D	0.937887	B;B;B;B	0.26318	0.002;0.085;0.146;0.001	B;B;B;B	0.22152	0.002;0.026;0.038;0.002	T	0.07986	-1.0744	10	0.37606	T	0.19	-23.147	14.5808	0.68288	0.0:0.1417:0.8583:0.0	.	827;808;449;857	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	S	827;808;857;857	ENSP00000397906:C827S;ENSP00000444633:C808S;ENSP00000279451:C857S;ENSP00000368824:C857S	ENSP00000279451:C857S	C	+	2	0	CNKSR2	21537534	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.047000	0.64232	2.444000	0.82710	0.513000	0.50165	TGT		0.552	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927		4	125	0	0	0	0.000248	0	4	125				
DCAF8L2	347442	broad.mit.edu	37	X	27765783	27765783	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:27765783G>C	ENST00000451261.2	+	5	1170	c.771G>C	c.(769-771)tgG>tgC	p.W257C		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	257								p.W224C(1)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						TGTGGGACTGGGTGCGGCAGA	0.517																																							uc011mjy.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(769-771)TGG>TGC		DDB1 and CUL4 associated factor 8-like 2							143.0	110.0	120.0					X																	27765783		692	1591	2283	SO:0001583	missense	347442							g.chrX:27765783G>C		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.771G>C	X.37:g.27765783G>C	ENSP00000462745:p.Trp257Cys		Somatic					p.W257C	NM_001136533	NP_001130005	WXS	Illumina HiSeq	Unspecified					1	858	+								B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	c.771G>C	CCDS59162.1																																																																																				0.517	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		7	28	0	0	0	0.001984	0	7	28				
FTHL17	53940	broad.mit.edu	37	X	31089982	31089982	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:31089982T>A	ENST00000359202.3	-	1	188	c.89A>T	c.(88-90)tAc>tTc	p.Y30F		NM_031894.2	NP_114100.1	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	30	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)		ferric iron binding (GO:0008199)	p.Y30F(2)		endometrium(2)|large_intestine(2)|liver(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	23						GTAGGAGGTGTAGAGCTCCAG	0.622																																							uc004dcl.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(88-90)TAC>TTC		ferritin, heavy polypeptide-like 17							80.0	70.0	73.0					X																	31089982		2202	4298	6500	SO:0001583	missense	53940				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity	g.chrX:31089982T>A	AF285592	CCDS14227.1	Xp21.2	2010-07-06			ENSG00000132446	ENSG00000132446			3987	protein-coding gene	gene with protein product	"""cancer/testis antigen 38"""	300308				11279525	Standard	NM_031894		Approved	CT38	uc004dcl.1	Q9BXU8	OTTHUMG00000021332	ENST00000359202.3:c.89A>T	X.37:g.31089982T>A	ENSP00000368207:p.Tyr30Phe		Somatic					p.Y30F	NM_031894	NP_114100	WXS	Illumina HiSeq	Unspecified	Q9BXU8	FHL17_HUMAN			1	192	-			30			Ferritin-like diiron.		Q6NT24|Q6NTE2	Missense_Mutation	SNP	ENST00000359202.3	37	c.89A>T	CCDS14227.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666304	0.47677	.	.	ENSG00000132446	ENST00000359202	T	0.63744	-0.06	3.55	3.55	0.40652	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.373486	0.27912	N	0.017342	T	0.69468	0.3114	L	0.49640	1.575	0.09310	N	1	D	0.57899	0.981	D	0.67382	0.951	T	0.58440	-0.7636	10	0.48119	T	0.1	.	9.6307	0.39778	0.0:0.0:0.0:1.0	.	30	Q9BXU8	FHL17_HUMAN	F	30	ENSP00000368207:Y30F	ENSP00000368207:Y30F	Y	-	2	0	FTHL17	30999903	0.001000	0.12720	0.002000	0.10522	0.016000	0.09150	0.429000	0.21412	1.629000	0.50426	0.437000	0.28790	TAC		0.622	FTHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056178.1	NM_031894		4	81	0	0	0	0.000248	0	4	81				
FAM47A	158724	broad.mit.edu	37	X	34148334	34148334	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:34148334C>A	ENST00000346193.3	-	1	2113	c.2062G>T	c.(2062-2064)Gca>Tca	p.A688S		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	688								p.A688S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACACGCTGTGCGGTATAAGAA	0.438																																							uc004ddg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(2062-2064)GCA>TCA		hypothetical protein LOC158724							86.0	83.0	84.0					X																	34148334		2202	4300	6502	SO:0001583	missense	158724							g.chrX:34148334C>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2062G>T	X.37:g.34148334C>A	ENSP00000345029:p.Ala688Ser		Somatic					p.A688S	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	2095	-			688					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.2062G>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	C	8.655	0.899192	0.17686	.	.	ENSG00000185448	ENST00000346193	T	0.62639	0.01	1.17	0.249	0.15531	.	.	.	.	.	T	0.41282	0.1152	L	0.28504	0.86	0.09310	N	1	B	0.33583	0.418	B	0.30716	0.119	T	0.18304	-1.0341	9	0.20519	T	0.43	.	4.8243	0.13408	0.0:0.4335:0.5665:0.0	.	688	Q5JRC9	FA47A_HUMAN	S	688	ENSP00000345029:A688S	ENSP00000345029:A688S	A	-	1	0	FAM47A	34058255	0.036000	0.19791	0.001000	0.08648	0.000000	0.00434	0.071000	0.14594	0.021000	0.15133	-0.368000	0.07277	GCA		0.438	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		6	136	1	0	2.0095e-06	0.001984	2.9334e-06	6	136				
CHDC2	286464	broad.mit.edu	37	X	36162711	36162711	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:36162711G>C	ENST00000313548.4	+	11	1480	c.1294G>C	c.(1294-1296)Gca>Cca	p.A432P		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	432	CH.					integral component of membrane (GO:0016021)		p.A432P(1)									ggagatggatgcaggagtcag	0.478																																							uc004ddk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1294-1296)GCA>CCA		hypothetical protein LOC286464							143.0	136.0	139.0					X																	36162711		2202	4300	6502	SO:0001583	missense	286464					integral to membrane		g.chrX:36162711G>C	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1294G>C	X.37:g.36162711G>C	ENSP00000324767:p.Ala432Pro		Somatic					p.A432P	NM_173695	NP_775966	WXS	Illumina HiSeq	Unspecified	Q8N9S7	CX059_HUMAN			11	1480	+			432						Missense_Mutation	SNP	ENST00000313548.4	37	c.1294G>C	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	G	4.218	0.039223	0.08148	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	0.694	-0.35	0.12606	.	3.285600	0.03600	U	0.233316	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	P	0.52061	0.95	B	0.37692	0.256	T	0.10590	-1.0623	8	0.33940	T	0.23	.	.	.	.	.	432	Q8N9S7	CX059_HUMAN	P	432	.	ENSP00000324767:A432P	A	+	1	0	CXorf59	36072632	0.037000	0.19845	0.001000	0.08648	0.001000	0.01503	0.529000	0.23019	-0.227000	0.09884	-0.225000	0.12378	GCA		0.478	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		4	173	0	0	0	0.000248	0	4	173				
SYTL5	94122	broad.mit.edu	37	X	37969676	37969676	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:37969676C>A	ENST00000357972.5	+	13	2083	c.1537C>A	c.(1537-1539)Cct>Act	p.P513T	SYTL5_ENST00000456733.2_Missense_Mutation_p.P535T|TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000297875.2_Missense_Mutation_p.P513T			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	513					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.P513T(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						AGTAGAGATTCCTTTTGACTC	0.443																																							uc004ddu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1537-1539)CCT>ACT		synaptotagmin-like 5 isoform 1							144.0	125.0	131.0					X																	37969676		2202	4300	6502	SO:0001583	missense	94122				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding	g.chrX:37969676C>A		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1537C>A	X.37:g.37969676C>A	ENSP00000350657:p.Pro513Thr		Somatic				SYTL5_uc004ddv.2_Missense_Mutation_p.P513T|SYTL5_uc004ddx.2_Missense_Mutation_p.P535T	p.P513T	NM_001163335	NP_001156807	WXS	Illumina HiSeq	Unspecified	Q8TDW5	SYTL5_HUMAN			14	2071	+			513					A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	c.1537C>A	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	C	9.562	1.118627	0.20877	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.09538	2.97;2.97;2.97	5.6	4.72	0.59763	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.201321	0.52532	D	0.000066	T	0.15046	0.0363	L	0.52011	1.625	0.29903	N	0.8242	B;B	0.27765	0.188;0.181	B;B	0.34385	0.047;0.181	T	0.03240	-1.1057	10	0.42905	T	0.14	-18.0934	15.371	0.74564	0.0:0.8605:0.1395:0.0	.	535;513	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	T	513;513;535	ENSP00000297875:P513T;ENSP00000350657:P513T;ENSP00000395220:P535T	ENSP00000297875:P513T	P	+	1	0	SYTL5	37854620	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.461000	0.45040	1.099000	0.41499	0.529000	0.55759	CCT		0.443	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780		12	147	1	0	0.00010058	0.001368	0.000127312	12	147				
SSX5	6758	broad.mit.edu	37	X	48053613	48053613	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:48053613C>A	ENST00000376923.1	-	3	231	c.232G>T	c.(232-234)Gac>Tac	p.D78Y	SSX5_ENST00000311798.1_Missense_Mutation_p.D119Y|SSX5_ENST00000347757.1_Missense_Mutation_p.D78Y			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	78	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.D119Y(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						CCCTGGAAGTCTGCGACCCGT	0.478																																							uc004dja.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(232-234)GAC>TAC		synovial sarcoma, X breakpoint 5 isoform b							155.0	135.0	141.0					X																	48053613		2203	4299	6502	SO:0001583	missense	6758				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	g.chrX:48053613C>A	BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.232G>T	X.37:g.48053613C>A	ENSP00000366122:p.Asp78Tyr		Somatic				SSX5_uc004diz.1_Missense_Mutation_p.D119Y	p.D78Y	NM_175723	NP_783729	WXS	Illumina HiSeq	Unspecified	O60225	SSX5_HUMAN			4	285	-			78			KRAB-related.		Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	37	c.232G>T	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	10.04	1.241287	0.22711	.	.	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757	T;T;T	0.08896	3.04;3.05;3.05	1.72	-1.1	0.09872	Krueppel-associated box (2);Krueppel-associated box-related (1);	1.475580	0.04191	N	0.328367	T	0.26774	0.0655	M	0.78223	2.4	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.15009	-1.0452	10	0.87932	D	0	.	4.6129	0.12411	0.0:0.5749:0.0:0.4251	.	78;119	O60225;O60225-2	SSX5_HUMAN;.	Y	119;78;78	ENSP00000312415:D119Y;ENSP00000366122:D78Y;ENSP00000290558:D78Y	ENSP00000312415:D119Y	D	-	1	0	SSX5	47938557	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.603000	0.05674	-0.345000	0.08325	0.171000	0.16805	GAC		0.478	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015		14	225	1	0	9.31168e-06	0.001855	1.31398e-05	14	225				
SSX9	280660	broad.mit.edu	37	X	48159066	48159066	+	RNA	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:48159066C>G	ENST00000608568.1	-	0	580					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.?(1)		breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						TTTCCTCTTCCCAGATGCCTT	0.527																																							uc010nib.1		NA																	1	Unknown(1)		lung(1)		NA						c.e6+1		synovial sarcoma, X breakpoint 9							176.0	168.0	171.0					X																	48159066		2203	4299	6502			0							g.chrX:48159066C>G	BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48159066C>G			Somatic					p.G156_splice	NM_174962	NP_777622	WXS	Illumina HiSeq	Unspecified					6	553	-									Splice_Site	SNP	ENST00000608568.1	37	c.466_splice		.	.	.	.	.	.	.	.	.	.	N	3.152	-0.174083	0.06421	.	.	ENSG00000204648	ENST00000376909;ENST00000407081	.	.	.	1.21	1.21	0.21127	.	.	.	.	.	.	.	.	.	.	.	0.22911	N	0.998575	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3895	0.16236	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SSX9	48044010	0.886000	0.30341	0.026000	0.17262	0.013000	0.08279	2.178000	0.42519	0.885000	0.36088	0.171000	0.16805	.		0.527	SSX9-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000472372.1	NR_073393		35	252	0	0	0	0.003755	0	35	252				
WNK3	65267	broad.mit.edu	37	X	54259271	54259271	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:54259271G>T	ENST00000375159.2	-	20	4810	c.4811C>A	c.(4810-4812)aCa>aAa	p.T1604K	WNK3_ENST00000375169.3_Missense_Mutation_p.T1557K|WNK3_ENST00000354646.2_Missense_Mutation_p.T1604K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1604					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.T1604K(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GTCCACATGTGTCAAGGACTG	0.383																																							uc004dtd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(4669-4671)ACA>AAA		WNK lysine deficient protein kinase 3 isoform 2							114.0	105.0	108.0					X																	54259271		2203	4300	6503	SO:0001583	missense	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54259271G>T	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4811C>A	X.37:g.54259271G>T	ENSP00000364301:p.Thr1604Lys		Somatic				WNK3_uc004dtc.1_Missense_Mutation_p.T1604K	p.T1557K	NM_001002838	NP_001002838	WXS	Illumina HiSeq	Unspecified	Q9BYP7	WNK3_HUMAN			21	5109	-			1557					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	c.4670C>A	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996779	0.74818	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.39787	1.06;1.06;1.06	5.55	4.69	0.59074	.	0.220923	0.31963	N	0.006795	T	0.51227	0.1662	L	0.60455	1.87	0.35391	D	0.79079	D;D	0.63046	0.992;0.986	P;P	0.54544	0.755;0.573	T	0.62412	-0.6860	10	0.38643	T	0.18	-7.4462	12.4462	0.55651	0.0848:0.0:0.9152:0.0	.	1557;1604	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	K	1557;1604;1604	ENSP00000364312:T1557K;ENSP00000346667:T1604K;ENSP00000364301:T1604K	ENSP00000346667:T1604K	T	-	2	0	WNK3	54275996	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.326000	0.72905	1.225000	0.43566	0.594000	0.82650	ACA		0.383	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		14	146	1	0	2.31682e-05	0.003163	3.14131e-05	14	146				
RGAG4	340526	broad.mit.edu	37	X	71349932	71349932	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:71349932C>A	ENST00000545866.1	-	1	1826	c.1459G>T	c.(1459-1461)Ggt>Tgt	p.G487C	NHSL2_ENST00000540800.1_Intron|RGAG4_ENST00000609883.1_Missense_Mutation_p.G487C	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	487								p.G560C(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GCGTGGTAACCACTTGTGGGG	0.557																																							uc010nlh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1459-1461)GGT>TGT		retrotransposon gag domain containing 4							80.0	79.0	79.0					X																	71349932		2094	4202	6296	SO:0001583	missense	340526							g.chrX:71349932C>A	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1459G>T	X.37:g.71349932C>A	ENSP00000441366:p.Gly487Cys		Somatic				NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA	p.G487C	NM_001024455	NP_001019626	WXS	Illumina HiSeq	Unspecified	Q5HYW3	RGAG4_HUMAN			1	1820	-	Renal(35;0.156)		487					A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	c.1459G>T	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465617	0.26335	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.16324	2.35;2.35	2.41	2.41	0.29592	.	.	.	.	.	T	0.21841	0.0526	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.65140	0.932	T	0.12400	-1.0549	8	.	.	.	.	10.0424	0.42166	0.0:1.0:0.0:0.0	.	487	Q5HYW3	RGAG4_HUMAN	C	487	ENSP00000441366:G487C;ENSP00000418667:G487C	.	G	-	1	0	RGAG4	71266657	0.168000	0.22989	0.004000	0.12327	0.009000	0.06853	0.864000	0.27926	1.470000	0.48102	0.513000	0.50165	GGT		0.557	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455		13	47	1	0	0.00136819	0.001368	0.00166013	13	47				
CYLC1	1538	broad.mit.edu	37	X	83128659	83128659	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:83128659A>G	ENST00000329312.4	+	4	980	c.943A>G	c.(943-945)Aaa>Gaa	p.K315E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	315					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K315E(1)|p.K314E(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAAAGTTAAGAAAAATGTCAA	0.343																																							uc004eei.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(943-945)AAA>GAA		cylicin, basic protein of sperm head							42.0	39.0	40.0					X																	83128659		2195	4295	6490	SO:0001583	missense	1538				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity	g.chrX:83128659A>G	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.943A>G	X.37:g.83128659A>G	ENSP00000331556:p.Lys315Glu		Somatic				CYLC1_uc004eeh.1_Missense_Mutation_p.K314E	p.K315E	NM_021118	NP_066941	WXS	Illumina HiSeq	Unspecified	P35663	CYLC1_HUMAN			4	964	+			315			2.		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	c.943A>G	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	a	1.029	-0.682518	0.03353	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.27104	1.69	2.38	2.38	0.29361	.	.	.	.	.	T	0.25975	0.0633	L	0.54323	1.7	0.09310	N	1	P;P	0.44139	0.827;0.827	P;P	0.46026	0.501;0.501	T	0.08186	-1.0734	9	0.24483	T	0.36	-7.2151	6.0572	0.19819	1.0:0.0:0.0:0.0	.	315;315	P35663;F5H4V5	CYLC1_HUMAN;.	E	315	ENSP00000331556:K315E	ENSP00000331556:K315E	K	+	1	0	CYLC1	83015315	0.256000	0.24012	0.018000	0.16275	0.037000	0.13140	1.811000	0.38942	1.221000	0.43506	0.486000	0.48141	AAA		0.343	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		13	57	0	0	0	0.001855	0	13	57				
HDX	139324	broad.mit.edu	37	X	83730391	83730391	+	Silent	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:83730391A>T	ENST00000297977.5	-	2	126	c.15T>A	c.(13-15)tcT>tcA	p.S5S	HDX_ENST00000506585.2_Intron|HDX_ENST00000373177.2_Silent_p.S5S	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	5						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S5S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CAGTAAATACAGAACGTAGAT	0.279																																					Pancreas(53;231 1169 36156 43751 51139)	Pancreas(53;231 1169 36156 43751 51139)	uc004eek.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(13-15)TCT>TCA		highly divergent homeobox							44.0	36.0	39.0					X																	83730391		2202	4297	6499	SO:0001819	synonymous_variant	139324					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:83730391A>T	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.15T>A	X.37:g.83730391A>T			Somatic				HDX_uc011mqv.1_Silent_p.S5S|HDX_uc004eel.1_Intron	p.S5S	NM_144657	NP_653258	WXS	Illumina HiSeq	Unspecified	Q7Z353	HDX_HUMAN			2	124	-			5			Homeobox 1.		A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	ENST00000297977.5	37	c.15T>A	CCDS35342.1																																																																																				0.279	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657		4	46	0	0	0	0.000248	0	4	46				
GPRASP1	9737	broad.mit.edu	37	X	101910104	101910104	+	Silent	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:101910104C>A	ENST00000361600.5	+	5	2064	c.1263C>A	c.(1261-1263)gcC>gcA	p.A421A	GPRASP1_ENST00000415986.1_Silent_p.A421A|GPRASP1_ENST00000444152.1_Silent_p.A421A|GPRASP1_ENST00000537097.1_Silent_p.A421A|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	421					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.A421A(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CAGATGAAGCCAGCATAGAGT	0.552																																							uc004ejj.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(1261-1263)GCC>GCA		G protein-coupled receptor associated sorting							72.0	71.0	71.0					X																	101910104		2203	4300	6503	SO:0001819	synonymous_variant	9737					cytoplasm	protein binding	g.chrX:101910104C>A	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1263C>A	X.37:g.101910104C>A			Somatic				GPRASP1_uc004eji.3_Silent_p.A421A|GPRASP1_uc010nod.2_Silent_p.A421A	p.A421A	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	2064	+			421					O43168|Q96LA1	Silent	SNP	ENST00000361600.5	37	c.1263C>A	CCDS35352.1																																																																																				0.552	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		21	88	1	0	1.96292e-10	0.001523	3.3688e-10	21	88				
GPRASP1	9737	broad.mit.edu	37	X	101911166	101911166	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:101911166G>T	ENST00000361600.5	+	5	3126	c.2325G>T	c.(2323-2325)gaG>gaT	p.E775D	GPRASP1_ENST00000415986.1_Missense_Mutation_p.E775D|GPRASP1_ENST00000444152.1_Missense_Mutation_p.E775D|GPRASP1_ENST00000537097.1_Missense_Mutation_p.E775D|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	775	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.E775D(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AAGCTGAGGAGGGGGACATTA	0.493																																							uc004ejj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(2323-2325)GAG>GAT		G protein-coupled receptor associated sorting							95.0	100.0	98.0					X																	101911166		2203	4300	6503	SO:0001583	missense	9737					cytoplasm	protein binding	g.chrX:101911166G>T	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2325G>T	X.37:g.101911166G>T	ENSP00000355146:p.Glu775Asp		Somatic				GPRASP1_uc004eji.3_Missense_Mutation_p.E775D|GPRASP1_uc010nod.2_Missense_Mutation_p.E775D	p.E775D	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	3126	+			775			Glu-rich.		O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	c.2325G>T	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	9.169	1.020576	0.19433	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	2.68	0.862	0.19056	.	.	.	.	.	T	0.18635	0.0447	L	0.55990	1.75	0.09310	N	1	D	0.54772	0.968	P	0.54664	0.758	T	0.16070	-1.0415	9	0.23302	T	0.38	-5.1022	4.7523	0.13066	0.3307:0.0:0.6693:0.0	.	775	Q5JY77	GASP1_HUMAN	D	775	ENSP00000393691:E775D;ENSP00000409420:E775D;ENSP00000355146:E775D;ENSP00000445683:E775D	ENSP00000355146:E775D	E	+	3	2	GPRASP1	101797822	0.001000	0.12720	0.013000	0.15412	0.087000	0.18053	-0.251000	0.08818	0.102000	0.17638	-0.729000	0.03580	GAG		0.493	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		7	177	1	0	1.06961e-07	0.00308	1.68398e-07	7	177				
IL1RAPL2	26280	broad.mit.edu	37	X	104440287	104440287	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:104440287G>T	ENST00000372582.1	+	3	969	c.213G>T	c.(211-213)ggG>ggT	p.G71G	IL1RAPL2_ENST00000344799.4_Silent_p.G71G	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	71	Ig-like C2-type 1.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.G71G(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGAGCACTGGGCTCAGGCTTA	0.448																																							uc004elz.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(211-213)GGG>GGT		interleukin 1 receptor accessory protein-like 2							111.0	93.0	99.0					X																	104440287		2203	4300	6503	SO:0001819	synonymous_variant	26280				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity	g.chrX:104440287G>T	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.213G>T	X.37:g.104440287G>T			Somatic					p.G71G	NM_017416	NP_059112	WXS	Illumina HiSeq	Unspecified	Q9NP60	IRPL2_HUMAN			3	969	+			71			Ig-like C2-type 1.|Extracellular (Potential).		Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	c.213G>T	CCDS14517.1																																																																																				0.448	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416		26	91	1	0	3.28513e-13	0.003954	6.01747e-13	26	91				
COL4A5	1287	broad.mit.edu	37	X	107827715	107827715	+	Splice_Site	SNP	G	G	T	rs104886092		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:107827715G>T	ENST00000361603.2	+	18	1236	c.992G>T	c.(991-993)gGc>gTc	p.G331V	COL4A5_ENST00000328300.6_Splice_Site_p.G331V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	331	Triple-helical region.		G -> V (in APSX).		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G331V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATTGAACAGGGCCAAAAAGGT	0.328									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4	GRCh37	CM990387	COL4A5	M	rs104886092	c.(991-993)GGC>GTC		type IV collagen alpha 5 isoform 2 precursor							73.0	72.0	72.0					X																	107827715		2203	4300	6503	SO:0001630	splice_region_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107827715G>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.991-1G>T	X.37:g.107827715G>T			Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.G331V|COL4A5_uc004eob.1_5'UTR	p.G331V	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			18	1194	+			331		G -> V (in APSX).	Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.992G>T	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078545	0.55753	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99637	-6.29;-6.29	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.99816	0.9919	H	0.97918	4.105	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96698	0.9516	9	0.87932	D	0	.	18.2578	0.90025	0.0:0.0:1.0:0.0	.	331;331	E7EVY4;P29400	.;CO4A5_HUMAN	V	331	ENSP00000331902:G331V;ENSP00000354505:G331V	ENSP00000331902:G331V	G	+	2	0	COL4A5	107714371	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.802000	0.85969	2.445000	0.82738	0.600000	0.82982	GGC		0.328	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		Missense_Mutation	7	75	1	0	5.18039e-06	0.00308	7.33728e-06	7	75				
CAPN6	827	broad.mit.edu	37	X	110490609	110490609	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:110490609G>A	ENST00000324068.1	-	12	1897	c.1730C>T	c.(1729-1731)cCt>cTt	p.P577L	CAPN6_ENST00000541758.1_Missense_Mutation_p.P322L	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	577	C2.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.P577L(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						TACTATAATAGGAATGTCAGT	0.423																																							uc004epc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(1729-1731)CCT>CTT		calpain 6							170.0	155.0	160.0					X																	110490609		2203	4300	6503	SO:0001583	missense	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110490609G>A	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1730C>T	X.37:g.110490609G>A	ENSP00000317214:p.Pro577Leu		Somatic				CAPN6_uc011msu.1_Missense_Mutation_p.P322L	p.P577L	NM_014289	NP_055104	WXS	Illumina HiSeq	Unspecified	Q9Y6Q1	CAN6_HUMAN			12	1898	-			577			C2.		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	37	c.1730C>T	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803168	0.90623	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	T;T	0.70516	-0.49;-0.49	5.14	5.14	0.70334	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	1.002720	0.08036	N	0.994342	T	0.81837	0.4907	M	0.73217	2.22	0.80722	D	1	P	0.45078	0.85	P	0.53722	0.733	T	0.76107	-0.3080	10	0.52906	T	0.07	.	16.3475	0.83150	0.0:0.0:1.0:0.0	.	577	Q9Y6Q1	CAN6_HUMAN	L	577;322	ENSP00000317214:P577L;ENSP00000441736:P322L	ENSP00000317214:P577L	P	-	2	0	CAPN6	110377265	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.695000	0.74593	2.380000	0.81148	0.456000	0.33151	CCT		0.423	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			8	297	0	0	0	0.006214	0	8	297				
WDR44	54521	broad.mit.edu	37	X	117543510	117543510	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:117543510A>T	ENST00000254029.3	+	11	1987	c.1592A>T	c.(1591-1593)cAa>cTa	p.Q531L	WDR44_ENST00000371825.3_Missense_Mutation_p.Q531L|WDR44_ENST00000371822.5_Missense_Mutation_p.Q506L	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	531						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.Q531L(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						TCAGCTGGACAAGACAATGTA	0.333																																							uc004eqn.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(1591-1593)CAA>CTA		WD repeat domain 44 protein							107.0	103.0	104.0					X																	117543510		2203	4300	6503	SO:0001583	missense	54521					cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm		g.chrX:117543510A>T	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1592A>T	X.37:g.117543510A>T	ENSP00000254029:p.Gln531Leu		Somatic				WDR44_uc004eqo.2_Missense_Mutation_p.Q531L|WDR44_uc011mtr.1_Missense_Mutation_p.Q506L|WDR44_uc010nqi.2_Missense_Mutation_p.Q241L	p.Q531L	NM_019045	NP_061918	WXS	Illumina HiSeq	Unspecified	Q5JSH3	WDR44_HUMAN			11	2017	+			531			WD 1.		B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	c.1592A>T	CCDS14572.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.588535	0.86851	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.59364	0.27;0.27;0.27	5.11	5.11	0.69529	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	N	0.21508	0.67	0.80722	D	1	D;D;D;D	0.89917	0.98;1.0;1.0;1.0	D;D;D;D	0.91635	0.952;0.999;0.998;0.998	T	0.67677	-0.5609	10	0.59425	D	0.04	-3.6519	14.0966	0.65027	1.0:0.0:0.0:0.0	.	506;531;531;531	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.;.;.;WDR44_HUMAN	L	506;531;531	ENSP00000360887:Q506L;ENSP00000254029:Q531L;ENSP00000360890:Q531L	ENSP00000254029:Q531L	Q	+	2	0	WDR44	117427538	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.260000	0.95568	1.706000	0.51276	0.341000	0.21757	CAA		0.333	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045		5	183	0	0	0	0.000602	0	5	183				
ATP1B4	23439	broad.mit.edu	37	X	119505001	119505001	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:119505001C>G	ENST00000218008.3	+	4	555	c.498C>G	c.(496-498)aaC>aaG	p.N166K	ATP1B4_ENST00000539306.1_Missense_Mutation_p.N123K|ATP1B4_ENST00000361319.3_Missense_Mutation_p.N162K	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	166					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.N162K(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						TTAACTTCAACTTCAACGTTT	0.398																																							uc004esr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(496-498)AAC>AAG		ATPase, (Na+)/K+ transporting, beta 4							137.0	113.0	121.0					X																	119505001		2203	4300	6503	SO:0001583	missense	23439				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity	g.chrX:119505001C>G	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.498C>G	X.37:g.119505001C>G	ENSP00000218008:p.Asn166Lys		Somatic				ATP1B4_uc004esq.2_Missense_Mutation_p.N162K|ATP1B4_uc011mtx.1_Missense_Mutation_p.N131K|ATP1B4_uc011mty.1_Missense_Mutation_p.N123K	p.N166K	NM_001142447	NP_001135919	WXS	Illumina HiSeq	Unspecified	Q9UN42	AT1B4_HUMAN			4	582	+			166			Perinuclear space (Potential).		Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	c.498C>G	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497987	0.44455	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.27720	1.65;1.65;1.65	5.51	4.65	0.58169	.	0.091150	0.64402	D	0.000001	T	0.34106	0.0886	L	0.28556	0.865	0.38369	D	0.944831	D;B;D;D	0.58970	0.984;0.024;0.984;0.98	P;B;P;P	0.57204	0.815;0.009;0.815;0.718	T	0.12837	-1.0532	10	0.27082	T	0.32	-33.0605	10.9296	0.47209	0.0:0.9112:0.0:0.0888	.	123;131;166;162	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	K	166;162;123	ENSP00000218008:N166K;ENSP00000355346:N162K;ENSP00000443334:N123K	ENSP00000218008:N166K	N	+	3	2	ATP1B4	119389029	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.204000	0.42761	1.083000	0.41159	0.544000	0.68410	AAC		0.398	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447		9	145	0	0	0	0.004482	0	9	145				
CUL4B	8450	broad.mit.edu	37	X	119668355	119668355	+	Silent	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:119668355G>T	ENST00000404115.3	-	19	2702	c.2301C>A	c.(2299-2301)atC>atA	p.I767I	CUL4B_ENST00000371322.5_Silent_p.I749I|CUL4B_ENST00000336592.6_Silent_p.I754I	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	767					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.I749I(1)|p.I767I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TTGCCTGCTTGATCTCTTCTA	0.388																																							uc004esw.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(2299-2301)ATC>ATA		cullin 4B isoform 1							200.0	187.0	191.0					X																	119668355		2203	4300	6503	SO:0001819	synonymous_variant	8450				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding	g.chrX:119668355G>T	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2301C>A	X.37:g.119668355G>T			Somatic				CUL4B_uc010nqq.2_Silent_p.I468I|CUL4B_uc004esv.2_Silent_p.I749I	p.I767I	NM_003588	NP_003579	WXS	Illumina HiSeq	Unspecified	Q13620	CUL4B_HUMAN			19	2738	-			767					B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	ENST00000404115.3	37	c.2301C>A	CCDS35379.1																																																																																				0.388	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588		37	260	1	0	6.33695e-27	0.007835	1.23183e-26	37	260				
GPR112	139378	broad.mit.edu	37	X	135430312	135430312	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:135430312G>T	ENST00000394143.1	+	6	4738	c.4447G>T	c.(4447-4449)Gac>Tac	p.D1483Y	GPR112_ENST00000370652.1_Missense_Mutation_p.D1483Y|GPR112_ENST00000412101.1_Missense_Mutation_p.D1278Y|GPR112_ENST00000287534.4_Missense_Mutation_p.D1420Y|GPR112_ENST00000394141.1_Missense_Mutation_p.D1278Y	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1483					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D1483Y(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AGTTCTCTCCGACAGGATCAC	0.433																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4447-4449)GAC>TAC		G-protein coupled receptor 112							99.0	98.0	98.0					X																	135430312		2203	4299	6502	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430312G>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4447G>T	X.37:g.135430312G>T	ENSP00000377699:p.Asp1483Tyr		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.D1278Y|GPR112_uc010nsc.1_Missense_Mutation_p.D1250Y	p.D1483Y	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	4738	+	Acute lymphoblastic leukemia(192;0.000127)		1483			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4447G>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	12.86	2.063774	0.36373	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.35236	1.36;1.36;1.32;1.45;1.32	2.81	0.852	0.18995	.	.	.	.	.	T	0.42314	0.1197	L	0.32530	0.975	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.87578	0.998;0.973;0.907	T	0.18241	-1.0343	9	0.72032	D	0.01	.	4.3839	0.11307	0.3628:0.0:0.6372:0.0	.	1420;1278;1483	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	Y	1483;1483;1278;1420;1278	ENSP00000377699:D1483Y;ENSP00000359686:D1483Y;ENSP00000416526:D1278Y;ENSP00000287534:D1420Y;ENSP00000377697:D1278Y	ENSP00000287534:D1420Y	D	+	1	0	GPR112	135257978	0.012000	0.17670	0.003000	0.11579	0.212000	0.24457	0.337000	0.19841	0.327000	0.23409	0.464000	0.42555	GAC		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			19	233	1	0	3.57192e-18	0.006122	6.83871e-18	19	233				
GABRA3	2556	broad.mit.edu	37	X	151336800	151336800	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:151336800C>A	ENST00000370314.4	-	10	1617	c.1379G>T	c.(1378-1380)cGc>cTc	p.R460L	RP11-329E24.6_ENST00000453915.1_RNA|GABRA3_ENST00000535043.1_Missense_Mutation_p.R460L	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	460					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R460L(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	AAAGATGATGCGGGAAATTTT	0.498																																					NSCLC(142;2578 2613 10251 16743)	NSCLC(142;2578 2613 10251 16743)	uc010ntk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1378-1380)CGC>CTC		gamma-aminobutyric acid A receptor, alpha 3	Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						238.0	187.0	204.0					X																	151336800		2203	4300	6503	SO:0001583	missense	2556				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chrX:151336800C>A		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.1379G>T	X.37:g.151336800C>A	ENSP00000359337:p.Arg460Leu		Somatic					p.R460L	NM_000808	NP_000799	WXS	Illumina HiSeq	Unspecified	P34903	GBRA3_HUMAN			10	1619	-	Acute lymphoblastic leukemia(192;6.56e-05)		460			Helical; (Probable).		Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	c.1379G>T	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578386	0.86645	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.84298	-1.83;-1.83;-1.83	4.57	4.57	0.56435	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92509	0.7621	M	0.85859	2.78	0.58432	D	0.999999	D	0.64830	0.994	D	0.76575	0.988	D	0.93732	0.7042	10	0.87932	D	0	.	14.1829	0.65586	0.0:1.0:0.0:0.0	.	460	P34903	GBRA3_HUMAN	L	460	ENSP00000359337:R460L;ENSP00000359334:R460L;ENSP00000443527:R460L	ENSP00000359334:R460L	R	-	2	0	GABRA3	151087456	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.723000	0.84788	2.011000	0.59026	0.540000	0.68198	CGC		0.498	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808		44	157	1	0	1.15183e-24	0.002222	2.22765e-24	44	157				
MLEC	9761	broad.mit.edu	37	12	121134166	121134168	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	GAA	GAA	-	-	GAA	GAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:121134166_121134168delGAA	ENST00000228506.3	+	5	1125_1127	c.697_699delGAA	c.(697-699)gaadel	p.E238del	RP11-173P15.3_ENST00000541383.1_RNA|MLEC_ENST00000412616.2_In_Frame_Del_p.K159del|RP11-173P15.3_ENST00000535720.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	238	Poly-Glu.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.E233E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						gaaagaagaggaagaagaagaag	0.458																																							uc001tyy.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(1)	1						c.(697-699)GAAdel		malectin precursor				4,33,4227		0,0,4,8,17,2103						1.0	1.0			129	1,29,8224		0,0,1,6,17,4103	no	codingComplex	MLEC	NM_014730.2		0,0,5,14,34,6206	A1A1,A1A2,A1R,A2A2,A2R,RR		0.3635,0.8677,0.5352				5,62,12451				SO:0001651	inframe_deletion	9761				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding	g.chr12:121134166_121134168delGAA	BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.697_699delGAA	12.37:g.121134175_121134177delGAA	ENSP00000228506:p.Glu238del		Somatic					p.E238del	NM_014730	NP_055545	WXS	Illumina HiSeq	Unspecified	Q14165	MLEC_HUMAN			5	848_850	+			238			Poly-Glu.|Lumenal (Potential).			In_Frame_Del	DEL	ENST00000228506.3	37	c.697_699delGAA	CCDS9206.1																																																																																				0.458	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730		8	196	NA	NA	NA	NA	NA	8	196	---	---	---	---
ACSF2	80221	broad.mit.edu	37	17	48503739	48503739	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:48503739delC	ENST00000300441.4	+	1	221	c.117delC	c.(115-117)gtcfs	p.V39fs	ACSF2_ENST00000502667.1_Frame_Shift_Del_p.V39fs|ACSF2_ENST00000504392.1_Frame_Shift_Del_p.V39fs|ACSF2_ENST00000427954.2_Frame_Shift_Del_p.V39fs|ACSF2_ENST00000541920.1_5'UTR	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	39					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TGCAGGGTGTCCGCTTCCTCA	0.726																																							uc002iqu.2		NA																	0					0						c.(115-117)GTCfs		acyl-CoA synthetase family member 2 precursor							9.0	13.0	12.0					17																	48503739		2140	4234	6374	SO:0001589	frameshift_variant	80221				fatty acid metabolic process	mitochondrion	ATP binding|ligase activity	g.chr17:48503739delC	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.117delC	17.37:g.48503739delC	ENSP00000300441:p.Val39fs		Somatic				ACSF2_uc010wml.1_Frame_Shift_Del_p.V39fs|ACSF2_uc010wmm.1_Frame_Shift_Del_p.V39fs|ACSF2_uc010wmn.1_Frame_Shift_Del_p.V39fs|ACSF2_uc010wmo.1_5'UTR	p.V39fs	NM_025149	NP_079425	WXS	Illumina HiSeq	Unspecified	Q96CM8	ACSF2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.55e-09)		1	221	+	Breast(11;1.93e-18)		39					B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Frame_Shift_Del	DEL	ENST00000300441.4	37	c.117delC	CCDS11567.1																																																																																				0.726	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
MED13	9969	broad.mit.edu	37	17	60107282	60107283	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr17:60107282_60107283delGT	ENST00000397786.2	-	7	1177_1178	c.1101_1102delAC	c.(1099-1104)atacccfs	p.P368fs	MED13_ENST00000580896.1_5'Flank	NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	368					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AATTTTCTGGGTATTTTCCCAC	0.381																																							uc002izo.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1099-1104)ATACCCfs		mediator complex subunit 13																																				SO:0001589	frameshift_variant	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60107282_60107283delGT	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.1101_1102delAC	17.37:g.60107282_60107283delGT	ENSP00000380888:p.Pro368fs		Somatic				MED13_uc002izp.2_5'UTR	p.I367fs	NM_005121	NP_005112	WXS	Illumina HiSeq	Unspecified	Q9UHV7	MED13_HUMAN			7	1178_1179	-			367_368					B2RU05|O60334	Frame_Shift_Del	DEL	ENST00000397786.2	37	c.1101_1102delAC	CCDS42366.1																																																																																				0.381	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		28	85	NA	NA	NA	NA	NA	28	85	---	---	---	---
ZADH2	284273	broad.mit.edu	37	18	72920829	72920830	+	Frame_Shift_Ins	INS	-	-	C			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr18:72920829_72920830insC	ENST00000322342.3	-	1	473_474	c.184_185insG	c.(184-186)gacfs	p.D62fs	TSHZ1_ENST00000322038.5_5'Flank|TSHZ1_ENST00000580243.1_5'Flank	NM_175907.4	NP_787103.1	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain containing 2	62						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(8)|skin(1)	15		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		GAGGTCTCCGTCCCCGGGGAGC	0.757																																							uc002llx.2		NA																	0					0						c.(184-186)GACfs		zinc binding alcohol dehydrogenase domain																																				SO:0001589	frameshift_variant	284273					peroxisome	oxidoreductase activity|zinc ion binding	g.chr18:72920829_72920830insC	BC033780	CCDS12008.1	18q22.3	2008-05-29	2008-05-29		ENSG00000180011	ENSG00000180011			28697	protein-coding gene	gene with protein product						12477932	Standard	NM_175907		Approved	MGC45594	uc002llx.3	Q8N4Q0	OTTHUMG00000132858	ENST00000322342.3:c.185dupG	18.37:g.72920833_72920833dupC	ENSP00000323678:p.Asp62fs		Somatic				TSHZ1_uc002lly.2_5'Flank	p.D62fs	NM_175907	NP_787103	WXS	Illumina HiSeq	Unspecified	Q8N4Q0	ZADH2_HUMAN		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)	1	452_453	-		Esophageal squamous(42;0.131)|Prostate(75;0.155)	62					A8KA15|B4DZ91	Frame_Shift_Ins	INS	ENST00000322342.3	37	c.184_185insG	CCDS12008.1																																																																																				0.757	ZADH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256332.1	NM_175907		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
IFNAR2	3455	broad.mit.edu	37	21	34635338	34635338	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr21:34635338delG	ENST00000342136.4	+	9	1407	c.1081delG	c.(1081-1083)gacfs	p.D361fs	IFNAR2_ENST00000404220.3_3'UTR|IL10RB-AS1_ENST00000411998.1_RNA|AP000295.9_ENST00000433395.2_Intron|IFNAR2_ENST00000382241.3_Frame_Shift_Del_p.D361fs|IFNAR2_ENST00000342101.3_3'UTR			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2	361					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	CCAGTTGATAGACCCGGAGTC	0.607																																							uc002yrd.2		NA																	0					0						c.(1081-1083)GACfs		interferon alpha/beta receptor 2 isoform a	Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)						63.0	66.0	65.0					21																	34635338		2203	4300	6503	SO:0001589	frameshift_variant	3455				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to interferon-alpha|response to virus|type I interferon-mediated signaling pathway	extracellular region|extracellular space|integral to plasma membrane	protein kinase binding|type I interferon binding|type I interferon receptor activity	g.chr21:34635338delG		CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.1081delG	21.37:g.34635338delG	ENSP00000343957:p.Asp361fs		Somatic				IFNAR2_uc002yre.2_Frame_Shift_Del_p.D361fs|IFNAR2_uc002yrf.2_3'UTR|IL10RB_uc002yrh.1_Intron|IL10RB_uc002yri.1_Intron	p.D361fs	NM_207585	NP_997468	WXS	Illumina HiSeq	Unspecified	P48551	INAR2_HUMAN			9	1409	+			361			Cytoplasmic (Potential).		A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Frame_Shift_Del	DEL	ENST00000342136.4	37	c.1081delG	CCDS13621.1																																																																																				0.607	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1			14	78	NA	NA	NA	NA	NA	14	78	---	---	---	---
SLITRK3	22865	broad.mit.edu	37	3	164906357	164906357	+	Frame_Shift_Del	DEL	G	G	-	rs146211129		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr3:164906357delG	ENST00000475390.1	-	2	2705	c.2262delC	c.(2260-2262)cccfs	p.P754fs	SLITRK3_ENST00000241274.3_Frame_Shift_Del_p.P754fs			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	754					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P754P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GCTTGTAGATGGGGTTGTTGC	0.582										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(2260-2262)CCCfs		slit and trk like 3 protein precursor							81.0	81.0	81.0					3																	164906357		2203	4300	6503	SO:0001589	frameshift_variant	22865					integral to membrane		g.chr3:164906357delG	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2262delC	3.37:g.164906357delG	ENSP00000420091:p.Pro754fs	HNSCC(40;0.11)	Somatic				SLITRK3_uc003fek.2_Frame_Shift_Del_p.P754fs	p.P754fs	NM_014926	NP_055741	WXS	Illumina HiSeq	Unspecified	O94933	SLIK3_HUMAN			2	2706	-			754			Cytoplasmic (Potential).		Q1RMY6	Frame_Shift_Del	DEL	ENST00000475390.1	37	c.2262delC	CCDS3197.1																																																																																				0.582	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		18	126	NA	NA	NA	NA	NA	18	126	---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65349867	65349867	+	Frame_Shift_Del	DEL	A	A	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr5:65349867delA	ENST00000284037.5	+	21	3110	c.2721delA	c.(2719-2721)ggafs	p.G907fs	ERBB2IP_ENST00000380943.2_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000380939.2_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000511297.1_Frame_Shift_Del_p.G903fs|ERBB2IP_ENST00000506030.1_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000380935.1_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000508515.1_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000380936.1_Frame_Shift_Del_p.G907fs|ERBB2IP_ENST00000380938.2_Frame_Shift_Del_p.G907fs	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	907					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CTGTTGATGGAAAAAATATAG	0.378																																							uc003juk.1		NA																	0				ovary(3)|lung(2)|central_nervous_system(2)	7						c.(2719-2721)GGAfs		ERBB2 interacting protein isoform 2							571.0	551.0	558.0					5																	65349867		2203	4300	6503	SO:0001589	frameshift_variant	55914				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton	g.chr5:65349867delA		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2721delA	5.37:g.65349867delA	ENSP00000284037:p.Gly907fs		Somatic				ERBB2IP_uc003jui.1_Frame_Shift_Del_p.G907fs|ERBB2IP_uc003juj.1_Frame_Shift_Del_p.G907fs|ERBB2IP_uc011cqx.1_Frame_Shift_Del_p.G907fs|ERBB2IP_uc011cqy.1_Frame_Shift_Del_p.G907fs|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Frame_Shift_Del_p.G903fs|ERBB2IP_uc003jul.1_Frame_Shift_Del_p.G903fs	p.G907fs	NM_018695	NP_061165	WXS	Illumina HiSeq	Unspecified	Q96RT1	LAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)	21	3029	+		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)	907					A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Frame_Shift_Del	DEL	ENST00000284037.5	37	c.2721delA	CCDS58953.1																																																																																				0.378	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695		7	1553	NA	NA	NA	NA	NA	7	1553	---	---	---	---
E2F5	1875	broad.mit.edu	37	8	86129664	86129664	+	IGR	DEL	T	T	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr8:86129664delT	ENST00000416274.2	+	0	1728				C8orf59_ENST00000545322.1_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000421308.2_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000417663.2_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000431163.2_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000458398.2_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000518562.1_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000524353.1_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000518091.1_Frame_Shift_Del_p.N22fs|C8orf59_ENST00000321777.5_Frame_Shift_Del_p.N22fs	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding						gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						AGCCTTAAAGTTTTTTTGGCT	0.343																																							uc010mac.1		NA																	0					0						c.(64-66)AACfs		hypothetical protein LOC401466							196.0	178.0	184.0					8																	86129664		1818	4077	5895	SO:0001628	intergenic_variant	401466							g.chr8:86129664delT	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785		8.37:g.86129664delT			Somatic				C8orf59_uc003ydd.2_Frame_Shift_Del_p.N22fs|C8orf59_uc010mad.1_Frame_Shift_Del_p.N22fs|C8orf59_uc003yde.2_Frame_Shift_Del_p.N22fs|C8orf59_uc011lfu.1_RNA	p.N22fs	NM_001099670	NP_001093140	WXS	Illumina HiSeq	Unspecified	Q8N0T1	CH059_HUMAN			3	305	-			22					E9PBN9|Q16601|Q92756	Frame_Shift_Del	DEL	ENST00000416274.2	37	c.65delA	CCDS47885.1																																																																																				0.343	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951		7	225	NA	NA	NA	NA	NA	7	225	---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8389298	8389298	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr9:8389298delC	ENST00000381196.4	-	34	4863	c.4320delG	c.(4318-4320)tggfs	p.W1440fs	PTPRD_ENST00000397606.3_Frame_Shift_Del_p.W1033fs|PTPRD_ENST00000397611.3_Frame_Shift_Del_p.W1030fs|PTPRD_ENST00000537002.1_Frame_Shift_Del_p.W1030fs|PTPRD_ENST00000360074.4_Frame_Shift_Del_p.W1427fs|PTPRD_ENST00000358503.5_Frame_Shift_Del_p.W1418fs|PTPRD_ENST00000355233.5_Frame_Shift_Del_p.W1034fs|PTPRD_ENST00000486161.1_Frame_Shift_Del_p.W1033fs|PTPRD_ENST00000397617.3_Frame_Shift_Del_p.W1033fs|PTPRD_ENST00000356435.5_Frame_Shift_Del_p.W1440fs|PTPRD_ENST00000540109.1_Frame_Shift_Del_p.W1440fs	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1440	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATATCATTCTCCAAAAGTCCC	0.403										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(4318-4320)TGGfs		protein tyrosine phosphatase, receptor type, D							180.0	173.0	175.0					9																	8389298		2203	4300	6503	SO:0001589	frameshift_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8389298delC	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4320delG	9.37:g.8389298delC	ENSP00000370593:p.Trp1440fs	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Frame_Shift_Del_p.W1034fs|PTPRD_uc003zkq.2_Frame_Shift_Del_p.W1033fs|PTPRD_uc003zkr.2_Frame_Shift_Del_p.W1024fs|PTPRD_uc003zks.2_Frame_Shift_Del_p.W1033fs|PTPRD_uc003zkl.2_Frame_Shift_Del_p.W1431fs|PTPRD_uc003zkm.2_Frame_Shift_Del_p.W1427fs|PTPRD_uc003zkn.2_Frame_Shift_Del_p.W1029fs|PTPRD_uc003zko.2_Frame_Shift_Del_p.W1030fs	p.W1440fs	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	36	5031	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1440			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Frame_Shift_Del	DEL	ENST00000381196.4	37	c.4320delG	CCDS43786.1																																																																																				0.403	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			12	228	NA	NA	NA	NA	NA	12	228	---	---	---	---
CHDC2	286464	broad.mit.edu	37	X	36162841	36162842	+	Frame_Shift_Ins	INS	-	-	T			TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chrX:36162841_36162842insT	ENST00000313548.4	+	11	1610_1611	c.1424_1425insT	c.(1423-1428)tgtttgfs	p.L476fs		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	476						integral component of membrane (GO:0016021)											ttttttgtttgtttgttctttt	0.431																																							uc004ddk.1		NA																	0				central_nervous_system(1)	1						c.(1423-1425)TGTfs		hypothetical protein LOC286464																																				SO:0001589	frameshift_variant	286464					integral to membrane		g.chrX:36162841_36162842insT	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1427dupT	X.37:g.36162844_36162844dupT	ENSP00000324767:p.Leu476fs		Somatic					p.C475fs	NM_173695	NP_775966	WXS	Illumina HiSeq	Unspecified	Q8N9S7	CX059_HUMAN			11	1610_1611	+			475			Helical; (Potential).			Frame_Shift_Ins	INS	ENST00000313548.4	37	c.1424_1425insT	CCDS14238.1																																																																																				0.431	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		14	46	NA	NA	NA	NA	NA	14	46	---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-49-6744-01A-11D-1855-08	TCGA-49-6744-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bf6ba698-7154-4d7f-b076-24ac2f768696	2c3be991-7581-48e9-8ebb-054eedf79d45	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		3	12	1	1	0.00909568	0.000248	0.0103446	3	12	NA	NA	NA	NA
