#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLCH2	9651	broad.mit.edu	37	1	2430207	2430207	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:2430207G>A	ENST00000419816.2	+	18	2648	c.2374G>A	c.(2374-2376)Gag>Aag	p.E792K	PLCH2_ENST00000288766.5_Missense_Mutation_p.E80K|PLCH2_ENST00000378486.3_Missense_Mutation_p.E792K|PLCH2_ENST00000378488.3_Missense_Mutation_p.E756K|PLCH2_ENST00000449969.1_Missense_Mutation_p.E765K			O75038	PLCH2_HUMAN	phospholipase C, eta 2	792	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.E639K(1)|p.E792K(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		TGTGGAGGTGGAGATCATTGG	0.672																																							uc001aji.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(1)|skin(1)	5						c.(2374-2376)GAG>AAG		phospholipase C, eta 2							27.0	31.0	30.0					1																	2430207		2056	4182	6238	SO:0001583	missense	9651				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr1:2430207G>A	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2374G>A	1.37:g.2430207G>A	ENSP00000389803:p.Glu792Lys		Somatic				PLCH2_uc010nyz.1_Missense_Mutation_p.E580K|PLCH2_uc009vle.1_Missense_Mutation_p.E544K|PLCH2_uc001ajj.1_Missense_Mutation_p.E580K|PLCH2_uc001ajk.1_Missense_Mutation_p.E580K|PLCH2_uc001ajl.1_5'UTR	p.E792K	NM_014638	NP_055453	WXS	Illumina HiSeq	Unspecified	O75038	PLCH2_HUMAN		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)	18	2648	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	792			C2.		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37	c.2374G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.491032|5.491032	0.96339|0.96339	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000288766;ENST00000378483;ENST00000343889;ENST00000278878|ENST00000419816	T;T;T;T|.	0.68479|.	-0.33;-0.33;-0.33;-0.33|.	4.93|4.93	4.93|4.93	0.64822|0.64822	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.057506|.	0.64402|.	D|.	0.000002|.	T|.	0.68238|.	0.2979|.	L|L	0.49256|0.49256	1.55|1.55	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.986;0.986;0.999;0.986|.	D;D;D;D|.	0.85130|.	0.984;0.988;0.997;0.991|.	T|.	0.66148|.	-0.5996|.	10|.	0.87932|.	D|.	0|.	.|.	16.6948|16.6948	0.85332|0.85332	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	639;544;765;792|.	B9DI81;B9DI82;O75038-2;O75038|.	.;.;.;PLCH2_HUMAN|.	K|X	765;792;756;80;78;639;544|86	ENSP00000397289:E765K;ENSP00000367747:E792K;ENSP00000367749:E756K;ENSP00000288766:E80K|.	ENSP00000278878:E544K|.	E|W	+|+	1|3	0|0	PLCH2|PLCH2	2420067|2420067	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.811000|0.811000	0.45836|0.45836	9.434000|9.434000	0.97515|0.97515	2.276000|2.276000	0.75962|0.75962	0.561000|0.561000	0.74099|0.74099	GAG|TGG		0.672	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638		4	10	0	0	0	0.000602	0	4	10				
GPR153	387509	broad.mit.edu	37	1	6313832	6313832	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:6313832G>A	ENST00000377893.2	-	3	991	c.732C>T	c.(730-732)ggC>ggT	p.G244G		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G244G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		TGGTCACGAGGCCCGTGGTCT	0.652																																							uc001amp.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(730-732)GGC>GGT		G protein-coupled receptor 153							94.0	97.0	96.0					1																	6313832		2203	4300	6503	SO:0001819	synonymous_variant	387509					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:6313832G>A	AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.732C>T	1.37:g.6313832G>A			Somatic					p.G244G	NM_207370	NP_997253	WXS	Illumina HiSeq	Unspecified	Q6NV75	GP153_HUMAN		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)	3	992	-	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	244			Helical; Name=6; (Potential).		Q5TGR5|Q6AHW8|Q86SP8	Silent	SNP	ENST00000377893.2	37	c.732C>T	CCDS64.1																																																																																				0.652	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003717.2			9	30	0	0	0	0.006214	0	9	30				
VPS13D	55187	broad.mit.edu	37	1	12337880	12337880	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:12337880C>A	ENST00000358136.3	+	19	4365	c.4235C>A	c.(4234-4236)gCg>gAg	p.A1412E	VPS13D_ENST00000356315.4_Missense_Mutation_p.A1412E	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.A1412E(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AATTTTGTGGCGGGAGATGAT	0.458																																							uc001atv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(4234-4236)GCG>GAG		vacuolar protein sorting 13D isoform 1							66.0	72.0	70.0					1																	12337880		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12337880C>A	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.4235C>A	1.37:g.12337880C>A	ENSP00000350854:p.Ala1412Glu		Somatic				VPS13D_uc001atw.2_Missense_Mutation_p.A1412E|VPS13D_uc001atx.2_Missense_Mutation_p.A600E	p.A1412E	NM_015378	NP_056193	WXS	Illumina HiSeq	Unspecified	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	19	4376	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	1412						Missense_Mutation	SNP	ENST00000358136.3	37	c.4235C>A	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	4.426	0.078710	0.08533	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.50813	0.73;0.73	6.17	6.17	0.99709	.	0.364959	0.30492	N	0.009509	T	0.31796	0.0808	N	0.24115	0.695	0.80722	D	1	P;B	0.39157	0.662;0.389	B;B	0.32583	0.148;0.103	T	0.24225	-1.0166	10	0.02654	T	1	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1412;1412	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	E	1412	ENSP00000348666:A1412E;ENSP00000350854:A1412E	ENSP00000348666:A1412E	A	+	2	0	VPS13D	12260467	0.987000	0.35691	0.997000	0.53966	0.979000	0.70002	3.624000	0.54231	2.941000	0.99782	0.655000	0.94253	GCG		0.458	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		3	80	1	0	0.00909568	0.009096	0.00968112	3	80				
HSPB7	27129	broad.mit.edu	37	1	16343586	16343586	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:16343586C>A	ENST00000311890.9	-	2	1142	c.316G>T	c.(316-318)Gag>Tag	p.E106*	HSPB7_ENST00000487046.1_Nonsense_Mutation_p.E111*|HSPB7_ENST00000406363.2_Nonsense_Mutation_p.E110*|HSPB7_ENST00000411503.1_Nonsense_Mutation_p.E106*|HSPB7_ENST00000375718.4_Nonsense_Mutation_p.E181*	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	106					regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.E106*(1)		breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCGCACCTCGATGTGGTTG	0.562																																							uc001axo.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(316-318)GAG>TAG		cardiovascular heat shock protein							134.0	128.0	130.0					1																	16343586		2203	4300	6503	SO:0001587	stop_gained	27129				regulation of heart contraction|response to heat|response to unfolded protein	Cajal body	protein C-terminus binding	g.chr1:16343586C>A	AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.316G>T	1.37:g.16343586C>A	ENSP00000310111:p.Glu106*		Somatic				HSPB7_uc001axp.2_Nonsense_Mutation_p.E194*|HSPB7_uc001axq.2_Nonsense_Mutation_p.E198*|HSPB7_uc001axr.2_Nonsense_Mutation_p.E199*|HSPB7_uc001axs.2_Nonsense_Mutation_p.E181*|CLCNKA_uc001axt.2_5'Flank	p.E106*	NM_014424	NP_055239	WXS	Illumina HiSeq	Unspecified	Q9UBY9	HSPB7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)	2	1143	-		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	106					B3KQ37|C9K0Y0|Q9NU17	Nonsense_Mutation	SNP	ENST00000311890.9	37	c.316G>T	CCDS30611.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966099	0.92855	.	.	ENSG00000173641	ENST00000411503;ENST00000311890;ENST00000375718;ENST00000375714;ENST00000463576;ENST00000487046;ENST00000406363	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-16.454	17.3793	0.87400	0.0:1.0:0.0:0.0	.	.	.	.	X	106;106;181;199;65;111;110	.	ENSP00000310111:E106X	E	-	1	0	HSPB7	16216173	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	7.350000	0.79385	2.441000	0.82636	0.313000	0.20887	GAG		0.562	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026334.2	NM_014424		40	62	1	0	1.03484e-13	0.005524	1.56263e-13	40	62				
RAP1GAP	5909	broad.mit.edu	37	1	21936680	21936680	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:21936680G>A	ENST00000374765.4	-	14	1132	c.932C>T	c.(931-933)tCc>tTc	p.S311F	RAP1GAP_ENST00000374763.2_Missense_Mutation_p.S311F|RAP1GAP_ENST00000374761.2_Missense_Mutation_p.S342F|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.S311F|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.S375F|RAP1GAP_ENST00000374757.3_5'Flank	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	311	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)	p.S342F(1)|p.S311F(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CAGGAAGTTGGACGCGATCAT	0.622																																							uc001bex.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|ovary(1)	3						c.(931-933)TCC>TTC		RAP1 GTPase activating protein isoform c							100.0	76.0	84.0					1																	21936680		2203	4300	6503	SO:0001583	missense	5909				regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding	g.chr1:21936680G>A	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.932C>T	1.37:g.21936680G>A	ENSP00000363897:p.Ser311Phe		Somatic				RAP1GAP_uc001bev.2_Missense_Mutation_p.S311F|RAP1GAP_uc001bew.2_Missense_Mutation_p.S375F|RAP1GAP_uc001bey.2_Missense_Mutation_p.S311F	p.S311F	NM_002885	NP_002876	WXS	Illumina HiSeq	Unspecified	P47736	RPGP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)	14	1190	-		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)	311			Rap-GAP.		J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	ENST00000374765.4	37	c.932C>T	CCDS218.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460809	0.84317	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.95656	-3.77;-3.77;-3.77;-3.77	5.36	5.36	0.76844	Rap/ran-GAP (2);	0.125788	0.56097	D	0.000039	D	0.98579	0.9525	H	0.96720	3.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.99;0.995;0.999;0.997	D	0.99541	1.0963	10	0.87932	D	0	-23.0424	16.9622	0.86275	0.0:0.0:1.0:0.0	.	311;311;341;311	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	F	375;342;311;311;341;311	ENSP00000290101:S375F;ENSP00000363893:S342F;ENSP00000441661:S311F;ENSP00000363897:S311F	ENSP00000290101:S375F	S	-	2	0	RAP1GAP	21809267	1.000000	0.71417	0.997000	0.53966	0.364000	0.29643	9.692000	0.98682	2.688000	0.91661	0.561000	0.74099	TCC		0.622	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885		10	49	0	0	0	0.008291	0	10	49				
MYOM3	127294	broad.mit.edu	37	1	24383886	24383886	+	Missense_Mutation	SNP	C	C	A	rs192299609	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:24383886C>A	ENST00000374434.3	-	37	4444	c.4282G>T	c.(4282-4284)Ggg>Tgg	p.G1428W	MYOM3_ENST00000330966.7_Missense_Mutation_p.G1431W|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000338909.5_Missense_Mutation_p.G321W	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	1428						M band (GO:0031430)	protein homodimerization activity (GO:0042803)	p.G1428W(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GGCTCGTCCCCGTGCTTGAAC	0.567																																							uc001bin.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(4282-4284)GGG>TGG		myomesin family, member 3							80.0	79.0	80.0					1																	24383886		2115	4243	6358	SO:0001583	missense	127294							g.chr1:24383886C>A	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.4282G>T	1.37:g.24383886C>A	ENSP00000363557:p.Gly1428Trp		Somatic				MYOM3_uc001bil.3_Missense_Mutation_p.G321W|MYOM3_uc001bim.3_Missense_Mutation_p.G1085W	p.G1428W	NM_152372	NP_689585	WXS	Illumina HiSeq	Unspecified	Q5VTT5	MYOM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)	37	4445	-		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	1428					A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	c.4282G>T	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768364	0.69878	.	.	ENSG00000142661	ENST00000338909;ENST00000374434;ENST00000330966;ENST00000374442	T;T;T	0.44482	0.92;0.92;0.92	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.65693	-0.6106	10	0.72032	D	0.01	.	18.8186	0.92088	0.0:1.0:0.0:0.0	.	1428;321	Q5VTT5;Q5VTT5-3	MYOM3_HUMAN;.	W	321;1428;1431;322	ENSP00000342689:G321W;ENSP00000363557:G1428W;ENSP00000332670:G1431W	ENSP00000332670:G1431W	G	-	1	0	MYOM3	24256473	1.000000	0.71417	0.901000	0.35422	0.267000	0.26476	5.952000	0.70282	2.436000	0.82500	0.655000	0.94253	GGG		0.567	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372		17	26	1	0	3.32936e-07	0.006122	4.20355e-07	17	26				
CSMD2	114784	broad.mit.edu	37	1	34238194	34238194	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:34238194A>T	ENST00000338325.1	-	7	1058	c.646T>A	c.(646-648)Tcg>Acg	p.S216T	CSMD2_ENST00000373381.4_Missense_Mutation_p.S608T			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	568	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S568T(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTCTTAGCCGACCATTGGTTA	0.577																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(1702-1704)TCG>ACG		CUB and Sushi multiple domains 2							129.0	113.0	118.0					1																	34238194		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34238194A>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.646T>A	1.37:g.34238194A>T	ENSP00000340311:p.Ser216Thr		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.S608T	p.S568T	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			13	1731	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	568			Sushi 3.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	37	c.1702T>A		.	.	.	.	.	.	.	.	.	.	A	33	5.200987	0.94997	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.63744	-0.06;-0.06	5.92	5.92	0.95590	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78059	0.4224	M	0.72576	2.205	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	T	0.79688	-0.1699	10	0.59425	D	0.04	.	15.1874	0.73016	1.0:0.0:0.0:0.0	.	568;608	Q7Z408;E7EUA6	CSMD2_HUMAN;.	T	608;216	ENSP00000362479:S608T;ENSP00000340311:S216T	ENSP00000241312:S568T	S	-	1	0	CSMD2	34010781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.313000	0.96297	2.270000	0.75569	0.459000	0.35465	TCG		0.577	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896		44	67	0	0	0	0.01441	0	44	67				
DLGAP3	58512	broad.mit.edu	37	1	35365842	35365842	+	Silent	SNP	G	G	T	rs149715442		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:35365842G>T	ENST00000373347.1	-	4	1408	c.1140C>A	c.(1138-1140)acC>acA	p.T380T	DLGAP3_ENST00000235180.4_Silent_p.T380T			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	380					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.T380T(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCTTGCCACCGGTGGGGTAAC	0.612																																							uc001byc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1138-1140)ACC>ACA		discs, large (Drosophila) homolog-associated							85.0	86.0	86.0					1																	35365842		2203	4300	6503	SO:0001819	synonymous_variant	58512				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		g.chr1:35365842G>T	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1140C>A	1.37:g.35365842G>T			Somatic					p.T380T	NM_001080418	NP_001073887	WXS	Illumina HiSeq	Unspecified	O95886	DLGP3_HUMAN			2	1140	-		Myeloproliferative disorder(586;0.0393)	380					Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	37	c.1140C>A	CCDS30670.1																																																																																				0.612	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		14	87	1	0	4.14922e-12	0.004007	5.93496e-12	14	87				
KIAA0319L	79932	broad.mit.edu	37	1	35940490	35940490	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:35940490C>A	ENST00000325722.3	-	5	1165	c.931G>T	c.(931-933)Gta>Tta	p.V311L		NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	311						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V311L(2)		breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CCAGCAGATACCACCAGTTCC	0.373																																							uc001byx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(931-933)GTA>TTA		dyslexia susceptibility 2-like							105.0	104.0	105.0					1																	35940490		2203	4300	6503	SO:0001583	missense	79932					cytoplasmic vesicle part|integral to membrane	protein binding	g.chr1:35940490C>A	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.931G>T	1.37:g.35940490C>A	ENSP00000318406:p.Val311Leu		Somatic				KIAA0319L_uc010ohw.1_RNA|KIAA0319L_uc001byz.2_Missense_Mutation_p.V311L|KIAA0319L_uc010ohx.1_Missense_Mutation_p.V311L	p.V311L	NM_024874	NP_079150	WXS	Illumina HiSeq	Unspecified	Q8IZA0	K319L_HUMAN			5	1189	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	311			Extracellular (Potential).		B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	37	c.931G>T	CCDS390.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.683211	0.68157	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579;ENST00000373258	T;T;T;T	0.68181	2.18;2.29;1.73;-0.31	5.8	4.89	0.63831	Fibronectin, type III (1);	0.065342	0.64402	D	0.000009	T	0.70876	0.3274	L	0.34521	1.04	0.47511	D	0.999446	D;B;P	0.60160	0.987;0.349;0.566	P;B;B	0.62649	0.905;0.226;0.232	T	0.74166	-0.3753	10	0.87932	D	0	-6.4452	12.6663	0.56844	0.0:0.9203:0.0:0.0797	.	311;311;311	B4DYG9;B1AN14;Q8IZA0	.;.;K319L_HUMAN	L	311	ENSP00000318406:V311L;ENSP00000395883:V311L;ENSP00000407576:V311L;ENSP00000362355:V311L	ENSP00000318406:V311L	V	-	1	0	KIAA0319L	35713077	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	4.660000	0.61511	1.462000	0.47948	0.655000	0.94253	GTA		0.373	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874		13	64	1	0	5.50884e-06	0.013537	6.54114e-06	13	64				
RSPO1	284654	broad.mit.edu	37	1	38082184	38082184	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:38082184G>T	ENST00000401069.1	-	4	970	c.258C>A	c.(256-258)gcC>gcA	p.A86A	RSPO1_ENST00000401070.1_Silent_p.A86A|RSPO1_ENST00000373059.1_Silent_p.A59A|RSPO1_ENST00000401071.2_Silent_p.A86A|RSPO1_ENST00000356545.2_Silent_p.A86A|RSPO1_ENST00000401068.1_Silent_p.A86A	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	86					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.A86A(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGGGTTGCGGGCGTCGAAGT	0.612																																					GBM(122;680 2230 27822 42821)	GBM(122;680 2230 27822 42821)	uc001cbl.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(256-258)GCC>GCA		R-spondin1 precursor							51.0	54.0	53.0					1																	38082184		2006	4167	6173	SO:0001819	synonymous_variant	284654				positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding	g.chr1:38082184G>T	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.258C>A	1.37:g.38082184G>T			Somatic				RSPO1_uc001cbm.1_Silent_p.A86A|RSPO1_uc009vvf.1_Silent_p.A59A|RSPO1_uc009vvg.1_Silent_p.A86A	p.A86A	NM_001038633	NP_001033722	WXS	Illumina HiSeq	Unspecified	Q2MKA7	RSPO1_HUMAN			5	1046	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	86					A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	ENST00000401069.1	37	c.258C>A	CCDS41304.1																																																																																				0.612	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640		21	32	1	0	3.51602e-12	0.008871	5.05055e-12	21	32				
C1orf109	54955	broad.mit.edu	37	1	38155361	38155361	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:38155361C>A	ENST00000358011.4	-	2	381	c.192G>T	c.(190-192)cgG>cgT	p.R64R	CDCA8_ENST00000327331.2_5'Flank|C1orf109_ENST00000464085.1_Silent_p.R64R|CDCA8_ENST00000373055.1_5'Flank	NM_017850.1	NP_060320.1	Q9NX04	CA109_HUMAN	chromosome 1 open reading frame 109	64								p.R64R(1)		lung(2)|prostate(2)	4		Myeloproliferative disorder(586;0.0393)				CTGGGAAGGCCCGAAGCGCCG	0.622																																							uc001cbp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(190-192)CGG>CGT		hypothetical protein LOC54955							59.0	62.0	61.0					1																	38155361		2203	4300	6503	SO:0001819	synonymous_variant	54955							g.chr1:38155361C>A	AK000515	CCDS423.1	1p34.3	2012-06-21			ENSG00000116922	ENSG00000116922			26039	protein-coding gene	gene with protein product		614799				22548824	Standard	XM_005270979		Approved	FLJ20508	uc001cbp.3	Q9NX04	OTTHUMG00000004323	ENST00000358011.4:c.192G>T	1.37:g.38155361C>A			Somatic				C1orf109_uc010oig.1_Silent_p.R127R|C1orf109_uc001cbo.2_Silent_p.R126R|C1orf109_uc001cbq.1_Silent_p.R64R|CDCA8_uc001cbr.2_5'Flank|CDCA8_uc001cbs.2_5'Flank	p.R64R	NM_017850	NP_060320	WXS	Illumina HiSeq	Unspecified	Q9NX04	CA109_HUMAN			2	382	-		Myeloproliferative disorder(586;0.0393)	64					D3DPT1|Q8WVD1	Silent	SNP	ENST00000358011.4	37	c.192G>T	CCDS423.1																																																																																				0.622	C1orf109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012486.1	NM_017850		18	75	1	0	0.006122	0.006122	0.00656759	18	75				
FAM183A	440585	broad.mit.edu	37	1	43616454	43616454	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:43616454C>T	ENST00000335282.4	+	2	156	c.156C>T	c.(154-156)ccC>ccT	p.P52P	FAM183A_ENST00000409337.1_3'UTR|FAM183A_ENST00000410048.1_Silent_p.P24P	NM_001101376.2	NP_001094846.2	A6NL82	F183A_HUMAN	family with sequence similarity 183, member A	52								p.P52P(3)		kidney(1)|large_intestine(1)|lung(2)|ovary(3)	7						CCAGGAAGCCCATGTCTTGGC	0.468																																							uc009vwo.2		NA																	3	Substitution - coding silent(3)	p.P52P(1)	lung(2)|ovary(1)	ovary(3)	3						c.(154-156)CCC>CCT		hCG23177							87.0	79.0	81.0					1																	43616454		1891	4118	6009	SO:0001819	synonymous_variant	440585							g.chr1:43616454C>T	AI192630, AI375550, AL139138	CCDS44126.1	1p34.2	2008-08-11			ENSG00000186973	ENSG00000186973			34347	protein-coding gene	gene with protein product						11181995	Standard	NM_001101376		Approved	LOC440585, hCG23177	uc009vwo.3	A6NL82	OTTHUMG00000007286	ENST00000335282.4:c.156C>T	1.37:g.43616454C>T			Somatic					p.P52P	NM_001101376	NP_001094846	WXS	Illumina HiSeq	Unspecified	A6NL82	F183A_HUMAN			2	185	+			52					B7ZBL8	Silent	SNP	ENST00000335282.4	37	c.156C>T	CCDS44126.1																																																																																				0.468	FAM183A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019024.3	NM_001101376		6	16	0	0	0	0.001168	0	6	16				
BSND	7809	broad.mit.edu	37	1	55474247	55474247	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:55474247C>A	ENST00000371265.4	+	4	1163	c.909C>A	c.(907-909)gcC>gcA	p.A303A		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	303					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)	p.A303A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						CAGATGGAGCCGGGGACCTCC	0.582																																					Ovarian(191;1657 2078 22894 42033 48899)	Ovarian(191;1657 2078 22894 42033 48899)	uc001cye.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(907-909)GCC>GCA		barttin							92.0	89.0	90.0					1																	55474247		2203	4300	6503	SO:0001819	synonymous_variant	7809					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex		g.chr1:55474247C>A	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.909C>A	1.37:g.55474247C>A			Somatic					p.A303A	NM_057176	NP_476517	WXS	Illumina HiSeq	Unspecified	Q8WZ55	BSND_HUMAN			4	1152	+			303			Cytoplasmic (Potential).		Q6NT28	Silent	SNP	ENST00000371265.4	37	c.909C>A	CCDS602.1																																																																																				0.582	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4	NM_057176		18	60	1	0	1.28384e-07	0.012319	1.63925e-07	18	60				
C8A	731	broad.mit.edu	37	1	57372457	57372457	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:57372457G>T	ENST00000361249.3	+	8	1310	c.1214G>T	c.(1213-1215)gGc>gTc	p.G405V		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	405	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.G405V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						TTTGGAGGTGGCAAAACTGGC	0.408																																							uc001cyo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1213-1215)GGC>GTC		complement component 8, alpha polypeptide							107.0	107.0	107.0					1																	57372457		2203	4300	6503	SO:0001583	missense	731				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex		g.chr1:57372457G>T	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1214G>T	1.37:g.57372457G>T	ENSP00000354458:p.Gly405Val		Somatic					p.G405V	NM_000562	NP_000553	WXS	Illumina HiSeq	Unspecified	P07357	CO8A_HUMAN			8	1346	+			405			MACPF.		A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	c.1214G>T	CCDS606.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056357	0.36277	.	.	ENSG00000157131	ENST00000361249	D	0.84298	-1.83	4.87	4.87	0.63330	Membrane attack complex component/perforin (MACPF) domain (3);	0.711573	0.14889	N	0.292511	D	0.85712	0.5760	M	0.84511	2.7	0.33884	D	0.636557	P	0.40360	0.714	B	0.37550	0.253	D	0.88227	0.2901	10	0.27082	T	0.32	-25.6441	13.709	0.62656	0.0:0.0:1.0:0.0	.	405	P07357	CO8A_HUMAN	V	405	ENSP00000354458:G405V	ENSP00000354458:G405V	G	+	2	0	C8A	57145045	0.050000	0.20438	0.154000	0.22540	0.521000	0.34408	0.895000	0.28363	2.711000	0.92665	0.561000	0.74099	GGC		0.408	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562		25	48	1	0	4.47668e-21	0.003954	7.47583e-21	25	48				
C8B	732	broad.mit.edu	37	1	57417726	57417726	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:57417726G>T	ENST00000371237.4	-	5	727	c.661C>A	c.(661-663)Cca>Aca	p.P221T	C8B_ENST00000535057.1_Missense_Mutation_p.P159T|C8B_ENST00000543257.1_Missense_Mutation_p.P169T	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	221	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.P221T(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ctTACCTGTGGCGTGTAGCTT	0.562																																							uc001cyp.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.(661-663)CCA>ACA		complement component 8, beta polypeptide							139.0	130.0	133.0					1																	57417726		2203	4300	6503	SO:0001583	missense	732				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex		g.chr1:57417726G>T	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.661C>A	1.37:g.57417726G>T	ENSP00000360281:p.Pro221Thr		Somatic				C8B_uc010oon.1_Missense_Mutation_p.P159T|C8B_uc010ooo.1_Missense_Mutation_p.P169T	p.P221T	NM_000066	NP_000057	WXS	Illumina HiSeq	Unspecified	P07358	CO8B_HUMAN			5	728	-			221			MACPF.		A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	c.661C>A	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	G	4.483	0.089543	0.08632	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.29142	1.89;1.58;1.58	5.56	2.36	0.29203	Membrane attack complex component/perforin (MACPF) domain (1);	0.292389	0.38837	N	0.001560	T	0.34454	0.0898	M	0.70275	2.135	0.09310	N	0.999995	P;P;P	0.49090	0.873;0.873;0.919	P;P;B	0.44990	0.466;0.466;0.401	T	0.24119	-1.0169	10	0.23891	T	0.37	-13.4424	12.5536	0.56240	0.0:0.344:0.5379:0.118	.	169;159;221	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	T	221;169;159	ENSP00000360281:P221T;ENSP00000442548:P169T;ENSP00000440113:P159T	ENSP00000360281:P221T	P	-	1	0	C8B	57190314	0.993000	0.37304	0.901000	0.35422	0.007000	0.05969	2.169000	0.42434	0.756000	0.33013	-0.282000	0.10007	CCA		0.562	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2			25	44	1	0	1.55469e-16	0.00333	2.49192e-16	25	44				
LEPR	3953	broad.mit.edu	37	1	66070859	66070859	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:66070859G>T	ENST00000349533.6	+	11	1727	c.1542G>T	c.(1540-1542)agG>agT	p.R514S	LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371058.1_Missense_Mutation_p.R514S|LEPR_ENST00000371059.3_Missense_Mutation_p.R514S|LEPR_ENST00000344610.8_Missense_Mutation_p.R514S|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371060.3_Missense_Mutation_p.R514S	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.R514S(3)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TGTGGATTAGGATCAATCACT	0.423																																							uc001dci.2		NA																	3	Substitution - Missense(3)		lung(3)	skin(1)	1						c.(1540-1542)AGG>AGT		leptin receptor isoform 1							232.0	207.0	216.0					1																	66070859		2203	4300	6503	SO:0001583	missense	3953				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity	g.chr1:66070859G>T	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.1542G>T	1.37:g.66070859G>T	ENSP00000330393:p.Arg514Ser		Somatic				LEPR_uc001dcg.2_Missense_Mutation_p.R514S|LEPR_uc001dch.2_Missense_Mutation_p.R514S|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Missense_Mutation_p.R514S|LEPR_uc001dck.2_Missense_Mutation_p.R514S	p.R514S	NM_002303	NP_002294	WXS	Illumina HiSeq	Unspecified	P48357	LEPR_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)	11	1744	+			514			Extracellular (Potential).		Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	c.1542G>T	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428130	0.43122	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	4.54	-2.42	0.06542	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.350129	0.31438	N	0.007652	T	0.12092	0.0294	L	0.57536	1.79	0.09310	N	0.999999	B;B;B	0.31274	0.081;0.071;0.317	B;B;B	0.30572	0.055;0.117;0.117	T	0.16778	-1.0391	10	0.62326	D	0.03	-4.292	4.6735	0.12701	0.1609:0.1138:0.6095:0.1158	.	514;514;514	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	S	514	ENSP00000340884:R514S;ENSP00000330393:R514S;ENSP00000360099:R514S;ENSP00000360098:R514S;ENSP00000360097:R514S	ENSP00000340884:R514S	R	+	3	2	LEPR	65843447	0.878000	0.30173	0.723000	0.30687	0.981000	0.71138	0.145000	0.16157	-0.266000	0.09339	0.460000	0.39030	AGG		0.423	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303		37	99	1	0	9.45814e-24	0.004878	1.63171e-23	37	99				
SGIP1	84251	broad.mit.edu	37	1	67206396	67206396	+	Missense_Mutation	SNP	G	G	A	rs34469055		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:67206396G>A	ENST00000371037.4	+	23	2367	c.2290G>A	c.(2290-2292)Gaa>Aaa	p.E764K	SGIP1_ENST00000371036.3_Missense_Mutation_p.E566K|SGIP1_ENST00000371035.3_Missense_Mutation_p.E554K|SGIP1_ENST00000237247.6_Missense_Mutation_p.E795K|SGIP1_ENST00000435165.2_Missense_Mutation_p.E269K|SGIP1_ENST00000371039.1_Missense_Mutation_p.E567K	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	764	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Necessary and sufficient to mediate interaction with CANX. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.E764K(1)|p.E567K(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TCAGAAGTCAGAAAATGGAGG	0.308																																							uc001dcr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2290-2292)GAA>AAA		SH3-domain GRB2-like (endophilin) interacting							46.0	46.0	46.0					1																	67206396		2203	4294	6497	SO:0001583	missense	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67206396G>A	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.2290G>A	1.37:g.67206396G>A	ENSP00000360076:p.Glu764Lys		Somatic				SGIP1_uc010opd.1_Missense_Mutation_p.E364K|SGIP1_uc001dcs.2_Missense_Mutation_p.E364K|SGIP1_uc001dct.2_Missense_Mutation_p.E366K|SGIP1_uc009wat.2_Missense_Mutation_p.E558K|SGIP1_uc001dcu.2_Missense_Mutation_p.E269K	p.E764K	NM_032291	NP_115667	WXS	Illumina HiSeq	Unspecified	Q9BQI5	SGIP1_HUMAN			23	2507	+			764					A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	c.2290G>A	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990240	0.93106	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037;ENST00000435165	T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83	5.86	5.86	0.93980	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.65080	0.2657	M	0.71581	2.175	0.80722	D	1	D;D;D;D;P	0.76494	0.996;0.999;0.999;0.992;0.743	D;D;D;D;P	0.81914	0.928;0.995;0.995;0.987;0.704	T	0.61242	-0.7102	10	0.48119	T	0.1	-20.9614	20.5632	0.99335	0.0:0.0:1.0:0.0	.	794;269;366;554;764	A6NEV3;Q6ZV33;B3KR01;B7Z5H8;Q9BQI5	.;.;.;.;SGIP1_HUMAN	K	795;567;554;794;767;566;764;269	ENSP00000237247:E795K;ENSP00000360078:E567K;ENSP00000360074:E554K;ENSP00000360075:E566K;ENSP00000360076:E764K;ENSP00000395525:E269K	ENSP00000237247:E795K	E	+	1	0	SGIP1	66978984	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.315000	0.96313	2.937000	0.99478	0.650000	0.86243	GAA		0.308	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		6	30	0	0	0	0.00308	0	6	30				
RPE65	6121	broad.mit.edu	37	1	68910296	68910296	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:68910296G>T	ENST00000262340.5	-	5	466	c.413C>A	c.(412-414)cCa>cAa	p.P138Q		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	138					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.P138Q(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TTCCCCCACTGGGTAGACATT	0.403																																							uc001dei.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(412-414)CCA>CAA		retinal pigment epithelium-specific protein							80.0	84.0	82.0					1																	68910296		2203	4300	6503	SO:0001583	missense	6121				visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity	g.chr1:68910296G>T	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.413C>A	1.37:g.68910296G>T	ENSP00000262340:p.Pro138Gln		Somatic					p.P138Q	NM_000329	NP_000320	WXS	Illumina HiSeq	Unspecified	Q16518	RPE65_HUMAN			5	467	-			138					A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	c.413C>A	CCDS643.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040350	0.55003	.	.	ENSG00000116745	ENST00000262340	D	0.95069	-3.6	5.05	5.05	0.67936	.	0.045171	0.85682	N	0.000000	D	0.89931	0.6858	L	0.56340	1.77	0.80722	D	1	B	0.15473	0.013	B	0.21546	0.035	D	0.86117	0.1566	10	0.22109	T	0.4	-23.44	18.5839	0.91181	0.0:0.0:1.0:0.0	.	138	Q16518	RPE65_HUMAN	Q	138	ENSP00000262340:P138Q	ENSP00000262340:P138Q	P	-	2	0	RPE65	68682884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.627000	0.88993	0.655000	0.94253	CCA		0.403	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329		25	57	1	0	5.45024e-15	0.00333	8.51443e-15	25	57				
ELTD1	64123	broad.mit.edu	37	1	79470904	79470904	+	Splice_Site	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:79470904A>T	ENST00000370742.3	-	2	86	c.23T>A	c.(22-24)gTg>gAg	p.V8E		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	8					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V8E(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GGAAAAAACCACTAAATAAAA	0.318																																							uc001diq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(22-24)GTG>GAG		EGF, latrophilin and seven transmembrane domain							47.0	41.0	43.0					1																	79470904		1803	4071	5874	SO:0001630	splice_region_variant	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79470904A>T	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.23-1T>A	1.37:g.79470904A>T			Somatic					p.V8E	NM_022159	NP_071442	WXS	Illumina HiSeq	Unspecified	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	2	179	-			8					B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	c.23T>A	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.233241	0.79688	.	.	ENSG00000162618	ENST00000370742	T	0.38240	1.15	5.65	5.65	0.86999	.	0.381252	0.25208	N	0.032332	T	0.29158	0.0725	L	0.44542	1.39	0.38796	D	0.955087	D	0.54397	0.966	P	0.52159	0.691	T	0.05241	-1.0897	9	.	.	.	.	12.2707	0.54704	1.0:0.0:0.0:0.0	.	8	Q9HBW9	ELTD1_HUMAN	E	8	ENSP00000359778:V8E	.	V	-	2	0	ELTD1	79243492	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.904000	0.63279	2.155000	0.67459	0.482000	0.46254	GTG		0.318	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	Missense_Mutation	3	15	0	0	0	0.004672	0	3	15				
GBP4	115361	broad.mit.edu	37	1	89651052	89651052	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:89651052T>C	ENST00000355754.6	-	11	1905	c.1808A>G	c.(1807-1809)gAa>gGa	p.E603G	GBP4_ENST00000471938.1_5'UTR	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	603						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.E603G(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CCTTAACTGTTCATTTTTAGT	0.343																																							uc001dnb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1807-1809)GAA>GGA		guanylate binding protein 4							131.0	114.0	120.0					1																	89651052		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89651052T>C	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1808A>G	1.37:g.89651052T>C	ENSP00000359490:p.Glu603Gly		Somatic					p.E603G	NM_052941	NP_443173	WXS	Illumina HiSeq	Unspecified	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	11	1924	-			603			Potential.		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.1808A>G	CCDS721.1	.	.	.	.	.	.	.	.	.	.	T	2.691	-0.273189	0.05716	.	.	ENSG00000162654	ENST00000355754	T	0.58940	0.3	1.43	0.259	0.15583	.	3.118040	0.00797	N	0.001393	T	0.14270	0.0345	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06862	-1.0803	10	0.33940	T	0.23	.	3.1896	0.06613	0.0:0.2538:0.0:0.7462	.	603	Q96PP9	GBP4_HUMAN	G	603	ENSP00000359490:E603G	ENSP00000359490:E603G	E	-	2	0	GBP4	89423640	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.312000	0.02720	0.062000	0.16340	0.454000	0.30748	GAA		0.343	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		13	47	0	0	0	0.013537	0	13	47				
BRDT	676	broad.mit.edu	37	1	92445140	92445140	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:92445140G>A	ENST00000362005.3	+	9	1531	c.1113G>A	c.(1111-1113)acG>acA	p.T371T	BRDT_ENST00000370389.2_Silent_p.T298T|BRDT_ENST00000399546.2_Silent_p.T371T|BRDT_ENST00000402388.1_Silent_p.T371T|BRDT_ENST00000484781.1_3'UTR|BRDT_ENST00000394530.3_Silent_p.T325T	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	371					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.T371T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TTTTCGAAACGCATTTTTCAA	0.323																																							uc001dok.3		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(2)|ovary(1)|lung(1)	4						c.(1111-1113)ACG>ACA		testis-specific bromodomain protein							81.0	82.0	81.0					1																	92445140		2203	4300	6503	SO:0001819	synonymous_variant	676				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity	g.chr1:92445140G>A	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1113G>A	1.37:g.92445140G>A			Somatic				BRDT_uc001dol.3_Silent_p.T371T|BRDT_uc010osz.1_Silent_p.T375T|BRDT_uc009wdf.2_Silent_p.T298T|BRDT_uc010ota.1_Silent_p.T325T|BRDT_uc010otb.1_Silent_p.T325T|BRDT_uc001dom.3_Silent_p.T371T	p.T371T	NM_207189	NP_997072	WXS	Illumina HiSeq	Unspecified	Q58F21	BRDT_HUMAN		all cancers(265;0.0228)|Epithelial(280;0.133)	8	1462	+		all_lung(203;0.00531)|Lung NSC(277;0.0194)	371					A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	ENST00000362005.3	37	c.1113G>A	CCDS735.1																																																																																				0.323	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189		14	37	0	0	0	0.00245	0	14	37				
LPPR4	9890	broad.mit.edu	37	1	99771956	99771956	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:99771956C>T	ENST00000370185.3	+	7	2179	c.1682C>T	c.(1681-1683)gCt>gTt	p.A561V	LPPR4_ENST00000370184.1_Missense_Mutation_p.A403V|LPPR4_ENST00000457765.1_Missense_Mutation_p.A503V	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		561					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.A561V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TTAAAAGCTGCTGAAAAGACT	0.547																																							uc001dse.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1681-1683)GCT>GTT		plasticity related gene 1							62.0	68.0	66.0					1																	99771956		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771956C>T																												ENST00000370185.3:c.1682C>T	1.37:g.99771956C>T	ENSP00000359204:p.Ala561Val		Somatic				LPPR4_uc010oue.1_Missense_Mutation_p.A503V	p.A561V	NM_014839	NP_055654	WXS	Illumina HiSeq	Unspecified	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1788	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	561					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1682C>T	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422096	0.62622	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000370184	T;T;T	0.27402	2.23;2.19;1.67	5.62	5.62	0.85841	.	0.178651	0.48767	D	0.000162	T	0.26122	0.0637	L	0.50333	1.59	0.80722	D	1	P;P	0.51537	0.946;0.467	P;B	0.45639	0.488;0.186	T	0.01118	-1.1446	9	.	.	.	-17.6802	19.6433	0.95764	0.0:1.0:0.0:0.0	.	503;561	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	V	561;503;403	ENSP00000359204:A561V;ENSP00000394913:A503V;ENSP00000359203:A403V	.	A	+	2	0	RP4-788L13.1	99544544	0.999000	0.42202	0.769000	0.31535	0.881000	0.50899	4.204000	0.58460	2.638000	0.89438	0.591000	0.81541	GCT		0.547	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			14	66	0	0	0	0.00245	0	14	66				
AGL	178	broad.mit.edu	37	1	100382210	100382210	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:100382210G>T	ENST00000294724.4	+	33	4882	c.4404G>T	c.(4402-4404)ttG>ttT	p.L1468F	AGL_ENST00000361522.4_Missense_Mutation_p.L1451F|AGL_ENST00000361915.3_Missense_Mutation_p.L1468F|AGL_ENST00000361302.3_Missense_Mutation_p.L1452F|AGL_ENST00000370163.3_Missense_Mutation_p.L1468F|AGL_ENST00000370161.2_Missense_Mutation_p.L1452F|AGL_ENST00000370165.3_Missense_Mutation_p.L1468F	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1468					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.L1468F(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TTTCCAGATTGATGGGCCCGG	0.348																																							uc001dsi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(4402-4404)TTG>TTT		amylo-1,6-glucosidase,							79.0	84.0	82.0					1																	100382210		2203	4300	6503	SO:0001583	missense	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100382210G>T	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.4404G>T	1.37:g.100382210G>T	ENSP00000294724:p.Leu1468Phe		Somatic				AGL_uc001dsj.1_Missense_Mutation_p.L1468F|AGL_uc001dsk.1_Missense_Mutation_p.L1468F|AGL_uc001dsl.1_Missense_Mutation_p.L1468F|AGL_uc001dsm.1_Missense_Mutation_p.L1452F|AGL_uc001dsn.1_Missense_Mutation_p.L1451F	p.L1468F	NM_000642	NP_000633	WXS	Illumina HiSeq	Unspecified	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	33	4804	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	1468			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	c.4404G>T	CCDS759.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982749	0.34942	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	5.89	2.69	0.31865	Six-hairpin glycosidase-like (1);	0.447254	0.25394	N	0.030982	T	0.55689	0.1936	M	0.80746	2.51	0.36429	D	0.864825	B;B;P	0.40619	0.338;0.338;0.724	B;B;B	0.42798	0.336;0.252;0.398	T	0.56709	-0.7934	10	0.33940	T	0.23	.	10.1059	0.42533	0.3162:0.0:0.6838:0.0	.	1451;1452;1468	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	F	1468;1468;1468;1468;1452;1452;1451	ENSP00000355106:L1468F;ENSP00000359184:L1468F;ENSP00000359182:L1468F;ENSP00000294724:L1468F;ENSP00000354971:L1452F;ENSP00000359180:L1452F;ENSP00000354635:L1451F	ENSP00000294724:L1468F	L	+	3	2	AGL	100154798	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	2.479000	0.45197	0.840000	0.34995	-0.150000	0.13652	TTG		0.348	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		12	45	1	0	0.000978159	0.010729	0.00108188	12	45				
COL11A1	1301	broad.mit.edu	37	1	103474073	103474073	+	Splice_Site	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:103474073C>A	ENST00000370096.3	-	15	1942		c.e15-1		COL11A1_ENST00000461720.1_5'Flank|COL11A1_ENST00000353414.4_Splice_Site|COL11A1_ENST00000358392.2_Splice_Site|COL11A1_ENST00000512756.1_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.?(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGGCCCCCCCTATAGAGAAA	0.353																																							uc001dul.2		NA																	2	Unknown(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.e15-1		alpha 1 type XI collagen isoform A							52.0	62.0	59.0					1																	103474073		2202	4300	6502	SO:0001630	splice_region_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103474073C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1630-1G>T	1.37:g.103474073C>A			Somatic				COL11A1_uc001duk.2_Splice_Site|COL11A1_uc001dum.2_Splice_Site_p.G556_splice|COL11A1_uc001dun.2_Splice_Site_p.G505_splice|COL11A1_uc009weh.2_Splice_Site_p.G428_splice	p.G544_splice	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	15	1948	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)						B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	37	c.1630_splice	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182164	0.57800	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5574	0.95357	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103246661	1.000000	0.71417	0.992000	0.48379	0.643000	0.38383	7.297000	0.78799	2.623000	0.88846	0.655000	0.94253	.		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Intron	8	52	1	0	0.00448238	0.004482	0.00483156	8	52				
SLC16A1	6566	broad.mit.edu	37	1	113471717	113471717	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:113471717C>T	ENST00000538576.1	-	2	1045	c.214G>A	c.(214-216)Gga>Aga	p.G72R	SLC16A1_ENST00000369626.3_Missense_Mutation_p.G72R|SLC16A1_ENST00000478835.1_5'UTR|SLC16A1_ENST00000433570.4_Missense_Mutation_p.G72R	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	72					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.G72R(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TACTTACCTCCACCATACATG	0.378																																							uc001ecx.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(214-216)GGA>AGA		solute carrier family 16, member 1	Pyruvic acid(DB00119)						49.0	44.0	46.0					1																	113471717		2203	4300	6503	SO:0001583	missense	6566				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr1:113471717C>T	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.214G>A	1.37:g.113471717C>T	ENSP00000441065:p.Gly72Arg		Somatic				SLC16A1_uc001ecy.2_Missense_Mutation_p.G72R|SLC16A1_uc001ecz.2_Missense_Mutation_p.G72R	p.G72R	NM_003051	NP_003042	WXS	Illumina HiSeq	Unspecified	P53985	MOT1_HUMAN		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	2	1046	-	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)	72			Helical; (Potential).		Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	ENST00000538576.1	37	c.214G>A	CCDS858.1	.	.	.	.	.	.	.	.	.	.	C	35	5.413552	0.96072	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580;ENST00000429288	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	5.97	5.97	0.96955	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80701	0.4673	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	D	0.83456	0.0051	10	0.62326	D	0.03	.	20.0086	0.97443	0.0:1.0:0.0:0.0	.	72;72	Q49A45;P53985	.;MOT1_HUMAN	R	72	ENSP00000358640:G72R;ENSP00000441065:G72R;ENSP00000416167:G72R;ENSP00000445061:G72R;ENSP00000399104:G72R;ENSP00000397106:G72R	ENSP00000358640:G72R	G	-	1	0	SLC16A1	113273240	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	6.046000	0.71029	2.835000	0.97688	0.591000	0.81541	GGA		0.378	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051		4	25	0	0	0	0.009096	0	4	25				
PDE4DIP	9659	broad.mit.edu	37	1	144882775	144882775	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:144882775C>A	ENST00000369354.3	-	24	3433	c.3244G>T	c.(3244-3246)Gtg>Ttg	p.V1082L	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.V1082L|PDE4DIP_ENST00000313382.9_Splice_Site|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.V1219L|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.V1219L|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1082					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.V1082L(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCAACCATCACCTCGCCCTTC	0.502			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		2	Substitution - Missense(2)		lung(2)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(3244-3246)GTG>TTG		phosphodiesterase 4D interacting protein isoform							303.0	271.0	282.0					1																	144882775		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144882775C>A	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3244G>T	1.37:g.144882775C>A	ENSP00000358360:p.Val1082Leu		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Splice_Site_p.E1147_splice|PDE4DIP_uc001elv.3_Missense_Mutation_p.V89L	p.V1082L	NM_014644	NP_055459	WXS	Illumina HiSeq	Unspecified	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	24	3535	-			1082					A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.3244G>T	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|C	17.13|17.13	3.311171|3.311171	0.60414|0.60414	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382|ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.|T;T;T;T	.|0.01538	.|4.8;4.8;4.79;4.8	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00936	.|0.0031	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|B	.|0.20887	.|0.049	.|B	.|0.16289	.|0.015	.|T	.|0.58618	.|-0.7605	.|9	.|0.21540	.|T	.|0.41	.|.	12.6839|12.6839	0.56936|0.56936	0.1647:0.8353:0.0:0.0|0.1647:0.8353:0.0:0.0	.|.	.|1082	.|Q5VU43	.|MYOME_HUMAN	.|L	-1|1082;1082;1219;1219	.|ENSP00000358360:V1082L;ENSP00000358363:V1082L;ENSP00000435654:V1219L;ENSP00000358366:V1219L	.|ENSP00000358360:V1082L	.|V	-|-	.|1	.|0	PDE4DIP|PDE4DIP	143594132|143594132	0.972000|0.972000	0.33761|0.33761	0.967000|0.967000	0.41034|0.41034	0.921000|0.921000	0.55340|0.55340	2.427000|2.427000	0.44740|0.44740	2.808000|2.808000	0.96608|0.96608	0.650000|0.650000	0.86243|0.86243	.|GTG		0.502	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		75	534	1	0	1.14856e-27	0.01441	2.04928e-27	75	534				
C1orf54	79630	broad.mit.edu	37	1	150252073	150252073	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:150252073C>T	ENST00000369102.1	+	7	1090	c.320C>T	c.(319-321)gCc>gTc	p.A107V	C1orf54_ENST00000369099.3_Missense_Mutation_p.A107V|C1orf51_ENST00000369094.1_5'Flank|C1orf54_ENST00000369098.3_Intron|C1orf51_ENST00000369095.1_5'Flank			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	107						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAACGATGCCGTGTCCAGT	0.522																																							uc001eud.2		NA																	0					0						c.(319-321)GCC>GTC		hypothetical protein LOC79630 precursor							621.0	529.0	561.0					1																	150252073		2203	4300	6503	SO:0001583	missense	79630					extracellular region		g.chr1:150252073C>T	BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.320C>T	1.37:g.150252073C>T	ENSP00000358098:p.Ala107Val		Somatic				C1orf54_uc001euc.2_Missense_Mutation_p.A108V|C1orf54_uc001eue.2_Intron|C1orf54_uc001euf.2_Missense_Mutation_p.A107V|C1orf54_uc001eug.2_Intron|C1orf51_uc001euh.2_5'Flank|C1orf51_uc001eui.2_5'Flank	p.A107V	NM_024579	NP_078855	WXS	Illumina HiSeq	Unspecified	Q8WWF1	CA054_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		5	358	+	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		107					Q9H5P3	Missense_Mutation	SNP	ENST00000369102.1	37	c.320C>T	CCDS948.1	.	.	.	.	.	.	.	.	.	.	C	9.929	1.214246	0.22289	.	.	ENSG00000118292	ENST00000369102;ENST00000369099	.	.	.	3.91	2.01	0.26516	.	0.323130	0.22614	N	0.057789	T	0.19208	0.0461	L	0.55481	1.735	0.09310	N	1	P	0.46064	0.872	P	0.45310	0.476	T	0.04229	-1.0967	9	0.87932	D	0	-2.0974	6.9331	0.24451	0.2009:0.6052:0.1939:0.0	.	107	Q8WWF1	CA054_HUMAN	V	107	.	ENSP00000358095:A107V	A	+	2	0	C1orf54	148518697	0.483000	0.25956	0.002000	0.10522	0.000000	0.00434	1.131000	0.31406	0.619000	0.30197	-0.834000	0.03071	GCC		0.522	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579		6	871	0	0	0	0.001984	0	6	871				
ADAMTSL4	54507	broad.mit.edu	37	1	150531542	150531542	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:150531542G>A	ENST00000369038.2	+	14	2865	c.2664G>A	c.(2662-2664)ggG>ggA	p.G888G	ADAMTSL4_ENST00000369039.5_Silent_p.G911G|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Silent_p.G888G			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	888	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.G888G(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CAGGAACTGGGCAGAGCTGTC	0.692																																							uc001eux.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(2662-2664)GGG>GGA		thrombospondin repeat containing 1 isoform 1							17.0	21.0	19.0					1																	150531542		2200	4296	6496	SO:0001819	synonymous_variant	54507				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding	g.chr1:150531542G>A	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2664G>A	1.37:g.150531542G>A			Somatic				ADAMTSL4_uc009wlw.2_Silent_p.G911G|ADAMTSL4_uc010pcg.1_Silent_p.G849G|ADAMTSL4_uc009wlx.2_Silent_p.G51G	p.G888G	NM_019032	NP_061905	WXS	Illumina HiSeq	Unspecified	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		16	2900	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		888			TSP type-1 4.		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Silent	SNP	ENST00000369038.2	37	c.2664G>A	CCDS955.1																																																																																				0.692	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032		6	52	0	0	0	0.001984	0	6	52				
HRNR	388697	broad.mit.edu	37	1	152187706	152187706	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:152187706G>A	ENST00000368801.2	-	3	6474	c.6399C>T	c.(6397-6399)taC>taT	p.Y2133Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2133					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Y2133*(1)|p.Y2133Y(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGTTGTCCGTAGCCAGAGG	0.567																																							uc001ezt.1		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		lung(2)	skin(2)|ovary(1)	3						c.(6397-6399)TAC>TAT		hornerin							22.0	23.0	22.0					1																	152187706		1603	3263	4866	SO:0001819	synonymous_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152187706G>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6399C>T	1.37:g.152187706G>A			Somatic					p.Y2133Y	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6475	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2133					Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	c.6399C>T	CCDS30859.1																																																																																				0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		40	604	0	0	0	0.01441	0	40	604				
CD1D	912	broad.mit.edu	37	1	158152695	158152695	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:158152695G>T	ENST00000368171.3	+	5	1134	c.635G>T	c.(634-636)gGc>gTc	p.G212V		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	212	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)	p.G212V(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CTGTCCCGTGGCCCCAGTCCT	0.572																																							uc001frr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(634-636)GGC>GTC		CD1D antigen precursor							78.0	80.0	79.0					1																	158152695		2203	4300	6503	SO:0001583	missense	912				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding	g.chr1:158152695G>T	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.635G>T	1.37:g.158152695G>T	ENSP00000357153:p.Gly212Val		Somatic				CD1D_uc009wss.2_Intron	p.G212V	NM_001766	NP_001757	WXS	Illumina HiSeq	Unspecified	P15813	CD1D_HUMAN			5	1134	+	all_hematologic(112;0.0378)		212			Ig-like.|Extracellular (Potential).		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	37	c.635G>T	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318492	0.40996	.	.	ENSG00000158473	ENST00000368171	T	0.13420	2.59	5.18	3.24	0.37175	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);	0.387954	0.22302	N	0.061847	T	0.10637	0.0260	M	0.91561	3.22	0.31678	N	0.643501	P	0.50369	0.934	B	0.40741	0.339	T	0.07790	-1.0754	10	0.51188	T	0.08	-14.134	6.6855	0.23142	0.0928:0.0:0.7319:0.1753	.	212	P15813	CD1D_HUMAN	V	212	ENSP00000357153:G212V	ENSP00000357153:G212V	G	+	2	0	CD1D	156419319	0.065000	0.20965	0.803000	0.32268	0.981000	0.71138	0.903000	0.28475	0.626000	0.30322	0.655000	0.94253	GGC		0.572	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766		37	77	1	0	3.62531e-18	0.004289	5.95147e-18	37	77				
SPTA1	6708	broad.mit.edu	37	1	158650416	158650416	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:158650416C>A	ENST00000368147.4	-	5	815	c.635G>T	c.(634-636)gGg>gTg	p.G212V		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	212					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.G212V(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AACAACTCTCCCTTCTTTAGC	0.463																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(634-636)GGG>GTG		spectrin, alpha, erythrocytic 1							149.0	148.0	148.0					1																	158650416		1919	4133	6052	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158650416C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.635G>T	1.37:g.158650416C>A	ENSP00000357129:p.Gly212Val		Somatic					p.G212V	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			5	834	-	all_hematologic(112;0.0378)		212			Spectrin 3.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.635G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	9.529	1.110406	0.20714	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.35973	1.28;1.28	5.25	1.31	0.21738	.	0.825660	0.09861	N	0.746162	T	0.09818	0.0241	N	0.24115	0.695	0.33249	D	0.55822	B	0.16396	0.017	B	0.19666	0.026	T	0.18681	-1.0329	10	0.33940	T	0.23	.	7.9641	0.30089	0.0:0.4677:0.0:0.5323	.	212	P02549	SPTA1_HUMAN	V	212	ENSP00000357130:G212V;ENSP00000357129:G212V	ENSP00000357129:G212V	G	-	2	0	SPTA1	156917040	0.010000	0.17322	0.000000	0.03702	0.329000	0.28539	1.595000	0.36708	0.083000	0.17047	0.650000	0.86243	GGG		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		48	85	1	0	2.01872e-29	0.01441	3.62087e-29	48	85				
PYHIN1	149628	broad.mit.edu	37	1	158911940	158911940	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:158911940T>G	ENST00000368140.1	+	5	998	c.753T>G	c.(751-753)caT>caG	p.H251Q	PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392252.3_Missense_Mutation_p.H242Q|PYHIN1_ENST00000392254.2_Missense_Mutation_p.H251Q|PYHIN1_ENST00000368138.3_Missense_Mutation_p.H242Q	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	251	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)		p.H251Q(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AGTTCTTTCATGTGAAGGTTT	0.323																																							uc001ftb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(751-753)CAT>CAG		pyrin and HIN domain family, member 1 alpha 1							57.0	61.0	60.0					1																	158911940		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158911940T>G	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.753T>G	1.37:g.158911940T>G	ENSP00000357122:p.His251Gln		Somatic				PYHIN1_uc001ftc.2_Missense_Mutation_p.H242Q|PYHIN1_uc001ftd.2_Missense_Mutation_p.H251Q|PYHIN1_uc001fte.2_Missense_Mutation_p.H242Q	p.H251Q	NM_152501	NP_689714	WXS	Illumina HiSeq	Unspecified	Q6K0P9	IFIX_HUMAN			5	998	+	all_hematologic(112;0.0378)		251			HIN-200.		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.753T>G	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	T	1.168	-0.641813	0.03531	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	3.09	-0.945	0.10388	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.02012	0.0063	L	0.27053	0.805	0.22142	N	0.999335	P;B;P;B	0.38395	0.629;0.292;0.629;0.413	B;B;B;B	0.34093	0.138;0.175;0.138;0.11	T	0.42068	-0.9473	9	0.29301	T	0.29	.	2.9391	0.05824	0.3307:0.0:0.1547:0.5145	.	242;251;242;251	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	Q	251;242;251;242	ENSP00000357122:H251Q;ENSP00000357120:H242Q;ENSP00000376083:H251Q;ENSP00000376082:H242Q	ENSP00000357120:H242Q	H	+	3	2	PYHIN1	157178564	0.000000	0.05858	0.185000	0.23176	0.018000	0.09664	-1.245000	0.02899	-0.058000	0.13177	0.533000	0.62120	CAT		0.323	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		11	18	0	0	0	0.013537	0	11	18				
LY9	4063	broad.mit.edu	37	1	160784336	160784336	+	Missense_Mutation	SNP	C	C	A	rs372475263		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:160784336C>A	ENST00000263285.6	+	4	887	c.857C>A	c.(856-858)aCa>aAa	p.T286K	LY9_ENST00000471816.1_3'UTR|LY9_ENST00000368037.5_Missense_Mutation_p.T286K|LY9_ENST00000392203.4_Missense_Mutation_p.T286K|LY9_ENST00000368041.2_Missense_Mutation_p.T246K|LY9_ENST00000341032.4_Missense_Mutation_p.T286K|LY9_ENST00000368040.1_5'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	286	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T286K(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TTGTTTAACACATCCATCATT	0.552																																							uc001fwu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(856-858)ACA>AAA		lymphocyte antigen 9 isoform a		C	LYS/THR	0,4406		0,0,2203	114.0	101.0	105.0		857	2.8	0.4	1		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	LY9	NM_002348.2	78	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	286/656	160784336	1,13005	2203	4300	6503	SO:0001583	missense	4063				cell adhesion|immunoglobulin mediated immune response	integral to membrane		g.chr1:160784336C>A	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.857C>A	1.37:g.160784336C>A	ENSP00000263285:p.Thr286Lys		Somatic				LY9_uc010pjs.1_Missense_Mutation_p.T286K|LY9_uc001fwv.2_Missense_Mutation_p.T286K|LY9_uc001fww.2_Missense_Mutation_p.T286K|LY9_uc001fwx.2_Missense_Mutation_p.T286K|LY9_uc001fwy.1_Missense_Mutation_p.T188K|LY9_uc001fwz.2_5'UTR	p.T286K	NM_002348	NP_002339	WXS	Illumina HiSeq	Unspecified	Q9HBG7	LY9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		4	907	+	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		286			Extracellular (Potential).|Ig-like V-type 2.		A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	c.857C>A	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828970	0.50845	0.0	1.16E-4	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.01516	4.81;4.81	3.8	2.76	0.32466	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02767	0.0083	L	0.53561	1.675	0.24027	N	0.996122	D;D;D;D;D;D	0.89917	0.999;0.999;0.982;0.999;1.0;0.999	D;D;P;D;D;D	0.85130	0.994;0.994;0.703;0.994;0.997;0.994	T	0.49143	-0.8970	9	0.42905	T	0.14	-4.286	8.4654	0.32953	0.0:0.7595:0.2405:0.0	.	286;246;246;286;286;286	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	K	286;286;286;286;246;246;188	ENSP00000342921:T286K;ENSP00000263285:T286K	ENSP00000263285:T286K	T	+	2	0	LY9	159050960	0.001000	0.12720	0.372000	0.25991	0.256000	0.26092	0.590000	0.23954	2.036000	0.60181	0.563000	0.77884	ACA		0.552	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348		28	56	1	0	3.73148e-12	0.007291	5.34871e-12	28	56				
OLFML2B	25903	broad.mit.edu	37	1	161953798	161953798	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:161953798G>T	ENST00000294794.3	-	8	2343	c.1920C>A	c.(1918-1920)ggC>ggA	p.G640G	OLFML2B_ENST00000367940.2_Silent_p.G641G|OLFML2B_ENST00000367938.1_Silent_p.G123G	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	640	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.G640G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CCTGGCTGAAGCCCTCATCGT	0.617																																							uc001gbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1918-1920)GGC>GGA		olfactomedin-like 2B precursor							78.0	69.0	72.0					1																	161953798		2203	4300	6503	SO:0001819	synonymous_variant	25903							g.chr1:161953798G>T	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1920C>A	1.37:g.161953798G>T			Somatic				OLFML2B_uc001gbt.2_Silent_p.G123G|OLFML2B_uc010pkq.1_Silent_p.G641G	p.G640G	NM_015441	NP_056256	WXS	Illumina HiSeq	Unspecified	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)		8	2344	-	all_hematologic(112;0.156)		640			Olfactomedin-like.		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Silent	SNP	ENST00000294794.3	37	c.1920C>A	CCDS1236.1																																																																																				0.617	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		5	39	1	0	8.12818e-05	0.001984	9.26203e-05	5	39				
ANKRD45	339416	broad.mit.edu	37	1	173616126	173616126	+	Missense_Mutation	SNP	C	C	A	rs199897076		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:173616126C>A	ENST00000333279.2	-	3	415	c.355G>T	c.(355-357)Gcc>Tcc	p.A119S		NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	135								p.A119S(1)		NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						CGACCCCAGGCTGCAGCACAA	0.423																																							uc001gja.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(355-357)GCC>TCC		ankyrin repeat domain 45							107.0	102.0	104.0					1																	173616126		2203	4300	6503	SO:0001583	missense	339416							g.chr1:173616126C>A		CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.355G>T	1.37:g.173616126C>A	ENSP00000331268:p.Ala119Ser		Somatic					p.A119S	NM_198493	NP_940895	WXS	Illumina HiSeq	Unspecified	Q5TZF3	ANR45_HUMAN			3	416	-			135			ANK 2.		A1A4G2|Q6ZST1	Missense_Mutation	SNP	ENST00000333279.2	37	c.355G>T	CCDS1309.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471892	0.63737	.	.	ENSG00000183831	ENST00000333279	T	0.63580	-0.05	5.43	5.43	0.79202	Ankyrin repeat-containing domain (4);	0.322596	0.30227	N	0.010107	T	0.42063	0.1186	N	0.20328	0.56	0.37906	D	0.931215	P	0.47034	0.889	P	0.47786	0.557	T	0.32428	-0.9907	10	0.15499	T	0.54	-3.0418	18.0246	0.89264	0.0:1.0:0.0:0.0	.	135	Q5TZF3	ANR45_HUMAN	S	119	ENSP00000331268:A119S	ENSP00000331268:A119S	A	-	1	0	ANKRD45	171882749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.547000	0.45786	2.547000	0.85894	0.557000	0.71058	GCC		0.423	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493		27	34	1	0	0.000147802	0.00632	0.000168137	27	34				
SERPINC1	462	broad.mit.edu	37	1	173878765	173878765	+	Missense_Mutation	SNP	C	C	T	rs199469509		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:173878765C>T	ENST00000367698.3	-	5	1196	c.1078G>A	c.(1078-1080)Ggc>Agc	p.G360S	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	360					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G360S(1)		NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	AAACTGAAGCCGTCCTCAATG	0.542																																							uc001gjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1078-1080)GGC>AGC		serpin peptidase inhibitor, clade C, member 1	Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)						116.0	116.0	116.0					1																	173878765		2203	4300	6503	SO:0001583	missense	462				blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity	g.chr1:173878765C>T	X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1078G>A	1.37:g.173878765C>T	ENSP00000356671:p.Gly360Ser		Somatic					p.G360S	NM_000488	NP_000479	WXS	Illumina HiSeq	Unspecified	P01008	ANT3_HUMAN			5	1197	-			360					B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	ENST00000367698.3	37	c.1078G>A	CCDS1313.1	.	.	.	.	.	.	.	.	.	.	c	6.370	0.436334	0.12104	.	.	ENSG00000117601	ENST00000367698	D	0.82344	-1.6	5.64	-1.51	0.08664	Serpin domain (3);	0.616386	0.19807	N	0.105640	T	0.18130	0.0435	N	0.00661	-1.28	0.23030	N	0.998404	B	0.06786	0.001	B	0.11329	0.006	T	0.44375	-0.9332	10	0.02654	T	1	.	2.9609	0.05891	0.1068:0.3078:0.109:0.4764	.	360	P01008	ANT3_HUMAN	S	360	ENSP00000356671:G360S	ENSP00000356671:G360S	G	-	1	0	SERPINC1	172145388	0.999000	0.42202	0.963000	0.40424	0.963000	0.63663	0.577000	0.23758	-0.507000	0.06549	-0.119000	0.15052	GGC		0.542	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488		26	138	0	0	0	0.00632	0	26	138				
TNR	7143	broad.mit.edu	37	1	175365812	175365813	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:175365812_175365813GG>CT	ENST00000367674.2	-	5	1815_1816	c.1107_1108CC>AG	c.(1105-1110)ctCCag>ctAGag	p.Q370E	TNR_ENST00000263525.2_Missense_Mutation_p.Q370E			Q92752	TENR_HUMAN	tenascin R	370	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.Q370E(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACCCGCTGCTGGAGCTGGAGGC	0.589																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1105-1110)CTCCAG>CTAGAG		tenascin R precursor																																				SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175365812_175365813GG>CT	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1107_1108delinsCT	1.37:g.175365812_175365813delinsCT	ENSP00000356646:p.Gln370Glu		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.Q370E|TNR_uc010pmz.1_Missense_Mutation_p.P335R	p.Q370E	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			3	1188_1189	-	Renal(580;0.146)		370			Fibronectin type-III 1.		C9J563|Q15568|Q5R3G0	Missense_Mutation	DNP	ENST00000367674.2	37	c.1107_1108CC>AG	CCDS1318.1																																																																																				0.589	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		7	60	0	0	0	0.004672	0	7	60				
TPR	7175	broad.mit.edu	37	1	186344160	186344160	+	Start_Codon_SNP	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:186344160T>A	ENST00000367478.4	-	1	297	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	C1orf27_ENST00000367470.3_5'Flank|C1orf27_ENST00000287859.6_5'Flank|TPR_ENST00000474852.1_5'UTR|C1orf27_ENST00000419367.3_5'Flank	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.M1L(2)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ACCGCCGCCATGTCGGTGGGG	0.622			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(1-3)ATG>TTG		nuclear pore complex-associated protein TPR							26.0	31.0	30.0					1																	186344160		1903	4105	6008	SO:0001582	initiator_codon_variant	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186344160T>A	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1A>T	1.37:g.186344160T>A	ENSP00000356448:p.Met1Leu		Somatic				C1orf27_uc001grw.2_5'Flank|C1orf27_uc010poq.1_5'Flank|C1orf27_uc010por.1_5'Flank|TPR_uc010pop.1_Missense_Mutation_p.M77L	p.M1L	NM_003292	NP_003283	WXS	Illumina HiSeq	Unspecified	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	1	298	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	1					Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	c.1A>T	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653132	0.88056	.	.	ENSG00000047410	ENST00000367478;ENST00000367472;ENST00000451586	T	0.24350	1.86	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	.	.	.	0.80722	D	1	D;P	0.56746	0.977;0.855	D;P	0.69654	0.965;0.813	T	0.57418	-0.7815	9	0.87932	D	0	.	15.3204	0.74117	0.0:0.0:0.0:1.0	.	1;1	Q15624;P12270	.;TPR_HUMAN	L	1;77;77	ENSP00000356448:M1L	ENSP00000356442:M77L	M	-	1	0	TPR	184610783	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.933000	0.63484	2.091000	0.63221	0.533000	0.62120	ATG		0.622	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	Missense_Mutation	6	34	0	0	0	0.001168	0	6	34				
KCNT2	343450	broad.mit.edu	37	1	196274434	196274434	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:196274434G>T	ENST00000294725.9	-	22	3440	c.2525C>A	c.(2524-2526)cCc>cAc	p.P842H	KCNT2_ENST00000367431.4_Missense_Mutation_p.P768H|KCNT2_ENST00000367433.5_Missense_Mutation_p.P818H|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.P768H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	842					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.P842H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CATGTTGGCGGGGTGAGTTAG	0.358																																							uc001gtd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(2524-2526)CCC>CAC		potassium channel, subfamily T, member 2							134.0	123.0	126.0					1																	196274434		2203	4300	6503	SO:0001583	missense	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196274434G>T	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2525C>A	1.37:g.196274434G>T	ENSP00000294725:p.Pro842His		Somatic				KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.P768H|KCNT2_uc001gtf.1_Missense_Mutation_p.P818H|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Missense_Mutation_p.P818H|KCNT2_uc001gth.1_Missense_Mutation_p.P339H	p.P842H	NM_198503	NP_940905	WXS	Illumina HiSeq	Unspecified	Q6UVM3	KCNT2_HUMAN			22	2585	-			842			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	c.2525C>A	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339054	0.81911	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.77877	-1.13;-1.13;-1.13	4.56	4.56	0.56223	.	0.000000	0.56097	D	0.000021	D	0.87573	0.6211	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;0.999;1.0;0.997	D;D;D;D;D	0.72075	0.928;0.976;0.951;0.976;0.928	D	0.88804	0.3287	10	0.62326	D	0.03	-14.0744	17.8796	0.88837	0.0:0.0:1.0:0.0	.	842;800;818;768;842	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	H	818;768;842	ENSP00000356403:P818H;ENSP00000356401:P768H;ENSP00000294725:P842H	ENSP00000294725:P842H	P	-	2	0	KCNT2	194541057	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.601000	0.98297	2.525000	0.85131	0.650000	0.86243	CCC		0.358	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		26	35	1	0	1.2476e-16	0.00632	2.00444e-16	26	35				
DENND1B	163486	broad.mit.edu	37	1	197522226	197522226	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:197522226A>T	ENST00000367396.3	-	16	1335	c.1166T>A	c.(1165-1167)cTg>cAg	p.L389Q	DENND1B_ENST00000400967.2_Missense_Mutation_p.L359Q|DENND1B_ENST00000235453.4_Missense_Mutation_p.L359Q	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B	389					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L29Q(1)|p.L389Q(1)|p.L359Q(1)		NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						TAGTTTTGCCAGTCGACCATC	0.299																																							uc001guf.3		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1165-1167)CTG>CAG		DENN/MADD domain containing 1B isoform 2							88.0	82.0	84.0					1																	197522226		1822	4073	5895	SO:0001583	missense	163486					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity	g.chr1:197522226A>T	BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.1166T>A	1.37:g.197522226A>T	ENSP00000356366:p.Leu389Gln		Somatic				DENND1B_uc010ppe.1_Missense_Mutation_p.L369Q|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Missense_Mutation_p.L359Q	p.L389Q	NM_144977	NP_659414	WXS	Illumina HiSeq	Unspecified	Q6P3S1	DEN1B_HUMAN			16	1504	-			389					B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Missense_Mutation	SNP	ENST00000367396.3	37	c.1166T>A	CCDS41452.2	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498508	0.85069	.	.	ENSG00000213047	ENST00000391979;ENST00000542760;ENST00000450419;ENST00000235453;ENST00000367396;ENST00000400967	T;T;T;T	0.63255	-0.03;2.93;2.56;2.93	5.59	5.59	0.84812	.	0.000000	0.64402	D	0.000001	T	0.79907	0.4527	M	0.81497	2.545	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.983;0.984	T	0.82637	-0.0359	10	0.72032	D	0.01	-4.4819	14.685	0.69042	1.0:0.0:0.0:0.0	.	389;389;359	Q6P3S1-5;Q6P3S1;Q6P3S1-4	.;DEN1B_HUMAN;.	Q	29;389;369;359;389;359	ENSP00000375839:L29Q;ENSP00000235453:L359Q;ENSP00000356366:L389Q;ENSP00000383751:L359Q	ENSP00000235453:L359Q	L	-	2	0	DENND1B	195788849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.882000	0.87258	2.260000	0.74910	0.529000	0.55759	CTG		0.299	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086539.1	NM_144977		25	47	0	0	0	0.00278	0	25	47				
PTPRC	5788	broad.mit.edu	37	1	198668779	198668779	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:198668779G>T	ENST00000367376.2	+	5	550	c.379G>T	c.(379-381)Ggc>Tgc	p.G127C	PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000352140.3_Missense_Mutation_p.G127C|PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000442510.2_Missense_Mutation_p.G129C|PTPRC_ENST00000391970.3_3'UTR	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	127					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G127C(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GACATTCAGCGGCTCCGCCGC	0.532											OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001gur.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(379-381)GGC>TGC		protein tyrosine phosphatase, receptor type, C							103.0	109.0	107.0					1																	198668779		2203	4300	6503	SO:0001583	missense	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198668779G>T	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.379G>T	1.37:g.198668779G>T	ENSP00000356346:p.Gly127Cys		Somatic	OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2100	PTPRC_uc001gus.1_Missense_Mutation_p.G127C|PTPRC_uc001gut.1_Intron|PTPRC_uc009wze.1_Missense_Mutation_p.G63C|PTPRC_uc009wzf.1_Missense_Mutation_p.G63C|PTPRC_uc010ppg.1_Missense_Mutation_p.G63C|PTPRC_uc001guu.1_Missense_Mutation_p.G170C|PTPRC_uc001guv.1_RNA|PTPRC_uc001guw.1_RNA	p.G127C	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			5	559	+			127			Extracellular (Potential).		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37	c.379G>T		.	.	.	.	.	.	.	.	.	.	G	13.00	2.105332	0.37145	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000271610;ENST00000530727;ENST00000442510;ENST00000367367	T	0.03035	4.07	5.21	0.246	0.15516	.	0.323970	0.26844	N	0.022204	T	0.08846	0.0219	L	0.47716	1.5	0.19945	N	0.999948	D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.997;0.997	D;P;P;D;P;P	0.65573	0.926;0.893;0.85;0.936;0.758;0.758	T	0.08700	-1.0709	10	0.54805	T	0.06	.	7.8206	0.29286	0.6121:0.0:0.3879:0.0	.	63;63;63;168;127;127	F5GXZ3;B4DSZ5;Q5T9M4;Q6Q1P2;E9PC28;P08575	.;.;.;.;.;PTPRC_HUMAN	C	129;63;127;127;168;61;127;61	ENSP00000193532:G127C	ENSP00000271610:G168C	G	+	1	0	PTPRC	196935402	0.118000	0.22208	0.126000	0.21872	0.012000	0.07955	0.370000	0.20433	0.036000	0.15547	-0.378000	0.06908	GGC		0.532	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				13	134	1	0	1.3612e-06	0.003163	1.66588e-06	13	134				
KDM5B	10765	broad.mit.edu	37	1	202702652	202702652	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:202702652C>A	ENST00000367265.3	-	23	4950	c.3786G>T	c.(3784-3786)tgG>tgT	p.W1262C	KDM5B_ENST00000367264.2_Missense_Mutation_p.W1298C	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1262					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.W1262C(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						CTCTGTGCTGCCAGTTCACGG	0.502																																							uc001gyf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|urinary_tract(1)	5						c.(3784-3786)TGG>TGT		jumonji, AT rich interactive domain 1B							111.0	109.0	109.0					1																	202702652		2203	4300	6503	SO:0001583	missense	10765				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr1:202702652C>A	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3786G>T	1.37:g.202702652C>A	ENSP00000356234:p.Trp1262Cys		Somatic				KDM5B_uc009xag.2_Missense_Mutation_p.W1298C|KDM5B_uc001gyg.1_Missense_Mutation_p.W1104C	p.W1262C	NM_006618	NP_006609	WXS	Illumina HiSeq	Unspecified	Q9UGL1	KDM5B_HUMAN			23	3902	-			1262					O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	c.3786G>T	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625880	0.87560	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.01005	5.45;5.45;5.45	6.09	6.09	0.99107	.	0.000000	0.85682	D	0.000000	T	0.07279	0.0184	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.00538	-1.1682	10	0.87932	D	0	-13.9714	20.6935	0.99705	0.0:1.0:0.0:0.0	.	1298;1262	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	C	1262;1104;1298;1104	ENSP00000356234:W1262C;ENSP00000356233:W1298C;ENSP00000235790:W1104C	ENSP00000235790:W1104C	W	-	3	0	KDM5B	200969275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.897000	0.99335	0.643000	0.83706	TGG		0.502	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		18	107	1	0	4.96729e-08	0.008871	6.42714e-08	18	107				
LAX1	54900	broad.mit.edu	37	1	203743121	203743121	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:203743121C>T	ENST00000442561.2	+	5	899	c.509C>T	c.(508-510)tCg>tTg	p.S170L	LAX1_ENST00000367217.5_Missense_Mutation_p.S154L|LAX1_ENST00000367215.1_3'UTR	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	170					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)	p.S170L(1)		central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTCACTCCCTCGGCACACTGC	0.532																																							uc001haa.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(508-510)TCG>TTG		lymphocyte transmembrane adaptor 1 isoform a							101.0	91.0	94.0					1																	203743121		2203	4300	6503	SO:0001583	missense	54900				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding	g.chr1:203743121C>T	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.509C>T	1.37:g.203743121C>T	ENSP00000406970:p.Ser170Leu		Somatic				LAX1_uc010pql.1_Missense_Mutation_p.S154L|LAX1_uc001hab.2_Missense_Mutation_p.S94L	p.S170L	NM_017773	NP_060243	WXS	Illumina HiSeq	Unspecified	Q8IWV1	LAX1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		5	919	+	all_cancers(21;0.0915)		170			Cytoplasmic (Potential).		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	c.509C>T	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	C	16.49	3.136880	0.56936	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.48	2.49	0.30216	.	0.585057	0.15444	N	0.262043	T	0.34600	0.0903	L	0.58101	1.795	0.09310	N	1	B;B	0.26902	0.163;0.163	B;B	0.20384	0.029;0.029	T	0.31052	-0.9957	9	0.59425	D	0.04	0.0	5.3313	0.15934	0.1621:0.6907:0.0:0.1472	.	154;170	B7Z744;Q8IWV1	.;LAX1_HUMAN	L	170;154	.	ENSP00000356186:S154L	S	+	2	0	LAX1	202009744	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.480000	0.22244	0.237000	0.21200	-0.302000	0.09304	TCG		0.532	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773		38	45	0	0	0	0.004878	0	38	45				
CNTN2	6900	broad.mit.edu	37	1	205036280	205036281	+	Missense_Mutation	DNP	CC	CC	AT	rs373478324		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:205036280_205036281CC>AT	ENST00000331830.4	+	16	2311_2312	c.2027_2028CC>AT	c.(2026-2028)aCC>aAT	p.T676N		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	676	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.T676N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTGGGCCTCACCCCCTGGATGG	0.579																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2026-2028)ACC>AAT		contactin 2 precursor																																				SO:0001583	missense	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205036280_205036281CC>AT	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	Exception_encountered	1.37:g.205036280_205036281delinsAT	ENSP00000330633:p.Thr676Asn		Somatic				CNTN2_uc001hbq.1_Missense_Mutation_p.T567N|CNTN2_uc001hbs.2_Missense_Mutation_p.T464N	p.T676N	NM_005076	NP_005067	WXS	Illumina HiSeq	Unspecified	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		16	2296_2297	+	all_cancers(21;0.144)|Breast(84;0.0437)		676			Fibronectin type-III 1.		P78432|Q5T054	Missense_Mutation	DNP	ENST00000331830.4	37	c.2027_2028CC>AT	CCDS1449.1																																																																																				0.579	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		5	63	0	0	0	0.004672	0	5	63				
DTL	51514	broad.mit.edu	37	1	212245479	212245479	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:212245479A>C	ENST00000366991.4	+	11	1273	c.959A>C	c.(958-960)tAt>tCt	p.Y320S	DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Missense_Mutation_p.Y278S	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	320					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.Y320S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TCTACCTTTTATGTAAAATCC	0.398																																							uc009xdc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(958-960)TAT>TCT		denticleless homolog							147.0	142.0	144.0					1																	212245479		2203	4300	6503	SO:0001583	missense	51514				DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding	g.chr1:212245479A>C	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.959A>C	1.37:g.212245479A>C	ENSP00000355958:p.Tyr320Ser		Somatic				DTL_uc010ptb.1_Missense_Mutation_p.Y278S|DTL_uc001hiz.3_Missense_Mutation_p.Y49S	p.Y320S	NM_016448	NP_057532	WXS	Illumina HiSeq	Unspecified	Q9NZJ0	DTL_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)	11	1273	+			320			WD 6.		A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	ENST00000366991.4	37	c.959A>C	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.530420	0.85706	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	T;T	0.13778	2.56;2.56	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.18593	0.0446	N	0.11818	0.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.22068	-1.0227	10	0.15066	T	0.55	-42.386	14.5109	0.67787	1.0:0.0:0.0:0.0	.	278;320;278	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	S	320;278	ENSP00000355958:Y320S;ENSP00000443870:Y278S	ENSP00000355958:Y320S	Y	+	2	0	DTL	210312102	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	8.132000	0.89603	2.124000	0.65301	0.455000	0.32223	TAT		0.398	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448		6	85	0	0	0	0.001984	0	6	85				
ESRRG	2104	broad.mit.edu	37	1	216737622	216737622	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:216737622T>A	ENST00000408911.3	-	5	954	c.801A>T	c.(799-801)acA>acT	p.T267T	ESRRG_ENST00000361525.3_Silent_p.T244T|ESRRG_ENST00000463665.1_Silent_p.T205T|ESRRG_ENST00000366938.2_Silent_p.T244T|ESRRG_ENST00000487276.1_Silent_p.T244T|ESRRG_ENST00000493748.1_Silent_p.T244T|ESRRG_ENST00000366940.2_Silent_p.T244T|ESRRG_ENST00000359162.2_Silent_p.T244T|ESRRG_ENST00000391890.3_Silent_p.T251T|ESRRG_ENST00000360012.3_Silent_p.T244T|ESRRG_ENST00000361395.2_Silent_p.T244T|ESRRG_ENST00000366937.1_Silent_p.T279T|ESRRG_ENST00000493603.1_Silent_p.T244T	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	267					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.T267T(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AGTCACACAGTGTAGTGAGGG	0.458																																							uc001hkw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(799-801)ACA>ACT		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						176.0	155.0	162.0					1																	216737622		2203	4300	6503	SO:0001819	synonymous_variant	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216737622T>A	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.801A>T	1.37:g.216737622T>A			Somatic				ESRRG_uc001hky.1_Silent_p.T244T|ESRRG_uc009xdp.1_Silent_p.T244T|ESRRG_uc001hkz.1_Silent_p.T205T|ESRRG_uc010puc.1_Silent_p.T244T|ESRRG_uc001hla.1_Silent_p.T244T|ESRRG_uc001hlb.1_Silent_p.T244T|ESRRG_uc010pud.1_Silent_p.T75T|ESRRG_uc001hlc.1_Silent_p.T244T|ESRRG_uc001hld.1_Silent_p.T244T|ESRRG_uc001hkx.1_Silent_p.T279T|ESRRG_uc009xdo.1_Silent_p.T244T|ESRRG_uc001hle.1_Silent_p.T244T	p.T267T	NM_001438	NP_001429	WXS	Illumina HiSeq	Unspecified	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	5	967	-			267					A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Silent	SNP	ENST00000408911.3	37	c.801A>T	CCDS41468.1																																																																																				0.458	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		7	59	0	0	0	0.001984	0	7	59				
LYST	1130	broad.mit.edu	37	1	235969162	235969162	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:235969162T>C	ENST00000389794.3	-	6	3448	c.3274A>G	c.(3274-3276)Aca>Gca	p.T1092A	LYST_ENST00000536965.1_Missense_Mutation_p.T1092A|LYST_ENST00000389793.2_Missense_Mutation_p.T1092A			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1092					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.T1092A(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTTGACTTGTAAATAGCTTT	0.418																																							uc001hxj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(3274-3276)ACA>GCA		lysosomal trafficking regulator							79.0	78.0	78.0					1																	235969162		2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235969162T>C	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.3274A>G	1.37:g.235969162T>C	ENSP00000374444:p.Thr1092Ala		Somatic				LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.T1092A	p.T1092A	NM_000081	NP_000072	WXS	Illumina HiSeq	Unspecified	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		6	3449	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	1092					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.3274A>G	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	0.074	-1.197246	0.01594	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.60548	0.18;0.18;1.33	5.32	-2.88	0.05682	.	1.266910	0.04973	N	0.464258	T	0.28300	0.0699	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.15607	-1.0431	10	0.08179	T	0.78	.	3.0997	0.06322	0.1238:0.4156:0.1262:0.3344	.	1092;1092	Q99698-3;Q99698	.;LYST_HUMAN	A	1092	ENSP00000374444:T1092A;ENSP00000374443:T1092A;ENSP00000438315:T1092A	ENSP00000374443:T1092A	T	-	1	0	LYST	234035785	0.000000	0.05858	0.000000	0.03702	0.382000	0.30200	-0.223000	0.09177	-0.140000	0.11394	0.460000	0.39030	ACA		0.418	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			10	73	0	0	0	0.006214	0	10	73				
RYR2	6262	broad.mit.edu	37	1	237944870	237944870	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:237944870C>A	ENST00000366574.2	+	89	12203	c.11886C>A	c.(11884-11886)tcC>tcA	p.S3962S	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.S3968S|RYR2_ENST00000542537.1_Silent_p.S3946S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3962					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.S3960S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCAGGATTCCAGTCAAATTG	0.338																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(11884-11886)TCC>TCA		cardiac muscle ryanodine receptor							91.0	90.0	90.0					1																	237944870		1896	4155	6051	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237944870C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11886C>A	1.37:g.237944870C>A			Somatic				RYR2_uc010pya.1_Silent_p.S377S	p.S3962S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		89	12006	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3962					Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.11886C>A	CCDS55691.1																																																																																				0.338	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		6	9	1	0	3.59834e-05	0.001168	4.1491e-05	6	9				
ZP4	57829	broad.mit.edu	37	1	238048492	238048492	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:238048492T>A	ENST00000366570.4	-	9	1442	c.1284A>T	c.(1282-1284)acA>acT	p.T428T	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	428	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.T428T(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GTTTCTCCACTGTAGGGTTCA	0.532																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1282-1284)ACA>ACT		zona pellucida glycoprotein 4 preproprotein							88.0	91.0	90.0					1																	238048492		2203	4300	6503	SO:0001819	synonymous_variant	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048492T>A	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1284A>T	1.37:g.238048492T>A			Somatic				LOC100130331_uc010pyc.1_Intron	p.T428T	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		9	1284	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	428			ZP.|Extracellular (Potential).		B2RAE1	Silent	SNP	ENST00000366570.4	37	c.1284A>T	CCDS1615.1																																																																																				0.532	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			24	29	0	0	0	0.014323	0	24	29				
FMN2	56776	broad.mit.edu	37	1	240497408	240497409	+	Splice_Site	DNP	GG	GG	TT			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:240497408_240497409GG>TT	ENST00000319653.9	+	13	4874_4875	c.4644_4645GG>TT	c.(4642-4647)gaGGat>gaTTat	p.1548_1549ED>DY	FMN2_ENST00000545751.1_Splice_Site_p.144_145ED>DY	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1548	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.?(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTGTTCATTAGGATGCTGGAAA	0.347																																							uc010pyd.1		NA																	1	Unknown(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.e13-1		formin 2																																				SO:0001630	splice_region_variant	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240497408_240497409GG>TT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	Exception_encountered	1.37:g.240497408_240497409delinsTT			Somatic				FMN2_uc010pye.1_Splice_Site_p.D1553_splice|FMN2_uc010pyf.1_Splice_Site_p.D195_splice|FMN2_uc010pyg.1_Splice_Site_p.D145_splice	p.D1549_splice	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		13	4870	+	Ovarian(103;0.127)	all_cancers(173;0.013)						B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Splice_Site	DNP	ENST00000319653.9	37	c.4645_splice	CCDS31069.2																																																																																				0.347	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	Missense_Mutation	58	89	0	0	0	0.004672	0	58	89				
SDCCAG8	10806	broad.mit.edu	37	1	243652408	243652408	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:243652408G>T	ENST00000366541.3	+	17	2196	c.2078G>T	c.(2077-2079)aGc>aTc	p.S693I	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.S548I|AKT3_ENST00000336199.5_Intron|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.S650I	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	693	Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.S693I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GAGAGGCAGAGCCTGTCGGAA	0.622																																							uc001hzw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2077-2079)AGC>ATC		serologically defined colon cancer antigen 8							27.0	29.0	28.0					1																	243652408		2203	4299	6502	SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243652408G>T	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.2078G>T	1.37:g.243652408G>T	ENSP00000355499:p.Ser693Ile		Somatic				SDCCAG8_uc010pyk.1_Missense_Mutation_p.S548I|SDCCAG8_uc010pyl.1_Missense_Mutation_p.S505I|SDCCAG8_uc001hzx.2_Missense_Mutation_p.S426I|AKT3_uc001hzz.1_Intron	p.S693I	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	17	2234	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	693			Mediates interaction with OFD1.|Potential.|Sufficient for homodimerization (By similarity).		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	c.2078G>T	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868708	0.72065	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.47177	0.88;0.88;0.89;0.85	5.56	-0.36	0.12568	.	0.379360	0.28544	N	0.014968	T	0.26448	0.0646	N	0.19112	0.55	0.80722	D	1	B;B	0.32467	0.372;0.372	B;B	0.34385	0.118;0.181	T	0.02411	-1.1163	10	0.40728	T	0.16	-0.2852	4.4973	0.11844	0.4264:0.3165:0.2571:0.0	.	650;693	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	I	650;693;548;394	ENSP00000348137:S650I;ENSP00000355499:S693I;ENSP00000341260:S548I;ENSP00000410200:S394I	ENSP00000341260:S548I	S	+	2	0	SDCCAG8	241719031	0.658000	0.27402	0.976000	0.42696	0.834000	0.47266	-0.146000	0.10250	0.024000	0.15214	-0.142000	0.14014	AGC		0.622	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		8	15	1	0	1.12685e-05	0.004482	1.32181e-05	8	15				
NLRP3	114548	broad.mit.edu	37	1	247588623	247588623	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:247588623C>A	ENST00000336119.3	+	3	2624	c.1878C>A	c.(1876-1878)agC>agA	p.S626R	NLRP3_ENST00000366497.2_Missense_Mutation_p.S626R|NLRP3_ENST00000348069.2_Missense_Mutation_p.S626R|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.S626R|NLRP3_ENST00000391827.2_Missense_Mutation_p.S626R|NLRP3_ENST00000391828.3_Missense_Mutation_p.S626R	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	626					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.S626R(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TCCAGCCCAGCCAGCTGGAAT	0.463																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1876-1878)AGC>AGA		NLR family, pyrin domain containing 3 isoform a							54.0	52.0	52.0					1																	247588623		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588623C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1878C>A	1.37:g.247588623C>A	ENSP00000337383:p.Ser626Arg		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.S626R|NLRP3_uc001icu.2_Missense_Mutation_p.S626R|NLRP3_uc001icw.2_Missense_Mutation_p.S626R|NLRP3_uc001icv.2_Missense_Mutation_p.S626R|NLRP3_uc010pyw.1_Missense_Mutation_p.S624R|NLRP3_uc001ict.1_Missense_Mutation_p.S624R	p.S626R	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	2016	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	626					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.1878C>A	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.982756	0.53827	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	3.96	1.05	0.20165	.	0.196582	0.36972	N	0.002316	D	0.87700	0.6243	L	0.50333	1.59	0.31627	N	0.649532	B;B;D;P;B	0.60575	0.012;0.139;0.988;0.788;0.409	B;B;P;P;B	0.60609	0.014;0.13;0.877;0.612;0.082	T	0.82299	-0.0526	10	0.18710	T	0.47	.	4.1764	0.10353	0.0:0.5952:0.1923:0.2125	.	626;626;626;626;626	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	R	626	ENSP00000375704:S626R;ENSP00000355453:S626R;ENSP00000337383:S626R;ENSP00000294752:S626R;ENSP00000355452:S626R;ENSP00000375703:S626R	ENSP00000337383:S626R	S	+	3	2	NLRP3	245655246	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	-1.272000	0.02826	0.249000	0.21456	-0.119000	0.15052	AGC		0.463	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		20	34	1	0	0.000175454	0.010504	0.000197605	20	34				
NLRP3	114548	broad.mit.edu	37	1	247607377	247607377	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:247607377G>T	ENST00000336119.3	+	7	3519	c.2773G>T	c.(2773-2775)Gga>Tga	p.G925*	NLRP3_ENST00000366497.2_Nonsense_Mutation_p.G868*|NLRP3_ENST00000348069.2_Nonsense_Mutation_p.G811*|NLRP3_ENST00000366496.2_Nonsense_Mutation_p.G868*|NLRP3_ENST00000391827.2_Nonsense_Mutation_p.G868*|NLRP3_ENST00000391828.3_Nonsense_Mutation_p.G925*	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	925					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.G925*(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAACACTCTCGGAGACAAGGG	0.493																																							uc001icr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2773-2775)GGA>TGA		NLR family, pyrin domain containing 3 isoform a							164.0	138.0	147.0					1																	247607377		2203	4300	6503	SO:0001587	stop_gained	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247607377G>T	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2773G>T	1.37:g.247607377G>T	ENSP00000337383:p.Gly925*		Somatic				NLRP3_uc001ics.2_Nonsense_Mutation_p.G868*|NLRP3_uc001icu.2_Nonsense_Mutation_p.G925*|NLRP3_uc001icw.2_Nonsense_Mutation_p.G868*|NLRP3_uc001icv.2_Nonsense_Mutation_p.G811*|NLRP3_uc010pyw.1_Nonsense_Mutation_p.G903*	p.G925*	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		9	2911	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	925			LRR 7.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Nonsense_Mutation	SNP	ENST00000336119.3	37	c.2773G>T	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	45	11.632756	0.99585	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	.	.	.	4.06	2.09	0.27110	.	0.306550	0.23836	N	0.044100	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	10.2411	0.43312	0.0:0.3946:0.6054:0.0	.	.	.	.	X	925;868;925;811;868;868	.	ENSP00000337383:G925X	G	+	1	0	NLRP3	245674000	0.999000	0.42202	0.588000	0.28705	0.347000	0.29111	1.926000	0.40084	0.618000	0.30179	0.549000	0.68633	GGA		0.493	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		36	59	1	0	6.90743e-12	0.003755	9.83873e-12	36	59				
OR2AK2	391191	broad.mit.edu	37	1	248128777	248128777	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:248128777C>A	ENST00000366480.3	+	1	243	c.144C>A	c.(142-144)acC>acA	p.T48T	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T48T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCATTGCCACCCTCTTTACAG	0.428																																					Melanoma(45;390 1181 23848 28461 41504)	Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(142-144)ACC>ACA		olfactory receptor, family 2, subfamily AK,							210.0	198.0	202.0					1																	248128777		2203	4300	6503	SO:0001819	synonymous_variant	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248128777C>A	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.144C>A	1.37:g.248128777C>A			Somatic				OR2L13_uc001ids.2_Intron	p.T48T	NM_001004491	NP_001004491	WXS	Illumina HiSeq	Unspecified	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	144	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		48			Helical; Name=1; (Potential).		B2RND1|Q6IF05	Silent	SNP	ENST00000366480.3	37	c.144C>A	CCDS31102.1																																																																																				0.428	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		24	247	1	0	4.26978e-12	0.00333	6.09454e-12	24	247				
OR2T33	391195	broad.mit.edu	37	1	248436317	248436317	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:248436317T>A	ENST00000318021.2	-	1	821	c.800A>T	c.(799-801)aAc>aTc	p.N267I		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N267I(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTTGTCATGGTTAGTGGACCT	0.473																																							uc010pzi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(799-801)AAC>ATC		olfactory receptor, family 2, subfamily T,							146.0	156.0	152.0					1																	248436317		2203	4300	6503	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436317T>A		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.800A>T	1.37:g.248436317T>A	ENSP00000324687:p.Asn267Ile		Somatic					p.N267I	NM_001004695	NP_001004695	WXS	Illumina HiSeq	Unspecified	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	800	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		267			Extracellular (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.800A>T	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	3.424	-0.117459	0.06838	.	.	ENSG00000177212	ENST00000318021	T	0.00107	8.72	1.77	-1.46	0.08800	GPCR, rhodopsin-like superfamily (1);	0.909504	0.08951	U	0.870032	T	0.00144	0.0004	N	0.24115	0.695	0.09310	N	1	P	0.48407	0.91	P	0.54431	0.752	T	0.32693	-0.9897	10	0.44086	T	0.13	.	1.255	0.01990	0.1771:0.1211:0.181:0.5208	.	267	Q8NG76	O2T33_HUMAN	I	267	ENSP00000324687:N267I	ENSP00000324687:N267I	N	-	2	0	OR2T33	246502940	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.287000	0.08388	-0.332000	0.08489	-0.860000	0.03012	AAC		0.473	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		33	198	0	0	0	0.003755	0	33	198				
OR2T4	127074	broad.mit.edu	37	1	248525781	248525781	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:248525781C>A	ENST00000366475.1	+	1	899	c.899C>A	c.(898-900)cCt>cAt	p.P300H		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P300H(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TACCACACCCCTGAGAAGGAC	0.507																																							uc001ieh.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(898-900)CCT>CAT		olfactory receptor, family 2, subfamily T,							142.0	141.0	141.0					1																	248525781		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525781C>A	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.899C>A	1.37:g.248525781C>A	ENSP00000355431:p.Pro300His		Somatic					p.P300H	NM_001004696	NP_001004696	WXS	Illumina HiSeq	Unspecified	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	899	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		300			Extracellular (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.899C>A	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029319	0.35797	.	.	ENSG00000196944	ENST00000366475	T	0.00231	8.49	3.0	1.0	0.19881	GPCR, rhodopsin-like superfamily (1);	0.309688	0.23494	N	0.047579	T	0.00356	0.0011	M	0.72894	2.215	0.09310	N	1	D	0.71674	0.998	D	0.68483	0.958	T	0.49995	-0.8879	10	0.87932	D	0	.	3.1315	0.06425	0.1895:0.3897:0.0:0.4208	.	300	Q8NH00	OR2T4_HUMAN	H	300	ENSP00000355431:P300H	ENSP00000355431:P300H	P	+	2	0	OR2T4	246592404	0.000000	0.05858	0.960000	0.40013	0.929000	0.56500	-0.697000	0.05098	0.455000	0.26910	-0.224000	0.12420	CCT		0.507	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		70	130	1	0	1.43675e-24	0.01441	2.49774e-24	70	130				
OR2T3	343173	broad.mit.edu	37	1	248636972	248636972	+	Missense_Mutation	SNP	C	C	G	rs201404223	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:248636972C>G	ENST00000359594.2	+	1	346	c.321C>G	c.(319-321)ttC>ttG	p.F107L		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F107L(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCAGATGTTCTTCTACCTGA	0.542													.|||	3	0.000599042	0.0	0.0043	5008	,	,		21410	0.0		0.0	False		,,,				2504	0.0						uc001iel.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(319-321)TTC>TTG		olfactory receptor, family 2, subfamily T,							144.0	129.0	134.0					1																	248636972		2193	4298	6491	SO:0001583	missense	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248636972C>G		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.321C>G	1.37:g.248636972C>G	ENSP00000352604:p.Phe107Leu		Somatic					p.F107L	NM_001005495	NP_001005495	WXS	Illumina HiSeq	Unspecified	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	321	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		107			Helical; Name=3; (Potential).		B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	c.321C>G	CCDS31117.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	c	12.29	1.892532	0.33442	.	.	ENSG00000196539	ENST00000359594	T	0.02216	4.39	2.65	-2.29	0.06805	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02267	0.0070	M	0.73430	2.235	0.09310	N	1	B	0.32939	0.391	B	0.30401	0.115	T	0.27606	-1.0069	9	0.62326	D	0.03	.	7.4232	0.27083	0.0:0.3841:0.0:0.6159	.	107	Q8NH03	OR2T3_HUMAN	L	107	ENSP00000352604:F107L	ENSP00000352604:F107L	F	+	3	2	OR2T3	246703595	0.000000	0.05858	0.005000	0.12908	0.533000	0.34776	-1.163000	0.03138	-0.284000	0.09102	0.186000	0.17326	TTC		0.542	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		45	63	0	0	0	0.01441	0	45	63				
TUBB8	347688	broad.mit.edu	37	10	93890	93890	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:93890C>A	ENST00000309812.4	-	4	504	c.442G>T	c.(442-444)Ggt>Tgt	p.G148C	TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.G76C	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	148					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G148C(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		AGAAGGGTACCCATCCCAGAC	0.587																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(442-444)GGT>TGT		tubulin, beta 8 isoform 1							85.0	76.0	79.0					10																	93890		2203	4300	6503	SO:0001583	missense	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93890C>A	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.442G>T	10.37:g.93890C>A	ENSP00000311042:p.Gly148Cys		Somatic				TUBB8_uc009xhe.2_Missense_Mutation_p.G111C|TUBB8_uc010pzs.1_Missense_Mutation_p.G76C	p.G148C	NM_177987	NP_817124	WXS	Illumina HiSeq	Unspecified	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	442	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	148					Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	c.442G>T	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299314	0.40694	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.73363	-0.74	.	.	.	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	U	0.000007	T	0.64768	0.2628	N	0.03608	-0.345	0.40961	D	0.984626	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65915	-0.6052	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	111;148	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	C	76;114;111;148	ENSP00000403895:G76C	ENSP00000272035:G114C	G	-	1	0	RP11-631M21.2	83890	1.000000	0.71417	0.678000	0.29963	0.683000	0.39861	5.268000	0.65536	0.119000	0.18210	0.121000	0.15741	GGT		0.587	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		27	153	1	0	2.12542e-12	0.00632	3.08572e-12	27	153				
GATA3	2625	broad.mit.edu	37	10	8100557	8100557	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:8100557G>A	ENST00000346208.3	+	3	986	c.531G>A	c.(529-531)cgG>cgA	p.R177R	GATA3_ENST00000379328.3_Silent_p.R177R|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	177					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.R177R(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GCTCGGCCCGGCAGGACGAGA	0.701			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																uc001ika.2		NA		Rec	yes		10	10p15	2625	F|N|S	GATA binding protein 3	yes	HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)	E			breast		1	Substitution - coding silent(1)		lung(1)	breast(17)|ovary(3)|central_nervous_system(2)	22						c.(529-531)CGG>CGA		GATA binding protein 3 isoform 2							51.0	50.0	50.0					10																	8100557		2203	4300	6503	SO:0001819	synonymous_variant	2625				aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr10:8100557G>A	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.531G>A	10.37:g.8100557G>A			Somatic				GATA3_uc001ijz.2_Silent_p.R177R	p.R177R	NM_002051	NP_002042	WXS	Illumina HiSeq	Unspecified	P23771	GATA3_HUMAN			3	1088	+			177					Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	37	c.531G>A	CCDS7083.1																																																																																				0.701	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		3	42	0	0	0	0.004672	0	3	42				
GPR158	57512	broad.mit.edu	37	10	25887427	25887427	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:25887427C>A	ENST00000376351.3	+	11	3231	c.2872C>A	c.(2872-2874)Ccc>Acc	p.P958T	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	958					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P958T(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AGATCCTGCCCCCCAAAACTC	0.438																																							uc001isj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2872-2874)CCC>ACC		G protein-coupled receptor 158 precursor							88.0	101.0	97.0					10																	25887427		2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25887427C>A	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2872C>A	10.37:g.25887427C>A	ENSP00000365529:p.Pro958Thr		Somatic				GPR158_uc001isk.2_Missense_Mutation_p.P333T	p.P958T	NM_020752	NP_065803	WXS	Illumina HiSeq	Unspecified	Q5T848	GP158_HUMAN			11	2932	+			958			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.2872C>A	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	1.360	-0.588975	0.03799	.	.	ENSG00000151025	ENST00000376351	T	0.28255	1.62	5.44	1.46	0.22682	.	0.949619	0.08802	N	0.891631	T	0.19927	0.0479	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33548	-0.9864	10	0.07482	T	0.82	.	7.0371	0.24998	0.1249:0.6822:0.0:0.1929	.	958	Q5T848	GP158_HUMAN	T	958	ENSP00000365529:P958T	ENSP00000365529:P958T	P	+	1	0	GPR158	25927433	0.004000	0.15560	0.002000	0.10522	0.233000	0.25261	1.710000	0.37920	0.649000	0.30751	0.650000	0.86243	CCC		0.438	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		29	66	1	0	1.26454e-06	0.005443	1.55601e-06	29	66				
SYT15	83849	broad.mit.edu	37	10	46967663	46967663	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:46967663T>C	ENST00000374321.4	-	4	480	c.414A>G	c.(412-414)aaA>aaG	p.K138K	SYT15_ENST00000374325.3_Silent_p.K138K|SYT15_ENST00000374323.4_Silent_p.K191K|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000503753.1_Silent_p.K138K	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K138K(2)|p.K190K(1)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						CGGTCTCACTTTTGTCCTCCG	0.612																																					Ovarian(57;1152 1428 19651 37745)	Ovarian(57;1152 1428 19651 37745)	uc001jea.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(412-414)AAA>AAG		synaptotagmin XV isoform a							100.0	116.0	111.0					10																	46967663		2060	4203	6263	SO:0001819	synonymous_variant	83849					integral to membrane|plasma membrane		g.chr10:46967663T>C	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.414A>G	10.37:g.46967663T>C			Somatic				SYT15_uc001jdz.2_Silent_p.K138K|SYT15_uc001jeb.2_Silent_p.K16K|SYT15_uc010qfp.1_RNA	p.K138K	NM_031912	NP_114118	WXS	Illumina HiSeq	Unspecified	Q9BQS2	SYT15_HUMAN			4	567	-			138			Cytoplasmic (Potential).		A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Silent	SNP	ENST00000374321.4	37	c.414A>G	CCDS44376.1																																																																																				0.612	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912		16	175	0	0	0	0.007413	0	16	175				
OGDHL	55753	broad.mit.edu	37	10	50953477	50953477	+	Nonsense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:50953477G>C	ENST00000374103.4	-	12	1627	c.1542C>G	c.(1540-1542)taC>taG	p.Y514*	OGDHL_ENST00000432695.1_Nonsense_Mutation_p.Y305*|OGDHL_ENST00000419399.1_Nonsense_Mutation_p.Y457*	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	514					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.Y514*(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GGATCTGCTTGTACATGAGCG	0.612																																							uc001jie.2		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(1)	1						c.(1540-1542)TAC>TAG		oxoglutarate dehydrogenase-like isoform a							108.0	96.0	100.0					10																	50953477		2203	4300	6503	SO:0001587	stop_gained	55753				glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:50953477G>C	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1542C>G	10.37:g.50953477G>C	ENSP00000363216:p.Tyr514*		Somatic				OGDHL_uc009xog.2_Nonsense_Mutation_p.Y541*|OGDHL_uc010qgt.1_Nonsense_Mutation_p.Y457*|OGDHL_uc010qgu.1_Nonsense_Mutation_p.Y305*|OGDHL_uc009xoh.2_Nonsense_Mutation_p.Y305*	p.Y514*	NM_018245	NP_060715	WXS	Illumina HiSeq	Unspecified	Q9ULD0	OGDHL_HUMAN			12	1684	-			514					A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Nonsense_Mutation	SNP	ENST00000374103.4	37	c.1542C>G	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	G	41	8.642527	0.98897	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	.	.	.	5.3	-0.604	0.11626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.443	0.38679	0.5042:0.0:0.4957:0.0	.	.	.	.	X	514;457;305	.	ENSP00000363216:Y514X	Y	-	3	2	OGDHL	50623483	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	1.357000	0.34090	-0.314000	0.08716	-0.355000	0.07637	TAC		0.612	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245		8	52	0	0	0	0.008291	0	8	52				
RHOBTB1	9886	broad.mit.edu	37	10	62648365	62648365	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:62648365A>T	ENST00000337910.5	-	6	1398	c.1061T>A	c.(1060-1062)gTg>gAg	p.V354E	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.V354E	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	354	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.V354E(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					CAGAGCCTCCACCAGGCTCTT	0.577																																							uc001jli.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1060-1062)GTG>GAG		Rho-related BTB domain containing 1							67.0	73.0	71.0					10																	62648365		2203	4298	6501	SO:0001583	missense	9886				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding	g.chr10:62648365A>T	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1061T>A	10.37:g.62648365A>T	ENSP00000338671:p.Val354Glu		Somatic				RHOBTB1_uc001jlh.2_Missense_Mutation_p.V354E|RHOBTB1_uc001jlj.2_Missense_Mutation_p.V354E|RHOBTB1_uc001jlk.2_Missense_Mutation_p.V354E|RHOBTB1_uc009xpe.1_Missense_Mutation_p.V292E|RHOBTB1_uc001jll.2_Missense_Mutation_p.V104E	p.V354E	NM_014836	NP_055651	WXS	Illumina HiSeq	Unspecified	O94844	RHBT1_HUMAN			7	1499	-	Prostate(12;0.0112)		354			BTB 1.			Missense_Mutation	SNP	ENST00000337910.5	37	c.1061T>A	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	A	3.251	-0.153246	0.06585	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.15256	2.44;2.44	5.91	-4.67	0.03319	BTB/POZ-like (2);BTB/POZ fold (1);	1.425340	0.04166	N	0.323994	T	0.08492	0.0211	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33929	-0.9849	10	0.30078	T	0.28	.	8.7984	0.34894	0.6438:0.0953:0.2609:0.0	.	354	O94844	RHBT1_HUMAN	E	354	ENSP00000350595:V354E;ENSP00000338671:V354E	ENSP00000338671:V354E	V	-	2	0	RHOBTB1	62318371	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.224000	0.09164	-1.170000	0.02769	0.377000	0.23210	GTG		0.577	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1			58	84	0	0	0	0.01441	0	58	84				
GRID1	2894	broad.mit.edu	37	10	87379647	87379647	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:87379647G>T	ENST00000327946.7	-	14	2422	c.2337C>A	c.(2335-2337)ccC>ccA	p.P779P	GRID1_ENST00000536331.1_Silent_p.P350P	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	779					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.P779P(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GGTCCCTGTAGGGGCTGCCAT	0.567										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(2335-2337)CCC>CCA		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						71.0	59.0	63.0					10																	87379647		2203	4300	6503	SO:0001819	synonymous_variant	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87379647G>T	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2337C>A	10.37:g.87379647G>T		Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_Intron|GRID1_uc010qmf.1_Silent_p.P350P	p.P779P	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			14	2438	-			779			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	c.2337C>A	CCDS31236.1																																																																																				0.567	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		13	26	1	0	1.5842e-08	0.001855	2.09374e-08	13	26				
SEC31B	25956	broad.mit.edu	37	10	102256170	102256170	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:102256170T>C	ENST00000370345.3	-	18	2252	c.2155A>G	c.(2155-2157)Atg>Gtg	p.M719V	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	719					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.M719V(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		TTAAGAACCATCACCTTCTCC	0.557																																							uc001krc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2155-2157)ATG>GTG		SEC31 homolog B							86.0	80.0	82.0					10																	102256170		2203	4300	6503	SO:0001583	missense	25956				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane		g.chr10:102256170T>C	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2155A>G	10.37:g.102256170T>C	ENSP00000359370:p.Met719Val		Somatic				SEC31B_uc010qpo.1_Missense_Mutation_p.M718V|SEC31B_uc001krd.1_Missense_Mutation_p.M256V|SEC31B_uc001krf.1_Missense_Mutation_p.M256V|SEC31B_uc001kre.1_Missense_Mutation_p.M256V|SEC31B_uc001krg.1_Missense_Mutation_p.M288V	p.M719V	NM_015490	NP_056305	WXS	Illumina HiSeq	Unspecified	Q9NQW1	SC31B_HUMAN		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)	18	2257	-		Colorectal(252;0.117)	719					B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	c.2155A>G	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	T	4.205	0.036854	0.08148	.	.	ENSG00000075826	ENST00000370345	T	0.47869	0.83	5.78	3.38	0.38709	.	0.254648	0.56097	N	0.000032	T	0.32466	0.0830	L	0.45285	1.41	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.002	T	0.09640	-1.0665	10	0.07175	T	0.84	-4.8651	7.2775	0.26292	0.0:0.0782:0.1446:0.7772	.	718;719	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	V	719	ENSP00000359370:M719V	ENSP00000359370:M719V	M	-	1	0	SEC31B	102246160	0.997000	0.39634	0.988000	0.46212	0.848000	0.48234	1.825000	0.39081	0.427000	0.26145	0.374000	0.22700	ATG		0.557	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490		9	67	0	0	0	0.006214	0	9	67				
SLK	9748	broad.mit.edu	37	10	105750539	105750539	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:105750539G>C	ENST00000369755.3	+	2	802	c.257G>C	c.(256-258)tGt>tCt	p.C86S	SLK_ENST00000335753.4_Missense_Mutation_p.C86S	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.C86S(1)		kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TTAGCATCTTGTGATCACCCA	0.348																																					NSCLC(111;540 1651 1927 4474 17706)	NSCLC(111;540 1651 1927 4474 17706)	uc001kxo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8						c.(256-258)TGT>TCT		serine/threonine kinase 2							129.0	120.0	123.0					10																	105750539		2203	4300	6503	SO:0001583	missense	9748				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity	g.chr10:105750539G>C		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.257G>C	10.37:g.105750539G>C	ENSP00000358770:p.Cys86Ser		Somatic				SLK_uc001kxp.1_Missense_Mutation_p.C86S	p.C86S	NM_014720	NP_055535	WXS	Illumina HiSeq	Unspecified	Q9H2G2	SLK_HUMAN		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	2	291	+		Colorectal(252;0.178)	86			Protein kinase.		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	c.257G>C	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138911	0.94560	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.64085	-0.08;-0.08	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70518	0.3233	N	0.17764	0.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.72530	-0.4265	10	0.66056	D	0.02	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	86;86	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	S	86	ENSP00000336824:C86S;ENSP00000358770:C86S	ENSP00000336824:C86S	C	+	2	0	SLK	105740529	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.734000	0.98822	2.941000	0.99782	0.655000	0.94253	TGT		0.348	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720		9	57	0	0	0	0.006214	0	9	57				
COL17A1	1308	broad.mit.edu	37	10	105794522	105794523	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:105794522_105794523GC>AA	ENST00000353479.5	-	51	3912_3913	c.3622_3623GC>TT	c.(3622-3624)GCc>TTc	p.A1208F	COL17A1_ENST00000369733.3_Missense_Mutation_p.A1126F	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1208	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A1208F(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGACAAGCCGGCAGCTGGGCAG	0.644																																							uc001kxr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(3622-3624)GCC>TTC		alpha 1 type XVII collagen																																				SO:0001583	missense	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105794522_105794523GC>AA	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3622_3623delinsAA	10.37:g.105794522_105794523delinsAA	ENSP00000340937:p.Ala1208Phe		Somatic				COL17A1_uc001kxq.2_5'Flank	p.A1208F	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	51	3791_3792	-		Colorectal(252;0.103)|Breast(234;0.122)	1208			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	DNP	ENST00000353479.5	37	c.3622_3623GC>TT	CCDS7554.1																																																																																				0.644	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		10	36	0	0	0	0.004672	0	10	36				
PNLIPRP1	5407	broad.mit.edu	37	10	118355819	118355819	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:118355819C>A	ENST00000528052.1	+	6	630	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.L187M|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.L187M			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	187					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.L187M(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		GACTCCAGGCCTGAGCAGGAT	0.582																																							uc001lco.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(559-561)CTG>ATG		pancreatic lipase-related protein 1 precursor							106.0	110.0	108.0					10																	118355819		2203	4300	6503	SO:0001583	missense	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118355819C>A	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.559C>A	10.37:g.118355819C>A	ENSP00000433933:p.Leu187Met		Somatic				PNLIPRP1_uc001lcp.2_Missense_Mutation_p.L187M|PNLIPRP1_uc009xys.1_RNA	p.L187M	NM_006229	NP_006220	WXS	Illumina HiSeq	Unspecified	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	6	577	+			187					Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	c.559C>A	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461132	0.26248	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000530319;ENST00000527980;ENST00000534537	D;D;D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17;-3.17;-3.17	5.1	2.17	0.27698	Lipase, N-terminal (1);	0.346287	0.24384	N	0.038990	D	0.91985	0.7461	M	0.87381	2.88	0.80722	D	1	P	0.41498	0.752	B	0.39339	0.297	D	0.89310	0.3632	10	0.87932	D	0	-3.5857	4.4873	0.11796	0.2357:0.518:0.0:0.2463	.	187	P54315	LIPR1_HUMAN	M	187;187;187;142;114;187	ENSP00000436123:L187M;ENSP00000351695:L187M;ENSP00000433933:L187M;ENSP00000437263:L142M;ENSP00000433785:L114M;ENSP00000434159:L187M	ENSP00000351695:L187M	L	+	1	2	PNLIPRP1	118345809	0.858000	0.29795	0.995000	0.50966	0.626000	0.37791	0.775000	0.26689	0.647000	0.30713	-0.150000	0.13652	CTG		0.582	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		32	129	1	0	2.81731e-10	0.010818	3.87452e-10	32	129				
VAX1	11023	broad.mit.edu	37	10	118897512	118897512	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:118897512G>C	ENST00000369206.5	-	1	55	c.56C>G	c.(55-57)gCc>gGc	p.A19G	VAX1_ENST00000277905.2_Missense_Mutation_p.A19G	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	19					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A19G(2)		endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		CGAGACCCGGGCAGCCTCGGC	0.562																																							uc009xyx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(55-57)GCC>GGC		ventral anterior homeobox 1 isoform a							44.0	50.0	48.0					10																	118897512		2203	4300	6503	SO:0001583	missense	11023					nucleus	sequence-specific DNA binding	g.chr10:118897512G>C	AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.56C>G	10.37:g.118897512G>C	ENSP00000358207:p.Ala19Gly		Somatic				VAX1_uc001ldb.1_Missense_Mutation_p.A19G	p.A19G	NM_001112704	NP_001106175	WXS	Illumina HiSeq	Unspecified	Q5SQQ9	VAX1_HUMAN		all cancers(201;0.0108)	1	301	-			19					B1AVW5|Q6ZSX0	Missense_Mutation	SNP	ENST00000369206.5	37	c.56C>G	CCDS44483.1	.	.	.	.	.	.	.	.	.	.	G	7.047	0.563627	0.13498	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.91631	-2.16;-2.88	4.25	3.22	0.36961	.	0.734981	0.12475	N	0.465685	T	0.74427	0.3715	N	0.01874	-0.695	0.24709	N	0.99322	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.63888	-0.6535	10	0.02654	T	1	-6.5749	7.7588	0.28940	0.0:0.1239:0.6261:0.25	.	19;19	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	G	19	ENSP00000277905:A19G;ENSP00000358207:A19G	ENSP00000277905:A19G	A	-	2	0	VAX1	118887502	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.197000	0.42696	1.896000	0.54893	0.305000	0.20034	GCC		0.562	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242		9	39	0	0	0	0.004482	0	9	39				
EIF3A	8661	broad.mit.edu	37	10	120810820	120810820	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:120810820T>A	ENST00000369144.3	-	15	2337	c.2210A>T	c.(2209-2211)cAg>cTg	p.Q737L	EIF3A_ENST00000541549.1_Missense_Mutation_p.Q703L	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.Q737L(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ACGTTCTAGCTGCATTGTAGT	0.348																																							uc001ldu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2209-2211)CAG>CTG		eukaryotic translation initiation factor 3,							145.0	134.0	137.0					10																	120810820		2203	4300	6503	SO:0001583	missense	8661				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity	g.chr10:120810820T>A	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.2210A>T	10.37:g.120810820T>A	ENSP00000358140:p.Gln737Leu		Somatic				EIF3A_uc010qsu.1_Missense_Mutation_p.Q703L|EIF3A_uc009xzg.1_5'Flank	p.Q737L	NM_003750	NP_003741	WXS	Illumina HiSeq	Unspecified	Q14152	EIF3A_HUMAN		all cancers(201;0.0236)	15	2356	-		Lung NSC(174;0.094)|all_lung(145;0.123)	737			Interaction with EIF3B.|Glu-rich.		B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	c.2210A>T	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111553	0.37242	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.41758	0.99;0.99	5.36	5.36	0.76844	.	0.000000	0.34555	U	0.003864	T	0.23649	0.0572	N	0.05383	-0.06	0.37498	D	0.91663	B	0.02656	0.0	B	0.04013	0.001	T	0.11792	-1.0573	10	0.45353	T	0.12	-22.2978	10.618	0.45462	0.1434:0.0:0.0:0.8566	.	737	Q14152	EIF3A_HUMAN	L	737;703	ENSP00000358140:Q737L;ENSP00000438178:Q703L	ENSP00000358140:Q737L	Q	-	2	0	EIF3A	120800810	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.739000	0.68622	2.041000	0.60428	0.333000	0.21579	CAG		0.348	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750		30	66	0	0	0	0.010818	0	30	66				
JAKMIP3	282973	broad.mit.edu	37	10	133930853	133930853	+	Silent	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:133930853G>C	ENST00000298622.4	+	2	546	c.408G>C	c.(406-408)ctG>ctC	p.L136L		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	136						Golgi apparatus (GO:0005794)		p.L136L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CCGTGCTGCTGTCCGAGGCCA	0.607																																							uc001lkx.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(406-408)CTG>CTC		Janus kinase and microtubule interacting protein							89.0	106.0	100.0					10																	133930853		2150	4250	6400	SO:0001819	synonymous_variant	282973							g.chr10:133930853G>C	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.408G>C	10.37:g.133930853G>C			Somatic					p.L136L	NM_001105521	NP_001098991	WXS	Illumina HiSeq	Unspecified				OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)	2	408	+		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)						A6PW00|Q69YM6|Q6ZT29	Silent	SNP	ENST00000298622.4	37	c.408G>C	CCDS44494.1																																																																																				0.607	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303		11	77	0	0	0	0.00245	0	11	77				
SYCE1	93426	broad.mit.edu	37	10	135369500	135369500	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr10:135369500G>T	ENST00000343131.5	-	9	684	c.580C>A	c.(580-582)Cag>Aag	p.Q194K	SYCE1_ENST00000368517.3_Missense_Mutation_p.Q158K|SYCE1_ENST00000432597.2_Missense_Mutation_p.Q158K|SPRN_ENST00000541506.1_Intron	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	194					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.Q158K(1)|p.Q194K(1)		breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTGAGCAGCTGCTCCTTGCTG	0.582																																							uc001lno.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(580-582)CAG>AAG		synaptonemal complex central element protein 1							148.0	123.0	131.0					10																	135369500		2203	4300	6503	SO:0001583	missense	93426				cell division	central element		g.chr10:135369500G>T	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.580C>A	10.37:g.135369500G>T	ENSP00000341282:p.Gln194Lys		Somatic				CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.Q66K|SYCE1_uc009ybn.2_Missense_Mutation_p.Q194K|SYCE1_uc001lnn.2_Missense_Mutation_p.Q158K	p.Q194K	NM_001143764	NP_001137236	WXS	Illumina HiSeq	Unspecified	Q8N0S2	SYCE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	9	685	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	194			Potential.		B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	c.580C>A	CCDS44501.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853350	0.51270	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	4.38	3.48	0.39840	.	0.280656	0.30338	N	0.009847	T	0.37892	0.1020	M	0.68317	2.08	0.25867	N	0.983751	B;P;P	0.46142	0.004;0.873;0.728	B;B;B	0.44044	0.006;0.439;0.264	T	0.25813	-1.0121	10	0.39692	T	0.17	-8.7195	9.9798	0.41806	0.0:0.0:0.7986:0.2014	.	66;194;158	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	K	194;158;158;194	ENSP00000303978:Q194K;ENSP00000411779:Q158K;ENSP00000357503:Q158K;ENSP00000341282:Q194K	ENSP00000303978:Q194K	Q	-	1	0	SYCE1	135219490	0.907000	0.30839	0.949000	0.38748	0.764000	0.43329	2.017000	0.40981	1.438000	0.47492	0.655000	0.94253	CAG		0.582	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564		35	64	1	0	1.42033e-22	0.004289	2.4135e-22	35	64				
MUC5B	727897	broad.mit.edu	37	11	1269244	1269244	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:1269244C>G	ENST00000529681.1	+	31	11192	c.11134C>G	c.(11134-11136)Ccg>Gcg	p.P3712A	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P3715A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3712	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.P3712A(1)|p.P3691A(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACGGCCACCCCGTCCTCCAC	0.657																																							uc009ycr.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(12718-12720)CCG>GCG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							65.0	84.0	78.0					11																	1269244		1993	4139	6132	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1269244C>G	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11134C>G	11.37:g.1269244C>G	ENSP00000436812:p.Pro3712Ala		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.P3715A	p.P4240A	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	50	12844	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	3712			7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.12718C>G	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	3.379	-0.126801	0.06795	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18657	2.2;2.33	3.27	-6.54	0.01860	.	.	.	.	.	T	0.10337	0.0253	N	0.24115	0.695	0.09310	N	1	B;B	0.22346	0.068;0.068	B;B	0.15052	0.012;0.012	T	0.28202	-1.0051	9	0.87932	D	0	.	3.8933	0.09128	0.4951:0.2255:0.2007:0.0787	.	4240;3715	A7Y9J9;E9PBJ0	.;.	A	3712;3715;3684;3617	ENSP00000436812:P3712A;ENSP00000415793:P3715A	ENSP00000343037:P3684A	P	+	1	0	MUC5B	1225820	.	.	0.000000	0.03702	0.008000	0.06430	.	.	-2.124000	0.00822	-0.350000	0.07774	CCG		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		41	42	0	0	0	0.01441	0	41	42				
SYT8	90019	broad.mit.edu	37	11	1857722	1857722	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:1857722G>T	ENST00000381968.3	+	6	754	c.626G>T	c.(625-627)gGg>gTg	p.G209V	SYT8_ENST00000341958.3_Missense_Mutation_p.G195V|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	209	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)	p.G209V(1)		breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGCTTCTCGGGGCATGAGCCC	0.677																																							uc001lue.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(625-627)GGG>GTG		synaptotagmin VIII							16.0	20.0	19.0					11																	1857722		2202	4295	6497	SO:0001583	missense	90019					acrosomal vesicle|integral to membrane|plasma membrane|synaptic vesicle	transporter activity	g.chr11:1857722G>T	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.626G>T	11.37:g.1857722G>T	ENSP00000371394:p.Gly209Val		Somatic				SYT8_uc001lud.2_Missense_Mutation_p.G209V|SYT8_uc001luf.1_Missense_Mutation_p.G195V|TNNI2_uc010qxc.1_5'Flank|TNNI2_uc010qxd.1_5'Flank	p.G209V	NM_138567	NP_612634	WXS	Illumina HiSeq	Unspecified	Q8NBV8	SYT8_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	6	754	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	209			C2 1.|Cytoplasmic (Potential).		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	c.626G>T	CCDS7726.2	.	.	.	.	.	.	.	.	.	.	g	13.62	2.290430	0.40494	.	.	ENSG00000149043	ENST00000381968;ENST00000341958	T;T	0.08102	3.13;3.13	2.76	-5.52	0.02560	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.05914	0.0154	L	0.32530	0.975	0.09310	N	1	B;B	0.27416	0.178;0.178	B;B	0.28385	0.089;0.089	T	0.41124	-0.9526	9	0.87932	D	0	.	6.0059	0.19547	0.4985:0.2256:0.2759:0.0	.	209;195	Q8NBV8;A6NCR4	SYT8_HUMAN;.	V	209;195	ENSP00000371394:G209V;ENSP00000343691:G195V	ENSP00000343691:G195V	G	+	2	0	SYT8	1814298	0.000000	0.05858	0.000000	0.03702	0.607000	0.37147	0.141000	0.16076	-0.968000	0.03578	0.313000	0.20887	GGG		0.677	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4			9	9	1	0	7.93312e-07	0.00245	9.79719e-07	9	9				
CHRNA10	57053	broad.mit.edu	37	11	3688774	3688775	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:3688774_3688775CC>AA	ENST00000250699.2	-	4	653_654	c.582_583GG>TT	c.(580-585)gcGGac>gcTTac	p.D195Y	CHRNA10_ENST00000493827.2_5'Flank|Y_RNA_ENST00000363331.1_RNA|CHRNA10_ENST00000534359.1_Missense_Mutation_p.R12L	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	195					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)	p.D195Y(1)		breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	TCCACGAAGTCCGCCAGGCTGG	0.718																																					Melanoma(153;17 1869 2949 7120 36888)	Melanoma(153;17 1869 2949 7120 36888)	uc001lyf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(580-585)GCGGAC>GCTTAC		cholinergic receptor, nicotinic, alpha 10	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)																																			SO:0001583	missense	57053				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding	g.chr11:3688774_3688775CC>AA	AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.582_583delinsAA	11.37:g.3688774_3688775delinsAA	ENSP00000250699:p.Asp195Tyr		Somatic				CHRNA10_uc010qxt.1_5'UTR|CHRNA10_uc010qxu.1_5'UTR	p.D195Y	NM_020402	NP_065135	WXS	Illumina HiSeq	Unspecified	Q9GZZ6	ACH10_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	4	654_655	-		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)	195			Extracellular (Potential).			Missense_Mutation	DNP	ENST00000250699.2	37	c.582_583GG>TT	CCDS7745.1																																																																																				0.718	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2			3	4	0	0	0	0.004672	0	3	4				
OR52B4	143496	broad.mit.edu	37	11	4389409	4389409	+	Silent	SNP	G	G	A	rs567146448	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4389409G>A	ENST00000408920.2	-	1	207	c.117C>T	c.(115-117)acC>acT	p.T39T		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	39					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T39T(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAAGAAGGGCGGTGACATAGG	0.527													G|||	3	0.000599042	0.0015	0.0	5008	,	,		22926	0.0		0.001	False		,,,				2504	0.0						uc010qye.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(115-117)ACC>ACT		olfactory receptor, family 52, subfamily B,							65.0	69.0	68.0					11																	4389409		2105	4246	6351	SO:0001819	synonymous_variant	143496				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4389409G>A	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.117C>T	11.37:g.4389409G>A			Somatic					p.T39T	NM_001005161	NP_001005161	WXS	Illumina HiSeq	Unspecified	Q8NGK2	O52B4_HUMAN		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	117	-		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)	39			Helical; Name=1; (Potential).		A6NP68|Q6IFK6	Silent	SNP	ENST00000408920.2	37	c.117C>T	CCDS41609.1																																																																																				0.527	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161		4	33	0	0	0	0.009096	0	4	33				
OR51D1	390038	broad.mit.edu	37	11	4661968	4661968	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4661968C>A	ENST00000357605.2	+	1	1024	c.948C>A	c.(946-948)ctC>ctA	p.L316L	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	316						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L316L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAAGGGTCCTCTGTATGTTCT	0.463																																							uc010qyk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(946-948)CTC>CTA		olfactory receptor, family 51, subfamily D,							70.0	69.0	69.0					11																	4661968		2201	4298	6499	SO:0001819	synonymous_variant	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661968C>A	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.948C>A	11.37:g.4661968C>A			Somatic					p.L316L	NM_001004751	NP_001004751	WXS	Illumina HiSeq	Unspecified	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	948	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	316			Cytoplasmic (Potential).		B9EIK4	Silent	SNP	ENST00000357605.2	37	c.948C>A	CCDS31357.1																																																																																				0.463	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		32	43	1	0	1.62565e-12	0.012213	2.36521e-12	32	43				
OR51E1	143503	broad.mit.edu	37	11	4674283	4674283	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4674283T>C	ENST00000396952.5	+	2	1177	c.527T>C	c.(526-528)aTc>aCc	p.I176T	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I175T(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGCTCCAATATCCTTTCCCAT	0.547																																							uc001lzi.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|pancreas(1)	4						c.(526-528)ATC>ACC		olfactory receptor, family 51, subfamily E,							214.0	182.0	193.0					11																	4674283		2201	4298	6499	SO:0001583	missense	143503				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4674283T>C	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.527T>C	11.37:g.4674283T>C	ENSP00000380155:p.Ile176Thr		Somatic					p.I176T	NM_152430	NP_689643	WXS	Illumina HiSeq	Unspecified	Q8TCB6	O51E1_HUMAN		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	671	+		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	175			Extracellular (Potential).		A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	37	c.527T>C	CCDS31358.2	.	.	.	.	.	.	.	.	.	.	T	4.688	0.127893	0.08981	.	.	ENSG00000180785	ENST00000396952	T	0.37584	1.19	4.98	0.0653	0.14356	GPCR, rhodopsin-like superfamily (1);	0.501168	0.18463	N	0.140478	T	0.20129	0.0484	N	0.25144	0.715	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.14924	-1.0455	10	0.72032	D	0.01	.	4.3074	0.10953	0.1382:0.2365:0.0:0.6252	.	175	Q8TCB6	O51E1_HUMAN	T	176	ENSP00000380155:I176T	ENSP00000380155:I176T	I	+	2	0	OR51E1	4630859	0.000000	0.05858	0.018000	0.16275	0.435000	0.31806	-0.159000	0.10056	-0.139000	0.11414	-0.256000	0.11100	ATC		0.547	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	NM_152430		58	72	0	0	0	0.01441	0	58	72				
OR51F2	119694	broad.mit.edu	37	11	4842747	4842747	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4842747T>A	ENST00000322110.5	+	1	197	c.132T>A	c.(130-132)ccT>ccA	p.P44P	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P44P(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTCCATCCCTTTTTGTCTCC	0.483																																							uc010qyn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(130-132)CCT>CCA		olfactory receptor, family 51, subfamily F,							274.0	271.0	272.0					11																	4842747		2201	4298	6499	SO:0001819	synonymous_variant	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4842747T>A	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.132T>A	11.37:g.4842747T>A			Somatic					p.P44P	NM_001004753	NP_001004753	WXS	Illumina HiSeq	Unspecified	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	132	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	44			Helical; Name=1; (Potential).		Q6IFI1	Silent	SNP	ENST00000322110.5	37	c.132T>A	CCDS31361.1																																																																																				0.483	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		101	143	0	0	0	0.01441	0	101	143				
OR51F2	119694	broad.mit.edu	37	11	4843386	4843386	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4843386C>A	ENST00000322110.5	+	1	836	c.771C>A	c.(769-771)tcC>tcA	p.S257S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S257S(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCTGCACATCCCACATCAGTG	0.498																																							uc010qyn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(769-771)TCC>TCA		olfactory receptor, family 51, subfamily F,							258.0	178.0	205.0					11																	4843386		2201	4298	6499	SO:0001819	synonymous_variant	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4843386C>A	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.771C>A	11.37:g.4843386C>A			Somatic					p.S257S	NM_001004753	NP_001004753	WXS	Illumina HiSeq	Unspecified	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	771	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	257			Helical; Name=6; (Potential).		Q6IFI1	Silent	SNP	ENST00000322110.5	37	c.771C>A	CCDS31361.1																																																																																				0.498	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		20	30	1	0	8.34094e-07	0.008871	1.02821e-06	20	30				
OR51G2	81282	broad.mit.edu	37	11	4936493	4936493	+	Missense_Mutation	SNP	G	G	T	rs148695983		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:4936493G>T	ENST00000322013.3	-	1	429	c.401C>A	c.(400-402)cCc>cAc	p.P134H	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P134H(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATAGTGCAAGGGGTGGCAGAT	0.488																																							uc001lzr.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(400-402)CCC>CAC		olfactory receptor, family 51, subfamily G,							74.0	74.0	74.0					11																	4936493		2201	4298	6499	SO:0001583	missense	81282				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4936493G>T	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.401C>A	11.37:g.4936493G>T	ENSP00000322593:p.Pro134His		Somatic					p.P134H	NM_001005238	NP_001005238	WXS	Illumina HiSeq	Unspecified	Q8NGK0	O51G2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	401	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	134			Cytoplasmic (Potential).		Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	c.401C>A	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425735	0.83667	.	.	ENSG00000176893	ENST00000322013	T	0.01918	4.56	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000122	T	0.28333	0.0700	H	0.99074	4.42	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.53913	-0.8371	10	0.87932	D	0	.	18.3106	0.90199	0.0:0.0:1.0:0.0	.	134	Q8NGK0	O51G2_HUMAN	H	134	ENSP00000322593:P134H	ENSP00000322593:P134H	P	-	2	0	OR51G2	4893069	1.000000	0.71417	0.980000	0.43619	0.904000	0.53231	9.375000	0.97178	2.906000	0.99361	0.655000	0.94253	CCC		0.488	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238		12	10	1	0	2.27111e-07	0.013537	2.88354e-07	12	10				
OR51V1	283111	broad.mit.edu	37	11	5221548	5221548	+	Missense_Mutation	SNP	G	G	T	rs575815859	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:5221548G>T	ENST00000321255.1	-	1	382	c.383C>A	c.(382-384)gCc>gAc	p.A128D		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	128					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A128D(1)		endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGGTCAAAGGCCATAGTGAG	0.453																																							uc010qyz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(382-384)GCC>GAC		olfactory receptor, family 51, subfamily V,							59.0	59.0	59.0					11																	5221548		2201	4298	6499	SO:0001583	missense	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5221548G>T	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.383C>A	11.37:g.5221548G>T	ENSP00000321729:p.Ala128Asp		Somatic					p.A128D	NM_001004760	NP_001004760	WXS	Illumina HiSeq	Unspecified	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	383	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	128			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000321255.1	37	c.383C>A	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134712	0.77662	.	.	ENSG00000176742	ENST00000321255	T	0.77750	-1.12	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.305531	0.23254	N	0.050209	D	0.91226	0.7235	H	0.96015	3.755	0.44702	D	0.99769	D	0.60575	0.988	P	0.62560	0.904	D	0.93740	0.7049	10	0.87932	D	0	.	17.2701	0.87098	0.0:0.0:1.0:0.0	.	128	Q9H2C8	O51V1_HUMAN	D	128	ENSP00000321729:A128D	ENSP00000321729:A128D	A	-	2	0	OR51V1	5178124	1.000000	0.71417	0.939000	0.37840	0.581000	0.36288	8.823000	0.92018	2.657000	0.90304	0.650000	0.86243	GCC		0.453	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		11	24	1	0	0.000673444	0.008291	0.00074607	11	24				
OR52L1	338751	broad.mit.edu	37	11	6007894	6007894	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:6007894C>A	ENST00000332249.4	-	1	321	c.267G>T	c.(265-267)ctG>ctT	p.L89L		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L74L(1)|p.L89L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCCAGAACCAGGTCGATGG	0.522																																					Melanoma(121;653 1666 10547 22796 51255)	Melanoma(121;653 1666 10547 22796 51255)	uc001mcd.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(265-267)CTG>CTT		olfactory receptor, family 52, subfamily L,							71.0	75.0	74.0					11																	6007894		2107	4235	6342	SO:0001819	synonymous_variant	338751				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6007894C>A	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.267G>T	11.37:g.6007894C>A			Somatic					p.L89L	NM_001005173	NP_001005173	WXS	Illumina HiSeq	Unspecified	Q8NGH7	O52L1_HUMAN		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	322	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	89			Helical; Name=2; (Potential).		B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	c.267G>T	CCDS44529.1																																																																																				0.522	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173		9	11	1	0	7.48243e-07	0.006214	9.29137e-07	9	11				
NLRP14	338323	broad.mit.edu	37	11	7083644	7083644	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:7083644T>A	ENST00000299481.4	+	10	3231	c.2885T>A	c.(2884-2886)cTg>cAg	p.L962Q		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	962					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.L962Q(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CTGAGGAGCCTGGACCTTGGG	0.423																																							uc001mfb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2884-2886)CTG>CAG		NLR family, pyrin domain containing 14							146.0	140.0	142.0					11																	7083644		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7083644T>A	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2885T>A	11.37:g.7083644T>A	ENSP00000299481:p.Leu962Gln		Somatic					p.L962Q	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	10	3208	+			962			LRR 9.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2885T>A	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.852255	0.51270	.	.	ENSG00000158077	ENST00000299481	D	0.89875	-2.58	4.84	4.84	0.62591	.	0.000000	0.35096	N	0.003454	D	0.95730	0.8611	H	0.95850	3.73	0.38616	D	0.951027	D	0.69078	0.997	D	0.74674	0.984	D	0.97122	0.9812	10	0.87932	D	0	.	10.9727	0.47448	0.0:0.0:0.0:1.0	.	962	Q86W24	NAL14_HUMAN	Q	962	ENSP00000299481:L962Q	ENSP00000299481:L962Q	L	+	2	0	NLRP14	7040220	1.000000	0.71417	0.810000	0.32431	0.197000	0.23852	6.010000	0.70753	2.164000	0.68074	0.533000	0.62120	CTG		0.423	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		36	48	0	0	0	0.004289	0	36	48				
PIK3C2A	5286	broad.mit.edu	37	11	17190358	17190358	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:17190358C>G	ENST00000265970.7	-	1	930	c.931G>C	c.(931-933)Gag>Cag	p.E311Q	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	311					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.E311Q(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GTCGATCTCTCTTCAAGAAGA	0.393																																							uc001mmq.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10						c.(931-933)GAG>CAG		phosphoinositide-3-kinase, class 2 alpha	Phosphatidylserine(DB00144)						156.0	152.0	153.0					11																	17190358		2200	4293	6493	SO:0001583	missense	5286				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	g.chr11:17190358C>G	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.931G>C	11.37:g.17190358C>G	ENSP00000265970:p.Glu311Gln		Somatic				PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Missense_Mutation_p.E311Q|PIK3C2A_uc009ygv.1_Missense_Mutation_p.E311Q	p.E311Q	NM_002645	NP_002636	WXS	Illumina HiSeq	Unspecified	O00443	P3C2A_HUMAN			1	997	-			311					B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	c.931G>C	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058529	0.36277	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	T	0.66995	-0.24	5.49	4.38	0.52667	.	0.363615	0.30575	N	0.009324	T	0.53498	0.1800	L	0.29908	0.895	0.80722	D	1	P;B	0.46512	0.879;0.181	B;B	0.39258	0.295;0.062	T	0.57539	-0.7794	10	0.38643	T	0.18	-5.6905	15.1667	0.72833	0.0:0.9204:0.0:0.0796	.	311;311	F5H5W9;O00443	.;P3C2A_HUMAN	Q	311	ENSP00000265970:E311Q	ENSP00000265970:E311Q	E	-	1	0	PIK3C2A	17146934	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.990000	0.49401	2.570000	0.86706	0.563000	0.77884	GAG		0.393	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645		6	77	0	0	0	0.001984	0	6	77				
LUZP2	338645	broad.mit.edu	37	11	25004827	25004827	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:25004827G>T	ENST00000336930.6	+	9	819	c.753G>T	c.(751-753)gcG>gcT	p.A251A	LUZP2_ENST00000533227.1_Silent_p.A165A			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	251						extracellular region (GO:0005576)		p.A251A(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						CAGATGCAGCGGCCAAAAGCA	0.433																																							uc001mqs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(751-753)GCG>GCT		leucine zipper protein 2 precursor							107.0	97.0	101.0					11																	25004827		2203	4300	6503	SO:0001819	synonymous_variant	338645					extracellular region		g.chr11:25004827G>T	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.753G>T	11.37:g.25004827G>T			Somatic				LUZP2_uc009yif.2_Silent_p.A165A|LUZP2_uc009yig.2_Silent_p.A209A	p.A251A	NM_001009909	NP_001009909	WXS	Illumina HiSeq	Unspecified	Q86TE4	LUZP2_HUMAN			9	987	+			251					A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Silent	SNP	ENST00000336930.6	37	c.753G>T	CCDS31446.1																																																																																				0.433	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909		24	33	1	0	2.21704e-12	0.00278	3.20501e-12	24	33				
PAX6	5080	broad.mit.edu	37	11	31811563	31811563	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:31811563G>T	ENST00000379132.3	-	12	1468	c.1188C>A	c.(1186-1188)ctC>ctA	p.L396L	PAX6_ENST00000379107.2_Silent_p.L410L|PAX6_ENST00000379115.4_Silent_p.L410L|PAX6_ENST00000241001.8_Silent_p.L396L|PAX6_ENST00000419022.1_Silent_p.L410L|PAX6_ENST00000379123.5_Silent_p.L396L|PAX6_ENST00000379111.2_Silent_p.L396L|PAX6_ENST00000379129.2_Silent_p.L410L			P26367	PAX6_HUMAN	paired box 6	396	Pro/Ser/Thr-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.L410L(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					CAGGGGAAATGAGTCCTAGAA	0.323									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																														uc001mtd.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9						c.(1186-1188)CTC>CTA		paired box gene 6 isoform a							50.0	49.0	49.0					11																	31811563		2202	4299	6501	SO:0001819	synonymous_variant	5080	Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome	blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity	g.chr11:31811563G>T	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.1188C>A	11.37:g.31811563G>T			Somatic				PAX6_uc001mte.3_Silent_p.L396L|PAX6_uc001mtg.3_Silent_p.L410L|PAX6_uc001mtf.3_Silent_p.L396L|PAX6_uc001mth.3_Silent_p.L396L|PAX6_uc009yjr.2_Silent_p.L396L	p.L396L	NM_001127612	NP_001121084	WXS	Illumina HiSeq	Unspecified	P26367	PAX6_HUMAN			12	2078	-	Lung SC(675;0.225)		396			Pro/Ser/Thr-rich.		Q6N006|Q99413	Silent	SNP	ENST00000379132.3	37	c.1188C>A	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316881	0.95682	.	.	ENSG00000007372	ENST00000531633	.	.	.	6.07	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2011	0.54326	0.1358:0.0:0.8642:0.0	.	.	.	.	X	175	.	.	S	-	2	0	PAX6	31768139	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.351000	0.52232	1.588000	0.49971	0.650000	0.86243	TCA		0.323	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604		12	18	1	0	9.31168e-06	0.001855	1.1018e-05	12	18				
QSER1	79832	broad.mit.edu	37	11	32956353	32956353	+	Silent	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:32956353A>T	ENST00000399302.2	+	4	3497	c.3162A>T	c.(3160-3162)gcA>gcT	p.A1054A	QSER1_ENST00000527788.1_Silent_p.A815A	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1054								p.A1054A(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CTGGGGATGCAGTCAGTGTCA	0.438																																							uc001mty.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(3160-3162)GCA>GCT		glutamine and serine rich 1							83.0	78.0	80.0					11																	32956353		1915	4128	6043	SO:0001819	synonymous_variant	79832							g.chr11:32956353A>T	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3162A>T	11.37:g.32956353A>T			Somatic				QSER1_uc001mtz.1_Silent_p.A815A|QSER1_uc001mua.2_Silent_p.A559A	p.A1054A	NM_001076786	NP_001070254	WXS	Illumina HiSeq	Unspecified	Q2KHR3	QSER1_HUMAN			4	3429	+	Breast(20;0.158)		1054					Q6ZU30|Q6ZUR5	Silent	SNP	ENST00000399302.2	37	c.3162A>T	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	0.490	-0.876007	0.02550	.	.	ENSG00000060749	ENST00000524678	.	.	.	5.51	1.79	0.24919	.	.	.	.	.	T	0.24005	0.0581	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21724	-1.0237	4	.	.	.	.	3.3741	0.07232	0.6288:0.1449:0.0973:0.129	.	.	.	.	L	75	.	.	Q	+	2	0	QSER1	32912929	0.009000	0.17119	0.120000	0.21714	0.540000	0.34992	1.102000	0.31050	0.365000	0.24400	-0.490000	0.04691	CAG		0.438	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		26	26	0	0	0	0.004656	0	26	26				
NR1H3	10062	broad.mit.edu	37	11	47282902	47282902	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:47282902C>T	ENST00000467728.1	+	4	1848	c.610C>T	c.(610-612)Ccc>Tcc	p.P204S	NR1H3_ENST00000407404.1_Missense_Mutation_p.P204S|NR1H3_ENST00000527949.1_Missense_Mutation_p.P113S|NR1H3_ENST00000481889.2_Missense_Mutation_p.P159S|NR1H3_ENST00000405576.1_Missense_Mutation_p.P159S|NR1H3_ENST00000441012.2_Missense_Mutation_p.P204S|NR1H3_ENST00000395397.3_Missense_Mutation_p.P159S|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405853.3_Missense_Mutation_p.P204S			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	204					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P204S(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						CCAAATCCTGCCCCAGCTCAG	0.597																																							uc009ylm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(610-612)CCC>TCC		nuclear receptor subfamily 1, group H, member 3							56.0	54.0	54.0					11																	47282902		2201	4298	6499	SO:0001583	missense	10062				apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding	g.chr11:47282902C>T	U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.610C>T	11.37:g.47282902C>T	ENSP00000420656:p.Pro204Ser		Somatic				NR1H3_uc009yll.1_Missense_Mutation_p.P210S|NR1H3_uc010rhk.1_Missense_Mutation_p.P210S|NR1H3_uc001nek.2_Missense_Mutation_p.P159S|NR1H3_uc001nej.2_Missense_Mutation_p.P204S|NR1H3_uc001nel.2_Missense_Mutation_p.P159S|NR1H3_uc001nen.3_Missense_Mutation_p.P204S|NR1H3_uc001nem.2_Missense_Mutation_p.P204S|NR1H3_uc001nep.2_Missense_Mutation_p.P113S	p.P204S	NM_005693	NP_005684	WXS	Illumina HiSeq	Unspecified	Q13133	NR1H3_HUMAN			5	831	+			204					A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	c.610C>T	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.132555	0.56828	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000531660;ENST00000407404;ENST00000449369;ENST00000441012;ENST00000436029;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;T;D;D;D;D;D;D;D	0.94232	-2.89;-3.2;-3.08;0.97;-3.25;-2.62;-2.93;-2.42;-2.93;-3.25;-3.38	5.33	5.33	0.75918	.	0.275088	0.41823	D	0.000811	D	0.92192	0.7524	M	0.74647	2.275	0.30860	N	0.733648	B;B;B;B;B	0.28552	0.029;0.009;0.215;0.08;0.046	B;B;B;B;B	0.25987	0.017;0.016;0.065;0.029;0.036	D	0.89078	0.3474	10	0.30854	T	0.27	.	15.4235	0.75031	0.0:0.8612:0.1388:0.0	.	210;159;204;159;204	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	S	159;159;159;70;204;204;204;204;204;204;113	ENSP00000378793:P159S;ENSP00000385073:P159S;ENSP00000433271:P159S;ENSP00000434650:P70S;ENSP00000385801:P204S;ENSP00000415591:P204S;ENSP00000387946:P204S;ENSP00000403696:P204S;ENSP00000420656:P204S;ENSP00000384745:P204S;ENSP00000432073:P113S	ENSP00000378793:P159S	P	+	1	0	NR1H3	47239478	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	2.741000	0.47426	2.871000	0.98454	0.655000	0.94253	CCC		0.597	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3			14	13	0	0	0	0.00499	0	14	13				
OR4A16	81327	broad.mit.edu	37	11	55110712	55110712	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:55110712C>A	ENST00000314721.2	+	1	86	c.36C>A	c.(34-36)ctC>ctA	p.L12L		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L12L(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						AATTTGTCCTCCTGGGCCTCA	0.388																																							uc010rie.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|pancreas(1)	3						c.(34-36)CTC>CTA		olfactory receptor, family 4, subfamily A,							55.0	50.0	52.0					11																	55110712		2201	4296	6497	SO:0001819	synonymous_variant	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55110712C>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.36C>A	11.37:g.55110712C>A			Somatic					p.L12L	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	36	+			12			Extracellular (Potential).		Q6IFL3	Silent	SNP	ENST00000314721.2	37	c.36C>A	CCDS31499.1																																																																																				0.388	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		11	46	1	0	1.58986e-06	0.008291	1.94221e-06	11	46				
OR4P4	81300	broad.mit.edu	37	11	55406106	55406106	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:55406106C>A	ENST00000314612.2	+	1	273	c.273C>A	c.(271-273)tcC>tcA	p.S91S		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S91S(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						AGACCATTTCCTATAATAACT	0.418																																							uc010rij.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(271-273)TCC>TCA		olfactory receptor, family 4, subfamily P,							121.0	105.0	111.0					11																	55406106		2179	4021	6200	SO:0001819	synonymous_variant	81300				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55406106C>A	AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.273C>A	11.37:g.55406106C>A			Somatic					p.S91S	NM_001004124	NP_001004124	WXS	Illumina HiSeq	Unspecified	Q8NGL7	OR4P4_HUMAN			1	273	+			91			Extracellular (Potential).			Silent	SNP	ENST00000314612.2	37	c.273C>A	CCDS31504.1																																																																																				0.418	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383356.1	NM_001004124		103	125	1	0	1.85837e-24	0.01441	3.22245e-24	103	125				
OR5L1	219437	broad.mit.edu	37	11	55579446	55579446	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:55579446C>A	ENST00000333973.2	+	1	593	c.504C>A	c.(502-504)ttC>ttA	p.F168L		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F168L(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GGATCCCCTTCTATAGATCTA	0.458																																							uc001nhw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(502-504)TTC>TTA		olfactory receptor, family 5, subfamily L,							220.0	201.0	208.0					11																	55579446		2200	4296	6496	SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579446C>A	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.504C>A	11.37:g.55579446C>A	ENSP00000335529:p.Phe168Leu		Somatic					p.F168L	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	504	+		all_epithelial(135;0.208)	168			Extracellular (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	c.504C>A	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	c	14.62	2.590264	0.46214	.	.	ENSG00000186117	ENST00000333973	T	0.00039	8.85	4.12	-6.45	0.01914	GPCR, rhodopsin-like superfamily (1);	0.126929	0.36555	N	0.002529	T	0.00144	0.0004	M	0.76938	2.355	0.09310	N	1	B	0.25272	0.122	B	0.29176	0.099	T	0.48445	-0.9035	10	0.66056	D	0.02	-23.4877	6.2129	0.20640	0.0:0.2736:0.2331:0.4933	.	168	Q8NGL2	OR5L1_HUMAN	L	168	ENSP00000335529:F168L	ENSP00000335529:F168L	F	+	3	2	OR5L1	55336022	0.000000	0.05858	0.000000	0.03702	0.234000	0.25298	-0.755000	0.04782	-1.214000	0.02614	-0.468000	0.05107	TTC		0.458	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		46	247	1	0	6.21074e-16	0.011902	9.86155e-16	46	247				
OR8J3	81168	broad.mit.edu	37	11	55904620	55904620	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:55904620G>C	ENST00000301529.1	-	1	574	c.575C>G	c.(574-576)aCt>aGt	p.T192S		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T192S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TGGTATGTAAGTATCAGAGCA	0.303																																							uc010riz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(574-576)ACT>AGT		olfactory receptor, family 8, subfamily J,							113.0	115.0	114.0					11																	55904620		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904620G>C		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.575C>G	11.37:g.55904620G>C	ENSP00000301529:p.Thr192Ser		Somatic					p.T192S	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	575	-	Esophageal squamous(21;0.00693)		192			Extracellular (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.575C>G	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535167	0.45176	.	.	ENSG00000167822	ENST00000301529	T	0.00207	8.55	3.27	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.086433	0.50627	D	0.000108	T	0.00496	0.0016	M	0.82193	2.58	0.24983	N	0.99159	P	0.51791	0.948	P	0.60068	0.868	T	0.32955	-0.9887	10	0.59425	D	0.04	.	12.3671	0.55234	0.0:0.0:1.0:0.0	.	192	Q8NGG0	OR8J3_HUMAN	S	192	ENSP00000301529:T192S	ENSP00000301529:T192S	T	-	2	0	OR8J3	55661196	0.002000	0.14202	0.780000	0.31762	0.415000	0.31203	0.497000	0.22514	1.553000	0.49476	0.297000	0.19635	ACT		0.303	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		22	120	0	0	0	0.010504	0	22	120				
OR5T1	390155	broad.mit.edu	37	11	56043707	56043707	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:56043707C>A	ENST00000313033.2	+	1	679	c.593C>A	c.(592-594)gCt>gAt	p.A198D		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A198D(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					CCTCTGCTTGCTATTTCTTGT	0.398																																							uc001nio.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(592-594)GCT>GAT		olfactory receptor, family 5, subfamily T,							237.0	223.0	228.0					11																	56043707		2201	4296	6497	SO:0001583	missense	390155				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56043707C>A	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.593C>A	11.37:g.56043707C>A	ENSP00000323612:p.Ala198Asp		Somatic					p.A198D	NM_001004745	NP_001004745	WXS	Illumina HiSeq	Unspecified	Q8NG75	OR5T1_HUMAN			1	593	+	Esophageal squamous(21;0.00448)		198			Extracellular (Potential).		B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	c.593C>A	CCDS31525.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322814	0.41096	.	.	ENSG00000181698	ENST00000313033	T	0.00115	8.71	3.44	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.128038	0.35436	N	0.003201	T	0.00241	0.0007	L	0.39692	1.235	0.09310	N	1	D	0.62365	0.991	D	0.70716	0.97	T	0.55842	-0.8077	10	0.51188	T	0.08	.	7.5234	0.27641	0.1804:0.6428:0.1768:0.0	.	198	Q8NG75	OR5T1_HUMAN	D	198	ENSP00000323612:A198D	ENSP00000323612:A198D	A	+	2	0	OR5T1	55800283	0.000000	0.05858	0.005000	0.12908	0.122000	0.20287	-0.441000	0.06879	1.943000	0.56356	0.465000	0.42564	GCT		0.398	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		130	173	1	0	1.19401e-59	0.01441	2.224e-59	130	173				
OR5T1	390155	broad.mit.edu	37	11	56043777	56043777	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:56043777C>G	ENST00000313033.2	+	1	749	c.663C>G	c.(661-663)gtC>gtG	p.V221V		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V221V(2)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TTGAGATAGTCACTATCCTGA	0.418																																							uc001nio.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(661-663)GTC>GTG		olfactory receptor, family 5, subfamily T,							216.0	204.0	208.0					11																	56043777		2201	4296	6497	SO:0001819	synonymous_variant	390155				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56043777C>G	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.663C>G	11.37:g.56043777C>G			Somatic					p.V221V	NM_001004745	NP_001004745	WXS	Illumina HiSeq	Unspecified	Q8NG75	OR5T1_HUMAN			1	663	+	Esophageal squamous(21;0.00448)		221			Helical; Name=5; (Potential).		B2RNM9	Silent	SNP	ENST00000313033.2	37	c.663C>G	CCDS31525.1																																																																																				0.418	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		61	216	0	0	0	0.01441	0	61	216				
OR5M3	219482	broad.mit.edu	37	11	56237320	56237320	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:56237320G>C	ENST00000312240.2	-	1	694	c.654C>G	c.(652-654)ttC>ttG	p.F218L		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F218L(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					CAATGAGGATGAATAAGTAAG	0.428																																							uc010rjk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(652-654)TTC>TTG		olfactory receptor, family 5, subfamily M,							81.0	80.0	81.0					11																	56237320		2201	4294	6495	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237320G>C	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.654C>G	11.37:g.56237320G>C	ENSP00000312208:p.Phe218Leu		Somatic					p.F218L	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	654	-	Esophageal squamous(21;0.00448)		218			Cytoplasmic (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.654C>G	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	6.171	0.399651	0.11696	.	.	ENSG00000174937	ENST00000312240	T	0.00063	8.78	5.04	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000427	T	0.00109	0.0003	L	0.28115	0.83	0.09310	N	0.999999	B	0.12013	0.005	B	0.17979	0.02	T	0.21075	-1.0256	10	0.40728	T	0.16	-20.4638	7.5357	0.27708	0.3824:0.0:0.6176:0.0	.	218	Q8NGP4	OR5M3_HUMAN	L	218	ENSP00000312208:F218L	ENSP00000312208:F218L	F	-	3	2	OR5M3	55993896	0.000000	0.05858	0.661000	0.29709	0.119000	0.20118	-0.932000	0.03963	0.095000	0.17434	-0.406000	0.06334	TTC		0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		10	67	0	0	0	0.010729	0	10	67				
MS4A14	84689	broad.mit.edu	37	11	60183058	60183058	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:60183058C>A	ENST00000300187.6	+	5	894	c.617C>A	c.(616-618)gCt>gAt	p.A206D	MS4A14_ENST00000531783.1_Missense_Mutation_p.A239D|MS4A14_ENST00000395005.2_Missense_Mutation_p.A189D|MS4A14_ENST00000531787.1_Missense_Mutation_p.A94D|MS4A14_ENST00000395001.1_3'UTR	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	206						integral component of membrane (GO:0016021)		p.A206D(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						GGAGGCTATGCTTTCTTCAAG	0.383																																							uc001npj.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(616-618)GCT>GAT		membrane-spanning 4-domains, subfamily A, member							132.0	130.0	131.0					11																	60183058		2203	4300	6503	SO:0001583	missense	84689					integral to membrane	receptor activity	g.chr11:60183058C>A	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.617C>A	11.37:g.60183058C>A	ENSP00000300187:p.Ala206Asp		Somatic				MS4A14_uc001npi.2_Missense_Mutation_p.A94D|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.A189D|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	p.A206D	NM_032597	NP_115986	WXS	Illumina HiSeq	Unspecified	Q96JA4	M4A14_HUMAN			5	1182	+			206					E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	c.617C>A	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856030	0.71834	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.10763	4.18;4.18;4.18;2.84	3.63	3.63	0.41609	.	10.647600	0.00166	N	0.000001	T	0.30008	0.0751	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70487	0.948;0.969	T	0.03202	-1.1061	10	0.72032	D	0.01	-2.6655	11.105	0.48197	0.0:1.0:0.0:0.0	.	189;206	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	D	94;206;189;239	ENSP00000437222:A94D;ENSP00000300187:A206D;ENSP00000378453:A189D;ENSP00000433761:A239D	ENSP00000300187:A206D	A	+	2	0	MS4A14	59939634	0.998000	0.40836	0.998000	0.56505	0.985000	0.73830	0.887000	0.28254	2.312000	0.78011	0.650000	0.86243	GCT		0.383	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2			23	38	1	0	2.32416e-17	0.014323	3.77885e-17	23	38				
SLC15A3	51296	broad.mit.edu	37	11	60714150	60714150	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:60714150C>A	ENST00000227880.3	-	2	935	c.702G>T	c.(700-702)gtG>gtT	p.V234V		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	234					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)	p.V234V(1)		central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						CCACACAGCCCACAGGGATGC	0.562																																							uc001nqn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(700-702)GTG>GTT		solute carrier family 15, member 3							96.0	93.0	94.0					11																	60714150		2203	4299	6502	SO:0001819	synonymous_variant	51296				oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity	g.chr11:60714150C>A	AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.702G>T	11.37:g.60714150C>A			Somatic				SLC15A3_uc001nqo.2_Silent_p.V234V	p.V234V	NM_016582	NP_057666	WXS	Illumina HiSeq	Unspecified	Q8IY34	S15A3_HUMAN			2	936	-			234			Helical; (Potential).		Q9P2X9	Silent	SNP	ENST00000227880.3	37	c.702G>T	CCDS7998.1	.	.	.	.	.	.	.	.	.	.	C	9.796	1.179290	0.21787	.	.	ENSG00000110446	ENST00000442626	.	.	.	4.65	3.72	0.42706	.	.	.	.	.	T	0.20007	0.0481	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.15492	-1.0435	5	0.02654	T	1	-17.3016	3.5888	0.07981	0.1763:0.5627:0.1702:0.0908	.	.	.	.	L	234	.	ENSP00000403318:W234L	W	-	2	0	SLC15A3	60470726	0.924000	0.31332	0.875000	0.34327	0.991000	0.79684	-0.052000	0.11865	1.307000	0.44944	0.591000	0.81541	TGG		0.562	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396366.1	NM_016582		31	199	1	0	4.15321e-07	0.009535	5.23397e-07	31	199				
CD6	923	broad.mit.edu	37	11	60783254	60783254	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:60783254A>T	ENST00000313421.7	+	9	1643	c.1457A>T	c.(1456-1458)tAt>tTt	p.Y486F	CD6_ENST00000344028.5_Missense_Mutation_p.Y454F|CD6_ENST00000352009.5_Missense_Mutation_p.Y454F|CD6_ENST00000452451.2_Intron|CD6_ENST00000346437.4_Intron	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	486					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)	p.Y486F(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						GACTCAGACTATGAGCACTAT	0.627																																					Pancreas(169;904 2017 4767 38890 42505)	Pancreas(169;904 2017 4767 38890 42505)	uc001nqq.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1456-1458)TAT>TTT		CD6 molecule precursor							104.0	102.0	103.0					11																	60783254		2203	4299	6502	SO:0001583	missense	923				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity	g.chr11:60783254A>T		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1457A>T	11.37:g.60783254A>T	ENSP00000323280:p.Tyr486Phe		Somatic				CD6_uc001nqp.2_Missense_Mutation_p.Y486F|CD6_uc001nqr.2_Missense_Mutation_p.Y454F|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Intron	p.Y486F	NM_006725	NP_006716	WXS	Illumina HiSeq	Unspecified	P30203	CD6_HUMAN			9	1680	+			486			Cytoplasmic (Potential).		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	c.1457A>T	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371259	0.82573	.	.	ENSG00000013725	ENST00000344028;ENST00000313421;ENST00000433107;ENST00000352009	T;T;T;T	0.04015	3.82;3.85;3.85;3.73	5.81	5.81	0.92471	.	0.000000	0.39544	N	0.001332	T	0.17408	0.0418	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79784	0.993;0.94;0.993	T	0.00127	-1.2019	10	0.66056	D	0.02	.	11.3118	0.49368	0.8483:0.1517:0.0:0.0	.	454;486;486	P30203-4;P30203;Q8N4Q7	.;CD6_HUMAN;.	F	454;486;353;454	ENSP00000344108:Y454F;ENSP00000323280:Y486F;ENSP00000410638:Y353F;ENSP00000340628:Y454F	ENSP00000323280:Y486F	Y	+	2	0	CD6	60539830	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.789000	0.62446	2.217000	0.71921	0.533000	0.62120	TAT		0.627	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725		119	70	0	0	0	0.01441	0	119	70				
AHNAK	79026	broad.mit.edu	37	11	62298829	62298829	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:62298829C>A	ENST00000378024.4	-	5	3334	c.3060G>T	c.(3058-3060)gtG>gtT	p.V1020V	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1020					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V1020V(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGACAGGTTCACATCAAATT	0.463																																							uc001ntl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(3058-3060)GTG>GTT		AHNAK nucleoprotein isoform 1							109.0	107.0	108.0					11																	62298829		2202	4299	6501	SO:0001819	synonymous_variant	79026				nervous system development	nucleus	protein binding	g.chr11:62298829C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3060G>T	11.37:g.62298829C>A			Somatic				AHNAK_uc001ntk.1_Intron	p.V1020V	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	3360	-		Melanoma(852;0.155)	1020					A1A586	Silent	SNP	ENST00000378024.4	37	c.3060G>T	CCDS31584.1																																																																																				0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		61	62	1	0	1.4709e-25	0.01441	2.5836e-25	61	62				
STIP1	10963	broad.mit.edu	37	11	63965045	63965045	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:63965045G>C	ENST00000305218.4	+	7	1027	c.880G>C	c.(880-882)Gaa>Caa	p.E294Q	STIP1_ENST00000358794.5_Missense_Mutation_p.E341Q|STIP1_ENST00000538945.1_Missense_Mutation_p.E270Q	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	294					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E294Q(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AGAAAACCGAGAAGACTATCG	0.498																																							uc001nyk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)	3						c.(880-882)GAA>CAA		stress-induced-phosphoprotein 1							64.0	67.0	66.0					11																	63965045		2201	4297	6498	SO:0001583	missense	10963				axon guidance|response to stress	Golgi apparatus|nucleus		g.chr11:63965045G>C	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.880G>C	11.37:g.63965045G>C	ENSP00000305958:p.Glu294Gln		Somatic				STIP1_uc010rnb.1_Missense_Mutation_p.E270Q	p.E294Q	NM_006819	NP_006810	WXS	Illumina HiSeq	Unspecified	P31948	STIP1_HUMAN			7	1027	+			294					B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	37	c.880G>C	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475168	0.84640	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.15603	2.41;2.65;2.45	5.73	5.73	0.89815	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.21387	0.0515	M	0.62016	1.91	0.80722	D	1	P;P	0.46784	0.884;0.816	B;B	0.39152	0.292;0.192	T	0.01951	-1.1241	10	0.27082	T	0.32	-29.9645	19.059	0.93080	0.0:0.0:1.0:0.0	.	270;294	F5H0T1;P31948	.;STIP1_HUMAN	Q	341;294;270	ENSP00000351646:E341Q;ENSP00000305958:E294Q;ENSP00000445957:E270Q	ENSP00000305958:E294Q	E	+	1	0	STIP1	63721621	1.000000	0.71417	0.979000	0.43373	0.991000	0.79684	7.320000	0.79064	2.882000	0.98803	0.655000	0.94253	GAA		0.498	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819		7	25	0	0	0	0.001984	0	7	25				
TM7SF2	7108	broad.mit.edu	37	11	64882402	64882402	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:64882402C>T	ENST00000279263.7	+	7	903	c.741C>T	c.(739-741)acC>acT	p.T247T	AP003068.12_ENST00000527789.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.T247T|TM7SF2_ENST00000531029.1_3'UTR|TM7SF2_ENST00000540748.1_Silent_p.T131T	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	247					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)	p.T247T(1)		lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCCTCACCACCATGGATATCA	0.617																																							uc001oct.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(739-741)ACC>ACT		transmembrane 7 superfamily member 2							187.0	197.0	194.0					11																	64882402		2111	4234	6345	SO:0001819	synonymous_variant	7108				cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane	delta14-sterol reductase activity	g.chr11:64882402C>T	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.741C>T	11.37:g.64882402C>T			Somatic				TM7SF2_uc010rny.1_Silent_p.T131T|TM7SF2_uc001ocu.2_Silent_p.T247T|TM7SF2_uc001ocv.2_Silent_p.T268T|uc009yqb.1_5'Flank	p.T247T	NM_003273	NP_003264	WXS	Illumina HiSeq	Unspecified	O76062	ERG24_HUMAN			7	888	+			247					A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	c.741C>T	CCDS41669.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711989	0.15306	.	.	ENSG00000149809	ENST00000528802	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	T	0.62319	0.2418	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59241	-0.7491	4	.	.	.	-10.0136	11.255	0.49048	0.1821:0.8179:0.0:0.0	.	.	.	.	L	75	.	.	P	+	2	0	TM7SF2	64638978	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	1.541000	0.36126	2.724000	0.93272	0.561000	0.74099	CCA		0.617	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273		70	158	0	0	0	0.01441	0	70	158				
FOSL1	8061	broad.mit.edu	37	11	65664372	65664372	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:65664372T>A	ENST00000312562.2	-	2	391	c.205A>T	c.(205-207)Acc>Tcc	p.T69S	FOSL1_ENST00000448083.2_Intron|FOSL1_ENST00000532401.1_Missense_Mutation_p.T69S|FOSL1_ENST00000531493.1_Missense_Mutation_p.T69S	NM_005438.3	NP_005429.1	P15407	FOSL1_HUMAN	FOS-like antigen 1	69					cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|chemotaxis (GO:0006935)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)|vitellogenesis (GO:0007296)	cytosol (GO:0005829)|neuron projection (GO:0043005)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T69S(1)		breast(1)|endometrium(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	10				READ - Rectum adenocarcinoma(159;0.168)		TGAGGGTAGGTCAGAGGCCTG	0.632																																							uc001ogg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)ACC>TCC		FOS-like antigen 1							66.0	63.0	64.0					11																	65664372		2201	4296	6497	SO:0001583	missense	8061				cellular defense response|chemotaxis|positive regulation of cell proliferation|response to virus|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:65664372T>A	BC016648	CCDS8121.1, CCDS73324.1	11q13	2013-01-10			ENSG00000175592	ENSG00000175592		"""basic leucine zipper proteins"""	13718	protein-coding gene	gene with protein product		136515				2107490	Standard	XM_005274311		Approved	fra-1	uc001ogg.1	P15407	OTTHUMG00000166715	ENST00000312562.2:c.205A>T	11.37:g.65664372T>A	ENSP00000310170:p.Thr69Ser		Somatic				FOSL1_uc010ros.1_Intron	p.T69S	NM_005438	NP_005429	WXS	Illumina HiSeq	Unspecified	P15407	FOSL1_HUMAN		READ - Rectum adenocarcinoma(159;0.168)	2	392	-			69					B4DR11|Q6FG51	Missense_Mutation	SNP	ENST00000312562.2	37	c.205A>T	CCDS8121.1	.	.	.	.	.	.	.	.	.	.	T	4.041	0.005124	0.07866	.	.	ENSG00000175592	ENST00000455710;ENST00000312562;ENST00000531493;ENST00000532401	T	0.75589	-0.95	5.21	-4.53	0.03462	.	1.309980	0.04730	N	0.421022	T	0.42449	0.1203	N	0.04508	-0.205	0.22745	N	0.998782	B	0.06786	0.001	B	0.06405	0.002	T	0.33033	-0.9884	10	0.08837	T	0.75	-1.2281	1.7083	0.02887	0.1295:0.287:0.1517:0.4318	.	69	P15407	FOSL1_HUMAN	S	69	ENSP00000310170:T69S	ENSP00000310170:T69S	T	-	1	0	FOSL1	65420948	0.013000	0.17824	0.816000	0.32577	0.768000	0.43524	0.130000	0.15850	-0.515000	0.06479	-1.216000	0.01612	ACC		0.632	FOSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391168.2	NM_005438		24	50	0	0	0	0.014323	0	24	50				
CD248	57124	broad.mit.edu	37	11	66084155	66084155	+	Missense_Mutation	SNP	G	G	T	rs140616335		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:66084155G>T	ENST00000311330.3	-	1	360	c.344C>A	c.(343-345)aCc>aAc	p.T115N	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	115	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)	p.T115N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGCCCAGTTGGTGAAAGCCGT	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14135	0.0		0.0	False		,,,				2504	0.0						uc001ohm.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)	3						c.(343-345)ACC>AAC		tumor endothelial marker 1 precursor	Cefalotin(DB00456)	G	ASN/THR	3,4319		0,3,2158	26.0	25.0	25.0		344	4.0	1.0	11	dbSNP_134	25	0,8476		0,0,4238	no	missense	CD248	NM_020404.2	65	0,3,6396	TT,TG,GG		0.0,0.0694,0.0234	probably-damaging	115/758	66084155	3,12795	2161	4238	6399	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66084155G>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.344C>A	11.37:g.66084155G>T	ENSP00000308117:p.Thr115Asn		Somatic					p.T115N	NM_020404	NP_065137	WXS	Illumina HiSeq	Unspecified	Q9HCU0	CD248_HUMAN			1	361	-			115			C-type lectin.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.344C>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807752	0.70797	6.94E-4	0.0	ENSG00000174807	ENST00000311330	T	0.19532	2.14	3.96	3.96	0.45880	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.137290	0.46442	D	0.000295	T	0.28101	0.0693	N	0.13003	0.285	0.42393	D	0.992538	D	0.89917	1.0	D	0.79784	0.993	T	0.17715	-1.0360	10	0.59425	D	0.04	-21.2427	13.5165	0.61543	0.0:0.0:1.0:0.0	.	115	Q9HCU0	CD248_HUMAN	N	115	ENSP00000308117:T115N	ENSP00000308117:T115N	T	-	2	0	CD248	65840731	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.688000	0.74557	2.033000	0.60031	0.491000	0.48974	ACC		0.716	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		13	28	1	0	1.49906e-05	0.00245	1.74333e-05	13	28				
NPAS4	266743	broad.mit.edu	37	11	66189700	66189700	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:66189700C>G	ENST00000311034.2	+	2	461	c.285C>G	c.(283-285)ctC>ctG	p.L95L		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	95	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.L95L(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GGAAATTGCTCTACCTGTCTG	0.597																																							uc001ohx.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(283-285)CTC>CTG		neuronal PAS domain protein 4							90.0	82.0	85.0					11																	66189700		2200	4295	6495	SO:0001819	synonymous_variant	266743				transcription, DNA-dependent		DNA binding|signal transducer activity	g.chr11:66189700C>G	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.285C>G	11.37:g.66189700C>G			Somatic				NPAS4_uc010rpc.1_5'UTR	p.L95L	NM_178864	NP_849195	WXS	Illumina HiSeq	Unspecified	Q8IUM7	NPAS4_HUMAN			2	461	+			95			PAS 1.		B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	37	c.285C>G	CCDS8138.1																																																																																				0.597	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		37	70	0	0	0	0.011902	0	37	70				
NPAS4	266743	broad.mit.edu	37	11	66189949	66189949	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:66189949A>T	ENST00000311034.2	+	3	531	c.355A>T	c.(355-357)Atc>Ttc	p.I119F		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	119	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.I119F(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GGGTGACAGCATCTACGACAT	0.547																																							uc001ohx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(355-357)ATC>TTC		neuronal PAS domain protein 4							173.0	147.0	156.0					11																	66189949		2200	4295	6495	SO:0001583	missense	266743				transcription, DNA-dependent		DNA binding|signal transducer activity	g.chr11:66189949A>T	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.355A>T	11.37:g.66189949A>T	ENSP00000311196:p.Ile119Phe		Somatic				NPAS4_uc010rpc.1_5'UTR	p.I119F	NM_178864	NP_849195	WXS	Illumina HiSeq	Unspecified	Q8IUM7	NPAS4_HUMAN			3	531	+			119			PAS 1.		B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	c.355A>T	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.188833	0.57909	.	.	ENSG00000174576	ENST00000311034	T	0.17854	2.25	4.71	4.71	0.59529	PAS (2);	0.000000	0.56097	D	0.000023	T	0.18087	0.0434	L	0.45470	1.425	0.58432	D	0.999997	P	0.34462	0.454	B	0.35727	0.209	T	0.03121	-1.1070	10	0.87932	D	0	-13.7299	12.1778	0.54196	1.0:0.0:0.0:0.0	.	119	Q8IUM7	NPAS4_HUMAN	F	119	ENSP00000311196:I119F	ENSP00000311196:I119F	I	+	1	0	NPAS4	65946525	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	3.412000	0.52679	1.975000	0.57531	0.460000	0.39030	ATC		0.547	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		28	76	0	0	0	0.009535	0	28	76				
CARNS1	57571	broad.mit.edu	37	11	67186368	67186368	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:67186368C>G	ENST00000307823.3	+	4	589	c.137C>G	c.(136-138)cCg>cGg	p.P46R	CARNS1_ENST00000423745.2_Missense_Mutation_p.P46R|CARNS1_ENST00000531040.1_Missense_Mutation_p.P169R|CARNS1_ENST00000445895.2_Missense_Mutation_p.P169R	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	46					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)	p.P169R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						TTTGTCCCCCCGCGCCGTGCC	0.687																																							uc009yrp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)CCG>CGG		ATP-grasp domain containing 1																																				SO:0001583	missense	57571				carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding	g.chr11:67186368C>G		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.137C>G	11.37:g.67186368C>G	ENSP00000308268:p.Pro46Arg		Somatic				PPP1CA_uc001okx.1_Intron|CARNS1_uc010rpq.1_Missense_Mutation_p.P185R|CARNS1_uc010rpr.1_Missense_Mutation_p.P169R|CARNS1_uc001olc.3_Missense_Mutation_p.P185R	p.P46R	NM_020811	NP_065862	WXS	Illumina HiSeq	Unspecified	A5YM72	CRNS1_HUMAN			4	589	+			46					A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	37	c.137C>G	CCDS44658.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530602	0.64860	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.45668	1.15;0.89;0.89;1.25	3.98	3.98	0.46160	.	.	.	.	.	T	0.50752	0.1634	L	0.27053	0.805	0.39388	D	0.966373	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.981;0.978;0.981	T	0.59043	-0.7528	9	0.87932	D	0	.	14.9825	0.71321	0.0:1.0:0.0:0.0	.	169;46;185	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	R	169;46;169;185;46;169	ENSP00000431670:P169R;ENSP00000308268:P46R;ENSP00000401519:P46R;ENSP00000389009:P169R	ENSP00000308268:P46R	P	+	2	0	CARNS1	66942944	0.995000	0.38212	0.916000	0.36221	0.803000	0.45373	3.553000	0.53713	2.055000	0.61198	0.561000	0.74099	CCG		0.687	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811		3	16	0	0	0	0.004672	0	3	16				
PDE2A	5138	broad.mit.edu	37	11	72292014	72292014	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:72292014G>A	ENST00000334456.5	-	24	2294	c.2049C>T	c.(2047-2049)gaC>gaT	p.D683D	PDE2A_ENST00000540345.1_Silent_p.D674D|PDE2A_ENST00000544570.1_Silent_p.D676D|PDE2A_ENST00000418754.2_Silent_p.D568D|PDE2A_ENST00000376450.3_Silent_p.D427D|PDE2A_ENST00000444035.2_Silent_p.D674D	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	683	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.D683D(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	AGATCTCGATGTCCCTGGTTG	0.522																																							uc010rrc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(2047-2049)GAC>GAT		phosphodiesterase 2A isoform 1	Sildenafil(DB00203)|Sulindac(DB00605)						111.0	94.0	99.0					11																	72292014		2200	4293	6493	SO:0001819	synonymous_variant	5138				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr11:72292014G>A	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.2049C>T	11.37:g.72292014G>A			Somatic				PDE2A_uc001oso.2_Silent_p.D662D|PDE2A_uc010rra.1_Silent_p.D676D|PDE2A_uc001osn.2_Silent_p.D427D|PDE2A_uc010rrb.1_Silent_p.D674D|PDE2A_uc010rrd.1_Silent_p.D568D	p.D683D	NM_002599	NP_002590	WXS	Illumina HiSeq	Unspecified	O00408	PDE2A_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		24	2292	-			683			Catalytic (By similarity).		B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Silent	SNP	ENST00000334456.5	37	c.2049C>T	CCDS8216.1																																																																																				0.522	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599		17	36	0	0	0	0.007413	0	17	36				
MAP6	4135	broad.mit.edu	37	11	75298562	75298562	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:75298562C>G	ENST00000304771.3	-	4	2734	c.1984G>C	c.(1984-1986)Ggt>Cgt	p.G662R	MAP6_ENST00000526740.1_Missense_Mutation_p.G333R|CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526689.1_5'Flank	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	662	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)		p.G662R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					ACCATGGAACCTTGATTCTTT	0.498																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)	Esophageal Squamous(181;1115 2007 8647 17065 22697)	uc001owu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1984-1986)GGT>CGT		microtubule-associated protein 6 isoform 1							167.0	152.0	157.0					11																	75298562		2200	4293	6493	SO:0001583	missense	4135					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding	g.chr11:75298562C>G	AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.1984G>C	11.37:g.75298562C>G	ENSP00000307093:p.Gly662Arg		Somatic					p.G662R	NM_033063	NP_149052	WXS	Illumina HiSeq	Unspecified	Q96JE9	MAP6_HUMAN			4	2049	-	Ovarian(111;0.11)		662			Pro-rich.		A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	ENST00000304771.3	37	c.1984G>C	CCDS31641.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170574	0.57584	.	.	ENSG00000171533	ENST00000304771;ENST00000526740;ENST00000545476	T	0.47869	0.83	5.01	4.02	0.46733	.	0.419287	0.20619	N	0.088818	T	0.41811	0.1175	M	0.62723	1.935	0.19775	N	0.999956	P	0.49961	0.93	P	0.44732	0.459	T	0.31971	-0.9924	10	0.20046	T	0.44	-0.2995	5.6979	0.17865	0.1943:0.7088:0.0:0.0969	.	662	Q96JE9	MAP6_HUMAN	R	662;333;333	ENSP00000307093:G662R	ENSP00000307093:G662R	G	-	1	0	MAP6	74976210	0.000000	0.05858	0.066000	0.19879	0.088000	0.18126	0.187000	0.16998	2.723000	0.93209	0.655000	0.94253	GGT		0.498	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383527.1	NM_033063		18	187	0	0	0	0.00499	0	18	187				
SYTL2	54843	broad.mit.edu	37	11	85445402	85445402	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:85445402G>A	ENST00000528231.1	-	6	1244	c.967C>T	c.(967-969)Cca>Tca	p.P323S	SYTL2_ENST00000316356.4_Missense_Mutation_p.P324S|SYTL2_ENST00000389960.4_Missense_Mutation_p.P323S|SYTL2_ENST00000524452.1_Missense_Mutation_p.P323S|SYTL2_ENST00000527523.1_Missense_Mutation_p.P275S	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	323					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.P324S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AGGGAGTTTGGGGAAGAGTTG	0.448																																							uc010rth.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(967-969)CCA>TCA		synaptotagmin-like 2 isoform g							108.0	111.0	110.0					11																	85445402		2203	4299	6502	SO:0001583	missense	54843				intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding	g.chr11:85445402G>A	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.967C>T	11.37:g.85445402G>A	ENSP00000431701:p.Pro323Ser		Somatic				SYTL2_uc010rtg.1_Missense_Mutation_p.P324S|SYTL2_uc010rti.1_Missense_Mutation_p.P323S|SYTL2_uc010rtj.1_Missense_Mutation_p.P275S|SYTL2_uc001pbf.3_Missense_Mutation_p.P323S|SYTL2_uc010rtf.1_Missense_Mutation_p.P181S	p.P323S	NM_001162951	NP_001156423	WXS	Illumina HiSeq	Unspecified	Q9HCH5	SYTL2_HUMAN		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)	6	1243	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	323					B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	c.967C>T	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.310662	0.00237	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.23348	2.0;2.01;2.01;1.91;2.0	6.06	-2.1	0.07210	.	.	.	.	.	T	0.05318	0.0141	N	0.00436	-1.5	0.09310	N	0.999999	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.0;0.001;0.0	T	0.39683	-0.9602	8	.	.	.	.	5.8728	0.18812	0.4821:0.0:0.3927:0.1252	.	275;323;323;324;181	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	S	323;324;323;275;323	ENSP00000374610:P323S;ENSP00000318803:P324S;ENSP00000431701:P323S;ENSP00000434010:P275S;ENSP00000435238:P323S	.	P	-	1	0	SYTL2	85123050	0.651000	0.27340	0.000000	0.03702	0.008000	0.06430	0.237000	0.17985	-0.745000	0.04772	-0.897000	0.02905	CCA		0.448	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927		50	102	0	0	0	0.01441	0	50	102				
TYR	7299	broad.mit.edu	37	11	88911910	88911910	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:88911910C>A	ENST00000263321.5	+	1	1291	c.789C>A	c.(787-789)ctC>ctA	p.L263L	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	263					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L263L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CTAACTTACTCAGCCCAGCAT	0.458																																							uc001pcs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(787-789)CTC>CTA		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						109.0	92.0	98.0					11																	88911910		2201	4299	6500	SO:0001819	synonymous_variant	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911910C>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.789C>A	11.37:g.88911910C>A			Somatic					p.L263L	NM_000372	NP_000363	WXS	Illumina HiSeq	Unspecified	P14679	TYRO_HUMAN			1	871	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	263			Lumenal, melanosome (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	c.789C>A	CCDS8284.1																																																																																				0.458	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		21	54	1	0	3.83957e-06	0.00278	4.59934e-06	21	54				
TYR	7299	broad.mit.edu	37	11	89028412	89028412	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:89028412G>C	ENST00000263321.5	+	5	1970	c.1468G>C	c.(1468-1470)Gcc>Ccc	p.A490P		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	490					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A490P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CGTCCTCACTGCCCTGCTGGC	0.537																																							uc001pcs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1468-1470)GCC>CCC		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						45.0	47.0	46.0					11																	89028412		2201	4299	6500	SO:0001583	missense	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:89028412G>C	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1468G>C	11.37:g.89028412G>C	ENSP00000263321:p.Ala490Pro		Somatic					p.A490P	NM_000372	NP_000363	WXS	Illumina HiSeq	Unspecified	P14679	TYRO_HUMAN			5	1550	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	490			Helical; (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	c.1468G>C	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307632	0.23821	.	.	ENSG00000077498	ENST00000263321	D	0.99232	-5.6	5.02	1.85	0.25348	.	0.399319	0.27258	N	0.020194	D	0.97739	0.9258	M	0.83774	2.66	0.09310	N	0.999994	P	0.43169	0.8	B	0.35470	0.203	D	0.94779	0.7952	9	.	.	.	.	5.3551	0.16057	0.2387:0.0:0.6158:0.1455	.	490	P14679	TYRO_HUMAN	P	490	ENSP00000263321:A490P	.	A	+	1	0	TYR	88668060	0.865000	0.29922	0.007000	0.13788	0.230000	0.25150	3.285000	0.51716	0.604000	0.29930	0.455000	0.32223	GCC		0.537	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		25	84	0	0	0	0.009535	0	25	84				
FOLH1B	219595	broad.mit.edu	37	11	89421795	89421795	+	RNA	SNP	C	C	A	rs556079298		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:89421795C>A	ENST00000532352.1	+	0	1465							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.Q218K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						GGTGTTCTTCCAACGACTTGG	0.313																																							uc001pda.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(652-654)CAA>AAA		folate hydrolase 1B							49.0	56.0	53.0					11																	89421795		2196	4292	6488			219595				proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:89421795C>A	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89421795C>A			Somatic					p.Q218K	NM_153696	NP_710163	WXS	Illumina HiSeq	Unspecified	Q9HBA9	FOH1B_HUMAN			10	1178	+			218						Missense_Mutation	SNP	ENST00000532352.1	37	c.652C>A																																																																																					0.313	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		62	137	1	0	1.21526e-53	0.01441	2.25122e-53	62	137				
CHORDC1	26973	broad.mit.edu	37	11	89947237	89947237	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:89947237T>C	ENST00000320585.6	-	4	687	c.278A>G	c.(277-279)cAg>cGg	p.Q93R	CHORDC1_ENST00000530765.1_Missense_Mutation_p.Q93R|CHORDC1_ENST00000457199.2_Missense_Mutation_p.Q74R	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	93	Interaction with HSP90AA1 and HSP90AB1. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)	p.Q93R(1)		endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				GATGTGTTCCTGAAATTTGGG	0.378																																							uc001pdg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(277-279)CAG>CGG		cysteine and histidine-rich domain-containing							165.0	158.0	161.0					11																	89947237		2201	4298	6499	SO:0001583	missense	26973				chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding	g.chr11:89947237T>C	AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.278A>G	11.37:g.89947237T>C	ENSP00000319255:p.Gln93Arg		Somatic				CHORDC1_uc009yvz.2_Missense_Mutation_p.Q74R	p.Q93R	NM_012124	NP_036256	WXS	Illumina HiSeq	Unspecified	Q9UHD1	CHRD1_HUMAN			4	688	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)	93			Interaction with HSP90AA1 and HSP90AB1 (By similarity).		B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	ENST00000320585.6	37	c.278A>G	CCDS8289.1	.	.	.	.	.	.	.	.	.	.	T	9.851	1.193592	0.22037	.	.	ENSG00000110172	ENST00000320585;ENST00000457199;ENST00000530765	T;T	0.43294	0.95;0.96	5.53	4.4	0.53042	.	0.109206	0.64402	D	0.000007	T	0.38188	0.1031	L	0.56769	1.78	0.38628	D	0.951292	B;B	0.14438	0.01;0.0	B;B	0.15052	0.012;0.0	T	0.23119	-1.0197	9	.	.	.	-11.8107	11.5627	0.50788	0.0:0.0703:0.0:0.9297	.	74;93	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	R	93;74;93	ENSP00000319255:Q93R;ENSP00000401080:Q74R	.	Q	-	2	0	CHORDC1	89586885	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.591000	0.61019	0.933000	0.37291	-0.423000	0.05987	CAG		0.378	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394111.1	NM_012124		45	143	0	0	0	0.01441	0	45	143				
GPR83	10888	broad.mit.edu	37	11	94126755	94126755	+	Missense_Mutation	SNP	G	G	C	rs375569079		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:94126755G>C	ENST00000243673.2	-	3	714	c.543C>G	c.(541-543)atC>atG	p.I181M	GPR83_ENST00000539203.2_Missense_Mutation_p.I139M	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	181					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.I181M(1)		NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTGATTGAGATCCGGGGTT	0.453																																							uc001pet.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(541-543)ATC>ATG		G protein-coupled receptor 83 precursor		G	MET/ILE	0,4402		0,0,2201	149.0	135.0	140.0		543	2.3	1.0	11		140	2,8594	2.2+/-6.3	0,2,4296	no	missense	GPR83	NM_016540.3	10	0,2,6497	CC,CG,GG		0.0233,0.0,0.0154	benign	181/424	94126755	2,12996	2201	4298	6499	SO:0001583	missense	10888					integral to membrane|plasma membrane	neuropeptide Y receptor activity	g.chr11:94126755G>C	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.543C>G	11.37:g.94126755G>C	ENSP00000243673:p.Ile181Met		Somatic					p.I181M	NM_016540	NP_057624	WXS	Illumina HiSeq	Unspecified	Q9NYM4	GPR83_HUMAN			3	715	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	181			Cytoplasmic (Potential).		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	37	c.543C>G	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	G	0.873	-0.731399	0.03135	0.0	2.33E-4	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.34072	1.38;1.38	5.47	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	0.189887	0.53938	N	0.000043	T	0.10680	0.0261	N	0.02721	-0.515	0.36040	D	0.839995	B	0.17852	0.024	B	0.22753	0.041	T	0.26916	-1.0089	10	0.02654	T	1	.	3.383	0.07261	0.0829:0.2451:0.4293:0.2428	.	181	Q9NYM4	GPR83_HUMAN	M	181;139	ENSP00000243673:I181M;ENSP00000441550:I139M	ENSP00000243673:I181M	I	-	3	3	GPR83	93766403	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.820000	0.39032	1.265000	0.44215	0.561000	0.74099	ATC		0.453	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540		23	73	0	0	0	0.003954	0	23	73				
MMP13	4322	broad.mit.edu	37	11	102822815	102822815	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:102822815G>C	ENST00000260302.3	-	5	753	c.725C>G	c.(724-726)cCt>cGt	p.P242R	MMP13_ENST00000340273.4_Missense_Mutation_p.P242R	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	242	Interaction with TIMP2.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P242R(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GGTGTAGATAGGAAACATGAG	0.453																																							uc001phl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(724-726)CCT>CGT		matrix metalloproteinase 13 preproprotein							237.0	227.0	230.0					11																	102822815		2202	4299	6501	SO:0001583	missense	4322				collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding	g.chr11:102822815G>C	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.725C>G	11.37:g.102822815G>C	ENSP00000260302:p.Pro242Arg		Somatic					p.P242R	NM_002427	NP_002418	WXS	Illumina HiSeq	Unspecified	P45452	MMP13_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0144)	5	753	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	242					A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	c.725C>G	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.947308	0.92593	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.56611	0.45;0.45	5.58	5.58	0.84498	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.096303	0.64402	D	0.000001	D	0.84061	0.5389	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89556	0.3803	10	0.87932	D	0	.	19.9312	0.97120	0.0:0.0:1.0:0.0	.	242	P45452	MMP13_HUMAN	R	242	ENSP00000260302:P242R;ENSP00000339672:P242R	ENSP00000260302:P242R	P	-	2	0	MMP13	102328025	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.809000	0.99208	2.759000	0.94783	0.650000	0.86243	CCT		0.453	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427		63	174	0	0	0	0.01441	0	63	174				
ANKK1	255239	broad.mit.edu	37	11	113266829	113266829	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:113266829C>T	ENST00000303941.3	+	5	817	c.723C>T	c.(721-723)ggC>ggT	p.G241G		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	241	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G241G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		TGGCGGCAGGCATGCGGCCCT	0.597																																							uc001pny.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(5)|stomach(1)|ovary(1)|breast(1)	8						c.(721-723)GGC>GGT		ankyrin repeat and kinase domain containing 1							60.0	64.0	63.0					11																	113266829		2031	4171	6202	SO:0001819	synonymous_variant	255239						ATP binding|protein serine/threonine kinase activity	g.chr11:113266829C>T	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.723C>T	11.37:g.113266829C>T			Somatic					p.G241G	NM_178510	NP_848605	WXS	Illumina HiSeq	Unspecified	Q8NFD2	ANKK1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)	5	817	+		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)	241			Protein kinase.			Silent	SNP	ENST00000303941.3	37	c.723C>T	CCDS44734.1																																																																																				0.597	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510		14	57	0	0	0	0.001855	0	14	57				
AMICA1	120425	broad.mit.edu	37	11	118081381	118081381	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:118081381C>A	ENST00000356289.5	-	4	418	c.245G>T	c.(244-246)gGg>gTg	p.G82V	AMICA1_ENST00000292067.7_Missense_Mutation_p.G72V|AMICA1_ENST00000526620.1_Missense_Mutation_p.G43V|AMICA1_ENST00000533261.1_Missense_Mutation_p.G82V	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	82	Ig-like V-type 1.				blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)	p.G72V(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CTGGAAGCGCCCAATAGGCAC	0.498																																							uc001psk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(244-246)GGG>GTG		adhesion molecule, interacts with CXADR antigen							132.0	122.0	126.0					11																	118081381		2200	4296	6496	SO:0001583	missense	120425				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane		g.chr11:118081381C>A	AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.245G>T	11.37:g.118081381C>A	ENSP00000348635:p.Gly82Val		Somatic				AMICA1_uc001psh.2_Missense_Mutation_p.G43V|AMICA1_uc009yzw.1_RNA|AMICA1_uc001psi.2_Missense_Mutation_p.G72V|AMICA1_uc001psj.2_Missense_Mutation_p.G82V|AMICA1_uc010rxw.1_Missense_Mutation_p.G43V|AMICA1_uc010rxx.1_Missense_Mutation_p.G82V|AMICA1_uc001psl.1_Missense_Mutation_p.G38V	p.G82V	NM_001098526	NP_001091996	WXS	Illumina HiSeq	Unspecified	Q86YT9	JAML1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)	4	419	-	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	82			Ig-like V-type 1.|Extracellular (Potential).		B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Missense_Mutation	SNP	ENST00000356289.5	37	c.245G>T	CCDS41723.1	.	.	.	.	.	.	.	.	.	.	C	4.961	0.178587	0.09443	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000533261;ENST00000526620;ENST00000537867;ENST00000524477;ENST00000525565	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.14	5.14	0.70334	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000064	D	0.82761	0.5107	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.85055	0.0931	10	0.72032	D	0.01	-34.0456	13.9841	0.64324	0.0:1.0:0.0:0.0	.	82;43;82;82;72	B4DVI6;E9PKK2;Q86YT9;E9PR26;Q86YT9-2	.;.;JAML1_HUMAN;.;.	V	82;72;82;43;43;43;82	ENSP00000348635:G82V;ENSP00000292067:G72V;ENSP00000436117:G82V;ENSP00000431218:G43V;ENSP00000432769:G43V;ENSP00000431791:G82V	ENSP00000292067:G72V	G	-	2	0	AMICA1	117586591	0.811000	0.29063	0.999000	0.59377	0.070000	0.16714	2.387000	0.44389	2.669000	0.90835	0.655000	0.94253	GGG		0.498	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206		34	93	1	0	1.06647e-15	0.003755	1.68941e-15	34	93				
OR6T1	219874	broad.mit.edu	37	11	123814283	123814283	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:123814283C>A	ENST00000321252.2	-	1	297	c.263G>T	c.(262-264)gGg>gTg	p.G88V		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G88V(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GGTGTGATCCCCCGTGAGGAT	0.498																																							uc010sab.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(262-264)GGG>GTG		olfactory receptor, family 6, subfamily T,							123.0	99.0	107.0					11																	123814283		2202	4299	6501	SO:0001583	missense	219874				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123814283C>A	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.263G>T	11.37:g.123814283C>A	ENSP00000325203:p.Gly88Val		Somatic					p.G88V	NM_001005187	NP_001005187	WXS	Illumina HiSeq	Unspecified	Q8NGN1	OR6T1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	263	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	88			Extracellular (Potential).		Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	c.263G>T	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	C	8.874	0.950082	0.18431	.	.	ENSG00000181499	ENST00000321252	T	0.03004	4.08	4.26	-0.052	0.13824	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.05914	0.0154	M	0.63208	1.945	0.09310	N	1	P	0.44521	0.837	P	0.45343	0.477	T	0.30297	-0.9983	9	0.87932	D	0	-20.0273	3.8497	0.08949	0.0:0.4213:0.187:0.3917	.	88	Q8NGN1	OR6T1_HUMAN	V	88	ENSP00000325203:G88V	ENSP00000325203:G88V	G	-	2	0	OR6T1	123319493	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.199000	0.09491	0.226000	0.20979	0.655000	0.94253	GGG		0.498	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		30	79	1	0	3.99451e-17	0.009535	6.43296e-17	30	79				
ZBTB44	29068	broad.mit.edu	37	11	130131495	130131495	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:130131495C>T	ENST00000357899.4	-	2	546	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	ZBTB44_ENST00000530205.1_Missense_Mutation_p.A92T|ZBTB44_ENST00000525842.1_Missense_Mutation_p.A92T|ZBTB44_ENST00000397753.1_Missense_Mutation_p.A92T			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	92	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A92T(1)		autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		GATAGAGTGGCTGTGTAAGCA	0.408																																							uc001qga.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(274-276)GCC>ACC		zinc finger and BTB domain containing 44							73.0	76.0	75.0					11																	130131495		1927	4144	6071	SO:0001583	missense	29068				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:130131495C>T	AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.274G>A	11.37:g.130131495C>T	ENSP00000350574:p.Ala92Thr		Somatic				ZBTB44_uc001qgb.3_Missense_Mutation_p.A92T|ZBTB44_uc001qfx.2_RNA|ZBTB44_uc001qgc.1_Missense_Mutation_p.A92T|ZBTB44_uc001qfz.2_Missense_Mutation_p.A92T	p.A92T	NM_014155	NP_054874	WXS	Illumina HiSeq	Unspecified	Q8NCP5	ZBT44_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)	2	668	-	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	92			BTB.		Q6IPT8|Q86VJ7|Q86XX5	Missense_Mutation	SNP	ENST00000357899.4	37	c.274G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.09|14.09	2.430856|2.430856	0.43122|0.43122	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000525842;ENST00000397753;ENST00000445008;ENST00000357899;ENST00000530205;ENST00000338191|ENST00000527478	T;T;T;T;T|.	0.71103|.	-0.54;-0.54;-0.54;-0.54;-0.54|.	6.07|6.07	5.17|5.17	0.71159|0.71159	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);|.	0.047608|.	0.85682|.	D|.	0.000000|.	T|T	0.55433|0.55433	0.1920|0.1920	L|L	0.31476|0.31476	0.935|0.935	0.51767|0.51767	D|D	0.999936|0.999936	P;P;B;B|.	0.36909|.	0.573;0.573;0.021;0.017|.	B;B;B;B|.	0.35182|.	0.197;0.197;0.019;0.011|.	T|T	0.52139|0.52139	-0.8615|-0.8615	10|5	0.72032|.	D|.	0.01|.	.|.	15.381|15.381	0.74654|0.74654	0.0:0.9336:0.0:0.0664|0.0:0.9336:0.0:0.0664	.|.	92;92;92;92|.	Q8NCP5-4;Q8NCP5-3;Q8NCP5;Q8NCP5-2|.	.;.;ZBT44_HUMAN;.|.	T|N	92;92;92;92;92;4|88	ENSP00000433457:A92T;ENSP00000380861:A92T;ENSP00000408079:A92T;ENSP00000350574:A92T;ENSP00000434177:A92T|.	ENSP00000341618:A4T|.	A|S	-|-	1|2	0|0	ZBTB44|ZBTB44	129636705|129636705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.777000|0.777000	0.43975|0.43975	5.946000|5.946000	0.70234|0.70234	1.583000|1.583000	0.49898|0.49898	0.655000|0.655000	0.94253|0.94253	GCC|AGC		0.408	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000386126.1	NM_014155		19	50	0	0	0	0.006122	0	19	50				
ADAMTS15	170689	broad.mit.edu	37	11	130343194	130343194	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:130343194G>T	ENST00000299164.2	+	8	2331	c.2331G>T	c.(2329-2331)gaG>gaT	p.E777D		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	777	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E777D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CCATCCTGGAGCCGCTGACCG	0.677																																							uc010scd.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(2329-2331)GAG>GAT		a disintegrin-like and metalloprotease							52.0	55.0	54.0					11																	130343194		2201	4297	6498	SO:0001583	missense	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130343194G>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2331G>T	11.37:g.130343194G>T	ENSP00000299164:p.Glu777Asp		Somatic					p.E777D	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	8	2331	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	777			Spacer.		Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	c.2331G>T	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928636	0.73327	.	.	ENSG00000166106	ENST00000299164	T	0.56611	0.45	5.91	5.91	0.95273	ADAM-TS Spacer 1 (1);	.	.	.	.	T	0.72732	0.3497	M	0.85710	2.77	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.74979	-0.3479	9	0.52906	T	0.07	.	9.9298	0.41514	0.1863:0.0:0.8137:0.0	.	777	Q8TE58	ATS15_HUMAN	D	777	ENSP00000299164:E777D	ENSP00000299164:E777D	E	+	3	2	ADAMTS15	129848404	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.735000	0.38176	2.813000	0.96785	0.655000	0.94253	GAG		0.677	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		31	75	1	0	7.26314e-15	0.007291	1.12687e-14	31	75				
NCAPD3	23310	broad.mit.edu	37	11	134086941	134086941	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr11:134086941C>A	ENST00000534548.2	-	3	335	c.271G>T	c.(271-273)Gca>Tca	p.A91S		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	91					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.A91S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TAGAACAATGCCACCAGTGTA	0.403																																							uc001qhd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5						c.(271-273)GCA>TCA		non-SMC condensin II complex, subunit D3							110.0	101.0	104.0					11																	134086941		2201	4297	6498	SO:0001583	missense	23310				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding	g.chr11:134086941C>A	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.271G>T	11.37:g.134086941C>A	ENSP00000433681:p.Ala91Ser		Somatic				NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	p.A91S	NM_015261	NP_056076	WXS	Illumina HiSeq	Unspecified	P42695	CNDD3_HUMAN		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)	3	877	-	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	91					A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	c.271G>T	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745011	0.89663	.	.	ENSG00000151503	ENST00000534548	T	0.31247	1.5	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.58163	0.2103	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59637	-0.7417	10	0.72032	D	0.01	-18.5707	19.5979	0.95548	0.0:1.0:0.0:0.0	.	91	P42695	CNDD3_HUMAN	S	91	ENSP00000433681:A91S	ENSP00000431612:A91S	A	-	1	0	NCAPD3	133592151	1.000000	0.71417	0.999000	0.59377	0.833000	0.47200	5.337000	0.65941	2.645000	0.89757	0.585000	0.79938	GCA		0.403	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		13	39	1	0	4.36969e-10	0.001855	5.97309e-10	13	39				
RAD52	5893	broad.mit.edu	37	12	1025913	1025913	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:1025913T>G	ENST00000358495.3	-	8	755	c.617A>C	c.(616-618)aAc>aCc	p.N206T	RAD52_ENST00000536177.1_Missense_Mutation_p.N206T|RAD52_ENST00000535376.1_5'Flank|RAD52_ENST00000539046.1_Missense_Mutation_p.N129T|RAD52_ENST00000430095.2_Missense_Mutation_p.N206T	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	206					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)	p.N206T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			TCGGCAGCTGTTGTATCTTGC	0.527								Homologous recombination																															uc001qis.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(616-618)AAC>ACC	Homologous_recombination	RAD52 homolog							129.0	135.0	133.0					12																	1025913		2085	4206	6291	SO:0001583	missense	5893				DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding	g.chr12:1025913T>G		CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.617A>C	12.37:g.1025913T>G	ENSP00000351284:p.Asn206Thr		Somatic				RAD52_uc001qit.1_RNA|RAD52_uc010sdt.1_Missense_Mutation_p.N129T|RAD52_uc001qiu.1_Missense_Mutation_p.N206T|RAD52_uc001qiv.1_RNA|RAD52_uc001qiw.1_RNA|RAD52_uc010sdu.1_Missense_Mutation_p.N206T	p.N206T	NM_134424	NP_602296	WXS	Illumina HiSeq	Unspecified	P43351	RAD52_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)		8	731	-	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		206					Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Missense_Mutation	SNP	ENST00000358495.3	37	c.617A>C	CCDS8507.2	.	.	.	.	.	.	.	.	.	.	T	8.251	0.808910	0.16467	.	.	ENSG00000002016	ENST00000358495;ENST00000430095;ENST00000539046;ENST00000536177	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	4.97	2.94	0.34122	.	0.660669	0.17234	N	0.181804	T	0.21509	0.0518	L	0.46157	1.445	0.52501	D	0.999954	B;B	0.25169	0.119;0.097	B;B	0.20955	0.03;0.032	T	0.04693	-1.0933	10	0.20046	T	0.44	-15.4226	5.3177	0.15864	0.0:0.4199:0.0:0.5801	.	206;206	F5GX32;P43351	.;RAD52_HUMAN	T	206;206;129;206	ENSP00000351284:N206T;ENSP00000387901:N206T;ENSP00000445245:N129T;ENSP00000440486:N206T	ENSP00000351284:N206T	N	-	2	0	RAD52	896174	0.831000	0.29352	0.981000	0.43875	0.063000	0.16089	0.896000	0.28377	1.258000	0.44101	0.459000	0.35465	AAC		0.527	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	NM_134424		33	75	0	0	0	0.012213	0	33	75				
FGF23	8074	broad.mit.edu	37	12	4479814	4479814	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:4479814G>T	ENST00000237837.1	-	3	596	c.451C>A	c.(451-453)Cca>Aca	p.P151T		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	151					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P151T(1)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TACGGGGGTGGGTTCATGCCT	0.617																																							uc001qmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(451-453)CCA>ACA		fibroblast growth factor 23 precursor							80.0	80.0	80.0					12																	4479814		2203	4300	6503	SO:0001583	missense	8074				cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity	g.chr12:4479814G>T	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.451C>A	12.37:g.4479814G>T	ENSP00000237837:p.Pro151Thr		Somatic					p.P151T	NM_020638	NP_065689	WXS	Illumina HiSeq	Unspecified	Q9GZV9	FGF23_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)		3	597	-			151					Q4V758	Missense_Mutation	SNP	ENST00000237837.1	37	c.451C>A	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717879	0.30413	.	.	ENSG00000118972	ENST00000237837	D	0.85861	-2.04	4.88	4.88	0.63580	.	0.192201	0.48286	D	0.000181	D	0.86481	0.5943	L	0.34521	1.04	0.42852	D	0.994086	D	0.69078	0.997	P	0.60541	0.876	D	0.83505	0.0077	10	0.20046	T	0.44	-20.4172	18.2026	0.89843	0.0:0.0:1.0:0.0	.	151	Q9GZV9	FGF23_HUMAN	T	151	ENSP00000237837:P151T	ENSP00000237837:P151T	P	-	1	0	FGF23	4350075	1.000000	0.71417	0.997000	0.53966	0.098000	0.18820	6.443000	0.73447	2.526000	0.85167	0.549000	0.68633	CCA		0.617	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1			38	92	1	0	3.33393e-15	0.004878	5.24456e-15	38	92				
GALNT8	26290	broad.mit.edu	37	12	4829883	4829883	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:4829883G>T	ENST00000252318.2	+	1	377	c.40G>T	c.(40-42)Ggg>Tgg	p.G14W	RP11-234B24.2_ENST00000527518.1_lincRNA|RP11-234B24.6_ENST00000544741.2_Intron	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	14					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.G14W(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CCTCTTCATTGGGCTGACTCT	0.512																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(40-42)GGG>TGG		polypeptide N-acetylgalactosaminyltransferase 8							109.0	102.0	104.0					12																	4829883		2203	4300	6503	SO:0001583	missense	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4829883G>T	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.40G>T	12.37:g.4829883G>T	ENSP00000252318:p.Gly14Trp		Somatic					p.G14W	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			1	132	+			14			Helical; Signal-anchor for type II membrane protein; (Potential).		B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	c.40G>T	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488435	0.64074	.	.	ENSG00000130035	ENST00000252318	T	0.59083	0.29	4.04	3.12	0.35913	.	7739.210000	0.00166	N	0.000000	T	0.69806	0.3152	L	0.43152	1.355	0.21740	N	0.999566	D	0.71674	0.998	D	0.71656	0.974	T	0.54938	-0.8218	10	0.72032	D	0.01	.	7.7311	0.28788	0.1205:0.0:0.8795:0.0	.	14	Q9NY28	GALT8_HUMAN	W	14	ENSP00000252318:G14W	ENSP00000252318:G14W	G	+	1	0	GALNT8	4700144	0.076000	0.21285	0.811000	0.32455	0.359000	0.29487	1.454000	0.35178	2.071000	0.62044	0.455000	0.32223	GGG		0.512	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		23	83	1	0	3.5997e-14	0.014323	5.50925e-14	23	83				
KCNA6	3742	broad.mit.edu	37	12	4920341	4920341	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:4920341G>T	ENST00000280684.3	+	1	2000	c.1134G>T	c.(1132-1134)ctG>ctT	p.L378L	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Silent_p.L378L			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	378					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.L378L(1)		NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	AGCTGGGGCTGCTCATCTTCT	0.597										HNSCC(72;0.22)																													uc001qng.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1132-1134)CTG>CTT		potassium voltage-gated channel, shaker-related							64.0	56.0	58.0					12																	4920341		2203	4297	6500	SO:0001819	synonymous_variant	3742					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:4920341G>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1134G>T	12.37:g.4920341G>T		HNSCC(72;0.22)	Somatic					p.L378L	NM_002235	NP_002226	WXS	Illumina HiSeq	Unspecified	P17658	KCNA6_HUMAN			1	2000	+			378			Helical; Name=Segment S5; (Potential).			Silent	SNP	ENST00000280684.3	37	c.1134G>T	CCDS8534.1																																																																																				0.597	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		8	71	1	0	0.000274275	0.004482	0.000306357	8	71				
KCNA5	3741	broad.mit.edu	37	12	5154413	5154413	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:5154413C>A	ENST00000252321.3	+	1	1329	c.1100C>A	c.(1099-1101)cCc>cAc	p.P367H		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	367					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCATCTTCCCCTACTTCATC	0.622																																							uc001qni.2		NA																	0				ovary(2)|breast(2)	4						c.(1099-1101)CCC>CAC		potassium voltage-gated channel, shaker-related							99.0	84.0	89.0					12																	5154413		2203	4300	6503	SO:0001583	missense	3741					Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr12:5154413C>A	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1100C>A	12.37:g.5154413C>A	ENSP00000252321:p.Pro367His		Somatic					p.P367H	NM_002234	NP_002225	WXS	Illumina HiSeq	Unspecified	P22460	KCNA5_HUMAN			1	1329	+			367			Helical; Name=Segment S3; (Potential).		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	c.1100C>A	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803057	0.70682	.	.	ENSG00000130037	ENST00000252321	D	0.98400	-4.91	4.87	4.87	0.63330	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99551	0.9839	H	0.99897	4.91	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.97374	0.9978	10	0.87932	D	0	.	17.2051	0.86915	0.0:1.0:0.0:0.0	.	367	P22460	KCNA5_HUMAN	H	367	ENSP00000252321:P367H	ENSP00000252321:P367H	P	+	2	0	KCNA5	5024674	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.597000	0.82733	2.536000	0.85505	0.561000	0.74099	CCC		0.622	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234		25	77	1	0	3.7963e-18	0.00333	6.20216e-18	25	77				
CD163L1	283316	broad.mit.edu	37	12	7531657	7531657	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:7531657T>C	ENST00000313599.3	-	9	2345	c.2288A>G	c.(2287-2289)gAa>gGa	p.E763G	CD163L1_ENST00000416109.2_Missense_Mutation_p.E773G|CD163L1_ENST00000396630.1_Missense_Mutation_p.E763G|CD163L1_ENST00000544331.1_5'UTR			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	763	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.E763*(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GAGAGAGGCTTCCCCTCCAGT	0.448																																							uc001qsy.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|skin(2)|central_nervous_system(1)	11						c.(2287-2289)GAA>GGA		scavenger receptor cysteine-rich type 1							80.0	75.0	77.0					12																	7531657		2203	4300	6503	SO:0001583	missense	283316					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity	g.chr12:7531657T>C	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2288A>G	12.37:g.7531657T>C	ENSP00000315945:p.Glu763Gly		Somatic				CD163L1_uc010sge.1_Missense_Mutation_p.E773G	p.E763G	NM_174941	NP_777601	WXS	Illumina HiSeq	Unspecified	Q9NR16	C163B_HUMAN			9	2314	-			763			SRCR 7.|Extracellular (Potential).		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	c.2288A>G	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024454	0.54683	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.48836	0.8;0.8;0.8	2.03	2.03	0.26663	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.757148	0.10858	U	0.626458	T	0.70885	0.3275	M	0.90814	3.15	0.32337	N	0.560321	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.71902	-0.4452	10	0.72032	D	0.01	.	7.9651	0.30094	0.0:0.0:0.0:1.0	.	773;763	E7EVK4;Q9NR16	.;C163B_HUMAN	G	763;773;763	ENSP00000315945:E763G;ENSP00000393474:E773G;ENSP00000379871:E763G	ENSP00000315945:E763G	E	-	2	0	CD163L1	7422924	1.000000	0.71417	0.127000	0.21898	0.019000	0.09904	4.116000	0.57871	1.173000	0.42796	0.374000	0.22700	GAA		0.448	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		34	79	0	0	0	0.013726	0	34	79				
FAM90A1	55138	broad.mit.edu	37	12	8377324	8377324	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:8377324G>T	ENST00000538603.1	-	4	663	c.105C>A	c.(103-105)ccC>ccA	p.P35P	FAM90A1_ENST00000307435.6_Silent_p.P35P	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	35							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P35P(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		CTTCTTCATCGGGCGGGGGAG	0.652																																							uc001qui.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(103-105)CCC>CCA		hypothetical protein LOC55138							7.0	10.0	9.0					12																	8377324		2140	4243	6383	SO:0001819	synonymous_variant	55138						nucleic acid binding|zinc ion binding	g.chr12:8377324G>T	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.105C>A	12.37:g.8377324G>T			Somatic				FAM90A1_uc001quh.2_Silent_p.P35P	p.P35P	NM_018088	NP_060558	WXS	Illumina HiSeq	Unspecified	Q86YD7	F90A1_HUMAN		Kidney(36;0.0866)	4	664	-			35					D3DUU9|Q9NVZ6	Silent	SNP	ENST00000538603.1	37	c.105C>A	CCDS31738.1																																																																																				0.652	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088		8	10	1	0	5.18039e-06	0.00308	6.17277e-06	8	10				
CLEC9A	283420	broad.mit.edu	37	12	10218183	10218183	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:10218183G>T	ENST00000355819.1	+	9	1291	c.678G>T	c.(676-678)acG>acT	p.T226T		NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	226	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.T226T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						ACTGCAGCACGTGGAAGTATT	0.423																																							uc001qxa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(676-678)ACG>ACT		C-type lectin domain family 9, member A							212.0	179.0	190.0					12																	10218183		2203	4300	6503	SO:0001819	synonymous_variant	283420				positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding	g.chr12:10218183G>T		CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.678G>T	12.37:g.10218183G>T			Somatic					p.T226T	NM_207345	NP_997228	WXS	Illumina HiSeq	Unspecified	Q6UXN8	CLC9A_HUMAN			9	1291	+			226			Extracellular (Potential).|C-type lectin.		B0ZBM2	Silent	SNP	ENST00000355819.1	37	c.678G>T	CCDS8611.1																																																																																				0.423	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000399564.1	NM_207345		52	93	1	0	1.46357e-32	0.01441	2.64614e-32	52	93				
OLR1	4973	broad.mit.edu	37	12	10312555	10312555	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:10312555C>G	ENST00000309539.3	-	6	806	c.746G>C	c.(745-747)gGa>gCa	p.G249A	OLR1_ENST00000543993.1_3'UTR|OLR1_ENST00000544577.1_Intron|OLR1_ENST00000432556.2_3'UTR|OLR1_ENST00000545927.1_3'UTR	NM_002543.3	NP_002534.1	P78380	OLR1_HUMAN	oxidized low density lipoprotein (lectin-like) receptor 1	249	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell death (GO:0008219)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|lipoprotein metabolic process (GO:0042157)|proteolysis (GO:0006508)|response to hydrogen peroxide (GO:0042542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|low-density lipoprotein receptor activity (GO:0005041)	p.G249A(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	10						ATAAACAGCTCCTCGTTGTAT	0.428																																							uc001qxo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(745-747)GGA>GCA		oxidized low density lipoprotein (lectin-like)							133.0	135.0	135.0					12																	10312555		2203	4300	6503	SO:0001583	missense	4973				blood circulation|blood coagulation|inflammatory response|leukocyte migration|proteolysis	extracellular region|integral to plasma membrane|membrane fraction	sugar binding	g.chr12:10312555C>G	D89050	CCDS8618.1, CCDS53745.1, CCDS53746.1	12p13.1-p12.3	2011-08-30	2006-12-07		ENSG00000173391	ENSG00000173391		"""C-type lectin domain containing"""	8133	protein-coding gene	gene with protein product		602601	"""oxidised low density lipoprotein (lectin-like) receptor 1"""			9763655	Standard	NM_002543		Approved	LOX-1, SCARE1, CLEC8A	uc001qxo.1	P78380	OTTHUMG00000168527	ENST00000309539.3:c.746G>C	12.37:g.10312555C>G	ENSP00000309124:p.Gly249Ala		Somatic				OLR1_uc010sgz.1_3'UTR|OLR1_uc010sha.1_3'UTR	p.G249A	NM_002543	NP_002534	WXS	Illumina HiSeq	Unspecified	P78380	OLR1_HUMAN			6	860	-			249			Extracellular (Potential).|C-type lectin.		A8K7V9|B4DI48|G3V1I4|Q2PP00|Q7Z484	Missense_Mutation	SNP	ENST00000309539.3	37	c.746G>C	CCDS8618.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.206224	0.39003	.	.	ENSG00000173391	ENST00000309539;ENST00000539518	T;T	0.21191	2.02;2.02	5.29	5.29	0.74685	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.096333	0.45606	D	0.000346	T	0.41880	0.1178	M	0.79258	2.445	0.80722	D	1	D	0.56521	0.976	P	0.56751	0.805	T	0.13388	-1.0511	10	0.41790	T	0.15	.	15.1685	0.72850	0.0:1.0:0.0:0.0	.	249	P78380	OLR1_HUMAN	A	249;196	ENSP00000309124:G249A;ENSP00000442389:G196A	ENSP00000309124:G249A	G	-	2	0	OLR1	10203822	0.062000	0.20869	0.084000	0.20598	0.111000	0.19643	3.290000	0.51755	2.857000	0.98124	0.650000	0.86243	GGA		0.428	OLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400091.1	NM_002543		37	128	0	0	0	0.004289	0	37	128				
KLRK1	22914	broad.mit.edu	37	12	10531201	10531201	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:10531201A>T	ENST00000240618.6	-	6	521	c.381T>A	c.(379-381)tgT>tgA	p.C127*	KLRC4-KLRK1_ENST00000539300.1_3'UTR|RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Nonsense_Mutation_p.C127*	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	127	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.C127*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TTTGAGACATACAAGAAGCCT	0.368																																							uc009zhj.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(379-381)TGT>TGA		NKG2-D type II integral membrane protein							92.0	96.0	95.0					12																	10531201		2203	4300	6503	SO:0001587	stop_gained	22914				natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding	g.chr12:10531201A>T	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.381T>A	12.37:g.10531201A>T	ENSP00000240618:p.Cys127*		Somatic				uc001qya.1_Intron|KLRK1_uc001qyb.2_RNA|KLRK1_uc001qyc.2_Nonsense_Mutation_p.C127*|KLRK1_uc009zhk.2_Nonsense_Mutation_p.C127*|KLRK1_uc001qyd.2_Nonsense_Mutation_p.C127*	p.C127*	NM_007360	NP_031386	WXS	Illumina HiSeq	Unspecified	P26718	NKG2D_HUMAN			6	545	-			127			Extracellular (Potential).|C-type lectin.		A8K7K5|A8K7P4|Q9NR41	Nonsense_Mutation	SNP	ENST00000240618.6	37	c.381T>A	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.178013	0.57692	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	.	.	.	5.96	3.63	0.41609	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2853	0.15698	0.749:0.0:0.251:0.0	.	.	.	.	X	127	.	ENSP00000240618:C127X	C	-	3	2	KLRK1	10422468	0.539000	0.26402	0.312000	0.25196	0.027000	0.11550	0.714000	0.25808	1.084000	0.41184	0.533000	0.62120	TGT		0.368	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360		26	63	0	0	0	0.005443	0	26	63				
GRIN2B	2904	broad.mit.edu	37	12	13716296	13716296	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:13716296C>A	ENST00000609686.1	-	13	4085	c.3876G>T	c.(3874-3876)aaG>aaT	p.K1292N		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1292	Interaction with DAPK1. {ECO:0000250}.				behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.K1292N(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCCGGTTCTTCTTCTGGGCCT	0.622																																							uc001rbt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(3874-3876)AAG>AAT		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						96.0	105.0	102.0					12																	13716296		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13716296C>A		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3876G>T	12.37:g.13716296C>A	ENSP00000477455:p.Lys1292Asn		Somatic					p.K1292N	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			13	4055	-			1292			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.3876G>T	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257474	0.39896	.	.	ENSG00000150086	ENST00000279593	T	0.12361	2.69	4.7	4.7	0.59300	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.125474	0.56097	D	0.000038	T	0.08313	0.0207	N	0.08118	0	0.50467	D	0.999872	B	0.29671	0.254	B	0.32342	0.144	T	0.22800	-1.0206	10	0.59425	D	0.04	.	11.6617	0.51349	0.0:0.9186:0.0:0.0814	.	1292	Q13224	NMDE2_HUMAN	N	1292	ENSP00000279593:K1292N	ENSP00000279593:K1292N	K	-	3	2	GRIN2B	13607563	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.678000	0.46900	2.579000	0.87056	0.563000	0.77884	AAG		0.622	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			41	83	1	0	1.15183e-24	0.009718	2.00756e-24	41	83				
CAPZA3	93661	broad.mit.edu	37	12	18891415	18891415	+	Silent	SNP	C	C	A	rs376550649		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:18891415C>A	ENST00000317658.3	+	1	371	c.213C>A	c.(211-213)ctC>ctA	p.L71L	PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|PLCZ1_ENST00000266505.7_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000435379.1_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	71					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)		p.L71L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				ATCCAGTACTCTTGTCTCACC	0.428																																							uc001rdy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(211-213)CTC>CTA		capping protein alpha 3		C		0,4406		0,0,2203	117.0	105.0	109.0		213	2.3	1.0	12		109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CAPZA3	NM_033328.2		0,1,6502	AA,AC,CC		0.0116,0.0,0.0077		71/300	18891415	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	93661				actin cytoskeleton organization|actin filament capping	F-actin capping protein complex	actin binding	g.chr12:18891415C>A	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.213C>A	12.37:g.18891415C>A			Somatic				PLCZ1_uc001rdv.3_5'Flank|PLCZ1_uc001rdw.3_5'Flank|PLCZ1_uc010sid.1_5'Flank	p.L71L	NM_033328	NP_201585	WXS	Illumina HiSeq	Unspecified	Q96KX2	CAZA3_HUMAN			1	371	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)	71					Q969J0	Silent	SNP	ENST00000317658.3	37	c.213C>A	CCDS8681.1																																																																																				0.428	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328		49	92	1	0	4.18559e-23	0.01441	7.18438e-23	49	92				
SLCO1C1	53919	broad.mit.edu	37	12	20890206	20890206	+	Splice_Site	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:20890206T>C	ENST00000266509.2	+	11	1916	c.1548T>C	c.(1546-1548)atT>atC	p.I516I	SLCO1C1_ENST00000381552.1_Splice_Site_p.I516I|SLCO1C1_ENST00000540354.1_Splice_Site_p.I467I|SLCO1C1_ENST00000545102.1_Splice_Site_p.I398I|SLCO1C1_ENST00000545604.1_Splice_Site_p.I516I	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	516	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.I516I(2)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	GAAAAAATATTGTAAGAAATC	0.423																																							uc001rej.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|pancreas(1)|skin(1)	7						c.(1546-1548)ATT>ATC		solute carrier organic anion transporter family,							82.0	78.0	80.0					12																	20890206		2203	4300	6503	SO:0001630	splice_region_variant	53919				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr12:20890206T>C	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1548+1T>C	12.37:g.20890206T>C			Somatic				SLCO1C1_uc010sii.1_Silent_p.I516I|SLCO1C1_uc010sij.1_Silent_p.I467I|SLCO1C1_uc009zip.2_Silent_p.I350I|SLCO1C1_uc001rei.2_Silent_p.I516I|SLCO1C1_uc010sik.1_Silent_p.I398I	p.I516I	NM_017435	NP_059131	WXS	Illumina HiSeq	Unspecified	Q9NYB5	SO1C1_HUMAN			12	1903	+	Esophageal squamous(101;0.149)		516			Extracellular (Potential).|Kazal-like.		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Silent	SNP	ENST00000266509.2	37	c.1548T>C	CCDS8683.1																																																																																				0.423	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	Silent	20	52	0	0	0	0.007413	0	20	52				
GYS2	2998	broad.mit.edu	37	12	21721852	21721852	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:21721852G>T	ENST00000261195.2	-	5	1024	c.770C>A	c.(769-771)aCg>aAg	p.T257K		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	257					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)	p.T257K(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTCAGAAACCGTGGTGAACAC	0.438																																					Colon(149;9 1820 3690 10544 50424)	Colon(149;9 1820 3690 10544 50424)	uc001rfb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(769-771)ACG>AAG		glycogen synthase 2							181.0	170.0	174.0					12																	21721852		2203	4300	6503	SO:0001583	missense	2998				glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity	g.chr12:21721852G>T		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.770C>A	12.37:g.21721852G>T	ENSP00000261195:p.Thr257Lys		Somatic					p.T257K	NM_021957	NP_068776	WXS	Illumina HiSeq	Unspecified	P54840	GYS2_HUMAN			5	1025	-			257					A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	c.770C>A	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038119	0.93630	.	.	ENSG00000111713	ENST00000261195	T	0.78595	-1.19	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.91422	0.7293	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93310	0.6684	10	0.87932	D	0	-21.1748	18.8391	0.92174	0.0:0.0:1.0:0.0	.	257	P54840	GYS2_HUMAN	K	257	ENSP00000261195:T257K	ENSP00000261195:T257K	T	-	2	0	GYS2	21613119	1.000000	0.71417	0.967000	0.41034	0.978000	0.69477	9.625000	0.98406	2.683000	0.91414	0.655000	0.94253	ACG		0.438	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957		26	85	1	0	1.64293e-13	0.00333	2.47535e-13	26	85				
OVOS2	144203	broad.mit.edu	37	12	31284361	31284361	+	IGR	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:31284361A>G								RP11-551L14.1 (13956 upstream) : FAM60A (149156 downstream)														p.Y972Y(1)									AGTCCAGAACATAAGTATCAG	0.413																																							uc010sjy.1		NA																	1	Substitution - coding silent(1)		lung(1)		NA						c.(2914-2916)TAT>TAC		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							73.0	74.0	73.0					12																	31284361		1836	4091	5927	SO:0001628	intergenic_variant	0							g.chr12:31284361A>G																													12.37:g.31284361A>G			Somatic					p.Y972Y			WXS	Illumina HiSeq	Unspecified					22	2916	-									Silent	SNP		37	c.2916T>C																																																																																				0	0.413									4	40	0	0	0	0.009096	0	4	40				
ZNF641	121274	broad.mit.edu	37	12	48737288	48737288	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:48737288C>A	ENST00000544117.2	-	6	1493	c.785G>T	c.(784-786)aGa>aTa	p.R262I	ZNF641_ENST00000547026.1_Missense_Mutation_p.R248I|ZNF641_ENST00000448928.3_Missense_Mutation_p.R239I|ZNF641_ENST00000301042.3_Missense_Mutation_p.R262I			Q96N77	ZN641_HUMAN	zinc finger protein 641	262	Transactivation.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R262I(1)		breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						TGTGTGGGGTCTTAACAGGGA	0.542																																							uc001rrn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(784-786)AGA>ATA		zinc finger protein 641							77.0	77.0	77.0					12																	48737288		2203	4300	6503	SO:0001583	missense	121274				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr12:48737288C>A	BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.785G>T	12.37:g.48737288C>A	ENSP00000437832:p.Arg262Ile		Somatic				ZNF641_uc001rro.1_Missense_Mutation_p.R248I|ZNF641_uc010sls.1_Missense_Mutation_p.R239I	p.R262I	NM_152320	NP_689533	WXS	Illumina HiSeq	Unspecified	Q96N77	ZN641_HUMAN			6	950	-			262			Transactivation.		B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Missense_Mutation	SNP	ENST00000544117.2	37	c.785G>T	CCDS8763.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684260	0.47991	.	.	ENSG00000167528	ENST00000301042;ENST00000544117;ENST00000448928;ENST00000547026	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.61	4.71	0.59529	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.171029	0.41712	D	0.000834	T	0.30008	0.0751	L	0.36672	1.1	0.46609	D	0.999127	P;P	0.49961	0.93;0.736	B;B	0.41571	0.36;0.205	T	0.11446	-1.0587	10	0.87932	D	0	.	11.755	0.51870	0.0:0.9127:0.0:0.0873	.	239;262	B4DNU5;Q96N77	.;ZN641_HUMAN	I	262;262;239;248	ENSP00000301042:R262I;ENSP00000437832:R262I;ENSP00000394627:R239I;ENSP00000449974:R248I	ENSP00000301042:R262I	R	-	2	0	ZNF641	47023555	0.050000	0.20438	1.000000	0.80357	0.994000	0.84299	0.536000	0.23129	1.487000	0.48415	0.655000	0.94253	AGA		0.542	ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1	NM_152320		31	44	1	0	1.56442e-22	0.012213	2.65169e-22	31	44				
TROAP	10024	broad.mit.edu	37	12	49724266	49724266	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:49724266G>T	ENST00000257909.3	+	13	1714	c.1638G>T	c.(1636-1638)gaG>gaT	p.E546D	TROAP_ENST00000551245.1_Missense_Mutation_p.E546D|TROAP_ENST00000547923.1_Missense_Mutation_p.E254D	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	546	4 X 33 AA approximate tandem repeats.|Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.E546D(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						AAGTACCAGAGCCCTACCCTC	0.622																																							uc001rtx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1636-1638)GAG>GAT		tastin isoform 1							54.0	56.0	56.0					12																	49724266		2203	4300	6503	SO:0001583	missense	10024				cell adhesion	cytoplasm		g.chr12:49724266G>T	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1638G>T	12.37:g.49724266G>T	ENSP00000257909:p.Glu546Asp		Somatic				TROAP_uc009zlh.2_Missense_Mutation_p.E546D|TROAP_uc001rty.2_Missense_Mutation_p.E254D	p.E546D	NM_005480	NP_005471	WXS	Illumina HiSeq	Unspecified	Q12815	TROAP_HUMAN			13	1805	+			546			Cys-rich.|4 X 33 AA approximate tandem repeats.|1.		F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	c.1638G>T	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926398	0.34002	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	3.45	2.45	0.29901	.	.	.	.	.	T	0.27134	0.0665	N	0.22421	0.69	0.09310	N	1	B;B;B	0.22604	0.072;0.072;0.072	B;B;B	0.29785	0.107;0.107;0.08	T	0.22312	-1.0220	8	0.14252	T	0.57	.	7.7883	0.29106	0.0:0.0:0.6256:0.3744	.	546;254;546	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	D	546;546;254	.	ENSP00000257909:E546D	E	+	3	2	TROAP	48010533	0.000000	0.05858	0.069000	0.20011	0.083000	0.17756	0.100000	0.15231	1.928000	0.55862	0.306000	0.20318	GAG		0.622	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480		25	60	1	0	2.41591e-17	0.004656	3.91627e-17	25	60				
KRT85	3891	broad.mit.edu	37	12	52758891	52758891	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:52758891G>T	ENST00000257901.3	-	2	559	c.484C>A	c.(484-486)Cgc>Agc	p.R162S	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	162	Linker 1.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R162S(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCGCAGCAGCGCTGGTTCTGG	0.622																																							uc001sag.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(484-486)CGC>AGC		keratin 85							51.0	52.0	52.0					12																	52758891		2203	4300	6503	SO:0001583	missense	3891				epidermis development	keratin filament	protein binding|structural molecule activity	g.chr12:52758891G>T	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.484C>A	12.37:g.52758891G>T	ENSP00000257901:p.Arg162Ser		Somatic					p.R162S	NM_002283	NP_002274	WXS	Illumina HiSeq	Unspecified	P78386	KRT85_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	2	604	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		162			Rod.|Linker 1.		Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	c.484C>A	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527897	0.27299	.	.	ENSG00000135443	ENST00000257901	T	0.75589	-0.95	4.51	-1.86	0.07760	Filament (1);	2.754660	0.00855	N	0.001868	T	0.66218	0.2767	N	0.16037	0.36	0.09310	N	1	B	0.23058	0.079	B	0.37650	0.255	T	0.61158	-0.7119	10	0.72032	D	0.01	.	8.8268	0.35061	0.0:0.1999:0.195:0.6051	.	162	P78386	KRT85_HUMAN	S	162	ENSP00000257901:R162S	ENSP00000257901:R162S	R	-	1	0	KRT85	51045158	0.001000	0.12720	0.000000	0.03702	0.413000	0.31143	-0.345000	0.07770	-0.134000	0.11516	0.491000	0.48974	CGC		0.622	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283		35	76	1	0	3.86903e-22	0.013726	6.50918e-22	35	76				
HOXC12	3228	broad.mit.edu	37	12	54348814	54348814	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:54348814C>T	ENST00000243103.3	+	1	197	c.101C>T	c.(100-102)gCg>gTg	p.A34V	AC012531.23_ENST00000603432.1_lincRNA	NM_173860.1	NP_776272.1	P31275	HXC12_HUMAN	homeobox C12	34					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A34V(1)		large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	12						GCGTCCGGGGCGCAGCTTCCC	0.657																																							uc010soq.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(100-102)GCG>GTG		homeobox C12							30.0	35.0	33.0					12																	54348814		2203	4300	6503	SO:0001583	missense	3228				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54348814C>T	AF328962	CCDS8866.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123407	ENSG00000123407		"""Homeoboxes / ANTP class : HOXL subclass"""	5124	protein-coding gene	gene with protein product		142975	"""homeo box C12"""	HOX3, HOX3F, HOC3F		1973146, 1358459	Standard	NM_173860		Approved		uc010soq.2	P31275	OTTHUMG00000160010	ENST00000243103.3:c.101C>T	12.37:g.54348814C>T	ENSP00000243103:p.Ala34Val		Somatic					p.A34V	NM_173860	NP_776272	WXS	Illumina HiSeq	Unspecified	P31275	HXC12_HUMAN			1	101	+			34					Q9BXJ6	Missense_Mutation	SNP	ENST00000243103.3	37	c.101C>T	CCDS8866.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876188	0.51801	.	.	ENSG00000123407	ENST00000243103	D	0.93307	-3.2	2.85	1.9	0.25705	.	0.075503	0.52532	D	0.000072	D	0.82490	0.5048	N	0.19112	0.55	0.34031	D	0.653865	P	0.42973	0.796	B	0.29440	0.102	T	0.83172	-0.0093	10	0.30854	T	0.27	.	10.2337	0.43270	0.0:0.428:0.572:0.0	.	34	P31275	HXC12_HUMAN	V	34	ENSP00000243103:A34V	ENSP00000243103:A34V	A	+	2	0	HOXC12	52635081	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.182000	0.65059	0.712000	0.32039	0.455000	0.32223	GCG		0.657	HOXC12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358868.2	NM_173860		11	24	0	0	0	0.010729	0	11	24				
HOXC10	3226	broad.mit.edu	37	12	54379592	54379592	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:54379592C>A	ENST00000303460.4	+	1	623	c.549C>A	c.(547-549)cgC>cgA	p.R183R	HOXC-AS3_ENST00000567780.1_RNA|RP11-834C11.12_ENST00000513209.1_5'Flank|HOXC-AS3_ENST00000514702.1_RNA|HOXC-AS3_ENST00000509870.1_RNA|HOXC-AS3_ENST00000513165.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	183					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R183R(1)		endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						TCAACCCGCGCGCCGAACATC	0.642																																							uc001sen.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(547-549)CGC>CGA		homeobox C10							30.0	35.0	33.0					12																	54379592		2203	4299	6502	SO:0001819	synonymous_variant	3226				positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54379592C>A		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.549C>A	12.37:g.54379592C>A			Somatic					p.R183R	NM_017409	NP_059105	WXS	Illumina HiSeq	Unspecified	Q9NYD6	HXC10_HUMAN			1	647	+			183					O15219|O15220|Q9BVD5	Silent	SNP	ENST00000303460.4	37	c.549C>A	CCDS8868.1																																																																																				0.642	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2			11	31	1	0	4.3838e-07	0.001855	5.50411e-07	11	31				
OR6C1	390321	broad.mit.edu	37	12	55715043	55715043	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:55715043C>A	ENST00000379668.2	+	1	698	c.660C>A	c.(658-660)atC>atA	p.I220I		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I220I(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						TATACATTATCAGAACAATTT	0.388																																							uc010spi.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(658-660)ATC>ATA		olfactory receptor, family 6, subfamily C,							83.0	75.0	78.0					12																	55715043		2203	4300	6503	SO:0001819	synonymous_variant	390321				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55715043C>A	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.660C>A	12.37:g.55715043C>A			Somatic					p.I220I	NM_001005182	NP_001005182	WXS	Illumina HiSeq	Unspecified	Q96RD1	OR6C1_HUMAN			1	660	+			220			Cytoplasmic (Potential).		B2RNM0	Silent	SNP	ENST00000379668.2	37	c.660C>A	CCDS31818.1																																																																																				0.388	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182		27	36	1	0	2.79863e-10	0.004656	3.85665e-10	27	36				
ESYT1	23344	broad.mit.edu	37	12	56531347	56531347	+	Missense_Mutation	SNP	G	G	A	rs577368857		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:56531347G>A	ENST00000394048.5	+	18	2267	c.2003G>A	c.(2002-2004)gGa>gAa	p.G668E	ESYT1_ENST00000541590.1_Missense_Mutation_p.G678E|ESYT1_ENST00000267113.4_Missense_Mutation_p.G678E	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	668	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.G668E(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TTCTTGGGGGGACTGGTGAAG	0.547																																							uc001sjq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(2002-2004)GGA>GAA		extended synaptotagmin-like protein 1							151.0	155.0	153.0					12																	56531347		2203	4300	6503	SO:0001583	missense	23344					integral to membrane		g.chr12:56531347G>A	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2003G>A	12.37:g.56531347G>A	ENSP00000377612:p.Gly668Glu		Somatic				ESYT1_uc001sjr.2_Missense_Mutation_p.G678E	p.G668E	NM_015292	NP_056107	WXS	Illumina HiSeq	Unspecified	Q9BSJ8	ESYT1_HUMAN			18	2053	+			668			C2 3.		A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	c.2003G>A	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	32	5.118401	0.94385	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.09723	2.95;2.95;2.95	5.22	5.22	0.72569	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.054134	0.64402	D	0.000001	T	0.37732	0.1014	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.12630	-1.0540	10	0.28530	T	0.3	-11.6564	17.9354	0.89011	0.0:0.0:1.0:0.0	.	678;668	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	E	668;622;678;678	ENSP00000377612:G668E;ENSP00000267113:G678E;ENSP00000445952:G678E	ENSP00000267113:G678E	G	+	2	0	ESYT1	54817614	1.000000	0.71417	0.958000	0.39756	0.994000	0.84299	9.272000	0.95707	2.608000	0.88229	0.655000	0.94253	GGA		0.547	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292		24	194	0	0	0	0.00333	0	24	194				
TBK1	29110	broad.mit.edu	37	12	64875778	64875778	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:64875778G>C	ENST00000331710.5	+	8	1308	c.969G>C	c.(967-969)aaG>aaC	p.K323N		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	323	Ubiquitin-like.				defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K323N(2)		breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		CAGCTCATAAGATTTATATTC	0.294																																							uc001ssc.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5						c.(967-969)AAG>AAC		TANK-binding kinase 1							70.0	66.0	67.0					12																	64875778		2203	4300	6503	SO:0001583	missense	29110				I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr12:64875778G>C	AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.969G>C	12.37:g.64875778G>C	ENSP00000329967:p.Lys323Asn		Somatic					p.K323N	NM_013254	NP_037386	WXS	Illumina HiSeq	Unspecified	Q9UHD2	TBK1_HUMAN		GBM - Glioblastoma multiforme(28;0.0386)	8	1031	+			323			Ubiquitin-like.		A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	37	c.969G>C	CCDS8968.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710390	0.30322	.	.	ENSG00000183735	ENST00000331710	T	0.69040	-0.37	5.17	2.07	0.26955	.	0.102114	0.64402	D	0.000003	T	0.59649	0.2209	M	0.62723	1.935	0.47949	D	0.999559	B	0.33000	0.393	B	0.31946	0.138	T	0.55623	-0.8112	9	.	.	.	-9.3898	11.2093	0.48788	0.3371:0.0:0.6629:0.0	.	323	Q9UHD2	TBK1_HUMAN	N	323	ENSP00000329967:K323N	.	K	+	3	2	TBK1	63162045	0.998000	0.40836	1.000000	0.80357	0.862000	0.49288	0.565000	0.23578	0.586000	0.29626	0.467000	0.42956	AAG		0.294	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254		3	42	0	0	0	0.004672	0	3	42				
ZFC3H1	196441	broad.mit.edu	37	12	72026208	72026208	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:72026208C>A	ENST00000378743.3	-	15	3262	c.2904G>T	c.(2902-2904)cgG>cgT	p.R968R		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	968					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R968R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCTTTTGTAACCGTCTTTTCT	0.378																																							uc001swo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(2902-2904)CGG>CGT		proline/serine-rich coiled-coil 2							86.0	83.0	84.0					12																	72026208		1815	4068	5883	SO:0001819	synonymous_variant	196441				RNA processing	intracellular	metal ion binding	g.chr12:72026208C>A	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.2904G>T	12.37:g.72026208C>A			Somatic					p.R968R	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			15	3263	-			968			Potential.		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	c.2904G>T	CCDS41813.1																																																																																				0.378	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		55	43	1	0	3.50607e-19	0.01441	5.78373e-19	55	43				
NAV3	89795	broad.mit.edu	37	12	78591054	78591054	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:78591054G>T	ENST00000397909.2	+	35	6492	c.6319G>T	c.(6319-6321)Gct>Tct	p.A2107S	NAV3_ENST00000541270.1_5'Flank|NAV3_ENST00000228327.6_Missense_Mutation_p.A2085S|NAV3_ENST00000266692.7_Missense_Mutation_p.A1908S|NAV3_ENST00000536525.2_Missense_Mutation_p.A2085S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2107						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.A2085S(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGCTAACCTGGCTGAACAGTG	0.348										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(6319-6321)GCT>TCT		neuron navigator 3							115.0	105.0	108.0					12																	78591054		1843	4089	5932	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78591054G>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6319G>T	12.37:g.78591054G>T	ENSP00000381007:p.Ala2107Ser	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.A2085S|NAV3_uc010sub.1_Missense_Mutation_p.A1564S|NAV3_uc009zsf.2_Missense_Mutation_p.A916S	p.A2107S	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			35	6492	+			2107					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.6319G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.099948|5.099948	0.94197|0.94197	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.88741|.	-2.42;-2.42;-2.42;-2.42;-2.42|.	5.59|5.59	5.59|5.59	0.84812|0.84812	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.39834|.	U|.	0.001245|.	T|T	0.82033|0.82033	0.4949|0.4949	M|M	0.81239|0.81239	2.535|2.535	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.996;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.99;0.999;0.996|.	T|T	0.81799|0.81799	-0.0767|-0.0767	10|5	0.48119|.	T|.	0.1|.	-17.1605|-17.1605	19.961|19.961	0.97250|0.97250	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2085;1908;2107;2085|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	S|V	2085;2107;2085;1908;699;707|979	ENSP00000446132:A2085S;ENSP00000381007:A2107S;ENSP00000228327:A2085S;ENSP00000266692:A1908S;ENSP00000448303:A707S|.	ENSP00000228327:A2085S|.	A|G	+|+	1|2	0|0	NAV3|NAV3	77115185|77115185	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	9.813000|9.813000	0.99286|0.99286	2.783000|2.783000	0.95769|0.95769	0.655000|0.655000	0.94253|0.94253	GCT|GGC		0.348	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		21	24	1	0	4.4004e-07	0.00333	5.51474e-07	21	24				
OTOGL	283310	broad.mit.edu	37	12	80762012	80762012	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:80762012G>A	ENST00000547103.1	+	54	6481	c.6475G>A	c.(6475-6477)Gat>Aat	p.D2159N	OTOGL_ENST00000458043.2_Missense_Mutation_p.D2171N|OTOGL_ENST00000546620.1_Missense_Mutation_p.D190N			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2159					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)	p.D2171N(1)|p.D536N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ATCCCCAAGTGATTATGGTTG	0.358																																							uc009zsg.1		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(151-153)GAT>AAT		RecName: Full=Uncharacterized protein C12orf64;							130.0	117.0	122.0					12																	80762012		2203	4300	6503	SO:0001583	missense	0							g.chr12:80762012G>A	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6475G>A	12.37:g.80762012G>A	ENSP00000447211:p.Asp2159Asn		Somatic				uc001szd.2_Missense_Mutation_p.D190N	p.D51N			WXS	Illumina HiSeq	Unspecified					9	752	+								F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37	c.151G>A		.	.	.	.	.	.	.	.	.	.	G	17.51	3.407634	0.62399	.	.	ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182	T;T;T;T	0.43294	2.33;2.33;2.23;0.95	5.47	4.52	0.55395	.	0.277119	0.30142	N	0.010310	T	0.29158	0.0725	L	0.28274	0.84	0.27649	N	0.947458	P	0.38767	0.646	B	0.39152	0.292	T	0.12192	-1.0557	10	0.07644	T	0.81	.	14.945	0.71023	0.0:0.228:0.772:0.0	.	536	Q3ZCN5	OTOGL_HUMAN	N	2159;2171;190;188	ENSP00000447211:D2159N;ENSP00000400895:D2171N;ENSP00000449094:D190N;ENSP00000449641:D188N	ENSP00000400895:D2171N	D	+	1	0	OTOGL	79286143	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.010000	0.57117	2.538000	0.85594	0.585000	0.79938	GAT		0.358	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591		4	6	0	0	0	0.009096	0	4	6				
PARPBP	55010	broad.mit.edu	37	12	102589845	102589845	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:102589845A>T	ENST00000358383.5	+	11	1561	c.1516A>T	c.(1516-1518)Aaa>Taa	p.K506*	PARPBP_ENST00000535811.1_3'UTR|PARPBP_ENST00000327680.2_Nonsense_Mutation_p.K425*|PARPBP_ENST00000392911.2_Nonsense_Mutation_p.K425*|PARPBP_ENST00000541394.1_Nonsense_Mutation_p.K583*|PARPBP_ENST00000543784.1_3'UTR|PARPBP_ENST00000378128.3_3'UTR			Q9NWS1	PARI_HUMAN	PARP1 binding protein	506					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K425*(1)|p.K506*(1)		endometrium(1)|lung(8)|urinary_tract(2)	11						GACAGGAAATAAAAGCTCAAA	0.328																																							uc001tjf.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(1516-1518)AAA>TAA		hypothetical protein LOC55010							59.0	58.0	59.0					12																	102589845		2203	4297	6500	SO:0001587	stop_gained	55010				response to DNA damage stimulus	cytoplasm|nucleus	DNA binding	g.chr12:102589845A>T	AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.1516A>T	12.37:g.102589845A>T	ENSP00000351153:p.Lys506*		Somatic				C12orf48_uc001tjg.2_Nonsense_Mutation_p.K425*|C12orf48_uc010swa.1_Nonsense_Mutation_p.K583*|C12orf48_uc001tjh.2_Nonsense_Mutation_p.K425*|C12orf48_uc010swb.1_3'UTR|C12orf48_uc009zuc.2_Nonsense_Mutation_p.K60*|C12orf48_uc001tjj.2_Nonsense_Mutation_p.K221*|C12orf48_uc001tjk.2_3'UTR|C12orf48_uc009zud.2_3'UTR	p.K506*	NM_017915	NP_060385	WXS	Illumina HiSeq	Unspecified	Q9NWS1	PR1BP_HUMAN			11	1628	+			506					B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Nonsense_Mutation	SNP	ENST00000358383.5	37	c.1516A>T	CCDS9090.2	.	.	.	.	.	.	.	.	.	.	A	32	5.173650	0.94807	.	.	ENSG00000185480	ENST00000327680;ENST00000541394;ENST00000358383;ENST00000392911	.	.	.	4.95	1.05	0.20165	.	0.269680	0.40728	N	0.001035	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.2646	3.2023	0.06653	0.6417:0.1393:0.0773:0.1418	.	.	.	.	X	425;583;506;425	.	ENSP00000332915:K425X	K	+	1	0	C12orf48	101113975	1.000000	0.71417	0.449000	0.26957	0.974000	0.67602	2.461000	0.45040	-0.004000	0.14419	0.533000	0.62120	AAA		0.328	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397030.2	NM_017915		29	12	0	0	0	0.007291	0	29	12				
SSH1	54434	broad.mit.edu	37	12	109186491	109186491	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:109186491C>A	ENST00000326495.5	-	14	1557	c.1464G>T	c.(1462-1464)ccG>ccT	p.P488P	SSH1_ENST00000360239.3_Silent_p.P176P|SSH1_ENST00000326470.5_Silent_p.P499P|SSH1_ENST00000551165.1_Silent_p.P488P	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	488					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.P488P(1)|p.P499P(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGGCTTTCCGGGGTGCCAT	0.652																																							uc001tnm.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)	4						c.(1462-1464)CCG>CCT		slingshot 1 isoform 1							26.0	30.0	29.0					12																	109186491		2203	4300	6503	SO:0001819	synonymous_variant	54434				actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr12:109186491C>A	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1464G>T	12.37:g.109186491C>A			Somatic				SSH1_uc001tnl.2_Silent_p.P176P|SSH1_uc010sxg.1_Silent_p.P499P|SSH1_uc001tnn.3_Silent_p.P488P	p.P488P	NM_018984	NP_061857	WXS	Illumina HiSeq	Unspecified	Q8WYL5	SSH1_HUMAN			14	1551	-			488					Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	ENST00000326495.5	37	c.1464G>T	CCDS9121.1																																																																																				0.652	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984		26	23	1	0	2.79863e-10	0.004656	3.85665e-10	26	23				
DNAH10	196385	broad.mit.edu	37	12	124393958	124393958	+	Silent	SNP	G	G	T	rs369490257		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:124393958G>T	ENST00000409039.3	+	57	9637	c.9612G>T	c.(9610-9612)tcG>tcT	p.S3204S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3204	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S3204S(1)|p.S1796S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ATTTTGATTCGATTACCCAGA	0.512																																							uc001uft.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(9610-9612)TCG>TCT		dynein, axonemal, heavy chain 10							56.0	55.0	55.0					12																	124393958		1961	4147	6108	SO:0001819	synonymous_variant	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124393958G>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9612G>T	12.37:g.124393958G>T			Somatic					p.S3204S	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	57	9637	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		3204			Stalk (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	c.9612G>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	g	0.024	-1.385335	0.01194	.	.	ENSG00000197653	ENST00000540041	.	.	.	5.43	-10.9	0.00192	.	.	.	.	.	T	0.19485	0.0468	.	.	.	0.28409	N	0.918264	.	.	.	.	.	.	T	0.08554	-1.0716	4	.	.	.	.	3.3286	0.07076	0.4691:0.1022:0.2799:0.1488	.	.	.	.	L	132	.	.	R	+	2	0	DNAH10	122959911	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.866000	0.00723	-5.085000	0.00022	-2.069000	0.00389	CGA		0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			4	14	1	0	0.00024832	0.009096	0.000278283	4	14				
DNAH10	196385	broad.mit.edu	37	12	124409644	124409644	+	Silent	SNP	C	C	T	rs369302336		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:124409644C>T	ENST00000409039.3	+	67	11485	c.11460C>T	c.(11458-11460)taC>taT	p.Y3820Y	RP11-380L11.4_ENST00000602952.1_RNA|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3820					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Y3820Y(1)|p.Y2412Y(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCTTGGGTTACGATAACAACA	0.473																																							uc001uft.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(11458-11460)TAC>TAT		dynein, axonemal, heavy chain 10		C		1,3909		0,1,1954	197.0	190.0	192.0		11460	-10.8	0.0	12		192	0,8302		0,0,4151	no	coding-synonymous	DNAH10	NM_207437.3		0,1,6105	TT,TC,CC		0.0,0.0256,0.0082		3820/4472	124409644	1,12211	1955	4151	6106	SO:0001819	synonymous_variant	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124409644C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11460C>T	12.37:g.124409644C>T			Somatic				DNAH10_uc001ufu.3_Translation_Start_Site	p.Y3820Y	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	67	11485	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		3820			TPR 4.		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	c.11460C>T	CCDS9255.2																																																																																				0.473	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			4	74	0	0	0	0.000602	0	4	74				
UBC	7316	broad.mit.edu	37	12	125397907	125397907	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:125397907G>C	ENST00000538617.1	-	3	727	c.411C>G	c.(409-411)atC>atG	p.I137M	UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536769.1_Missense_Mutation_p.I137M|UBC_ENST00000339647.5_Missense_Mutation_p.I137M|UBC_ENST00000546120.1_Intron			P0CG48	UBC_HUMAN	ubiquitin C	517	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.I137M(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		ACTCTTTCTGGATGTTGTAGT	0.552																																							uc001ugs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(409-411)ATC>ATG		ubiquitin C							101.0	96.0	98.0					12																	125397907		2202	4280	6482	SO:0001583	missense	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125397907G>C		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.411C>G	12.37:g.125397907G>C	ENSP00000443053:p.Ile137Met		Somatic				UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Missense_Mutation_p.I137M|UBC_uc001ugt.2_Missense_Mutation_p.I137M|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Translation_Start_Site	p.I137M	NM_021009	NP_066289	WXS	Illumina HiSeq	Unspecified	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	859	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		137			Ubiquitin-like 2.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000538617.1	37	c.411C>G		.	.	.	.	.	.	.	.	.	.	-	13.43	2.235458	0.39498	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000339647;ENST00000540351;ENST00000541645;ENST00000535131	T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	4.0	4.0	0.46444	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	U	0.000015	D	0.91119	0.7204	M	0.92367	3.3	0.80722	D	1	B;B;B	0.30727	0.292;0.248;0.292	D;D;D	0.66979	0.948;0.914;0.948	D	0.91230	0.5013	10	0.87932	D	0	.	9.0324	0.36267	0.1049:0.0:0.8951:0.0	.	226;137;137	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	M	137	ENSP00000441543:I137M;ENSP00000443053:I137M;ENSP00000344818:I137M;ENSP00000442800:I137M;ENSP00000445337:I137M;ENSP00000439492:I137M	ENSP00000344818:I137M	I	-	3	3	UBC	123963860	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.464000	0.60134	1.944000	0.56390	0.650000	0.86243	ATC		0.552	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		29	175	0	0	0	0.010771	0	29	175				
P2RX2	22953	broad.mit.edu	37	12	133196643	133196643	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:133196643T>G	ENST00000389110.3	+	5	552	c.515T>G	c.(514-516)gTg>gGg	p.V172G	P2RX2_ENST00000350048.5_Missense_Mutation_p.V148G|P2RX2_ENST00000343948.4_Missense_Mutation_p.V172G|P2RX2_ENST00000352418.4_Missense_Mutation_p.V100G|P2RX2_ENST00000348800.5_Missense_Mutation_p.V172G|P2RX2_ENST00000351222.4_Missense_Mutation_p.V80G|P2RX2_ENST00000449132.2_Silent_p.G136G	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	172					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.V172G(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACCTGCGAGGTGTTCGGCTGG	0.677																																							uc001ukj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(514-516)GTG>GGG		purinergic receptor P2X2 isoform A							13.0	12.0	12.0					12																	133196643		2196	4290	6486	SO:0001583	missense	22953				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity	g.chr12:133196643T>G	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.515T>G	12.37:g.133196643T>G	ENSP00000373762:p.Val172Gly		Somatic				P2RX2_uc001uki.1_Missense_Mutation_p.V172G|P2RX2_uc001ukk.1_Missense_Mutation_p.V172G|P2RX2_uc001ukl.1_Missense_Mutation_p.V148G|P2RX2_uc001ukm.1_Missense_Mutation_p.V100G|P2RX2_uc001ukn.1_Missense_Mutation_p.V80G|P2RX2_uc009zyt.1_Missense_Mutation_p.V172G|P2RX2_uc001uko.1_Silent_p.G136G	p.V172G	NM_170682	NP_733782	WXS	Illumina HiSeq	Unspecified	Q9UBL9	P2RX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)	5	515	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)	172			Extracellular (Potential).		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	ENST00000389110.3	37	c.515T>G	CCDS31931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.74|17.74	3.464185|3.464185	0.63513|0.63513	.|.	.|.	ENSG00000187848|ENSG00000187848	ENST00000542301;ENST00000536121;ENST00000535910|ENST00000389110;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	.|T;T;T;T;T;T	.|0.06371	.|3.31;3.31;3.31;3.31;3.31;3.31	5.08|5.08	3.91|3.91	0.45181|0.45181	.|.	.|0.076254	.|0.56097	.|D	.|0.000032	T|T	0.28134|0.28134	0.0694|0.0694	M|M	0.88310|0.88310	2.945|2.945	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.998;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.85130	.|0.993;0.995;0.997;0.95;0.992;0.995;0.988	T|T	0.03193|0.03193	-1.1062|-1.1062	5|10	.|0.87932	.|D	.|0	-19.9287|-19.9287	10.8419|10.8419	0.46720|0.46720	0.1417:0.0:0.0:0.8583|0.1417:0.0:0.0:0.8583	.|.	.|172;80;100;148;172;172;172	.|Q32MC3;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.|.;.;.;.;.;P2RX2_HUMAN;.	G|G	183;158;128|172;172;100;148;80;172	.|ENSP00000373762:V172G;ENSP00000343339:V172G;ENSP00000341419:V100G;ENSP00000343904:V148G;ENSP00000344502:V80G;ENSP00000345095:V172G	.|ENSP00000343339:V172G	C|V	+|+	1|2	0|0	P2RX2|P2RX2	131706716|131706716	0.981000|0.981000	0.34729|0.34729	0.648000|0.648000	0.29521|0.29521	0.395000|0.395000	0.30598|0.30598	3.668000|3.668000	0.54554|0.54554	0.746000|0.746000	0.32786|0.32786	0.459000|0.459000	0.35465|0.35465	TGT|GTG		0.677	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			4	4	0	0	0	0.009096	0	4	4				
TUBA3C	7278	broad.mit.edu	37	13	19751104	19751104	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:19751104G>T	ENST00000400113.3	-	4	1123	c.1019C>A	c.(1018-1020)aCc>aAc	p.T340N		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	340					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T340N(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		AAACTGGATGGTGCGCTTGGT	0.527																																							uc009zzj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1018-1020)ACC>AAC		tubulin, alpha 3c							117.0	99.0	105.0					13																	19751104		2203	4300	6503	SO:0001583	missense	7278				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr13:19751104G>T	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1019C>A	13.37:g.19751104G>T	ENSP00000382982:p.Thr340Asn		Somatic					p.T340N	NM_006001	NP_005992	WXS	Illumina HiSeq	Unspecified	Q13748	TBA3C_HUMAN		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	4	1068	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	340					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	c.1019C>A	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	g	3.507	-0.100589	0.06967	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.81415	-1.49	1.21	1.21	0.21127	.	0.000000	0.48286	U	0.000184	T	0.82190	0.4983	.	.	.	0.36843	D	0.887513	.	.	.	.	.	.	D	0.84137	0.0415	7	0.72032	D	0.01	.	8.3447	0.32266	0.0:0.0:1.0:0.0	.	.	.	.	N	340	ENSP00000382982:T340N	ENSP00000354037:T340N	T	-	2	0	TUBA3C	18649104	0.997000	0.39634	1.000000	0.80357	0.556000	0.35491	0.114000	0.15520	0.976000	0.38417	0.184000	0.17185	ACC		0.527	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		13	64	1	0	7.93312e-07	0.00245	9.79719e-07	13	64				
RNF17	56163	broad.mit.edu	37	13	25352513	25352513	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:25352513A>T	ENST00000255324.5	+	4	450	c.398A>T	c.(397-399)aAg>aTg	p.K133M	RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000255325.6_Missense_Mutation_p.K133M|RNF17_ENST00000381921.1_Missense_Mutation_p.K133M	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	133					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.K133M(2)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCCACAGACAAGACTCTTTTG	0.378																																							uc001upr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(397-399)AAG>ATG		ring finger protein 17							179.0	163.0	168.0					13																	25352513		2203	4300	6503	SO:0001583	missense	56163				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding	g.chr13:25352513A>T	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.398A>T	13.37:g.25352513A>T	ENSP00000255324:p.Lys133Met		Somatic				RNF17_uc010tdd.1_Translation_Start_Site|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.K133M|RNF17_uc001ups.2_Missense_Mutation_p.K72M|RNF17_uc001upq.1_Missense_Mutation_p.K133M	p.K133M	NM_031277	NP_112567	WXS	Illumina HiSeq	Unspecified	Q9BXT8	RNF17_HUMAN		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)	4	439	+		Lung SC(185;0.0225)|Breast(139;0.077)	133					Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	c.398A>T	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	A	6.888	0.533303	0.13188	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000255325;ENST00000255326	T;T;T	0.19105	3.46;3.46;2.17	4.68	-0.0299	0.13916	.	0.592988	0.15845	N	0.241847	T	0.09686	0.0238	N	0.08118	0	0.09310	N	1	B;B;B	0.29955	0.263;0.143;0.074	B;B;B	0.29598	0.078;0.057;0.104	T	0.23261	-1.0193	10	0.66056	D	0.02	.	7.5008	0.27516	0.476:0.0:0.524:0.0	.	133;133;133	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	M	133	ENSP00000255324:K133M;ENSP00000371346:K133M;ENSP00000255325:K133M	ENSP00000255324:K133M	K	+	2	0	RNF17	24250513	0.585000	0.26774	0.016000	0.15963	0.086000	0.17979	0.222000	0.17699	-0.155000	0.11098	-0.220000	0.12472	AAG		0.378	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994		19	58	0	0	0	0.007413	0	19	58				
FLT3	2322	broad.mit.edu	37	13	28599082	28599082	+	Splice_Site	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:28599082T>C	ENST00000241453.7	-	18	2289		c.e18-2		FLT3_ENST00000380982.4_Splice_Site|FLT3_ENST00000537084.1_Splice_Site	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3						B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.?(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGGCATGCTATTAAAAAAT	0.299			"""Mis, O"""		"""AML, ALL"""																																		uc001urw.2		NA		Dom	yes		13	13q12	2322	Mis|O	fms-related tyrosine kinase 3			L			AML|ALL		1	Unknown(1)		lung(1)	haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549						c.e18-1		fms-related tyrosine kinase 3 precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						89.0	96.0	94.0					13																	28599082		2203	4300	6503	SO:0001630	splice_region_variant	2322				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	g.chr13:28599082T>C	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2208-2A>G	13.37:g.28599082T>C			Somatic				FLT3_uc010aao.2_Splice_Site|FLT3_uc010tdn.1_Splice_Site_p.S736_splice	p.S736_splice	NM_004119	NP_004110	WXS	Illumina HiSeq	Unspecified	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	18	2290	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)						A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Splice_Site	SNP	ENST00000241453.7	37	c.2208_splice	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	T	16.17	3.048386	0.55110	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4451	0.61136	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT3	27497082	0.452000	0.25713	0.535000	0.28026	0.343000	0.28985	1.859000	0.39418	2.164000	0.68074	0.454000	0.30748	.		0.299	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		Intron	3	96	0	0	0	0.004672	0	3	96				
MTUS2	23281	broad.mit.edu	37	13	29599271	29599271	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:29599271G>T	ENST00000431530.3	+	1	524	c.466G>T	c.(466-468)Gtt>Ttt	p.V156F		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	146						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.V156F(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CAGTCTAGACGTTTTGGCTAA	0.507																																							uc001usl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(466-468)GTT>TTT		hypothetical protein LOC23281 isoform a							107.0	108.0	108.0					13																	29599271		2041	4201	6242	SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29599271G>T	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.466G>T	13.37:g.29599271G>T	ENSP00000392057:p.Val156Phe		Somatic					p.V156F	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	524	+			146					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	c.466G>T	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	g	13.41	2.227757	0.39399	.	.	ENSG00000132938	ENST00000431530	T	0.13089	2.62	5.31	4.47	0.54385	.	0.458519	0.17964	N	0.156061	T	0.16599	0.0399	L	0.51422	1.61	0.09310	N	0.999998	P	0.35433	0.501	B	0.43194	0.411	T	0.14839	-1.0458	9	.	.	.	.	6.5869	0.22626	0.1543:0.0:0.7009:0.1447	.	146	Q5JR59	MTUS2_HUMAN	F	156	ENSP00000392057:V156F	.	V	+	1	0	MTUS2	28497271	0.005000	0.15991	0.003000	0.11579	0.001000	0.01503	1.007000	0.29860	1.247000	0.43917	-0.122000	0.15005	GTT		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		11	86	1	0	2.68362e-12	0.013537	3.87126e-12	11	86				
STARD13	90627	broad.mit.edu	37	13	33686964	33686964	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:33686964C>T	ENST00000336934.5	-	9	2502	c.2386G>A	c.(2386-2388)Gtc>Atc	p.V796I	STARD13_ENST00000255486.4_Missense_Mutation_p.V788I|STARD13_ENST00000399365.3_Missense_Mutation_p.V678I	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	796	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.V796I(2)		breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		AAGTTGACGACGTCGTTCAGG	0.542																																							uc001uuw.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(2386-2388)GTC>ATC		StAR-related lipid transfer (START) domain							108.0	109.0	109.0					13																	33686964		2203	4300	6503	SO:0001583	missense	90627				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding	g.chr13:33686964C>T	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2386G>A	13.37:g.33686964C>T	ENSP00000338785:p.Val796Ile		Somatic				STARD13_uc001uuu.2_Missense_Mutation_p.V788I|STARD13_uc001uuv.2_Missense_Mutation_p.V678I|STARD13_uc001uux.2_Missense_Mutation_p.V761I|STARD13_uc010tec.1_RNA	p.V796I	NM_178006	NP_821074	WXS	Illumina HiSeq	Unspecified	Q9Y3M8	STA13_HUMAN		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)	9	2512	-	all_epithelial(80;0.155)	Lung SC(185;0.0367)	796			Rho-GAP.		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	c.2386G>A	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323141	0.60634	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.25085	1.82;1.82;1.82	5.38	5.38	0.77491	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.37839	0.1018	L	0.42581	1.335	0.80722	D	1	P;P;D	0.53885	0.721;0.941;0.963	B;P;P	0.54460	0.38;0.753;0.638	T	0.02081	-1.1217	10	0.33940	T	0.23	.	19.2053	0.93728	0.0:1.0:0.0:0.0	.	761;796;788	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	I	678;788;796	ENSP00000382300:V678I;ENSP00000255486:V788I;ENSP00000338785:V796I	ENSP00000255486:V788I	V	-	1	0	STARD13	32584964	1.000000	0.71417	0.159000	0.22649	0.281000	0.26958	7.720000	0.84759	2.528000	0.85240	0.650000	0.86243	GTC		0.542	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466		58	74	0	0	0	0.01441	0	58	74				
FREM2	341640	broad.mit.edu	37	13	39262601	39262601	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:39262601G>C	ENST00000280481.7	+	1	1336	c.1120G>C	c.(1120-1122)Gat>Cat	p.D374H		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	374					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D374H(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGTGAGCACCGATGATCGCAG	0.577																																							uc001uwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(1120-1122)GAT>CAT		FRAS1-related extracellular matrix protein 2							106.0	103.0	104.0					13																	39262601		2203	4300	6503	SO:0001583	missense	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39262601G>C	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1120G>C	13.37:g.39262601G>C	ENSP00000280481:p.Asp374His		Somatic					p.D374H	NM_207361	NP_997244	WXS	Illumina HiSeq	Unspecified	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	1	1429	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	374			CSPG 1.|Extracellular (Potential).		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	c.1120G>C	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105325	0.77096	.	.	ENSG00000150893	ENST00000280481	T	0.21191	2.02	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.53834	0.1821	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55503	-0.8131	10	0.72032	D	0.01	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	374	Q5SZK8	FREM2_HUMAN	H	374	ENSP00000280481:D374H	ENSP00000280481:D374H	D	+	1	0	FREM2	38160601	1.000000	0.71417	0.972000	0.41901	0.981000	0.71138	8.003000	0.88520	2.826000	0.97356	0.561000	0.74099	GAT		0.577	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		29	81	0	0	0	0.009535	0	29	81				
HTR2A	3356	broad.mit.edu	37	13	47409356	47409356	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:47409356G>T	ENST00000378688.4	-	3	1163	c.1032C>A	c.(1030-1032)atC>atA	p.I344I	HTR2A_ENST00000542664.1_Silent_p.I344I|HTR2A_ENST00000543956.1_Silent_p.I260I			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	344					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.I344I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGACGGCCATGATGTTTGTGA	0.493																																							uc001vbq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(1030-1032)ATC>ATA		5-hydroxytryptamine receptor 2A isoform 1	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						156.0	129.0	138.0					13																	47409356		2203	4300	6503	SO:0001819	synonymous_variant	3356				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity	g.chr13:47409356G>T	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1032C>A	13.37:g.47409356G>T			Somatic				HTR2A_uc001vbr.2_Silent_p.I244I|HTR2A_uc010acr.2_Silent_p.I344I	p.I344I	NM_000621	NP_000612	WXS	Illumina HiSeq	Unspecified	P28223	5HT2A_HUMAN		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	3	1166	-		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)	344			Helical; Name=6; (By similarity).		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	37	c.1032C>A	CCDS9405.1																																																																																				0.493	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		6	80	1	0	0.00116845	0.001168	0.00128189	6	80				
FARP1	10160	broad.mit.edu	37	13	99042284	99042284	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:99042284T>G	ENST00000319562.6	+	10	1194	c.929T>G	c.(928-930)gTt>gGt	p.V310G	FARP1_ENST00000376586.2_Missense_Mutation_p.V310G|FARP1_ENST00000595437.1_Missense_Mutation_p.V310G	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	310	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V310G(2)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			AAAATCTGTGTTGAACATCAT	0.483																																							uc001vnj.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)	2						c.(928-930)GTT>GGT		FERM, RhoGEF, and pleckstrin domain protein 1							141.0	144.0	143.0					13																	99042284		2203	4300	6503	SO:0001583	missense	10160				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr13:99042284T>G	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.929T>G	13.37:g.99042284T>G	ENSP00000322926:p.Val310Gly		Somatic				FARP1_uc001vnh.2_Missense_Mutation_p.V310G	p.V310G	NM_005766	NP_005757	WXS	Illumina HiSeq	Unspecified	Q9Y4F1	FARP1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.233)		10	1265	+	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		310			FERM.		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	c.929T>G	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.745904	0.89663	.	.	ENSG00000152767	ENST00000376586;ENST00000376584;ENST00000319562	D;D	0.88431	-2.38;-2.38	5.64	5.64	0.86602	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.95884	0.8660	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.96942	0.9688	10	0.87932	D	0	.	15.8697	0.79101	0.0:0.0:0.0:1.0	.	310;310	Q9Y4F1;C9JME2	FARP1_HUMAN;.	G	310;15;310	ENSP00000365771:V310G;ENSP00000322926:V310G	ENSP00000322926:V310G	V	+	2	0	FARP1	97840285	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	8.040000	0.89188	2.152000	0.67230	0.533000	0.62120	GTT		0.483	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766		30	125	0	0	0	0.008361	0	30	125				
ABHD13	84945	broad.mit.edu	37	13	108881888	108881888	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:108881888G>T	ENST00000375898.3	+	2	623	c.322G>T	c.(322-324)Gga>Tga	p.G108*		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	108						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.G108*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					ACGATACACTGGAGACAATTC	0.388																																					Pancreas(22;506 789 38166 45896 51596)	Pancreas(22;506 789 38166 45896 51596)	uc001vqq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(322-324)GGA>TGA		abhydrolase domain containing 13							80.0	75.0	77.0					13																	108881888		2203	4299	6502	SO:0001587	stop_gained	84945					integral to membrane	hydrolase activity	g.chr13:108881888G>T	AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.322G>T	13.37:g.108881888G>T	ENSP00000365063:p.Gly108*		Somatic					p.G108*	NM_032859	NP_116248	WXS	Illumina HiSeq	Unspecified	Q7L211	ABHDD_HUMAN			2	587	+	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)		108					B3KWE7|Q8NBW1|Q96JX9	Nonsense_Mutation	SNP	ENST00000375898.3	37	c.322G>T	CCDS32007.1	.	.	.	.	.	.	.	.	.	.	G	38	6.829261	0.97869	.	.	ENSG00000139826	ENST00000375898	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-20.8923	19.2409	0.93883	0.0:0.0:1.0:0.0	.	.	.	.	X	108	.	ENSP00000365063:G108X	G	+	1	0	ABHD13	107679889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.352000	0.97076	2.788000	0.95919	0.557000	0.71058	GGA		0.388	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859		10	41	1	0	1.76689e-08	0.006214	2.32612e-08	10	41				
MYO16	23026	broad.mit.edu	37	13	109459025	109459025	+	Splice_Site	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:109459025A>G	ENST00000357550.2	+	6	716		c.e6-1		MYO16_ENST00000251041.5_Splice_Site|MYO16_ENST00000356711.2_Splice_Site	NM_001198950.1	NP_001185879.1			myosin XVI									p.?(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCTTCGCTGCAGTTACACATG	0.423																																							uc001vqt.1		NA																	1	Unknown(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.e7-2		myosin heavy chain Myr 8							103.0	95.0	98.0					13																	109459025		2203	4300	6503	SO:0001630	splice_region_variant	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109459025A>G		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.676-1A>G	13.37:g.109459025A>G			Somatic				MYO16_uc010agk.1_Splice_Site_p.L248_splice|MYO16_uc001vqu.1_Splice_Site_p.L26_splice	p.L226_splice	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		7	802	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)								Splice_Site	SNP	ENST00000357550.2	37	c.676_splice	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683011	0.29872	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7781	0.57461	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO16	108257026	1.000000	0.71417	0.983000	0.44433	0.279000	0.26890	7.836000	0.86788	1.888000	0.54679	0.533000	0.62120	.		0.423	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	Intron	14	38	0	0	0	0.001855	0	14	38				
OR4L1	122742	broad.mit.edu	37	14	20528375	20528375	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:20528375C>A	ENST00000315683.1	+	1	172	c.172C>A	c.(172-174)Ccc>Acc	p.P58T		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P58T(1)		central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		CCTTCATTCTCCCTTGTACTT	0.423																																							uc001vwn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(172-174)CCC>ACC		olfactory receptor, family 4, subfamily L,							174.0	180.0	178.0					14																	20528375		2203	4300	6503	SO:0001583	missense	122742				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20528375C>A		CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.172C>A	14.37:g.20528375C>A	ENSP00000319217:p.Pro58Thr		Somatic					p.P58T	NM_001004717	NP_001004717	WXS	Illumina HiSeq	Unspecified	Q8NH43	OR4L1_HUMAN	Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)	1	172	+	all_cancers(95;0.00108)		58			Helical; Name=2; (Potential).		Q6IEZ5	Missense_Mutation	SNP	ENST00000315683.1	37	c.172C>A	CCDS32029.1	.	.	.	.	.	.	.	.	.	.	.	19.31	3.803141	0.70682	.	.	ENSG00000176246	ENST00000315683	T	0.02032	4.49	3.84	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000080	T	0.18841	0.0452	H	0.98754	4.32	0.44036	D	0.996767	D	0.65815	0.995	P	0.56563	0.801	T	0.41395	-0.9511	10	0.66056	D	0.02	.	13.7048	0.62631	0.0:1.0:0.0:0.0	.	58	Q8NH43	OR4L1_HUMAN	T	58	ENSP00000319217:P58T	ENSP00000319217:P58T	P	+	1	0	OR4L1	19598215	0.992000	0.36948	0.998000	0.56505	0.921000	0.55340	4.241000	0.58707	2.147000	0.66899	0.639000	0.83563	CCC		0.423	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1			65	139	1	0	1.1794e-34	0.01441	2.13806e-34	65	139				
OXA1L	5018	broad.mit.edu	37	14	23237370	23237370	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:23237370C>T	ENST00000604262.1	+	3	452	c.429C>T	c.(427-429)gcC>gcT	p.A143A	OXA1L_ENST00000285848.5_Silent_p.A203A|OXA1L_ENST00000358043.5_Silent_p.A127A|CTD-2555K7.2_ENST00000554730.1_RNA|OXA1L_ENST00000412791.1_Silent_p.A143A|CTD-2555K7.2_ENST00000554857.1_RNA|CTD-2555K7.2_ENST00000553792.1_RNA			Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	143					aerobic respiration (GO:0009060)|mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex I biogenesis (GO:0097031)|negative regulation of ATPase activity (GO:0032780)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|protein complex assembly (GO:0006461)|protein insertion into membrane (GO:0051205)|protein tetramerization (GO:0051262)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	mitochondrial ribosome binding (GO:0097177)|protein homodimerization activity (GO:0042803)	p.A203A(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|skin(2)	19	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		GGTGGGGGGCCATTGCTGCAT	0.488																																							uc001wgn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(607-609)GCC>GCT		oxidase (cytochrome c) assembly 1-like							46.0	46.0	46.0					14																	23237370		2203	4300	6503	SO:0001819	synonymous_variant	5018				aerobic respiration|mitochondrial proton-transporting ATP synthase complex assembly|mitochondrial respiratory chain complex I assembly|negative regulation of ATPase activity|negative regulation of oxidoreductase activity|protein insertion into membrane|protein tetramerization	integral to mitochondrial membrane|mitochondrial respiratory chain|protein complex	protein homodimerization activity|ribosome binding	g.chr14:23237370C>T		CCDS9573.1	14q11.2	2009-05-26			ENSG00000155463	ENSG00000155463			8526	protein-coding gene	gene with protein product		601066				8586451, 19349278	Standard	NM_005015		Approved	MGC133129, OXA1	uc001wgn.2	Q15070	OTTHUMG00000028691	ENST00000604262.1:c.429C>T	14.37:g.23237370C>T			Somatic				OXA1L_uc010tnc.1_Silent_p.A203A|OXA1L_uc001wgo.2_RNA|OXA1L_uc010akc.2_Silent_p.A203A|OXA1L_uc001wgp.2_Silent_p.A127A|OXA1L_uc001wgq.2_5'UTR	p.A203A	NM_005015	NP_005006	WXS	Illumina HiSeq	Unspecified	Q15070	OXA1L_HUMAN		GBM - Glioblastoma multiforme(265;0.0096)	3	609	+	all_cancers(95;8.44e-05)		143			Helical; (Potential).		B4DPA2	Silent	SNP	ENST00000604262.1	37	c.609C>T																																																																																					0.488	OXA1L-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468876.1	NM_005015		20	41	0	0	0	0.008871	0	20	41				
MYH6	4624	broad.mit.edu	37	14	23855735	23855735	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:23855735T>A	ENST00000356287.3	-	32	4777	c.4748A>T	c.(4747-4749)gAg>gTg	p.E1583V	MYH6_ENST00000405093.3_Missense_Mutation_p.E1583V|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1583					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.E1583V(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTCCATCTCCTCGTCCTTCTC	0.632																																							uc001wjv.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(4747-4749)GAG>GTG		myosin heavy chain 6							165.0	172.0	170.0					14																	23855735		2203	4300	6503	SO:0001583	missense	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23855735T>A	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4748A>T	14.37:g.23855735T>A	ENSP00000348634:p.Glu1583Val		Somatic					p.E1583V	NM_002471	NP_002462	WXS	Illumina HiSeq	Unspecified	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	33	4815	-	all_cancers(95;2.54e-05)		1583			Potential.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	c.4748A>T	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	t	24.1	4.494154	0.85069	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.90676	-2.71;-2.71	4.26	4.26	0.50523	Myosin tail (1);	.	.	.	.	D	0.96266	0.8782	H	0.94183	3.505	0.51767	D	0.999936	D	0.67145	0.996	D	0.70016	0.967	D	0.97253	0.9899	9	0.87932	D	0	.	13.6786	0.62469	0.0:0.0:0.0:1.0	.	1583	P13533	MYH6_HUMAN	V	1583	ENSP00000386041:E1583V;ENSP00000348634:E1583V	ENSP00000348634:E1583V	E	-	2	0	MYH6	22925575	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.974000	0.88039	1.669000	0.50854	0.459000	0.35465	GAG		0.632	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			74	203	0	0	0	0.01441	0	74	203				
AKAP6	9472	broad.mit.edu	37	14	33291371	33291371	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:33291371C>T	ENST00000280979.4	+	13	4522	c.4352C>T	c.(4351-4353)cCt>cTt	p.P1451L	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1451					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.P1451L(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAACATACCCCTGACTGTTTG	0.363																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(4351-4353)CCT>CTT		A-kinase anchor protein 6							64.0	63.0	64.0					14																	33291371		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33291371C>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4352C>T	14.37:g.33291371C>T	ENSP00000280979:p.Pro1451Leu		Somatic					p.P1451L	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	4522	+	Breast(36;0.0388)|Prostate(35;0.15)		1451					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.4352C>T	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671931	0.29693	.	.	ENSG00000151320	ENST00000280979	T	0.05199	3.48	5.55	5.55	0.83447	.	0.547660	0.20079	N	0.099695	T	0.08802	0.0218	L	0.51422	1.61	0.80722	D	1	B	0.27625	0.183	B	0.22386	0.039	T	0.04565	-1.0942	10	0.87932	D	0	-6.8527	14.2207	0.65826	0.1485:0.8515:0.0:0.0	.	1451	Q13023	AKAP6_HUMAN	L	1451	ENSP00000280979:P1451L	ENSP00000280979:P1451L	P	+	2	0	AKAP6	32361122	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.596000	0.46205	2.606000	0.88127	0.563000	0.77884	CCT		0.363	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		10	44	0	0	0	0.008291	0	10	44				
SSTR1	6751	broad.mit.edu	37	14	38679167	38679167	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:38679167C>A	ENST00000267377.2	+	3	1190	c.573C>A	c.(571-573)ccC>ccA	p.P191P		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	191					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.P191P(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TCATCCTGCCCATCGTGGTCT	0.657																																							uc001wul.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(1)|lung(1)	5						c.(571-573)CCC>CCA		somatostatin receptor 1	Octreotide(DB00104)						85.0	82.0	83.0					14																	38679167		2203	4299	6502	SO:0001819	synonymous_variant	6751				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity	g.chr14:38679167C>A		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.573C>A	14.37:g.38679167C>A			Somatic				SSTR1_uc010amu.1_Intron	p.P191P	NM_001049	NP_001040	WXS	Illumina HiSeq	Unspecified	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	3	1190	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		191			Helical; Name=4; (Potential).			Silent	SNP	ENST00000267377.2	37	c.573C>A	CCDS9666.1																																																																																				0.657	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			11	40	1	0	7.03913e-09	0.013537	9.48813e-09	11	40				
FANCM	57697	broad.mit.edu	37	14	45645710	45645710	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:45645710T>C	ENST00000267430.5	+	14	3838	c.3753T>C	c.(3751-3753)gaT>gaC	p.D1251D	FANCM_ENST00000542564.2_Silent_p.D1225D	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1251					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.D1251D(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATACATCAGATAGCAATAGAC	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc001wwd.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(2)|breast(2)	7						c.(3751-3753)GAT>GAC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							79.0	81.0	80.0					14																	45645710		2203	4300	6503	SO:0001819	synonymous_variant	57697	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45645710T>C	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3753T>C	14.37:g.45645710T>C			Somatic				FANCM_uc010anf.2_Silent_p.D1225D|FANCM_uc001wwe.3_Silent_p.D787D|FANCM_uc010ang.2_Silent_p.D465D	p.D1251D	NM_020937	NP_065988	WXS	Illumina HiSeq	Unspecified	Q8IYD8	FANCM_HUMAN			14	3852	+			1251					B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	c.3753T>C	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	T	0.027	-1.360980	0.01245	.	.	ENSG00000187790	ENST00000554809	.	.	.	5.91	2.04	0.26737	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.0944	0.03664	0.2672:0.0758:0.1384:0.5186	.	.	.	.	Q	184	.	.	X	+	1	0	FANCM	44715460	0.787000	0.28750	0.055000	0.19348	0.173000	0.22820	2.293000	0.43558	0.429000	0.26202	0.533000	0.62120	TAG		0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		24	52	0	0	0	0.00278	0	24	52				
GPATCH2L	55668	broad.mit.edu	37	14	76633041	76633041	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:76633041G>T	ENST00000261530.7	+	3	764	c.698G>T	c.(697-699)gGg>gTg	p.G233V	GPATCH2L_ENST00000556663.1_Missense_Mutation_p.G233V|GPATCH2L_ENST00000557263.1_Missense_Mutation_p.G233V|GPATCH2L_ENST00000312858.5_Missense_Mutation_p.G233V	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	233								p.G233V(2)									AGTGACACTGGGCTCTTTACC	0.428																																							uc001xsh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(697-699)GGG>GTG		hypothetical protein LOC55668 isoform 1							141.0	122.0	128.0					14																	76633041		2203	4300	6503	SO:0001583	missense	55668							g.chr14:76633041G>T	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.698G>T	14.37:g.76633041G>T	ENSP00000261530:p.Gly233Val		Somatic				C14orf118_uc001xsi.2_Missense_Mutation_p.G233V|C14orf118_uc001xsj.1_Missense_Mutation_p.G233V|C14orf118_uc001xsk.1_Missense_Mutation_p.G233V|C14orf118_uc001xsl.2_RNA	p.G233V	NM_017926	NP_060396	WXS	Illumina HiSeq	Unspecified	Q9NWQ4	CN118_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0172)	3	784	+			233					B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Missense_Mutation	SNP	ENST00000261530.7	37	c.698G>T	CCDS9848.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438283	0.83885	.	.	ENSG00000089916	ENST00000336993;ENST00000557263;ENST00000312858;ENST00000261530;ENST00000556663	T;T;T;T	0.64991	0.77;-0.08;-0.13;0.77	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	T	0.77961	0.4209	M	0.66297	2.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.80580	-0.1319	10	0.87932	D	0	-29.3332	16.7426	0.85463	0.0:0.0:1.0:0.0	.	233;233;233	Q9NWQ4-1;Q9NWQ4-4;Q9NWQ4	.;.;CN118_HUMAN	V	233	ENSP00000451587:G233V;ENSP00000323775:G233V;ENSP00000261530:G233V;ENSP00000450657:G233V	ENSP00000261530:G233V	G	+	2	0	C14orf118	75702794	1.000000	0.71417	0.976000	0.42696	0.942000	0.58702	7.455000	0.80726	2.363000	0.80096	0.591000	0.81541	GGG		0.428	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926		6	43	1	0	0.00116845	0.001168	0.00128189	6	43				
GALC	2581	broad.mit.edu	37	14	88431915	88431915	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:88431915C>G	ENST00000261304.2	-	9	1073	c.967G>C	c.(967-969)Ggg>Cgg	p.G323R	GALC_ENST00000393568.4_Missense_Mutation_p.G300R|GALC_ENST00000393569.2_Missense_Mutation_p.G297R|GALC_ENST00000544807.2_Missense_Mutation_p.G267R	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	323			G -> R (in GLD). {ECO:0000269|PubMed:20886637}.		carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)	p.G323W(1)|p.G323R(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTCATCAACCCGCATCTCCCA	0.448																																							uc001xvt.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(967-969)GGG>CGG		galactosylceramidase isoform a precursor							77.0	84.0	82.0					14																	88431915		1925	4133	6058	SO:0001583	missense	2581				carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity	g.chr14:88431915C>G	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.967G>C	14.37:g.88431915C>G	ENSP00000261304:p.Gly323Arg		Somatic				GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Missense_Mutation_p.G297R|GALC_uc010tvy.1_Missense_Mutation_p.G300R|GALC_uc010tvz.1_Missense_Mutation_p.G267R|GALC_uc001xvu.1_Missense_Mutation_p.G323R	p.G323R	NM_000153	NP_000144	WXS	Illumina HiSeq	Unspecified	P54803	GALC_HUMAN			9	1366	-			323		G -> R (in GLD).			B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Missense_Mutation	SNP	ENST00000261304.2	37	c.967G>C	CCDS9878.2	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709756	0.68730	.	.	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000539620;ENST00000393568;ENST00000445021	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79	6.07	5.19	0.71726	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.045148	0.85682	D	0.000000	D	0.98080	0.9367	M	0.91300	3.195	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;1.0	D	0.98988	1.0807	10	0.87932	D	0	-11.8685	14.5036	0.67739	0.0:0.9287:0.0:0.0713	.	267;300;297;323;323	P54803-5;E7EPA4;P54803-4;G3XAI6;P54803	.;.;.;.;GALC_HUMAN	R	323;267;297;112;300;323	ENSP00000261304:G323R;ENSP00000437513:G267R;ENSP00000377199:G297R;ENSP00000377198:G300R	ENSP00000261304:G323R	G	-	1	0	GALC	87501668	1.000000	0.71417	0.221000	0.23827	0.435000	0.31806	7.488000	0.81441	1.580000	0.49851	-0.150000	0.13652	GGG		0.448	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2			20	54	0	0	0	0.008871	0	20	54				
AHNAK2	113146	broad.mit.edu	37	14	105413167	105413167	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:105413167G>T	ENST00000333244.5	-	7	8740	c.8621C>A	c.(8620-8622)gCt>gAt	p.A2874D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2874						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A2874D(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACCTGGCCAGCCTGGACCTC	0.627																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(8620-8622)GCT>GAT		AHNAK nucleoprotein 2							116.0	129.0	125.0					14																	105413167		1914	4120	6034	SO:0001583	missense	113146					nucleus		g.chr14:105413167G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8621C>A	14.37:g.105413167G>T	ENSP00000353114:p.Ala2874Asp		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.A2774D	p.A2874D	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	8741	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2874					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.8621C>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	14.05	2.419781	0.42918	.	.	ENSG00000185567	ENST00000333244	T	0.00949	5.51	2.82	-4.44	0.03557	.	.	.	.	.	T	0.01387	0.0045	M	0.88450	2.955	0.09310	N	1	B	0.26845	0.161	B	0.23574	0.047	T	0.46414	-0.9193	9	0.15499	T	0.54	.	1.8317	0.03132	0.1122:0.2567:0.3428:0.2882	.	2874	Q8IVF2	AHNK2_HUMAN	D	2874	ENSP00000353114:A2874D	ENSP00000353114:A2874D	A	-	2	0	AHNAK2	104484212	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.204000	0.09425	-0.736000	0.04831	0.306000	0.20318	GCT		0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		63	303	1	0	4.17052e-40	0.01441	7.64219e-40	63	303				
AHNAK2	113146	broad.mit.edu	37	14	105420366	105420366	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:105420366G>T	ENST00000333244.5	-	7	1541	c.1422C>A	c.(1420-1422)ggC>ggA	p.G474G	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	474						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.G474G(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAATCTGTGTGCCTCCTTCGG	0.522																																							uc010axc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1420-1422)GGC>GGA		AHNAK nucleoprotein 2							53.0	57.0	56.0					14																	105420366		2003	4177	6180	SO:0001819	synonymous_variant	113146					nucleus		g.chr14:105420366G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1422C>A	14.37:g.105420366G>T			Somatic				AHNAK2_uc001ypx.2_Silent_p.G374G	p.G474G	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	1542	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	474					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	c.1422C>A	CCDS45177.1																																																																																				0.522	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		27	55	1	0	2.61193e-14	0.009535	4.00654e-14	27	55				
AHNAK2	113146	broad.mit.edu	37	14	105420648	105420648	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:105420648C>A	ENST00000333244.5	-	7	1259	c.1140G>T	c.(1138-1140)agG>agT	p.R380S	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	380						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.R380S(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTGTTCTGCCCTCTCCTCTC	0.632																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1138-1140)AGG>AGT		AHNAK nucleoprotein 2							79.0	85.0	83.0					14																	105420648		2058	4203	6261	SO:0001583	missense	113146					nucleus		g.chr14:105420648C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1140G>T	14.37:g.105420648C>A	ENSP00000353114:p.Arg380Ser		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.R280S	p.R380S	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	1260	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	380					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.1140G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	11.27	1.587934	0.28268	.	.	ENSG00000185567	ENST00000333244	T	0.03772	3.81	4.03	-0.0558	0.13808	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.20164	0.042	B	0.14023	0.01	T	0.49041	-0.8980	9	0.09084	T	0.74	.	6.0738	0.19903	0.0:0.545:0.2881:0.1669	.	380	Q8IVF2	AHNK2_HUMAN	S	380	ENSP00000353114:R380S	ENSP00000353114:R380S	R	-	3	2	AHNAK2	104491693	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.118000	0.10692	-0.109000	0.12044	-0.769000	0.03391	AGG		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		30	86	1	0	1.06801e-11	0.009535	1.50857e-11	30	86				
TMEM121	80757	broad.mit.edu	37	14	105995420	105995420	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr14:105995420C>T	ENST00000392519.2	+	2	413	c.249C>T	c.(247-249)atC>atT	p.I83I	TMEM121_ENST00000431372.1_Silent_p.I83I	NM_025268.2	NP_079544.1	Q9BTD3	TM121_HUMAN	transmembrane protein 121	83						integral component of membrane (GO:0016021)		p.I83I(1)		endometrium(2)|lung(1)	3		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.0959)|all cancers(159;0.235)		TCCTTTACATCTTCGTGCTGG	0.662																																							uc001yrp.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(247-249)ATC>ATT		hole protein							84.0	83.0	84.0					14																	105995420		2203	4299	6502	SO:0001819	synonymous_variant	80757					integral to membrane		g.chr14:105995420C>T		CCDS10006.1	14q32.33	2006-02-16			ENSG00000184986	ENSG00000184986			20511	protein-coding gene	gene with protein product						12204283	Standard	NM_025268		Approved	MGC4659, hole	uc001yrp.1	Q9BTD3	OTTHUMG00000029912	ENST00000392519.2:c.249C>T	14.37:g.105995420C>T			Somatic				ADAM6_uc010tyt.1_Intron|uc001yrr.2_5'Flank	p.I83I	NM_025268	NP_079544	WXS	Illumina HiSeq	Unspecified	Q9BTD3	TM121_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.0959)|all cancers(159;0.235)	2	400	+		Melanoma(154;0.226)	83			Helical; (Potential).			Silent	SNP	ENST00000392519.2	37	c.249C>T	CCDS10006.1																																																																																				0.662	TMEM121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074621.2	NM_025268		4	17	0	0	0	0.000602	0	4	17				
NBEAP1	606	broad.mit.edu	37	15	20874950	20874950	+	RNA	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:20874950T>C	ENST00000556948.1	-	0	298							P0C6P0	BCL8_HUMAN	neurobeachin pseudogene 1																		CAAATATGTATATAGGGAAAG	0.279																																							uc010tze.1		NA																	0					0						c.(187-189)TAT>TGT		RecName: Full=Putative protein BCL8;																																						606							g.chr15:20874950T>C			15q11.2	2014-03-20	2011-05-03	2011-05-03	ENSG00000258590	ENSG00000258590			1007	pseudogene	pseudogene		601889	"""B-cell CLL/lymphoma 8"""	BCL8		9159141	Standard	NR_027992		Approved	BCL8A	uc010tze.1	P0C6P0	OTTHUMG00000171717		15.37:g.20874950T>C			Somatic				BCL8_uc010tzd.1_RNA	p.Y63C	NR_027992		WXS	Illumina HiSeq	Unspecified					3	395	-									Missense_Mutation	SNP	ENST00000556948.1	37	c.188A>G																																																																																					0.279	NBEAP1-002	KNOWN	not_best_in_genome_evidence|basic	retained_intron	pseudogene	OTTHUMT00000414853.1	NR_027992		10	45	0	0	0	0.006214	0	10	45				
NPAP1	23742	broad.mit.edu	37	15	24921596	24921596	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:24921596C>A	ENST00000329468.2	+	1	1056	c.582C>A	c.(580-582)acC>acA	p.T194T		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	194					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T194T(1)									CCCAGGGCACCCAGGGAGACG	0.582																																							uc001ywo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(580-582)ACC>ACA		hypothetical protein LOC23742							44.0	38.0	40.0					15																	24921596		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921596C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.582C>A	15.37:g.24921596C>A			Somatic					p.T194T	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	1056	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	194						Silent	SNP	ENST00000329468.2	37	c.582C>A	CCDS10015.1																																																																																				0.582	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		8	16	1	0	0.00307968	0.00308	0.00334084	8	16				
RYR3	6263	broad.mit.edu	37	15	33822838	33822838	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:33822838G>C	ENST00000389232.4	+	4	395	c.325G>C	c.(325-327)Gtt>Ctt	p.V109L	RYR3_ENST00000415757.3_Missense_Mutation_p.V109L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	109	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V109L(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGGCCATGCAGTTCTCCTGAG	0.527																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(325-327)GTT>CTT		ryanodine receptor 3							70.0	67.0	68.0					15																	33822838		1968	4155	6123	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33822838G>C		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.325G>C	15.37:g.33822838G>C	ENSP00000373884:p.Val109Leu		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.V109L	p.V109L	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	4	395	+		all_lung(180;7.18e-09)	109			Cytoplasmic (By similarity).|MIR 1.		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.325G>C	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704628	0.48412	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91237	-2.81;-2.81	5.76	2.0	0.26442	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.118143	0.56097	D	0.000037	D	0.83220	0.5207	L	0.36672	1.1	0.28096	N	0.931608	B;B	0.12013	0.005;0.002	B;B	0.12837	0.007;0.008	T	0.74665	-0.3589	10	0.62326	D	0.03	.	6.2055	0.20600	0.7176:0.1354:0.147:0.0	.	109;109	Q15413-2;Q15413	.;RYR3_HUMAN	L	109	ENSP00000373884:V109L;ENSP00000399610:V109L	ENSP00000354735:V109L	V	+	1	0	RYR3	31610130	0.999000	0.42202	0.553000	0.28255	0.933000	0.57130	3.363000	0.52321	0.454000	0.26884	-0.238000	0.12139	GTT		0.527	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			7	18	0	0	0	0.004482	0	7	18				
KNSTRN	90417	broad.mit.edu	37	15	40675518	40675518	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:40675518C>T	ENST00000249776.8	+	2	414	c.299C>T	c.(298-300)cCg>cTg	p.P100L	KNSTRN_ENST00000448395.2_Missense_Mutation_p.P100L|KNSTRN_ENST00000416151.2_Missense_Mutation_p.P100L|KNSTRN_ENST00000608100.1_Missense_Mutation_p.P22L	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein									p.P100L(1)									GGCGGCCAGCCGGCAGGTGAG	0.682																																							uc001zll.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(298-300)CCG>CTG		TRAF4 associated factor 1 isoform a							23.0	27.0	25.0					15																	40675518		1918	4105	6023	SO:0001583	missense	90417					nucleus	protein binding	g.chr15:40675518C>T	AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.299C>T	15.37:g.40675518C>T	ENSP00000249776:p.Pro100Leu		Somatic				C15orf23_uc010ucp.1_Missense_Mutation_p.P100L|C15orf23_uc001zlo.2_Missense_Mutation_p.P100L|C15orf23_uc001zlm.2_RNA|C15orf23_uc001zln.2_RNA	p.P100L	NM_033286	NP_150628	WXS	Illumina HiSeq	Unspecified	Q9Y448	T4AF1_HUMAN		GBM - Glioblastoma multiforme(113;3.39e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0798)	2	414	+		all_cancers(109;2.34e-14)|all_epithelial(112;9.21e-12)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)	100						Missense_Mutation	SNP	ENST00000249776.8	37	c.299C>T	CCDS42021.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.263444	0.39995	.	.	ENSG00000128944	ENST00000249776;ENST00000416151;ENST00000448395	T;T;T	0.25912	1.77;1.77;1.77	4.76	2.87	0.33458	.	0.529047	0.18734	N	0.132651	T	0.16514	0.0397	L	0.29908	0.895	0.09310	N	0.999999	B;B;B	0.27971	0.196;0.054;0.196	B;B;B	0.20184	0.011;0.007;0.028	T	0.16928	-1.0386	10	0.72032	D	0.01	0.0985	7.3737	0.26817	0.0:0.8:0.0:0.2	.	100;100;100	Q9Y448-2;Q9Y448-3;Q9Y448	.;.;T4AF1_HUMAN	L	100	ENSP00000249776:P100L;ENSP00000391233:P100L;ENSP00000393001:P100L	ENSP00000249776:P100L	P	+	2	0	C15orf23	38462810	0.001000	0.12720	0.048000	0.18961	0.024000	0.10985	0.713000	0.25794	0.720000	0.32209	0.462000	0.41574	CCG		0.682	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761		7	10	0	0	0	0.00308	0	7	10				
TYRO3	7301	broad.mit.edu	37	15	41864678	41864678	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:41864678C>T	ENST00000263798.3	+	15	2015	c.1791C>T	c.(1789-1791)ccC>ccT	p.P597P	TYRO3_ENST00000559066.1_Silent_p.P552P	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	597	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P589P(2)|p.P597P(2)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCCGTCTCCCCATCCCCATGG	0.597																																							uc001zof.1		NA																	4	Substitution - coding silent(4)		lung(2)|endometrium(2)	ovary(3)|lung(2)|central_nervous_system(1)	6						c.(1789-1791)CCC>CCT		TYRO3 protein tyrosine kinase precursor							109.0	97.0	101.0					15																	41864678		2203	4300	6503	SO:0001819	synonymous_variant	7301					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr15:41864678C>T	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1791C>T	15.37:g.41864678C>T			Somatic					p.P597P	NM_006293	NP_006284	WXS	Illumina HiSeq	Unspecified	Q06418	TYRO3_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)	15	2015	+		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)	597			Protein kinase.|Cytoplasmic (Potential).		O14953|Q86VR3	Silent	SNP	ENST00000263798.3	37	c.1791C>T	CCDS10080.1																																																																																				0.597	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2			8	62	0	0	0	0.00308	0	8	62				
PLA2G4D	283748	broad.mit.edu	37	15	42379517	42379517	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:42379517A>C	ENST00000290472.3	-	3	330	c.236T>G	c.(235-237)cTt>cGt	p.L79R		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	79	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.L79R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		ACTTTGGATAAGGAAACGGAA	0.562																																							uc001zox.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(235-237)CTT>CGT		phospholipase A2, group IVD							201.0	184.0	190.0					15																	42379517		2203	4299	6502	SO:0001583	missense	283748				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity	g.chr15:42379517A>C	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.236T>G	15.37:g.42379517A>C	ENSP00000290472:p.Leu79Arg		Somatic					p.L79R	NM_178034	NP_828848	WXS	Illumina HiSeq	Unspecified	Q86XP0	PA24D_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)	3	331	-		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)	79			C2.		Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	c.236T>G	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	A	1.158	-0.644581	0.03531	.	.	ENSG00000159337	ENST00000290472	T	0.68479	-0.33	5.21	3.01	0.34805	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.590712	0.14181	N	0.336048	T	0.35480	0.0933	N	0.04387	-0.21	0.33038	D	0.531118	B	0.02656	0.0	B	0.15052	0.012	T	0.41034	-0.9531	10	0.02654	T	1	-5.8996	6.3081	0.21149	0.6581:0.2145:0.0:0.1274	.	79	Q86XP0	PA24D_HUMAN	R	79	ENSP00000290472:L79R	ENSP00000290472:L79R	L	-	2	0	PLA2G4D	40166809	0.670000	0.27512	0.979000	0.43373	0.119000	0.20118	0.208000	0.17415	0.977000	0.38444	0.533000	0.62120	CTT		0.562	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034		3	114	0	0	0	0.004672	0	3	114				
PRTG	283659	broad.mit.edu	37	15	55916678	55916678	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:55916678C>G	ENST00000389286.4	-	18	3002	c.2955G>C	c.(2953-2955)caG>caC	p.Q985H		NM_173814.4	NP_776175.2			protogenin									p.Q985H(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GAGTTCCATTCTGTGCCGTCT	0.433																																							uc002adg.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(2953-2955)CAG>CAC		protogenin precursor							104.0	94.0	97.0					15																	55916678		1881	4110	5991	SO:0001583	missense	283659				multicellular organismal development	integral to membrane		g.chr15:55916678C>G	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.2955G>C	15.37:g.55916678C>G	ENSP00000373937:p.Gln985His		Somatic					p.Q985H	NM_173814	NP_776175	WXS	Illumina HiSeq	Unspecified	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	18	3003	-			985						Missense_Mutation	SNP	ENST00000389286.4	37	c.2955G>C	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297165	0.60086	.	.	ENSG00000166450	ENST00000389286	T	0.54279	0.58	5.83	4.9	0.64082	.	0.149392	0.50627	D	0.000116	T	0.56366	0.1980	L	0.57536	1.79	0.80722	D	1	D	0.57899	0.981	P	0.48840	0.592	T	0.57516	-0.7798	10	0.45353	T	0.12	-14.9678	14.4426	0.67327	0.0:0.9279:0.0:0.0721	.	985	Q2VWP7	PRTG_HUMAN	H	985	ENSP00000373937:Q985H	ENSP00000373937:Q985H	Q	-	3	2	PRTG	53703970	1.000000	0.71417	0.995000	0.50966	0.563000	0.35712	1.674000	0.37544	2.759000	0.94783	0.650000	0.86243	CAG		0.433	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		7	33	0	0	0	0.00308	0	7	33				
PRTG	283659	broad.mit.edu	37	15	55964743	55964743	+	Silent	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:55964743A>T	ENST00000389286.4	-	11	1988	c.1941T>A	c.(1939-1941)gcT>gcA	p.A647A		NM_173814.4	NP_776175.2			protogenin									p.A647A(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGCCCTGAATAGCAGCTGTGT	0.488																																							uc002adg.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1939-1941)GCT>GCA		protogenin precursor							112.0	111.0	111.0					15																	55964743		1943	4129	6072	SO:0001819	synonymous_variant	283659				multicellular organismal development	integral to membrane		g.chr15:55964743A>T	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1941T>A	15.37:g.55964743A>T			Somatic				PRTG_uc002adh.2_Silent_p.A149A	p.A647A	NM_173814	NP_776175	WXS	Illumina HiSeq	Unspecified	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	11	1989	-			647			Fibronectin type-III 3.			Silent	SNP	ENST00000389286.4	37	c.1941T>A	CCDS42040.1																																																																																				0.488	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		31	38	0	0	0	0.008361	0	31	38				
RP11-24M17.5	0	broad.mit.edu	37	15	76074505	76074505	+	RNA	SNP	G	G	T	rs563249416		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:76074505G>T	ENST00000395215.3	+	0	684				RN7SL319P_ENST00000480656.2_RNA														p.V215L(1)									GAACGCACACGTGACACAGGT	0.577																																							uc010umm.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(607-609)GTG>TTG		SubName: Full=cDNA FLJ59077, highly similar to Golgin subfamily A member 6;																																						0							g.chr15:76074505G>T																													15.37:g.76074505G>T			Somatic				uc002bba.1_5'Flank	p.V203L			WXS	Illumina HiSeq	Unspecified					8	684	+									Missense_Mutation	SNP	ENST00000395215.3	37	c.607G>T		.	.	.	.	.	.	.	.	.	.	.	3.020	-0.202022	0.06219	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	0.789	0.18607	.	.	.	.	.	T	0.15435	0.0372	.	.	.	.	.	.	B	0.12630	0.006	B	0.16722	0.016	T	0.36648	-0.9739	6	0.05833	T	0.94	.	3.9805	0.09493	0.0:0.0:0.588:0.4119	.	215	B4DZE6	.	L	215	.	ENSP00000378641:V215L	V	+	1	0	AC019294.2	73861560	0.004000	0.15560	0.003000	0.11579	0.007000	0.05969	0.313000	0.19415	0.745000	0.32763	0.274000	0.19336	GTG		0.577	RP11-24M17.5-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000420501.1			9	18	1	0	1.12685e-05	0.004482	1.32181e-05	9	18				
ZNF774	342132	broad.mit.edu	37	15	90903397	90903397	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr15:90903397G>T	ENST00000354377.3	+	4	520	c.334G>T	c.(334-336)Gag>Tag	p.E112*	ZNF774_ENST00000379090.5_Intron|ZNF774_ENST00000558115.1_3'UTR	NM_001004309.2	NP_001004309.2	Q6NX45	ZN774_HUMAN	zinc finger protein 774	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E112*(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|stomach(1)	14	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AGGAAACTGGGAGCAAGGCCT	0.473																																							uc002bpk.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(334-336)GAG>TAG		zinc finger protein 774							54.0	53.0	53.0					15																	90903397		2199	4298	6497	SO:0001587	stop_gained	342132				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:90903397G>T	BC067279	CCDS32330.1	15q26.1	2013-01-08				ENSG00000196391		"""Zinc fingers, C2H2-type"""	33108	protein-coding gene	gene with protein product							Standard	NM_001004309		Approved	MGC75360	uc002bpk.4	Q6NX45		ENST00000354377.3:c.334G>T	15.37:g.90903397G>T	ENSP00000346348:p.Glu112*		Somatic					p.E112*	NM_001004309	NP_001004309	WXS	Illumina HiSeq	Unspecified	Q6NX45	ZN774_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)		4	520	+	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		112					A8K020	Nonsense_Mutation	SNP	ENST00000354377.3	37	c.334G>T	CCDS32330.1	.	.	.	.	.	.	.	.	.	.	G	9.991	1.230765	0.22542	.	.	ENSG00000196391	ENST00000354377	.	.	.	5.51	0.283	0.15696	.	0.446120	0.16205	N	0.224766	.	.	.	.	.	.	0.29480	N	0.856431	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	1.471	0.02416	0.3079:0.1336:0.4215:0.137	.	.	.	.	X	112	.	ENSP00000346348:E112X	E	+	1	0	ZNF774	88704401	0.000000	0.05858	0.145000	0.22337	0.078000	0.17371	0.085000	0.14912	-0.193000	0.10415	0.655000	0.94253	GAG		0.473	ZNF774-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418048.1	NM_001004309		16	25	1	0	2.23348e-06	0.004007	2.70895e-06	16	25				
PRR35	146325	broad.mit.edu	37	16	613968	613968	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:613968C>A	ENST00000409413.3	+	2	953	c.674C>A	c.(673-675)cCc>cAc	p.P225H		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		225	Pro-rich.							p.P225H(1)		central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						TACTTGGGGCCCTCACTGGCC	0.731																																							uc002chk.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(673-675)CCC>CAC		hypothetical protein LOC146325							12.0	14.0	14.0					16																	613968		1907	4096	6003	SO:0001583	missense	146325							g.chr16:613968C>A																												ENST00000409413.3:c.674C>A	16.37:g.613968C>A	ENSP00000386499:p.Pro225His		Somatic					p.P225H	NM_145270	NP_660313	WXS	Illumina HiSeq	Unspecified	P0CG20	CP011_HUMAN			2	953	+			225			Pro-rich.		B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	37	c.674C>A	CCDS45365.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851133	0.51270	.	.	ENSG00000161992	ENST00000409413	T	0.09350	2.99	5.06	5.06	0.68205	.	0.000000	0.53938	D	0.000059	T	0.32526	0.0832	M	0.68952	2.095	0.36400	D	0.863053	D	0.89917	1.0	D	0.73380	0.98	T	0.33574	-0.9863	10	0.87932	D	0	.	17.4186	0.87508	0.0:1.0:0.0:0.0	.	225	P0CG20	CP011_HUMAN	H	225	ENSP00000386499:P225H	ENSP00000386499:P225H	P	+	2	0	C16orf11	553969	0.736000	0.28164	1.000000	0.80357	0.857000	0.48899	3.707000	0.54838	2.364000	0.80123	0.563000	0.77884	CCC		0.731	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1			3	3	1	0	0.004672	0.004672	0.00501999	3	3				
RBFOX1	54715	broad.mit.edu	37	16	7760649	7760649	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:7760649G>A	ENST00000550418.1	+	16	2084	c.1096G>A	c.(1096-1098)Gcc>Acc	p.A366T	RBFOX1_ENST00000311745.5_Missense_Mutation_p.A387T|RBFOX1_ENST00000547372.1_3'UTR|RBFOX1_ENST00000436368.2_Intron|RBFOX1_ENST00000553186.1_Missense_Mutation_p.A339T|RBFOX1_ENST00000547338.1_Missense_Mutation_p.A366T|RBFOX1_ENST00000340209.4_Missense_Mutation_p.A371T|RBFOX1_ENST00000355637.4_3'UTR|RBFOX1_ENST00000552089.1_3'UTR	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	366					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.A366T(1)|p.A387T(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TTTGACTGATGCCAAGACTAG	0.408																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1096-1098)GCC>ACC		ataxin 2-binding protein 1 isoform 4							229.0	202.0	211.0					16																	7760649		2197	4300	6497	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7760649G>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1096G>A	16.37:g.7760649G>A	ENSP00000450031:p.Ala366Thr		Somatic				A2BP1_uc002cyt.2_Missense_Mutation_p.A339T|A2BP1_uc010uyb.1_Missense_Mutation_p.A366T|A2BP1_uc002cyw.2_3'UTR|A2BP1_uc002cyy.2_Missense_Mutation_p.A387T|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Missense_Mutation_p.A360T	p.A366T	NM_018723	NP_061193	WXS	Illumina HiSeq	Unspecified	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	16	2084	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	366					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.1096G>A	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792959	0.31685	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547338;ENST00000311745;ENST00000352951;ENST00000340209	T;T;T;T;T	0.30981	1.51;1.8;1.51;1.85;1.51	5.95	5.95	0.96441	.	0.052184	0.85682	D	0.000000	T	0.31734	0.0806	N	0.08118	0	0.58432	D	0.999998	D;D;B;B	0.61697	0.99;0.99;0.358;0.41	P;P;B;B	0.57911	0.829;0.829;0.106;0.071	T	0.12811	-1.0533	10	0.16896	T	0.51	-12.1122	20.3923	0.98948	0.0:0.0:1.0:0.0	.	360;387;339;366	F8WAC5;Q9NWB1-2;Q9NWB1-3;Q9NWB1	.;.;.;RFOX1_HUMAN	T	366;339;366;387;360;371	ENSP00000450031:A366T;ENSP00000447753:A339T;ENSP00000447717:A366T;ENSP00000309117:A387T;ENSP00000344196:A371T	ENSP00000309117:A387T	A	+	1	0	RBFOX1	7700650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.455000	0.90355	2.831000	0.97527	0.609000	0.83330	GCC		0.408	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		44	61	0	0	0	0.011902	0	44	61				
OTOA	146183	broad.mit.edu	37	16	21739679	21739679	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:21739679G>T	ENST00000286149.4	+	19	2177	c.2176G>T	c.(2176-2178)Ggc>Tgc	p.G726C	OTOA_ENST00000388956.4_Missense_Mutation_p.G633C|OTOA_ENST00000388957.3_Missense_Mutation_p.G388C|OTOA_ENST00000388958.3_Missense_Mutation_p.G712C			Q7RTW8	OTOAN_HUMAN	otoancorin	726					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.G712S(1)|p.G712C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TGCTCTACACGGCCTCAGAGA	0.597																																							uc002djh.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2134-2136)GGC>TGC		otoancorin isoform 1							76.0	68.0	71.0					16																	21739679		2198	4300	6498	SO:0001583	missense	146183				sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix		g.chr16:21739679G>T	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2176G>T	16.37:g.21739679G>T	ENSP00000286149:p.Gly726Cys		Somatic				uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.G633C|OTOA_uc002dji.2_Missense_Mutation_p.G388C|OTOA_uc010vbk.1_Missense_Mutation_p.G360C	p.G712C	NM_144672	NP_653273	WXS	Illumina HiSeq	Unspecified	Q7RTW8	OTOAN_HUMAN		GBM - Glioblastoma multiforme(48;0.0414)	19	2135	+			726					A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37	c.2134G>T		.	.	.	.	.	.	.	.	.	.	G	11.32	1.603550	0.28534	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957;ENST00000338456	T;T;T;T	0.64085	-0.08;-0.07;-0.07;-0.07	5.29	-6.43	0.01926	.	0.930648	0.09084	N	0.850899	T	0.63153	0.2487	L	0.47716	1.5	0.09310	N	0.999999	D;D;D;D	0.76494	0.997;0.999;0.996;0.997	P;D;P;P	0.63597	0.881;0.916;0.864;0.881	T	0.60398	-0.7271	10	0.62326	D	0.03	-0.359	6.2874	0.21041	0.4369:0.3649:0.1981:0.0	.	726;633;388;712	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	C	712;726;633;388;121	ENSP00000373610:G712C;ENSP00000286149:G726C;ENSP00000373608:G633C;ENSP00000373609:G388C	ENSP00000286149:G726C	G	+	1	0	OTOA	21647180	0.000000	0.05858	0.008000	0.14137	0.080000	0.17528	-0.195000	0.09546	-0.661000	0.05345	-0.150000	0.13652	GGC		0.597	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			13	17	1	0	2.31682e-05	0.003163	2.68056e-05	13	17				
SALL1	6299	broad.mit.edu	37	16	51176050	51176050	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:51176050G>T	ENST00000251020.4	-	2	116	c.83C>A	c.(82-84)aCa>aAa	p.T28K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_5'UTR|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	28					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T28K(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ACCCTTTTCTGTGTCTCCTAC	0.463																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(82-84)ACA>AAA		sal-like 1 isoform a							75.0	77.0	76.0					16																	51176050		2196	4294	6490	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51176050G>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.83C>A	16.37:g.51176050G>T	ENSP00000251020:p.Thr28Lys		Somatic				SALL1_uc010vgr.1_5'UTR|SALL1_uc010cbv.2_Intron	p.T28K	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	114	-		all_cancers(37;0.0322)	28					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.83C>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.246007	0.01481	.	.	ENSG00000103449	ENST00000251020;ENST00000457559	T	0.06218	3.33	5.6	0.929	0.19449	.	0.367420	0.32868	N	0.005542	T	0.04998	0.0134	L	0.40543	1.245	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.34477	-0.9827	10	0.07482	T	0.82	.	11.6234	0.51132	0.2827:0.0:0.7173:0.0	.	28	Q9NSC2	SALL1_HUMAN	K	28	ENSP00000251020:T28K	ENSP00000251020:T28K	T	-	2	0	SALL1	49733551	1.000000	0.71417	0.236000	0.24074	0.592000	0.36648	3.519000	0.53458	0.318000	0.23185	-0.157000	0.13467	ACA		0.463	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		40	94	1	0	6.45866e-13	0.00874	9.5195e-13	40	94				
RPGRIP1L	23322	broad.mit.edu	37	16	53672256	53672256	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:53672256T>G	ENST00000379925.3	-	20	3076	c.3026A>C	c.(3025-3027)gAa>gCa	p.E1009A	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.E1009A|RPGRIP1L_ENST00000568009.1_5'UTR|RPGRIP1L_ENST00000563746.1_Intron|RPGRIP1L_ENST00000262135.4_Intron	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	1009					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.E1009A(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CATATTAATTTCTATTTCTGG	0.338																																							uc002ehp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3025-3027)GAA>GCA		RPGRIP1-like isoform a							115.0	114.0	114.0					16																	53672256		2198	4298	6496	SO:0001583	missense	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53672256T>G		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.3026A>C	16.37:g.53672256T>G	ENSP00000369257:p.Glu1009Ala		Somatic				RPGRIP1L_uc002eho.3_Intron|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.E1009A|RPGRIP1L_uc010cbx.2_Intron|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.E1009A	p.E1009A	NM_015272	NP_056087	WXS	Illumina HiSeq	Unspecified	Q68CZ1	FTM_HUMAN			20	3090	-		all_cancers(37;0.0973)	1009					A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	c.3026A>C	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	T	7.664	0.685540	0.14973	.	.	ENSG00000103494	ENST00000379925	T	0.74315	-0.83	4.82	4.82	0.62117	.	0.566073	0.17994	N	0.155102	T	0.54127	0.1839	N	0.08118	0	0.80722	D	1	B;B;B	0.20887	0.049;0.013;0.049	B;B;B	0.19666	0.016;0.006;0.026	T	0.50659	-0.8802	10	0.22706	T	0.39	-5.0655	12.0821	0.53677	0.0:0.0:0.0:1.0	.	1009;1009;1009	B4E3M8;B7ZKJ9;Q68CZ1	.;.;FTM_HUMAN	A	1009	ENSP00000369257:E1009A	ENSP00000369257:E1009A	E	-	2	0	RPGRIP1L	52229757	0.810000	0.29049	0.130000	0.21974	0.146000	0.21551	2.474000	0.45154	1.947000	0.56498	0.528000	0.53228	GAA		0.338	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		7	51	0	0	0	0.001984	0	7	51				
GNAO1	2775	broad.mit.edu	37	16	56377844	56377844	+	Intron	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:56377844G>T	ENST00000262493.6	+	6	1569				GNAO1_ENST00000262494.7_Silent_p.R349R	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.R349R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				AAAACCTGCGGGGCTGTGGAC	0.622																																							uc002eit.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|breast(1)	2						c.(1045-1047)CGG>CGT		guanine nucleotide binding protein, alpha							110.0	83.0	92.0					16																	56377844		2198	4300	6498	SO:0001627	intron_variant	2775				dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity	g.chr16:56377844G>T		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.723+7072G>T	16.37:g.56377844G>T			Somatic				GNAO1_uc002eiu.3_Intron	p.R349R	NM_138736	NP_620073	WXS	Illumina HiSeq	Unspecified	P09471	GNAO_HUMAN			8	1944	+		all_neural(199;0.159)	349					P29777|Q8TD72|Q9UMV4	Silent	SNP	ENST00000262493.6	37	c.1047G>T	CCDS10756.1																																																																																				0.622	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988		18	33	1	0	5.26018e-13	0.012319	7.7869e-13	18	33				
AMFR	267	broad.mit.edu	37	16	56438863	56438863	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:56438863G>A	ENST00000290649.5	-	6	1008	c.798C>T	c.(796-798)ctC>ctT	p.L266L		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	266					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L266L(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						ACAGGAGAGTGAGCTCCATGA	0.478																																					Pancreas(2;144 323 39528)	Pancreas(2;144 323 39528)	uc002eiy.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(796-798)CTC>CTT		autocrine motility factor receptor							191.0	149.0	163.0					16																	56438863		2198	4300	6498	SO:0001819	synonymous_variant	267				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:56438863G>A	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.798C>T	16.37:g.56438863G>A			Somatic				AMFR_uc002eix.2_5'Flank	p.L266L	NM_001144	NP_001135	WXS	Illumina HiSeq	Unspecified	Q9UKV5	AMFR2_HUMAN			6	1003	-			266					P26442|Q8IZ70	Silent	SNP	ENST00000290649.5	37	c.798C>T	CCDS10758.1																																																																																				0.478	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2			7	37	0	0	0	0.001984	0	7	37				
PMFBP1	83449	broad.mit.edu	37	16	72163128	72163128	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:72163128C>A	ENST00000237353.10	-	13	2048	c.1787G>T	c.(1786-1788)aGg>aTg	p.R596M	PMFBP1_ENST00000537465.1_Missense_Mutation_p.R601M|PMFBP1_ENST00000355636.6_Missense_Mutation_p.R451M	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	601						cytoplasm (GO:0005737)		p.R596M(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				GCCTTGCTCCCTGTGCTGAAA	0.433																																							uc002fcc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1801-1803)AGG>ATG		polyamine modulated factor 1 binding protein 1							170.0	176.0	174.0					16																	72163128		2198	4300	6498	SO:0001583	missense	83449							g.chr16:72163128C>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1787G>T	16.37:g.72163128C>A	ENSP00000237353:p.Arg596Met		Somatic				PMFBP1_uc002fcd.2_Missense_Mutation_p.R596M|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Missense_Mutation_p.R451M|PMFBP1_uc010cgo.1_5'Flank	p.R601M	NM_031293	NP_112583	WXS	Illumina HiSeq	Unspecified	Q8TBY8	PMFBP_HUMAN			13	1974	-		Ovarian(137;0.179)	601			Potential.		B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	c.1802G>T	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684941	0.47991	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.13196	2.61;2.62;2.61	4.31	2.07	0.26955	.	0.382752	0.22695	N	0.056780	T	0.17789	0.0427	L	0.34521	1.04	0.09310	N	1	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.60415	0.847;0.874;0.847	T	0.03773	-1.1005	10	0.72032	D	0.01	-14.5575	5.308	0.15815	0.0:0.6745:0.0:0.3255	.	601;596;601	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	M	601;596;451	ENSP00000443817:R601M;ENSP00000237353:R596M;ENSP00000347854:R451M	ENSP00000237353:R596M	R	-	2	0	PMFBP1	70720629	0.350000	0.24878	0.094000	0.20943	0.128000	0.20619	0.603000	0.24149	0.567000	0.29293	-0.345000	0.07892	AGG		0.433	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		39	239	1	0	1.67305e-13	0.00623	2.50957e-13	39	239				
CNTNAP4	85445	broad.mit.edu	37	16	76486440	76486440	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:76486440T>A	ENST00000476707.1	+	7	1255	c.1116T>A	c.(1114-1116)tcT>tcA	p.S372S	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Silent_p.S320S|CNTNAP4_ENST00000478060.1_Silent_p.S296S|CNTNAP4_ENST00000307431.8_Silent_p.S368S			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	369					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S296S(1)|p.S368S(1)|p.S344S(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						AACCACAATCTATGCCCGTGA	0.383																																							uc002feu.1		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)|pancreas(1)	2						c.(1105-1107)TCT>TCA		cell recognition protein CASPR4 isoform 1							96.0	94.0	95.0					16																	76486440		2198	4300	6498	SO:0001819	synonymous_variant	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76486440T>A	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1116T>A	16.37:g.76486440T>A			Somatic				CNTNAP4_uc002fev.1_Silent_p.S233S|CNTNAP4_uc010chb.1_Silent_p.S296S|CNTNAP4_uc002fex.1_Silent_p.S372S|CNTNAP4_uc002few.2_Silent_p.S344S	p.S369S	NM_033401	NP_207837	WXS	Illumina HiSeq	Unspecified	Q9C0A0	CNTP4_HUMAN			10	1492	+			369			Extracellular (Potential).		E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37	c.1107T>A																																																																																					0.383	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		19	100	0	0	0	0.012319	0	19	100				
CNTNAP4	85445	broad.mit.edu	37	16	76513434	76513434	+	Splice_Site	SNP	C	C	A	rs374622637		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:76513434C>A	ENST00000476707.1	+	11	2029	c.1890C>A	c.(1888-1890)acC>acA	p.T630T	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Splice_Site_p.T578T|CNTNAP4_ENST00000478060.1_Splice_Site_p.T554T|CNTNAP4_ENST00000307431.8_Splice_Site_p.T626T			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	627	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.T602T(1)|p.T554T(1)|p.T626T(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GCAATATGACCGGTGAGTTAA	0.338																																							uc002feu.1		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)|pancreas(1)	2						c.(1879-1881)ACC>ACA		cell recognition protein CASPR4 isoform 1							84.0	86.0	86.0					16																	76513434		2198	4298	6496	SO:0001630	splice_region_variant	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76513434C>A	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1891+1C>A	16.37:g.76513434C>A			Somatic				CNTNAP4_uc002fev.1_Silent_p.T491T|CNTNAP4_uc010chb.1_Silent_p.T554T|CNTNAP4_uc002fex.1_Silent_p.T630T|CNTNAP4_uc002few.2_Silent_p.T602T	p.T627T	NM_033401	NP_207837	WXS	Illumina HiSeq	Unspecified	Q9C0A0	CNTP4_HUMAN			14	2266	+			627			Extracellular (Potential).|Fibrinogen C-terminal.		E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37	c.1881C>A																																																																																					0.338	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	Silent	22	105	1	0	7.45023e-12	0.010504	1.05896e-11	22	105				
PKD1L2	114780	broad.mit.edu	37	16	81181898	81181898	+	RNA	SNP	G	G	A	rs375682246		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:81181898G>A	ENST00000525539.1	-	0	4817				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.P1606P(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GGAGGTTGATGGGGAACATGA	0.552																																							uc002fgh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(4816-4818)CCC>CCT		polycystin 1-like 2 isoform a		G		0,3788		0,0,1894	68.0	68.0	68.0		4818	2.7	1.0	16		68	1,8273		0,1,4136	no	coding-synonymous	PKD1L2	NM_052892.3		0,1,6030	AA,AG,GG		0.0121,0.0,0.0083		1606/2460	81181898	1,12061	1894	4137	6031			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81181898G>A	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81181898G>A			Somatic				PKD1L2_uc002fgg.1_RNA	p.P1606P	NM_052892	NP_443124	WXS	Illumina HiSeq	Unspecified	Q7Z442	PK1L2_HUMAN			29	4818	-			1606			Helical; (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37	c.4818C>T																																																																																					0.552	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			11	45	0	0	0	0.008291	0	11	45				
JPH3	57338	broad.mit.edu	37	16	87678336	87678336	+	Silent	SNP	C	C	A	rs112449440		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr16:87678336C>A	ENST00000284262.2	+	2	1097	c.855C>A	c.(853-855)acC>acA	p.T285T		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	285					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)	p.T285T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CCACCACCACCGAGACCTACG	0.672																																							uc002fkd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(853-855)ACC>ACA		junctophilin 3							87.0	81.0	83.0					16																	87678336		2198	4300	6498	SO:0001819	synonymous_variant	57338				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	g.chr16:87678336C>A	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.855C>A	16.37:g.87678336C>A			Somatic				JPH3_uc010vou.1_RNA	p.T285T	NM_020655	NP_065706	WXS	Illumina HiSeq	Unspecified	Q8WXH2	JPH3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0287)	2	1109	+			285			Cytoplasmic (Potential).		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	ENST00000284262.2	37	c.855C>A	CCDS10962.1																																																																																				0.672	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			15	41	1	0	0.000422831	0.004007	0.000471513	15	41				
TP53	7157	broad.mit.edu	37	17	7576855	7576855	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:7576855G>A	ENST00000269305.4	-	9	1180	c.991C>T	c.(991-993)Cag>Tag	p.Q331*	TP53_ENST00000420246.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q331*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	331	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		Q -> H (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q331*(23)|p.0?(8)|p.Q331fs*6(2)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTAGTACCTGAAGGGTGAAA	0.448		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		34	Substitution - Nonsense(23)|Whole gene deletion(8)|Insertion - Frameshift(2)|Unknown(1)	p.Q331*(14)|p.0?(7)|p.Q331P(3)|p.Q331fs*6(1)|p.?(1)|p.Q331Q(1)|p.Q331R(1)|p.Q331H(1)|p.Q331fs*14(1)	lung(6)|large_intestine(4)|urinary_tract(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|skin(2)|ovary(2)|stomach(1)|breast(1)|oesophagus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(991-993)CAG>TAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							115.0	108.0	110.0					17																	7576855		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7576855G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.991C>T	17.37:g.7576855G>A	ENSP00000269305:p.Gln331*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.Q331*|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_Nonsense_Mutation_p.Q199*|TP53_uc010cng.1_Nonsense_Mutation_p.Q199*|TP53_uc002gii.1_Nonsense_Mutation_p.Q199*|TP53_uc010cnh.1_Nonsense_Mutation_p.Q331*|TP53_uc010cni.1_Nonsense_Mutation_p.Q331*|TP53_uc002gij.2_Nonsense_Mutation_p.Q331*	p.Q331*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	9	1185	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	331		Q -> R (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Interaction with HIPK2.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.991C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117678	0.77323	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.95	2.88	0.33553	.	0.253251	0.40469	N	0.001098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-17.7352	9.751	0.40475	0.0:0.0:0.4869:0.5131	.	.	.	.	X	331;331;331;331;331;320;199	.	ENSP00000269305:Q331X	Q	-	1	0	TP53	7517580	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.858000	0.39408	0.557000	0.29117	-0.314000	0.08810	CAG		0.448	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		20	35	0	0	0	0.012319	0	20	35				
PIK3R6	146850	broad.mit.edu	37	17	8770949	8770949	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:8770949C>A	ENST00000311434.9	-	0	45					NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.G17C(1)									TTGGGGGAGCCTCCACGGGTG	0.587																																							uc002glq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(-196--192)GAGGC>GATGC		phosphoinositide-3-kinase, regulatory subunit 6							51.0	46.0	47.0					17																	8770949		876	1991	2867			146850				platelet activation	cytosol		g.chr17:8770949C>A	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.-195G>T	17.37:g.8770949C>A			Somatic				PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA		NM_001010855	NP_001010855	WXS	Illumina HiSeq	Unspecified	Q5UE93	PI3R6_HUMAN			1	46	-								Q658R3	Translation_Start_Site	SNP	ENST00000311434.9	37	c.-194G>T																																																																																					0.587	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855		11	19	1	0	2.80697e-09	0.010729	3.79866e-09	11	19				
MYH13	8735	broad.mit.edu	37	17	10222405	10222405	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:10222405A>G	ENST00000418404.3	-	26	3603	c.3440T>C	c.(3439-3441)cTg>cCg	p.L1147P	RP11-401O9.4_ENST00000609088.1_RNA|RP11-401O9.3_ENST00000577743.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.L1147P			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1147					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.L1147P(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GATCTCCTCCAGTTCCCTGGC	0.552																																							uc002gmk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(3439-3441)CTG>CCG		myosin, heavy polypeptide 13, skeletal muscle							89.0	97.0	94.0					17																	10222405		2203	4300	6503	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10222405A>G	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3440T>C	17.37:g.10222405A>G	ENSP00000404570:p.Leu1147Pro		Somatic					p.L1147P	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			27	3530	-			1147			Potential.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.3440T>C	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.995367	0.54147	.	.	ENSG00000006788	ENST00000252172	D	0.84800	-1.9	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.95004	0.8383	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96466	0.9345	9	0.87932	D	0	.	13.4569	0.61204	1.0:0.0:0.0:0.0	.	1147	Q9UKX3	MYH13_HUMAN	P	1147	ENSP00000252172:L1147P	ENSP00000252172:L1147P	L	-	2	0	MYH13	10163130	1.000000	0.71417	0.999000	0.59377	0.329000	0.28539	9.054000	0.93866	1.815000	0.52974	0.482000	0.46254	CTG		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		54	80	0	0	0	0.01441	0	54	80				
SPECC1	92521	broad.mit.edu	37	17	20107987	20107987	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:20107987G>T	ENST00000261503.5	+	4	676	c.625G>T	c.(625-627)Ggc>Tgc	p.G209C	SPECC1_ENST00000584527.1_5'Flank|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395529.3_Missense_Mutation_p.G209C|SPECC1_ENST00000395530.2_Missense_Mutation_p.G128C|SPECC1_ENST00000395525.3_Missense_Mutation_p.G128C|SPECC1_ENST00000395527.4_Missense_Mutation_p.G209C|SPECC1_ENST00000395522.2_Missense_Mutation_p.G128C|SPECC1_ENST00000536879.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	209					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.G209C(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TGATGCTTTGGGCCCAAATGT	0.438																																							uc002gwq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(625-627)GGC>TGC		spectrin domain with coiled-coils 1 NSP5b3b							153.0	170.0	164.0					17																	20107987		2203	4300	6503	SO:0001583	missense	92521					nucleus		g.chr17:20107987G>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.625G>T	17.37:g.20107987G>T	ENSP00000261503:p.Gly209Cys		Somatic				CYTSB_uc010cqx.2_Missense_Mutation_p.G209C|CYTSB_uc002gwr.2_Missense_Mutation_p.G209C|CYTSB_uc002gws.2_Missense_Mutation_p.G209C|CYTSB_uc002gwv.2_Missense_Mutation_p.G128C|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_5'UTR|CYTSB_uc002gwt.2_Missense_Mutation_p.G128C|CYTSB_uc002gwu.2_Missense_Mutation_p.G128C	p.G209C	NM_001033553	NP_001028725	WXS	Illumina HiSeq	Unspecified	Q5M775	CYTSB_HUMAN			4	770	+			209					B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	c.625G>T	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.639067	0.47153	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T;T	0.66280	-0.2;-0.11;2.89;2.89;2.89	4.82	2.78	0.32641	.	0.771688	0.12534	N	0.460517	T	0.59622	0.2207	N	0.19112	0.55	0.19300	N	0.999974	D;D;D;P	0.65815	0.989;0.995;0.989;0.928	P;P;P;P	0.58454	0.839;0.839;0.839;0.566	T	0.49466	-0.8937	10	0.66056	D	0.02	-9.4455	8.6631	0.34103	0.0878:0.1545:0.7577:0.0	.	128;128;209;209	Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;CYTSB_HUMAN	C	209;209;209;128;128;128	ENSP00000378901:G209C;ENSP00000261503:G209C;ENSP00000378900:G209C;ENSP00000378893:G128C;ENSP00000378896:G128C	ENSP00000261503:G209C	G	+	1	0	SPECC1	20048579	0.225000	0.23685	0.007000	0.13788	0.962000	0.63368	2.747000	0.47475	0.689000	0.31550	0.655000	0.94253	GGC		0.438	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		48	94	1	0	9.22156e-22	0.01441	1.54758e-21	48	94				
KIAA0100	9703	broad.mit.edu	37	17	26965369	26965369	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:26965369G>A	ENST00000528896.2	-	13	1487	c.1413C>T	c.(1411-1413)tgC>tgT	p.C471C	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Silent_p.C328C|KIAA0100_ENST00000389003.3_Silent_p.C328C	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	471						extracellular region (GO:0005576)		p.C471C(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCACACGCCAGCAGAGGTGGT	0.567																																							uc002hbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(1411-1413)TGC>TGT		hypothetical protein LOC9703 precursor							63.0	59.0	60.0					17																	26965369		2203	4300	6503	SO:0001819	synonymous_variant	9703					extracellular region		g.chr17:26965369G>A	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1413C>T	17.37:g.26965369G>A			Somatic					p.C471C	NM_014680	NP_055495	WXS	Illumina HiSeq	Unspecified	Q14667	K0100_HUMAN			13	1512	-	Lung NSC(42;0.00431)		471					A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	37	c.1413C>T	CCDS32595.1																																																																																				0.567	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680		14	29	0	0	0	0.001855	0	14	29				
SEZ6	124925	broad.mit.edu	37	17	27306716	27306716	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:27306716G>A	ENST00000317338.12	-	3	1268	c.840C>T	c.(838-840)ggC>ggT	p.G280G	SEZ6_ENST00000360295.9_Silent_p.G280G|SEZ6_ENST00000442608.3_Silent_p.G280G|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000335960.6_Silent_p.G280G			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	280					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.G280G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CCACGCCATAGCCAGGGTAGA	0.542																																							uc002hdp.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(838-840)GGC>GGT		seizure related 6 homolog isoform 1							59.0	61.0	61.0					17																	27306716		2006	4175	6181	SO:0001819	synonymous_variant	124925					integral to membrane|plasma membrane		g.chr17:27306716G>A	AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.840C>T	17.37:g.27306716G>A			Somatic				SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Silent_p.G280G|SEZ6_uc002hdq.1_Silent_p.G155G|SEZ6_uc010crz.1_Silent_p.G280G	p.G280G	NM_178860	NP_849191	WXS	Illumina HiSeq	Unspecified	Q53EL9	SEZ6_HUMAN	Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)		3	1034	-	Lung NSC(42;0.0137)		280			Extracellular (Potential).		B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Silent	SNP	ENST00000317338.12	37	c.840C>T	CCDS45639.1																																																																																				0.542	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3			4	21	0	0	0	0.009096	0	4	21				
ANKRD13B	124930	broad.mit.edu	37	17	27935036	27935036	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:27935036G>T	ENST00000394859.3	+	3	437	c.283G>T	c.(283-285)Gag>Tag	p.E95*	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	95						endosome (GO:0005768)|plasma membrane (GO:0005886)		p.E95*(1)		cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						CCGGGACCTGGAGCTGGTGCA	0.662																																							uc002hei.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(283-285)GAG>TAG		ankyrin repeat domain 13B							46.0	55.0	52.0					17																	27935036		2203	4300	6503	SO:0001587	stop_gained	124930							g.chr17:27935036G>T	AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.283G>T	17.37:g.27935036G>T	ENSP00000378328:p.Glu95*		Somatic				ANKRD13B_uc002heh.2_Intron|ANKRD13B_uc002hej.2_RNA	p.E95*	NM_152345	NP_689558	WXS	Illumina HiSeq	Unspecified	Q86YJ7	AN13B_HUMAN			3	396	+			95			ANK 2.		Q8N7S9	Nonsense_Mutation	SNP	ENST00000394859.3	37	c.283G>T	CCDS11251.1	.	.	.	.	.	.	.	.	.	.	G	38	6.829428	0.97869	.	.	ENSG00000198720	ENST00000394859	.	.	.	6.03	6.03	0.97812	.	0.097321	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-31.6487	20.177	0.98182	0.0:0.0:1.0:0.0	.	.	.	.	X	95	.	ENSP00000378328:E95X	E	+	1	0	ANKRD13B	24959162	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.854000	0.98071	0.655000	0.94253	GAG		0.662	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256077.1	NM_152345		18	22	1	0	1.02788e-11	0.00499	1.45492e-11	18	22				
NF1	4763	broad.mit.edu	37	17	29661882	29661882	+	Nonsense_Mutation	SNP	G	G	T	rs587782088		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:29661882G>T	ENST00000358273.4	+	40	6222	c.5839G>T	c.(5839-5841)Gaa>Taa	p.E1947*	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000356175.3_Nonsense_Mutation_p.E1926*|NF1_ENST00000417592.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1947					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.E1947*(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCTTTGTTTGGAATACATGAC	0.333			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		13	Whole gene deletion(8)|Unknown(3)|Substitution - Nonsense(2)		soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(5839-5841)GAA>TAA		neurofibromin isoform 1							108.0	103.0	105.0					17																	29661882		2203	4300	6503	SO:0001587	stop_gained	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29661882G>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5839G>T	17.37:g.29661882G>T	ENSP00000351015:p.Glu1947*	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Nonsense_Mutation_p.E1926*|NF1_uc010cso.2_Nonsense_Mutation_p.E135*|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	p.E1947*	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	40	6172	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	1947					O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	c.5839G>T	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	49	15.149753	0.99824	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	19.4882	0.95039	0.0:0.0:1.0:0.0	.	.	.	.	X	1947;1926;1592	.	ENSP00000348498:E1926X	E	+	1	0	NF1	26686008	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.261000	0.95576	2.620000	0.88729	0.557000	0.71058	GAA		0.333	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		8	35	1	0	4.68919e-08	0.008291	6.09056e-08	8	35				
SLFN12L	100506736	broad.mit.edu	37	17	33849347	33849347	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:33849347G>A	ENST00000361112.4	-	2	930	c.52C>T	c.(52-54)Cac>Tac	p.H18Y				Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	0						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.H18Y(1)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						AGAATTCTGTGTGCCTCACAG	0.393																																							uc002hjn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(52-54)CAC>TAC		schlafen family member 12-like							182.0	140.0	153.0					17																	33849347		692	1591	2283	SO:0001583	missense	342615							g.chr17:33849347G>A	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000361112.4:c.52C>T	17.37:g.33849347G>A	ENSP00000354412:p.His18Tyr		Somatic					p.H18Y	NM_001145027	NP_001138499	WXS	Illumina HiSeq	Unspecified					2	931	-								F5H6G3	Missense_Mutation	SNP	ENST00000361112.4	37	c.52C>T		.	.	.	.	.	.	.	.	.	.	G	6.565	0.472618	0.12461	.	.	ENSG00000205045	ENST00000361112	T	0.03358	3.96	2.79	-5.59	0.02505	.	.	.	.	.	T	0.02418	0.0074	.	.	.	0.09310	N	0.999999	B	0.30236	0.274	B	0.21151	0.033	T	0.25984	-1.0116	8	0.52906	T	0.07	.	6.0825	0.19948	0.0:0.2591:0.2468:0.494	.	18	Q6IEE8-2	.	Y	18	ENSP00000354412:H18Y	ENSP00000354412:H18Y	H	-	1	0	SLFN12L	30873460	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-5.539000	0.00115	-2.581000	0.00462	-0.678000	0.03780	CAC		0.393	SLFN12L-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000399529.1	XM_496206		7	42	0	0	0	0.001984	0	7	42				
AP2B1	163	broad.mit.edu	37	17	34044368	34044368	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:34044368G>T	ENST00000262325.7	+	20	3292	c.2739G>T	c.(2737-2739)acG>acT	p.T913T	AP2B1_ENST00000538556.1_Splice_Site_p.T856T|AP2B1_ENST00000589344.1_Splice_Site_p.T927T|AP2B1_ENST00000592545.1_Splice_Site_p.T889T|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000312678.8_Splice_Site_p.T927T|AP2B1_ENST00000537622.2_Splice_Site_p.T927T	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	913	Interaction with ARRB1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.T927T(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCAATTACACGGTAAGGCCTT	0.493																																							uc002hjr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2737-2739)ACG>ACT		adaptor-related protein complex 2, beta 1							93.0	84.0	87.0					17																	34044368		2203	4300	6503	SO:0001630	splice_region_variant	163				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity	g.chr17:34044368G>T	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2739+1G>T	17.37:g.34044368G>T			Somatic				AP2B1_uc002hjq.2_Silent_p.T927T|AP2B1_uc010wci.1_Silent_p.T889T|AP2B1_uc002hjs.2_Silent_p.T856T|AP2B1_uc002hjt.2_Silent_p.T927T|AP2B1_uc010ctv.2_Silent_p.T927T|AP2B1_uc010wcj.1_Silent_p.T664T	p.T913T	NM_001282	NP_001273	WXS	Illumina HiSeq	Unspecified	P63010	AP2B1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)	20	2928	+		Ovarian(249;0.17)	913			Interaction with ARRB1.		A6NJP3|P21851|Q7Z451|Q96J19	Silent	SNP	ENST00000262325.7	37	c.2739G>T	CCDS32622.1																																																																																				0.493	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		Silent	14	90	1	0	1.5739e-10	0.004007	2.19568e-10	14	90				
CCL15	6359	broad.mit.edu	37	17	34328476	34328476	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:34328476G>T	ENST00000354059.4	-	1	608	c.56C>A	c.(55-57)tCc>tAc	p.S19Y	CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.S19Y|RP11-104J23.1_ENST00000590192.1_RNA|CCL14_ENST00000536149.1_5'UTR	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	19					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.S19Y(1)		large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGGGCCTGGGATCCAAGGAC	0.587																																							uc010wcu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(55-57)TCC>TAC		chemokine (C-C motif) ligand 15 precursor							97.0	72.0	81.0					17																	34328476		2203	4300	6503	SO:0001583	missense	6359				cell-cell signaling|cellular calcium ion homeostasis|immune response	extracellular space	chemoattractant activity|chemokine activity|heparin binding|signal transducer activity	g.chr17:34328476G>T	AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.56C>A	17.37:g.34328476G>T	ENSP00000293276:p.Ser19Tyr		Somatic				CCL14-CCL15_uc010wcs.1_RNA|CCL14-CCL15_uc010wct.1_RNA	p.S19Y	NM_032965	NP_116741	WXS	Illumina HiSeq	Unspecified	Q16663	CCL15_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	1	625	-		Ovarian(249;0.17)	19					B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	ENST00000354059.4	37	c.56C>A	CCDS11304.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962675	0.34659	.	.	ENSG00000161574	ENST00000354059	T	0.05513	3.43	3.13	-0.0587	0.13796	.	31.081300	0.00166	N	0.000000	T	0.15955	0.0384	L	0.59436	1.845	0.09310	N	1	D	0.63880	0.993	P	0.56700	0.804	T	0.12451	-1.0547	10	0.66056	D	0.02	.	5.078	0.14642	0.4531:0.0:0.5469:0.0	.	19	Q16663	CCL15_HUMAN	Y	19	ENSP00000293276:S19Y	ENSP00000293276:S19Y	S	-	2	0	CCL15	31352589	0.011000	0.17503	0.022000	0.16811	0.610000	0.37248	-0.063000	0.11655	0.019000	0.15079	0.603000	0.83216	TCC		0.587	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256584.2	NM_004167		4	30	1	0	0.00909568	0.009096	0.00968112	4	30				
HOXB4	3214	broad.mit.edu	37	17	46654118	46654118	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:46654118G>T	ENST00000332503.5	-	2	2513	c.722C>A	c.(721-723)cCt>cAt	p.P241H	HOXB3_ENST00000485909.2_5'Flank|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000490677.1_5'Flank|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000311626.4_5'Flank|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000460160.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	241					anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P241H(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						GGGCCGGCCAGGGGGCCCTCC	0.682																																							uc002inp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(721-723)CCT>CAT		homeobox B4							23.0	26.0	25.0					17																	46654118		2201	4291	6492	SO:0001583	missense	3214					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46654118G>T		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.722C>A	17.37:g.46654118G>T	ENSP00000328928:p.Pro241His		Somatic				HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'Flank|HOXB3_uc010wlk.1_5'Flank|HOXB3_uc010wll.1_Intron	p.P241H	NM_024015	NP_076920	WXS	Illumina HiSeq	Unspecified	P17483	HXB4_HUMAN			2	784	-			241					Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	c.722C>A	CCDS11529.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.403152	0.42613	.	.	ENSG00000182742	ENST00000332503	D	0.91521	-2.86	5.78	3.69	0.42338	.	1.198870	0.05904	N	0.630409	D	0.86343	0.5910	L	0.29908	0.895	0.34039	D	0.654808	P	0.41041	0.736	B	0.38458	0.274	T	0.81858	-0.0739	10	0.52906	T	0.07	.	11.502	0.50444	0.0741:0.0:0.7765:0.1494	.	241	P17483	HXB4_HUMAN	H	241	ENSP00000328928:P241H	ENSP00000328928:P241H	P	-	2	0	HOXB4	44009117	1.000000	0.71417	0.996000	0.52242	0.742000	0.42306	1.682000	0.37628	1.448000	0.47680	0.555000	0.69702	CCT		0.682	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2			10	39	1	0	7.48243e-07	0.006214	9.29137e-07	10	39				
KIF2B	84643	broad.mit.edu	37	17	51900967	51900967	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:51900967C>A	ENST00000268919.4	+	1	729	c.573C>A	c.(571-573)atC>atA	p.I191I		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	191					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I191I(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGCACATGATCGAAGAGTATC	0.582																																							uc002iua.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)	8						c.(571-573)ATC>ATA		kinesin family member 2B							75.0	65.0	68.0					17																	51900967		2203	4300	6503	SO:0001819	synonymous_variant	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51900967C>A	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.573C>A	17.37:g.51900967C>A			Somatic				uc010wna.1_RNA	p.I191I	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	729	+			191					Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	c.573C>A	CCDS32685.1																																																																																				0.582	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		12	54	1	0	2.27111e-07	0.013537	2.88354e-07	12	54				
KIF2B	84643	broad.mit.edu	37	17	51901301	51901301	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:51901301G>T	ENST00000268919.4	+	1	1063	c.907G>T	c.(907-909)Ggg>Tgg	p.G303W		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	303	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G303W(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CTTTGCCTATGGGCAGACGGG	0.552																																							uc002iua.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)	8						c.(907-909)GGG>TGG		kinesin family member 2B							93.0	84.0	87.0					17																	51901301		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901301G>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.907G>T	17.37:g.51901301G>T	ENSP00000268919:p.Gly303Trp		Somatic				uc010wna.1_RNA	p.G303W	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	1063	+			303			ATP (By similarity).|Kinesin-motor.		Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.907G>T	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995848	0.74703	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.79845	-1.31	5.52	5.52	0.82312	Kinesin, motor domain (5);	0.000000	0.52532	D	0.000067	D	0.95341	0.8488	H	0.99927	4.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97591	1.0117	10	0.87932	D	0	.	18.3543	0.90352	0.0:0.0:1.0:0.0	.	303	Q8N4N8	KIF2B_HUMAN	W	303;191	ENSP00000268919:G303W	ENSP00000268919:G303W	G	+	1	0	KIF2B	49256300	1.000000	0.71417	0.982000	0.44146	0.805000	0.45488	7.969000	0.87988	2.739000	0.93911	0.655000	0.94253	GGG		0.552	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		23	55	1	0	3.83957e-06	0.00278	4.59934e-06	23	55				
EFCAB3	146779	broad.mit.edu	37	17	60484501	60484501	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:60484501G>A	ENST00000305286.3	+	8	873	c.795G>A	c.(793-795)gaG>gaA	p.E265E	EFCAB3_ENST00000450662.2_Silent_p.E317E	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	265							calcium ion binding (GO:0005509)	p.E265E(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AGAAATTAGAGATGCTAAGAA	0.368																																							uc002izu.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(793-795)GAG>GAA		EF-hand calcium binding domain 3 isoform b							99.0	100.0	100.0					17																	60484501		2203	4300	6503	SO:0001819	synonymous_variant	146779						calcium ion binding	g.chr17:60484501G>A	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.795G>A	17.37:g.60484501G>A			Somatic				EFCAB3_uc010wpc.1_Silent_p.E317E	p.E265E	NM_173503	NP_775774	WXS	Illumina HiSeq	Unspecified	Q8N7B9	EFCB3_HUMAN	BRCA - Breast invasive adenocarcinoma(2;2.27e-11)		8	873	+			265					J3KQM8	Silent	SNP	ENST00000305286.3	37	c.795G>A	CCDS11632.1																																																																																				0.368	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503		26	66	0	0	0	0.003954	0	26	66				
SMARCD2	6603	broad.mit.edu	37	17	61914849	61914849	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:61914849C>T	ENST00000448276.2	-	2	618	c.353G>A	c.(352-354)cGc>cAc	p.R118H	SMARCD2_ENST00000225742.9_Missense_Mutation_p.R43H|SMARCD2_ENST00000323347.10_Missense_Mutation_p.R70H|RN7SL805P_ENST00000581353.1_RNA	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	118	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)	p.R62H(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CACAAGCAGGCGTTTTCGGAA	0.632																																							uc010deb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(352-354)CGC>CAC		SWI/SNF-related matrix-associated							59.0	67.0	65.0					17																	61914849		1974	4154	6128	SO:0001583	missense	6603				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity	g.chr17:61914849C>T	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.353G>A	17.37:g.61914849C>T	ENSP00000392617:p.Arg118His		Somatic				SMARCD2_uc010wpt.1_Missense_Mutation_p.R70H|SMARCD2_uc010dea.1_Missense_Mutation_p.R43H|SMARCD2_uc010dec.1_Missense_Mutation_p.R97H	p.R118H	NM_001098426	NP_001091896	WXS	Illumina HiSeq	Unspecified	Q92925	SMRD2_HUMAN			2	670	-			118			Pro-rich.		A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	ENST00000448276.2	37	c.353G>A	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	15.78	2.933995	0.52866	.	.	ENSG00000108604	ENST00000448276;ENST00000450364;ENST00000323347	T;T	0.48522	0.81;0.85	5.17	5.17	0.71159	.	0.096298	0.64402	D	0.000002	T	0.58163	0.2103	L	0.39085	1.19	0.51767	D	0.999938	D;D;D	0.89917	0.986;1.0;1.0	P;P;D	0.65443	0.476;0.891;0.935	T	0.59369	-0.7467	10	0.62326	D	0.03	-0.412	16.2004	0.82067	0.0:1.0:0.0:0.0	.	70;81;118	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	H	118;81;70	ENSP00000392617:R118H;ENSP00000318451:R70H	ENSP00000318451:R70H	R	-	2	0	SMARCD2	59268581	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.947000	0.75959	2.702000	0.92279	0.491000	0.48974	CGC		0.632	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426		38	79	0	0	0	0.011902	0	38	79				
RGS9	8787	broad.mit.edu	37	17	63200369	63200369	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:63200369C>G	ENST00000262406.9	+	15	1220	c.1153C>G	c.(1153-1155)Cgc>Ggc	p.R385G	RGS9_ENST00000443584.3_Missense_Mutation_p.R382G|RGS9_ENST00000449996.3_Missense_Mutation_p.R382G	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	385	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.R385G(1)|p.R385C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GCACCCCCACCGCTATGTGCT	0.587																																							uc002jfe.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(2)|skin(2)	4						c.(1153-1155)CGC>GGC		regulator of G-protein signaling 9 isoform 1							64.0	70.0	68.0					17																	63200369		1950	4159	6109	SO:0001583	missense	8787				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr17:63200369C>G	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1153C>G	17.37:g.63200369C>G	ENSP00000262406:p.Arg385Gly		Somatic				RGS9_uc010dem.2_Missense_Mutation_p.R382G|RGS9_uc002jfd.2_Missense_Mutation_p.R382G|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Missense_Mutation_p.R156G	p.R385G	NM_003835	NP_003826	WXS	Illumina HiSeq	Unspecified	O75916	RGS9_HUMAN			15	1263	+			385			RGS.		A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	c.1153C>G	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235186	0.39498	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.02121	4.44;4.44	5.78	5.78	0.91487	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	M	0.91038	3.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.01027	-1.1476	10	0.87932	D	0	.	20.0124	0.97464	0.0:1.0:0.0:0.0	.	385;385;382	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	G	385;382	ENSP00000262406:R385G;ENSP00000396329:R382G	ENSP00000262406:R385G	R	+	1	0	RGS9	60630831	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.798000	0.62510	2.749000	0.94314	0.655000	0.94253	CGC		0.587	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835		4	38	0	0	0	0.000602	0	4	38				
ABCA10	10349	broad.mit.edu	37	17	67212137	67212137	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:67212137G>T	ENST00000269081.4	-	9	1586	c.677C>A	c.(676-678)gCa>gAa	p.A226E	ABCA10_ENST00000432313.2_Missense_Mutation_p.A226E|ABCA10_ENST00000416101.2_Missense_Mutation_p.A226E	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	226					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A226E(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GAAAGCCAATGCTATCTGAAG	0.368																																							uc010dfa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(676-678)GCA>GAA		ATP-binding cassette, sub-family A, member 10							56.0	58.0	57.0					17																	67212137		2203	4300	6503	SO:0001583	missense	10349				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67212137G>T	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.677C>A	17.37:g.67212137G>T	ENSP00000269081:p.Ala226Glu		Somatic				ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'Flank|ABCA10_uc010dfc.1_Missense_Mutation_p.A118E	p.A226E	NM_080282	NP_525021	WXS	Illumina HiSeq	Unspecified	Q8WWZ4	ABCAA_HUMAN			9	1556	-	Breast(10;6.95e-12)		226			Helical; (Potential).		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	c.677C>A	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226008	0.39300	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.83163	-1.69;-1.69;-1.69	3.21	3.21	0.36854	.	0.560834	0.13174	U	0.408034	D	0.87067	0.6085	M	0.78049	2.395	0.09310	N	1	D;P	0.53151	0.958;0.915	P;P	0.57468	0.821;0.776	T	0.75886	-0.3159	10	0.29301	T	0.29	.	8.2602	0.31779	0.0:0.2466:0.7534:0.0	.	226;226	E5RFP5;Q8WWZ4	.;ABCAA_HUMAN	E	226	ENSP00000269081:A226E;ENSP00000407772:A226E;ENSP00000387674:A226E	ENSP00000269081:A226E	A	-	2	0	ABCA10	64723732	0.002000	0.14202	0.008000	0.14137	0.850000	0.48378	1.152000	0.31663	1.626000	0.50381	0.514000	0.50259	GCA		0.368	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282		6	55	1	0	0.00116845	0.001168	0.00128189	6	55				
GPR142	350383	broad.mit.edu	37	17	72368430	72368430	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:72368430G>T	ENST00000335666.4	+	4	1128	c.1080G>T	c.(1078-1080)ctG>ctT	p.L360L		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	360						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L360L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCATCCTCCTGGGCATCACCA	0.667																																							uc010wqy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1078-1080)CTG>CTT		G protein-coupled receptor 142							110.0	91.0	97.0					17																	72368430		2203	4300	6503	SO:0001819	synonymous_variant	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368430G>T	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1080G>T	17.37:g.72368430G>T			Somatic				GPR142_uc010wqx.1_Silent_p.L272L	p.L360L	NM_181790	NP_861455	WXS	Illumina HiSeq	Unspecified	Q7Z601	GP142_HUMAN			4	1080	+			360			Helical; Name=6; (Potential).		A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	c.1080G>T	CCDS11698.1																																																																																				0.667	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		20	58	1	0	1.15919e-05	0.008871	1.35739e-05	20	58				
OTOP2	92736	broad.mit.edu	37	17	72926892	72926892	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:72926892G>C	ENST00000580223.1	+	5	1192	c.1162G>C	c.(1162-1164)Gtg>Ctg	p.V388L	OTOP2_ENST00000331427.4_Missense_Mutation_p.V388L			Q7RTS6	OTOP2_HUMAN	otopetrin 2	388						integral component of membrane (GO:0016021)		p.V388L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CTACTCCATCGTGGCTGTGGT	0.617																																							uc010wrp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(1162-1164)GTG>CTG		otopetrin 2							67.0	58.0	61.0					17																	72926892		2203	4300	6503	SO:0001583	missense	92736					integral to membrane		g.chr17:72926892G>C	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1162G>C	17.37:g.72926892G>C	ENSP00000463837:p.Val388Leu		Somatic					p.V388L	NM_178160	NP_835454	WXS	Illumina HiSeq	Unspecified	Q7RTS6	OTOP2_HUMAN			7	1251	+	all_lung(278;0.172)|Lung NSC(278;0.207)		388			Helical; (Potential).			Missense_Mutation	SNP	ENST00000580223.1	37	c.1162G>C	CCDS11708.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775480	0.70107	.	.	ENSG00000183034	ENST00000331427	T	0.22743	1.94	5.47	5.47	0.80525	.	0.135123	0.50627	D	0.000103	T	0.33352	0.0860	L	0.41632	1.29	0.53005	D	0.999962	D	0.76494	0.999	D	0.69479	0.964	T	0.01371	-1.1372	10	0.23891	T	0.37	-16.1359	12.6937	0.56990	0.0755:0.0:0.9245:0.0	.	388	Q7RTS6	OTOP2_HUMAN	L	388	ENSP00000332528:V388L	ENSP00000332528:V388L	V	+	1	0	OTOP2	70438487	1.000000	0.71417	0.995000	0.50966	0.887000	0.51463	5.754000	0.68743	2.581000	0.87130	0.456000	0.33151	GTG		0.617	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160		7	27	0	0	0	0.001984	0	7	27				
KIAA0195	9772	broad.mit.edu	37	17	73488697	73488697	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:73488697C>T	ENST00000314256.7	+	15	2133	c.1739C>T	c.(1738-1740)aCc>aTc	p.T580I	KIAA0195_ENST00000375248.5_Missense_Mutation_p.T590I|KIAA0195_ENST00000579208.1_Missense_Mutation_p.T231I	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	580						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.T580I(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGCACCTCACCTCCCTCAAA	0.592																																							uc002jnz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1738-1740)ACC>ATC		hypothetical protein LOC9772							119.0	106.0	110.0					17																	73488697		2203	4300	6503	SO:0001583	missense	9772				ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism	g.chr17:73488697C>T		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1739C>T	17.37:g.73488697C>T	ENSP00000313885:p.Thr580Ile		Somatic				KIAA0195_uc010wsa.1_Missense_Mutation_p.T590I|KIAA0195_uc010wsb.1_Missense_Mutation_p.T220I|KIAA0195_uc002job.3_5'Flank	p.T580I	NM_014738	NP_055553	WXS	Illumina HiSeq	Unspecified	Q12767	K0195_HUMAN	all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		15	2014	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		580					O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	c.1739C>T	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.105313	0.37145	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	D;D	0.87966	-2.32;-2.32	5.6	5.6	0.85130	.	0.290270	0.38720	N	0.001584	T	0.78691	0.4323	N	0.19112	0.55	0.36328	D	0.858652	B;B;B	0.21905	0.01;0.062;0.037	B;B;B	0.26614	0.019;0.071;0.032	T	0.77422	-0.2594	10	0.40728	T	0.16	-16.4668	11.0712	0.48004	0.1499:0.7213:0.1288:0.0	.	590;590;580	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	I	580;590	ENSP00000313885:T580I;ENSP00000364397:T590I	ENSP00000313885:T580I	T	+	2	0	KIAA0195	71000292	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	4.777000	0.62361	2.651000	0.90000	0.561000	0.74099	ACC		0.592	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		13	62	0	0	0	0.013537	0	13	62				
CANT1	124583	broad.mit.edu	37	17	76993507	76993507	+	Silent	SNP	G	G	A	rs201935694	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:76993507G>A	ENST00000302345.2	-	2	692	c.198C>T	c.(196-198)ccC>ccT	p.P66P	CANT1_ENST00000392446.5_Silent_p.P66P|CANT1_ENST00000591773.1_Silent_p.P66P|CANT1_ENST00000591732.1_5'Flank	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	66					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)	p.P66P(1)	CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GGGGCCTGCCGGGGGCCGGGC	0.682			T	ETV4	prostate								G|||	11	0.00219649	0.0076	0.0014	5008	,	,		9117	0.0		0.0	False		,,,				2504	0.0						uc002jwn.2		NA		Dom	yes		17	17q25	124583	T	calcium activated nucleotidase 1			E	ETV4		prostate		1	Substitution - coding silent(1)		lung(1)		0						c.(196-198)CCC>CCT		calcium activated nucleotidase 1		G	,,	32,4226		0,32,2097	17.0	23.0	21.0		198,198,198	-10.0	0.0	17		21	1,8413		0,1,4206	no	coding-synonymous,coding-synonymous,coding-synonymous	CANT1	NM_001159772.1,NM_001159773.1,NM_138793.3	,,	0,33,6303	AA,AG,GG		0.0119,0.7515,0.2604	,,	66/402,66/402,66/402	76993507	33,12639	2129	4207	6336	SO:0001819	synonymous_variant	124583				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity	g.chr17:76993507G>A	AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.198C>T	17.37:g.76993507G>A			Somatic				CANT1_uc002jwk.2_Silent_p.P66P|CANT1_uc002jwj.2_Silent_p.P66P|CANT1_uc002jwl.2_RNA|CANT1_uc002jwm.1_5'Flank	p.P66P	NM_001159772	NP_001153244	WXS	Illumina HiSeq	Unspecified	Q8WVQ1	CANT1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)		4	637	-			66			Lumenal (Potential).		B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Silent	SNP	ENST00000302345.2	37	c.198C>T	CCDS11760.1																																																																																				0.682	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2	NM_138793		8	33	0	0	0	0.00308	0	8	33				
LPIN2	9663	broad.mit.edu	37	18	2931392	2931392	+	Missense_Mutation	SNP	C	C	A	rs318240736		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:2931392C>A	ENST00000261596.4	-	9	1556	c.1318G>T	c.(1318-1320)Ggc>Tgc	p.G440C		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	440					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)	p.G440C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GACTGGGAGCCAGAGAGTGTG	0.572																																							uc002klo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1318-1320)GGC>TGC		lipin 2							49.0	36.0	40.0					18																	2931392		2203	4300	6503	SO:0001583	missense	9663				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity	g.chr18:2931392C>A	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1318G>T	18.37:g.2931392C>A	ENSP00000261596:p.Gly440Cys		Somatic					p.G440C	NM_014646	NP_055461	WXS	Illumina HiSeq	Unspecified	Q92539	LPIN2_HUMAN		READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)	9	1557	-			440					A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	c.1318G>T	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	C	32	5.163342	0.94727	.	.	ENSG00000101577	ENST00000261596	D	0.81739	-1.53	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.91355	0.7273	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91177	0.4973	10	0.59425	D	0.04	-26.1247	20.4019	0.98996	0.0:1.0:0.0:0.0	.	440	Q92539	LPIN2_HUMAN	C	440	ENSP00000261596:G440C	ENSP00000261596:G440C	G	-	1	0	LPIN2	2921392	1.000000	0.71417	0.986000	0.45419	0.929000	0.56500	5.645000	0.67909	2.815000	0.96918	0.650000	0.86243	GGC		0.572	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646		5	5	1	0	5.9392e-07	0.001168	7.4158e-07	5	5				
LAMA1	284217	broad.mit.edu	37	18	6943237	6943237	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:6943237T>C	ENST00000389658.3	-	62	9102	c.9009A>G	c.(9007-9009)ccA>ccG	p.P3003P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	3003	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P3003P(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACTGGGTGTGTGGACTTTCAG	0.493																																							uc002knm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(9007-9009)CCA>CCG		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						288.0	210.0	236.0					18																	6943237		2203	4300	6503	SO:0001819	synonymous_variant	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:6943237T>C	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.9009A>G	18.37:g.6943237T>C			Somatic				LAMA1_uc002knk.2_Silent_p.P333P|LAMA1_uc002knl.2_Silent_p.P456P|LAMA1_uc010wzj.1_Silent_p.P2479P	p.P3003P	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			62	9103	-		Colorectal(10;0.172)	3003			Laminin G-like 5.			Silent	SNP	ENST00000389658.3	37	c.9009A>G	CCDS32787.1																																																																																				0.493	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		36	50	0	0	0	0.004289	0	36	50				
MTCL1	23255	broad.mit.edu	37	18	8783547	8783547	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:8783547G>T	ENST00000306329.11	+	5	1517	c.1517G>T	c.(1516-1518)aGg>aTg	p.R506M	SOGA2_ENST00000517570.1_Missense_Mutation_p.R146M|SOGA2_ENST00000400050.3_Missense_Mutation_p.R146M|SOGA2_ENST00000359865.3_Missense_Mutation_p.R146M|SOGA2_ENST00000306285.7_5'UTR														p.R146M(1)									GCCGATTTGAGGTGCCAGCTC	0.517																																							uc002knr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)AGG>ATG		hypothetical protein LOC23255							38.0	40.0	39.0					18																	8783547		2203	4300	6503	SO:0001583	missense	23255							g.chr18:8783547G>T																												ENST00000306329.11:c.1517G>T	18.37:g.8783547G>T	ENSP00000305027:p.Arg506Met		Somatic				KIAA0802_uc002knq.2_Missense_Mutation_p.R146M|KIAA0802_uc010dkw.1_Translation_Start_Site	p.R146M	NM_015210	NP_056025	WXS	Illumina HiSeq	Unspecified	Q9Y4B5	CC165_HUMAN			6	579	+			497						Missense_Mutation	SNP	ENST00000306329.11	37	c.437G>T		.	.	.	.	.	.	.	.	.	.	G	14.83	2.652707	0.47362	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T;T	0.78595	2.5;-1.19;-1.19;-1.19	5.96	2.09	0.27110	.	0.247074	0.29080	N	0.013219	T	0.75317	0.3833	L	0.47190	1.495	0.80722	D	1	P	0.45672	0.864	P	0.49226	0.603	T	0.73212	-0.4054	10	0.87932	D	0	-33.0487	9.2893	0.37778	0.7888:0.0:0.2112:0.0	.	146	Q9Y4B5-3	.	M	167;146;146;146	ENSP00000305027:R167M;ENSP00000429556:R146M;ENSP00000352927:R146M;ENSP00000382924:R146M	ENSP00000305027:R167M	R	+	2	0	CCDC165	8773547	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.462000	0.53042	0.153000	0.19213	-0.300000	0.09419	AGG		0.517	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			8	11	1	0	3.09899e-07	0.004482	3.91998e-07	8	11				
PTPN2	5771	broad.mit.edu	37	18	12814257	12814257	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:12814257G>A	ENST00000309660.5	-	7	896	c.803C>T	c.(802-804)tCa>tTa	p.S268L	PTPN2_ENST00000591115.1_Missense_Mutation_p.S291L|PTPN2_ENST00000353319.4_Missense_Mutation_p.S268L|PTPN2_ENST00000327283.3_Missense_Mutation_p.S268L|PTPN2_ENST00000591497.1_Missense_Mutation_p.S239L	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	268	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)	p.S268L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				AGCCATGTATGAGAATCTCAG	0.323																																							uc002krp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(802-804)TCA>TTA		protein tyrosine phosphatase, non-receptor type							97.0	91.0	93.0					18																	12814257		2202	4299	6501	SO:0001583	missense	5771				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding	g.chr18:12814257G>A	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.803C>T	18.37:g.12814257G>A	ENSP00000311857:p.Ser268Leu		Somatic				PTPN2_uc002krl.2_Missense_Mutation_p.S268L|PTPN2_uc002krn.2_Missense_Mutation_p.S291L|PTPN2_uc002kro.2_Missense_Mutation_p.S268L|PTPN2_uc002krm.2_Missense_Mutation_p.S268L	p.S268L	NM_002828	NP_002819	WXS	Illumina HiSeq	Unspecified	P17706	PTN2_HUMAN			7	997	-		Lung NSC(161;8.94e-06)	268			Tyrosine-protein phosphatase.		A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	c.803C>T	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	G	32	5.117238	0.94385	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	T;T;T	0.80994	-1.44;-1.44;-1.44	5.86	5.86	0.93980	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.46758	D	0.000272	D	0.84723	0.5535	L	0.35249	1.045	0.80722	D	1	D;P;P;D;P	0.62365	0.964;0.884;0.905;0.991;0.905	P;P;P;P;P	0.61201	0.885;0.55;0.763;0.832;0.679	D	0.85723	0.1326	10	0.87932	D	0	.	20.1931	0.98233	0.0:0.0:1.0:0.0	.	268;268;245;268;268	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	L	268;268;245;268	ENSP00000320298:S268L;ENSP00000320546:S268L;ENSP00000311857:S268L	ENSP00000311857:S268L	S	-	2	0	PTPN2	12804257	1.000000	0.71417	0.986000	0.45419	0.945000	0.59286	9.420000	0.97426	2.771000	0.95319	0.563000	0.77884	TCA		0.323	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423		9	25	0	0	0	0.006214	0	9	25				
CDH2	1000	broad.mit.edu	37	18	25573585	25573585	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:25573585G>A	ENST00000269141.3	-	8	1460	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M	CDH2_ENST00000399380.3_Missense_Mutation_p.T315M	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	346	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.T346M(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AATTATTAACGTATACTGTTG	0.373																																							uc002kwg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)	4						c.(1036-1038)ACG>ATG		cadherin 2, type 1 preproprotein							213.0	184.0	194.0					18																	25573585		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25573585G>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1037C>T	18.37:g.25573585G>A	ENSP00000269141:p.Thr346Met		Somatic				CDH2_uc010xbn.1_Missense_Mutation_p.T315M	p.T346M	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			8	1496	-			346			Extracellular (Potential).|Cadherin 2.		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.1037C>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247416	0.80024	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.53206	0.63;0.63	5.87	5.87	0.94306	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	M	0.62016	1.91	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.97110	0.675;1.0	T	0.67941	-0.5540	10	0.66056	D	0.02	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	315;346	A8MWK3;P19022	.;CADH2_HUMAN	M	346;315	ENSP00000269141:T346M;ENSP00000382312:T315M	ENSP00000269141:T346M	T	-	2	0	CDH2	23827583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.823000	0.86660	2.941000	0.99782	0.655000	0.94253	ACG		0.373	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		55	68	0	0	0	0.01441	0	55	68				
DSC3	1825	broad.mit.edu	37	18	28602364	28602364	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:28602364G>C	ENST00000360428.4	-	7	960	c.880C>G	c.(880-882)Ctc>Gtc	p.L294V	DSC3_ENST00000434452.1_Missense_Mutation_p.L294V	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	294	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.L294V(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ACAGAAAAGAGCCCAGGTGAC	0.498																																							uc002kwj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(880-882)CTC>GTC		desmocollin 3 isoform Dsc3a preproprotein							151.0	128.0	136.0					18																	28602364		2203	4300	6503	SO:0001583	missense	1825				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding	g.chr18:28602364G>C	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.880C>G	18.37:g.28602364G>C	ENSP00000353608:p.Leu294Val		Somatic				DSC3_uc002kwi.3_Missense_Mutation_p.L294V	p.L294V	NM_001941	NP_001932	WXS	Illumina HiSeq	Unspecified	Q14574	DSC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.125)		7	1035	-			294			Extracellular (Potential).|Cadherin 2.		A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	c.880C>G	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673648	0.29693	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.51817	0.69;0.69	4.9	0.81	0.18732	Cadherin (4);Cadherin-like (1);	0.000000	0.30293	N	0.009955	T	0.42765	0.1217	M	0.62154	1.92	0.24904	N	0.992085	B;P	0.35493	0.049;0.505	B;B	0.40636	0.142;0.335	T	0.32508	-0.9904	10	0.48119	T	0.1	.	4.9734	0.14127	0.1739:0.0:0.2834:0.5426	.	294;294	Q14574;Q14574-2	DSC3_HUMAN;.	V	294	ENSP00000353608:L294V;ENSP00000392068:L294V	ENSP00000353608:L294V	L	-	1	0	DSC3	26856362	0.000000	0.05858	0.971000	0.41717	0.268000	0.26511	-0.619000	0.05572	0.260000	0.21731	0.655000	0.94253	CTC		0.498	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423		26	48	0	0	0	0.003954	0	26	48				
ST8SIA5	29906	broad.mit.edu	37	18	44266155	44266155	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr18:44266155C>G	ENST00000315087.7	-	5	1211	c.551G>C	c.(550-552)aGc>aCc	p.S184T	ST8SIA5_ENST00000538168.1_Missense_Mutation_p.S220T|ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.S153T	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	184					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.S184T(1)		kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						GAAGTCGGCGCTGTTGATCTC	0.577																																							uc002lcj.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(550-552)AGC>ACC		ST8 alpha-N-acetyl-neuraminide							77.0	66.0	70.0					18																	44266155		2203	4300	6503	SO:0001583	missense	29906				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane		g.chr18:44266155C>G	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.551G>C	18.37:g.44266155C>G	ENSP00000321343:p.Ser184Thr		Somatic				ST8SIA5_uc002lci.1_Missense_Mutation_p.S31T|ST8SIA5_uc010xcy.1_Missense_Mutation_p.S220T|ST8SIA5_uc010xcz.1_Missense_Mutation_p.S153T	p.S184T	NM_013305	NP_037437	WXS	Illumina HiSeq	Unspecified	O15466	SIA8E_HUMAN			5	1119	-			184			Lumenal (Potential).		B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	37	c.551G>C	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724658	0.48833	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.34072	1.38;1.38;1.38	5.48	3.69	0.42338	.	0.222796	0.47455	D	0.000226	T	0.38558	0.1045	M	0.73430	2.235	0.45946	D	0.998779	B;B;B	0.33171	0.091;0.136;0.4	B;B;B	0.34038	0.073;0.142;0.174	T	0.36432	-0.9748	10	0.49607	T	0.09	-0.3483	11.0179	0.47701	0.0:0.8517:0.0:0.1483	.	153;220;184	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	T	184;220;153	ENSP00000321343:S184T;ENSP00000445492:S220T;ENSP00000443683:S153T	ENSP00000321343:S184T	S	-	2	0	ST8SIA5	42520153	1.000000	0.71417	0.917000	0.36280	0.975000	0.68041	4.867000	0.63013	1.330000	0.45394	0.491000	0.48974	AGC		0.577	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305		11	20	0	0	0	0.013537	0	11	20				
DOT1L	84444	broad.mit.edu	37	19	2216346	2216346	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:2216346C>G	ENST00000398665.3	+	20	2026	c.1990C>G	c.(1990-1992)Ccg>Gcg	p.P664A	AC004490.1_ENST00000585593.1_RNA|DOT1L_ENST00000608122.1_3'UTR	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	664					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.P664A(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTGTGTGCCGCCTGACGA	0.677																																							uc002lvb.3		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4						c.(1990-1992)CCG>GCG		DOT1-like, histone H3 methyltransferase							30.0	34.0	33.0					19																	2216346		2018	4173	6191	SO:0001583	missense	84444					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr19:2216346C>G	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1990C>G	19.37:g.2216346C>G	ENSP00000381657:p.Pro664Ala		Somatic				DOT1L_uc002lvc.1_5'UTR|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_5'UTR	p.P664A	NM_032482	NP_115871	WXS	Illumina HiSeq	Unspecified	Q8TEK3	DOT1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2026	+		Hepatocellular(1079;0.137)	664					O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	c.1990C>G	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.34|16.34	3.096406|3.096406	0.56075|0.56075	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000440640|ENST00000398665;ENST00000221482	.|T	.|0.25250	.|1.81	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|0.111630	.|0.64402	.|D	.|0.000006	T|T	0.45216|0.45216	0.1331|0.1331	M|M	0.66939|0.66939	2.045|2.045	0.36491|0.36491	D|D	0.868443|0.868443	.|D	.|0.71674	.|0.998	.|D	.|0.64687	.|0.928	T|T	0.56165|0.56165	-0.8024|-0.8024	5|10	.|0.87932	.|D	.|0	-23.2795|-23.2795	11.1084|11.1084	0.48216|0.48216	0.0:0.9156:0.0:0.0844|0.0:0.9156:0.0:0.0844	.|.	.|664	.|Q8TEK3-2	.|.	W|A	450|664	.|ENSP00000381657:P664A	.|ENSP00000221482:P664A	C|P	+|+	3|1	2|0	DOT1L|DOT1L	2167346|2167346	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.324000|0.324000	0.28378|0.28378	5.513000|5.513000	0.67037|0.67037	2.379000|2.379000	0.81126|0.81126	0.655000|0.655000	0.94253|0.94253	TGC|CCG		0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482		12	27	0	0	0	0.013537	0	12	27				
TMPRSS9	360200	broad.mit.edu	37	19	2396584	2396584	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:2396584C>T	ENST00000332578.3	+	2	190	c.190C>T	c.(190-192)Cgg>Tgg	p.R64W	TMPRSS9_ENST00000592650.1_3'UTR	NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	64					plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.R64W(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGAGCTGCGGGGAATCCG	0.662																																							uc010xgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(190-192)CGG>TGG		transmembrane protease, serine 9							29.0	24.0	26.0					19																	2396584		2203	4300	6503	SO:0001583	missense	360200				proteolysis	integral to plasma membrane	serine-type endopeptidase activity	g.chr19:2396584C>T	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.190C>T	19.37:g.2396584C>T	ENSP00000330264:p.Arg64Trp		Somatic				TMPRSS9_uc002lvv.1_Missense_Mutation_p.R64W	p.R64W	NM_182973	NP_892018	WXS	Illumina HiSeq	Unspecified	Q7Z410	TMPS9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	190	+			64			Extracellular (Potential).		Q6ZND6|Q7Z411	Missense_Mutation	SNP	ENST00000332578.3	37	c.190C>T	CCDS12088.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793755	0.50102	.	.	ENSG00000178297	ENST00000395264;ENST00000332578	D	0.89485	-2.52	3.98	-0.282	0.12878	.	1.443730	0.04882	N	0.447922	D	0.89375	0.6697	L	0.43152	1.355	0.09310	N	1	D;D	0.89917	0.991;1.0	P;P	0.60886	0.549;0.88	T	0.76594	-0.2902	10	0.62326	D	0.03	.	2.8997	0.05701	0.2113:0.4205:0.269:0.0993	.	64;64	Q7Z410;E7EMP4	TMPS9_HUMAN;.	W	64	ENSP00000330264:R64W	ENSP00000330264:R64W	R	+	1	2	TMPRSS9	2347584	0.000000	0.05858	0.012000	0.15200	0.079000	0.17450	-0.142000	0.10311	0.233000	0.21120	0.555000	0.69702	CGG		0.662	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973		6	4	0	0	0	0.001168	0	6	4				
PLIN4	729359	broad.mit.edu	37	19	4512005	4512005	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:4512005G>T	ENST00000301286.3	-	3	1924	c.1925C>A	c.(1924-1926)aCc>aAc	p.T642N		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	642	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.T570N(1)|p.T642N(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GATATTTTGGGTCGTTTTCAG	0.562																																							uc002mar.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1924-1926)ACC>AAC		plasma membrane associated protein, S3-12							144.0	148.0	147.0					19																	4512005		2067	4185	6252	SO:0001583	missense	729359					lipid particle|plasma membrane		g.chr19:4512005G>T	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1925C>A	19.37:g.4512005G>T	ENSP00000301286:p.Thr642Asn		Somatic				PLIN4_uc010dub.1_5'Flank	p.T642N	NM_001080400	NP_001073869	WXS	Illumina HiSeq	Unspecified	Q96Q06	PLIN4_HUMAN			3	1925	-			642			27 X 33 AA approximate tandem repeat.|17.		A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	c.1925C>A	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643910	0.47258	.	.	ENSG00000167676	ENST00000301286	T	0.05513	3.43	4.77	2.55	0.30701	.	0.376577	0.19144	N	0.121630	T	0.10078	0.0247	M	0.82923	2.615	0.09310	N	1	B	0.27951	0.195	B	0.22152	0.038	T	0.35450	-0.9788	10	0.10902	T	0.67	-10.7036	13.8221	0.63329	0.0:0.2919:0.7081:0.0	.	642	Q96Q06	PLIN4_HUMAN	N	642	ENSP00000301286:T642N	ENSP00000301286:T642N	T	-	2	0	PLIN4	4463005	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.802000	0.27069	0.398000	0.25338	0.289000	0.19496	ACC		0.562	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901		48	86	1	0	1.89013e-27	0.01441	3.36353e-27	48	86				
SAFB2	9667	broad.mit.edu	37	19	5587938	5587938	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:5587938C>A	ENST00000252542.4	-	19	2843	c.2579G>T	c.(2578-2580)cGc>cTc	p.R860L		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	860	Gly-rich.|Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R860L(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CTGCCAGGCGCGTGCCTGGTG	0.667																																					Ovarian(127;888 1728 23957 44128 52668)	Ovarian(127;888 1728 23957 44128 52668)	uc002mcd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2578-2580)CGC>CTC		scaffold attachment factor B2							17.0	19.0	18.0					19																	5587938		2203	4299	6502	SO:0001583	missense	9667				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding	g.chr19:5587938C>A	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2579G>T	19.37:g.5587938C>A	ENSP00000252542:p.Arg860Leu		Somatic					p.R860L	NM_014649	NP_055464	WXS	Illumina HiSeq	Unspecified	Q14151	SAFB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)	19	2791	-			860			Interacts with SAFB1.|Gly-rich.		B4DKG3|Q8TB13	Missense_Mutation	SNP	ENST00000252542.4	37	c.2579G>T	CCDS32879.1	.	.	.	.	.	.	.	.	.	.	c	10.76	1.440291	0.25900	.	.	ENSG00000130254	ENST00000252542	T	0.12672	2.66	4.41	3.34	0.38264	.	0.111909	0.40469	N	0.001086	T	0.10766	0.0263	L	0.34521	1.04	0.09310	N	1	P	0.35684	0.515	B	0.32149	0.141	T	0.12528	-1.0544	10	0.62326	D	0.03	-4.3184	12.2018	0.54331	0.0:0.8204:0.1796:0.0	.	860	Q14151	SAFB2_HUMAN	L	860	ENSP00000252542:R860L	ENSP00000252542:R860L	R	-	2	0	SAFB2	5538938	0.943000	0.32029	0.002000	0.10522	0.001000	0.01503	2.155000	0.42301	0.787000	0.33731	0.655000	0.94253	CGC		0.667	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451016.1	NM_014649		7	9	1	0	1.12685e-05	0.004482	1.32181e-05	7	9				
FBN3	84467	broad.mit.edu	37	19	8131064	8131064	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:8131064G>A	ENST00000600128.1	-	64	8583	c.8169C>T	c.(8167-8169)atC>atT	p.I2723I	FBN3_ENST00000270509.2_Silent_p.I2723I|FBN3_ENST00000601739.1_Silent_p.I2723I			Q75N90	FBN3_HUMAN	fibrillin 3	2723						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.I2723I(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGAGCTCCAGGATGCGCTCGG	0.652																																							uc002mjf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(8167-8169)ATC>ATT		fibrillin 3 precursor							23.0	22.0	22.0					19																	8131064		2202	4300	6502	SO:0001819	synonymous_variant	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8131064G>A		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.8169C>T	19.37:g.8131064G>A			Somatic				FBN3_uc002mje.2_Silent_p.I519I	p.I2723I	NM_032447	NP_115823	WXS	Illumina HiSeq	Unspecified	Q75N90	FBN3_HUMAN			63	8190	-			2723					Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	c.8169C>T	CCDS12196.1																																																																																				0.652	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		10	12	0	0	0	0.010729	0	10	12				
ZNF266	10781	broad.mit.edu	37	19	9524200	9524200	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:9524200C>A	ENST00000592904.1	-	5	3477	c.1401G>T	c.(1399-1401)atG>atT	p.M467I	ZNF266_ENST00000592292.1_Missense_Mutation_p.M467I|ZNF266_ENST00000590306.1_Missense_Mutation_p.M467I|ZNF266_ENST00000588933.1_Missense_Mutation_p.M467I|ZNF266_ENST00000361451.2_Missense_Mutation_p.M467I|ZNF266_ENST00000588221.1_Missense_Mutation_p.M467I|ZNF266_ENST00000361151.1_Missense_Mutation_p.M467I			Q14584	ZN266_HUMAN	zinc finger protein 266	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M467I(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TGCCACATTCCATACACGTGA	0.448																																							uc002mll.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1399-1401)ATG>ATT		zinc finger protein 266							67.0	55.0	59.0					19																	9524200		2203	4300	6503	SO:0001583	missense	10781				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9524200C>A	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1401G>T	19.37:g.9524200C>A	ENSP00000466714:p.Met467Ile		Somatic				ZNF266_uc002mlm.2_Missense_Mutation_p.M467I|ZNF266_uc002mln.2_Missense_Mutation_p.M467I|ZNF266_uc002mlo.2_Missense_Mutation_p.M467I|ZNF266_uc010dwp.2_Missense_Mutation_p.M467I|ZNF266_uc010dwq.2_Missense_Mutation_p.M467I	p.M467I	NM_198058	NP_932175	WXS	Illumina HiSeq	Unspecified	Q14584	ZN266_HUMAN			4	1667	-			467			C2H2-type 12.		A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	c.1401G>T	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461439	0.26248	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07216	3.21;3.21	2.51	-1.22	0.09494	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03477	0.0100	N	0.04746	-0.17	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.41197	-0.9522	9	0.59425	D	0.04	.	2.4421	0.04497	0.1891:0.504:0.185:0.1219	.	467	Q14584	ZN266_HUMAN	I	467	ENSP00000354680:M467I;ENSP00000355047:M467I	ENSP00000355047:M467I	M	-	3	0	ZNF266	9385200	0.000000	0.05858	0.005000	0.12908	0.960000	0.62799	-2.490000	0.00975	-0.150000	0.11195	0.555000	0.69702	ATG		0.448	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1			8	29	1	0	0.00448238	0.004482	0.00483156	8	29				
ZNF560	147741	broad.mit.edu	37	19	9578911	9578911	+	Nonsense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:9578911T>A	ENST00000301480.4	-	10	925	c.712A>T	c.(712-714)Aga>Tga	p.R238*		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R238*(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						GTGTTGCCTCTATTTTGAGTA	0.388																																							uc002mlp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(712-714)AGA>TGA		zinc finger protein 560							121.0	102.0	108.0					19																	9578911		2203	4300	6503	SO:0001587	stop_gained	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9578911T>A	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.712A>T	19.37:g.9578911T>A	ENSP00000301480:p.Arg238*		Somatic				ZNF560_uc010dwr.1_Nonsense_Mutation_p.R132*	p.R238*	NM_152476	NP_689689	WXS	Illumina HiSeq	Unspecified	Q96MR9	ZN560_HUMAN			10	922	-			238					Q495S9|Q495T1	Nonsense_Mutation	SNP	ENST00000301480.4	37	c.712A>T	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.477770	0.63849	.	.	ENSG00000198028	ENST00000301480	.	.	.	2.32	-1.46	0.08800	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	8.2872	0.31935	0.0:0.6655:0.0:0.3345	.	.	.	.	X	238	.	ENSP00000301480:R238X	R	-	1	2	ZNF560	9439911	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.232000	0.09055	-0.429000	0.07329	-0.366000	0.07423	AGA		0.388	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		41	38	0	0	0	0.006999	0	41	38				
SMARCA4	6597	broad.mit.edu	37	19	11105642	11105642	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:11105642G>T	ENST00000429416.3	+	10	1839	c.1558G>T	c.(1558-1560)Gag>Tag	p.E520*	SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.E520*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.E520*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	520	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E520*(2)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GAAAGAGAACGAGCGGATCGA	0.567			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		3	Substitution - Nonsense(2)|Unknown(1)	p.?(1)	lung(3)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(1558-1560)GAG>TAG		SWI/SNF-related matrix-associated							142.0	111.0	121.0					19																	11105642		2203	4300	6503	SO:0001587	stop_gained	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11105642G>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1558G>T	19.37:g.11105642G>T	ENSP00000395654:p.Glu520*		Somatic				SMARCA4_uc010dxp.2_Nonsense_Mutation_p.E520*|SMARCA4_uc010dxo.2_Nonsense_Mutation_p.E520*|SMARCA4_uc002mqg.1_Nonsense_Mutation_p.E520*|SMARCA4_uc010dxq.2_Nonsense_Mutation_p.E520*|SMARCA4_uc010dxr.2_Nonsense_Mutation_p.E520*|SMARCA4_uc002mqj.3_Nonsense_Mutation_p.E520*|SMARCA4_uc010dxs.2_Nonsense_Mutation_p.E520*|SMARCA4_uc002mqe.2_Nonsense_Mutation_p.E520*	p.E520*	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			9	1842	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	520			HSA.		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	ENST00000429416.3	37	c.1558G>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	37	6.206363	0.97376	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.1577	16.3965	0.83607	0.0:0.0:1.0:0.0	.	.	.	.	X	520	.	ENSP00000343896:E520X	E	+	1	0	SMARCA4	10966642	1.000000	0.71417	0.170000	0.22879	0.543000	0.35085	9.565000	0.98154	2.487000	0.83934	0.563000	0.77884	GAG		0.567	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		9	13	1	0	1.12685e-05	0.004482	1.32181e-05	9	13				
MYO9B	4650	broad.mit.edu	37	19	17296811	17296811	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:17296811G>T	ENST00000594824.1	+	18	2724		c.e18+1		MYO9B_ENST00000397274.2_Splice_Site|MYO9B_ENST00000595618.1_Splice_Site			Q13459	MYO9B_HUMAN	myosin IXB						actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.?(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGCTGAAAAGGTGAGTTTCTC	0.552																																							uc010eak.2		NA																	2	Unknown(2)		lung(2)	breast(1)	1						c.e18+1		myosin IXB isoform 1							82.0	83.0	83.0					19																	17296811		1976	4145	6121	SO:0001630	splice_region_variant	4650				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity	g.chr19:17296811G>T		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2577+1G>T	19.37:g.17296811G>T			Somatic				MYO9B_uc002nfi.2_Splice_Site_p.K859_splice|MYO9B_uc002nfj.1_Splice_Site_p.K859_splice	p.K859_splice	NM_004145	NP_004136	WXS	Illumina HiSeq	Unspecified	Q13459	MYO9B_HUMAN			18	2729	+								O75314|Q9NUJ2|Q9UHN0	Splice_Site	SNP	ENST00000594824.1	37	c.2577_splice		.	.	.	.	.	.	.	.	.	.	G	17.34	3.365563	0.61513	.	.	ENSG00000099331	ENST00000397274	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1421	0.89643	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO9B	17157811	1.000000	0.71417	0.996000	0.52242	0.389000	0.30415	9.581000	0.98210	2.593000	0.87608	0.655000	0.94253	.		0.552	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		Intron	25	47	1	0	1.08971e-26	0.00632	1.92905e-26	25	47				
UNC13A	23025	broad.mit.edu	37	19	17752261	17752261	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:17752261C>T	ENST00000519716.2	-	21	2576	c.2577G>A	c.(2575-2577)caG>caA	p.Q859Q	UNC13A_ENST00000550896.1_Silent_p.Q857Q|UNC13A_ENST00000551649.1_Silent_p.Q859Q|UNC13A_ENST00000252773.7_Silent_p.Q859Q|UNC13A_ENST00000552293.1_Silent_p.Q859Q|UNC13A_ENST00000428389.2_Silent_p.Q947Q	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	859					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.Q859Q(1)|p.Q947Q(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCACAATCTCCTGGGCTGTCT	0.562																																							uc002nhd.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(2839-2841)CAG>CAA		unc-13 homolog A							122.0	123.0	123.0					19																	17752261		2181	4285	6466	SO:0001819	synonymous_variant	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17752261C>T	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2577G>A	19.37:g.17752261C>T			Somatic					p.Q947Q	NM_001080421	NP_001073890	WXS	Illumina HiSeq	Unspecified	Q9UPW8	UN13A_HUMAN			21	2841	-			859					E5RHY9	Silent	SNP	ENST00000519716.2	37	c.2841G>A	CCDS46013.2																																																																																				0.562	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		19	20	0	0	0	0.007413	0	19	20				
GATAD2A	54815	broad.mit.edu	37	19	19611940	19611940	+	Silent	SNP	G	G	A	rs201382142		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:19611940G>A	ENST00000360315.3	+	9	1527	c.1215G>A	c.(1213-1215)tcG>tcA	p.S405S	GATAD2A_ENST00000429563.2_Silent_p.S233S|GATAD2A_ENST00000358713.3_Silent_p.S405S|GATAD2A_ENST00000537887.1_Silent_p.S34S|GATAD2A_ENST00000252577.5_Silent_p.S405S|GATAD2A_ENST00000404158.1_Silent_p.S406S	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	405	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S405S(1)|p.S262S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GCAGGATGTCGGCCGCCACTG	0.657													g|||	1	0.000199681	0.0	0.0	5008	,	,		17598	0.001		0.0	False		,,,				2504	0.0						uc010xqt.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1213-1215)TCG>TCA		GATA zinc finger domain containing 2A							37.0	36.0	36.0					19																	19611940		2201	4298	6499	SO:0001819	synonymous_variant	54815				DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:19611940G>A	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1215G>A	19.37:g.19611940G>A			Somatic				GATAD2A_uc010xqu.1_Silent_p.S34S|GATAD2A_uc010xqv.1_Silent_p.S425S|GATAD2A_uc010xqw.1_Silent_p.S233S	p.S405S	NM_017660	NP_060130	WXS	Illumina HiSeq	Unspecified	Q86YP4	P66A_HUMAN			9	1527	+			405					B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Silent	SNP	ENST00000360315.3	37	c.1215G>A	CCDS12402.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.324	0.617543	0.14129	.	.	ENSG00000167491	ENST00000418032	.	.	.	5.76	-9.06	0.00727	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	T	0.36040	-0.9764	4	.	.	.	-18.3918	12.674	0.56882	0.7592:0.0885:0.1522:0.0	.	.	.	.	S	32	.	.	G	+	1	0	GATAD2A	19472940	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-1.674000	0.01949	-1.669000	0.01470	-0.124000	0.14976	GGC		0.657	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660		4	42	0	0	0	0.009096	0	4	42				
TSHZ3	57616	broad.mit.edu	37	19	31769817	31769817	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:31769817C>A	ENST00000240587.4	-	2	1209	c.882G>T	c.(880-882)atG>atT	p.M294I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	294					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M111I(1)|p.M294I(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTGTTTTGATCATATGGACAC	0.517																																							uc002nsy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(880-882)ATG>ATT		zinc finger protein 537							97.0	91.0	93.0					19																	31769817		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31769817C>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.882G>T	19.37:g.31769817C>A	ENSP00000240587:p.Met294Ile		Somatic					p.M294I	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	947	-	Esophageal squamous(110;0.226)		294			C2H2-type 2.		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.882G>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	19.99	3.927890	0.73327	.	.	ENSG00000121297	ENST00000240587	T	0.57595	0.39	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	L	0.54323	1.7	0.80722	D	1	P	0.40931	0.733	D	0.68765	0.96	T	0.71603	-0.4543	10	0.87932	D	0	-33.0919	19.7698	0.96359	0.0:1.0:0.0:0.0	.	294	Q63HK5	TSH3_HUMAN	I	294	ENSP00000240587:M294I	ENSP00000240587:M294I	M	-	3	0	TSHZ3	36461657	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.659000	0.90383	0.655000	0.94253	ATG		0.517	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		36	71	1	0	2.20474e-14	0.003755	3.3973e-14	36	71				
RHPN2	85415	broad.mit.edu	37	19	33490547	33490547	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:33490547T>A	ENST00000254260.3	-	10	1205	c.1170A>T	c.(1168-1170)ccA>ccT	p.P390P	RHPN2_ENST00000400226.4_Silent_p.P239P	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	390	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.P390P(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCAGCCCCTCTGGCATGTGGT	0.602																																							uc002nuf.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(5)|ovary(1)	6						c.(1168-1170)CCA>CCT		rhophilin, Rho GTPase binding protein 2							60.0	50.0	54.0					19																	33490547		2202	4297	6499	SO:0001819	synonymous_variant	85415				signal transduction	perinuclear region of cytoplasm	protein binding	g.chr19:33490547T>A	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1170A>T	19.37:g.33490547T>A			Somatic				RHPN2_uc010xro.1_Silent_p.P239P|RHPN2_uc002nue.2_Silent_p.P120P	p.P390P	NM_033103	NP_149094	WXS	Illumina HiSeq	Unspecified	Q8IUC4	RHPN2_HUMAN			10	1236	-	Esophageal squamous(110;0.137)		390			BRO1.		B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	ENST00000254260.3	37	c.1170A>T	CCDS12427.1																																																																																				0.602	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103		3	18	0	0	0	0.004672	0	3	18				
ZNF461	92283	broad.mit.edu	37	19	37130585	37130585	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:37130585C>A	ENST00000588268.1	-	6	889	c.662G>T	c.(661-663)tGt>tTt	p.C221F	ZNF461_ENST00000360357.4_Missense_Mutation_p.C198F|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C94F(1)|p.C221F(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GCATTCTTTACATTCAGAAAG	0.313																																							uc002oem.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(661-663)TGT>TTT		gonadotropin inducible transcription repressor							68.0	67.0	67.0					19																	37130585		1855	4102	5957	SO:0001583	missense	92283				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37130585C>A	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.662G>T	19.37:g.37130585C>A	ENSP00000467931:p.Cys221Phe		Somatic				ZNF461_uc002oen.2_Missense_Mutation_p.C190F|ZNF461_uc010xtj.1_Missense_Mutation_p.C198F	p.C221F	NM_153257	NP_694989	WXS	Illumina HiSeq	Unspecified	Q8TAF7	ZN461_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		6	890	-	Esophageal squamous(110;0.198)		221					A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	ENST00000588268.1	37	c.662G>T	CCDS54257.1	.	.	.	.	.	.	.	.	.	.	C	9.186	1.024739	0.19433	.	.	ENSG00000197808	ENST00000396893;ENST00000360357;ENST00000540605	T	0.63744	-0.06	3.73	1.56	0.23342	.	.	.	.	.	T	0.73281	0.3567	M	0.91872	3.25	0.09310	N	0.999999	P;P;P	0.50943	0.886;0.94;0.886	P;P;B	0.50754	0.498;0.649;0.442	T	0.64339	-0.6431	9	0.87932	D	0	.	7.0249	0.24934	0.0:0.681:0.0:0.319	.	198;143;221	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	F	221;198;94	ENSP00000353515:C198F	ENSP00000353515:C198F	C	-	2	0	ZNF461	41822425	0.250000	0.23951	0.062000	0.19696	0.683000	0.39861	1.475000	0.35409	0.346000	0.23899	0.591000	0.81541	TGT		0.313	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	NM_153257		21	29	1	0	6.33239e-15	0.010504	9.84715e-15	21	29				
ATP5SL	55101	broad.mit.edu	37	19	41939238	41939238	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:41939238G>C	ENST00000221943.9	-	5	540	c.535C>G	c.(535-537)Ctc>Gtc	p.L179V	ATP5SL_ENST00000597457.1_Intron|ATP5SL_ENST00000417807.3_Missense_Mutation_p.L185V|ATP5SL_ENST00000590641.2_Missense_Mutation_p.L158V|ATP5SL_ENST00000438807.3_Intron|ATP5SL_ENST00000592922.2_Missense_Mutation_p.L152V|ATP5SL_ENST00000595425.1_Missense_Mutation_p.L152V|ATP5SL_ENST00000589970.1_Intron|ATP5SL_ENST00000301183.11_Intron	NM_018035.2	NP_060505.2	Q9NW81	AT5SL_HUMAN	ATP5S-like	179						mitochondrion (GO:0005739)		p.L179V(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	11						GCCAGCGAGAGCTCCTGCAAC	0.682																																							uc002oqw.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|breast(1)	2						c.(535-537)CTC>GTC		ATP5S-like							34.0	37.0	36.0					19																	41939238		2203	4299	6502	SO:0001583	missense	55101							g.chr19:41939238G>C	AK001103	CCDS33032.1, CCDS54269.1, CCDS54270.1, CCDS54271.1, CCDS59389.1, CCDS59390.1	19q13.2	2007-12-13				ENSG00000105341			25496	protein-coding gene	gene with protein product						12477932	Standard	NM_001167867		Approved	FLJ10241	uc002oqv.3	Q9NW81		ENST00000221943.9:c.535C>G	19.37:g.41939238G>C	ENSP00000221943:p.Leu179Val		Somatic				CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_RNA|ATP5SL_uc002oqv.2_Missense_Mutation_p.L185V|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Missense_Mutation_p.L152V|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_Missense_Mutation_p.L166V|ATP5SL_uc010xwb.1_Missense_Mutation_p.L158V	p.L179V	NM_018035	NP_060505	WXS	Illumina HiSeq	Unspecified	Q9NW81	AT5SL_HUMAN			5	541	-			179					B4DDC0|B4DMZ4|B4DP55|B4DXE8|F5H4W7|K7EMF6|Q96D43	Missense_Mutation	SNP	ENST00000221943.9	37	c.535C>G	CCDS33032.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949485	0.53186	.	.	ENSG00000105341	ENST00000221943;ENST00000438807;ENST00000417807;ENST00000507129	T;T	0.59906	0.23;0.23	4.43	4.43	0.53597	.	0.000000	0.64402	D	0.000010	T	0.80701	0.4673	M	0.92367	3.3	0.45962	D	0.998782	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;0.997;1.0;0.998	D	0.85374	0.1115	10	0.72032	D	0.01	-31.8121	14.416	0.67151	0.0:0.0:1.0:0.0	.	158;152;179;185	B4DFT4;E9PDC6;Q9NW81;F5H4W7	.;.;AT5SL_HUMAN;.	V	179;152;185;255	ENSP00000221943:L179V;ENSP00000403910:L185V	ENSP00000221943:L179V	L	-	1	0	ATP5SL	46631078	1.000000	0.71417	0.998000	0.56505	0.238000	0.25445	3.140000	0.50585	2.448000	0.82819	0.563000	0.77884	CTC		0.682	ATP5SL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460602.1	NM_018035		7	31	0	0	0	0.001984	0	7	31				
TMEM145	284339	broad.mit.edu	37	19	42827820	42827820	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:42827820C>A	ENST00000301204.3	+	14	1321	c.1280C>A	c.(1279-1281)cCc>cAc	p.P427H	MEGF8_ENST00000251268.6_5'Flank|MEGF8_ENST00000334370.4_5'Flank	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	427					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)		p.P427H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				GTCCCTGGACCCGGAGGGAGC	0.622																																							uc002otk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1279-1281)CCC>CAC		transmembrane protein 145							82.0	68.0	73.0					19																	42827820		2203	4300	6503	SO:0001583	missense	284339					integral to membrane		g.chr19:42827820C>A	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.1280C>A	19.37:g.42827820C>A	ENSP00000301204:p.Pro427His		Somatic				MEGF8_uc002otl.3_5'Flank	p.P427H	NM_173633	NP_775904	WXS	Illumina HiSeq	Unspecified	Q8NBT3	TM145_HUMAN			14	1332	+		Prostate(69;0.00682)	427						Missense_Mutation	SNP	ENST00000301204.3	37	c.1280C>A	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	C	9.215	1.031966	0.19590	.	.	ENSG00000167619	ENST00000301204	T	0.45668	0.89	4.83	4.83	0.62350	.	0.349077	0.23770	N	0.044726	T	0.45013	0.1321	L	0.43152	1.355	0.43214	D	0.99508	D	0.69078	0.997	P	0.53912	0.737	T	0.32455	-0.9906	10	0.45353	T	0.12	-23.3187	9.4476	0.38706	0.0:0.9017:0.0:0.0983	.	427	Q8NBT3	TM145_HUMAN	H	427	ENSP00000301204:P427H	ENSP00000301204:P427H	P	+	2	0	TMEM145	47519660	0.089000	0.21612	0.129000	0.21949	0.024000	0.10985	2.174000	0.42482	2.398000	0.81561	0.655000	0.94253	CCC		0.622	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		19	25	1	0	4.96729e-08	0.008871	6.42714e-08	19	25				
PSG6	5675	broad.mit.edu	37	19	43420611	43420611	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:43420611G>A	ENST00000292125.2	-	2	137	c.93C>T	c.(91-93)ccC>ccT	p.P31P	PSG6_ENST00000402603.4_Silent_p.P31P|PSG6_ENST00000187910.2_Silent_p.P31P|PSG6_ENST00000601833.1_5'UTR	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	31					female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.P31P(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GGGCAGTGGTGGGCAGGTTCC	0.468																																							uc002ovj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(91-93)CCC>CCT		pregnancy specific beta-1-glycoprotein 6 isoform							140.0	142.0	141.0					19																	43420611		2201	4299	6500	SO:0001819	synonymous_variant	5675				female pregnancy	extracellular region		g.chr19:43420611G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.93C>T	19.37:g.43420611G>A			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ovf.1_Silent_p.P31P|PSG6_uc002ovg.1_Silent_p.P31P	p.P31P	NM_002782	NP_002773	WXS	Illumina HiSeq	Unspecified	Q00889	PSG6_HUMAN			2	145	-		Prostate(69;0.00899)	31					O75244|Q15224|Q15235|Q549K1	Silent	SNP	ENST00000292125.2	37	c.93C>T	CCDS12613.1																																																																																				0.468	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		82	102	0	0	0	0.01441	0	82	102				
ZNF235	9310	broad.mit.edu	37	19	44792248	44792248	+	Missense_Mutation	SNP	T	T	C	rs200301700		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:44792248T>C	ENST00000291182.4	-	5	1442	c.1340A>G	c.(1339-1341)cAt>cGt	p.H447R	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	447					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H447R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				CTGATGGGTATGAAGATTTGA	0.398																																							uc002oza.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1339-1341)CAT>CGT		zinc finger protein 93 homolog							97.0	97.0	97.0					19																	44792248		2203	4300	6503	SO:0001583	missense	9310				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44792248T>C	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1340A>G	19.37:g.44792248T>C	ENSP00000291182:p.His447Arg		Somatic				ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.H443R|ZNF235_uc010xwx.1_Missense_Mutation_p.H361R	p.H447R	NM_004234	NP_004225	WXS	Illumina HiSeq	Unspecified	Q14590	ZN235_HUMAN			5	1443	-		Prostate(69;0.0352)|all_neural(266;0.116)	447			C2H2-type 6.		B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	c.1340A>G	CCDS33048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.58|11.58	1.682047|1.682047	0.29872|0.29872	.|.	.|.	ENSG00000159917|ENSG00000159917	ENST00000391957;ENST00000291182|ENST00000359844	T|.	0.07216|.	3.21|.	4.37|4.37	3.25|3.25	0.37280|0.37280	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.44285|.	D|.	0.000472|.	T|T	0.09905|0.09905	0.0243|0.0243	N|N	0.00783|0.00783	-1.19|-1.19	0.09310|0.09310	N|N	1|1	D;D|.	0.76494|.	0.999;0.999|.	P;D|.	0.62955|.	0.852;0.909|.	T|T	0.05716|0.05716	-1.0868|-1.0868	10|6	0.15499|0.62326	T|D	0.54|0.03	.|.	6.0955|6.0955	0.20019|0.20019	0.157:0.0:0.1613:0.6817|0.157:0.0:0.1613:0.6817	.|.	443;447|.	Q14590-2;Q14590|.	.;ZN235_HUMAN|.	R|V	447|359	ENSP00000291182:H447R|.	ENSP00000291182:H447R|ENSP00000352902:I359V	H|I	-|-	2|1	0|0	ZNF235|ZNF235	49484088|49484088	0.000000|0.000000	0.05858|0.05858	0.907000|0.907000	0.35723|0.35723	0.985000|0.985000	0.73830|0.73830	0.593000|0.593000	0.23999|0.23999	1.931000|1.931000	0.55961|0.55961	0.379000|0.379000	0.24179|0.24179	CAT|ATA		0.398	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			37	47	0	0	0	0.005524	0	37	47				
GPR4	2828	broad.mit.edu	37	19	46094361	46094361	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:46094361G>T	ENST00000323040.4	-	2	1708	c.764C>A	c.(763-765)cCc>cAc	p.P255H	GPR4_ENST00000591614.1_5'Flank|OPA3_ENST00000544371.1_Intron	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	255				P -> L (in Ref. 5; BAF83387). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P255H(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GCAGTCCCAGGGGCGGCCCAG	0.627																																					Esophageal Squamous(117;181 1612 1673 14956 42937)	Esophageal Squamous(117;181 1612 1673 14956 42937)	uc002pcm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(763-765)CCC>CAC		G protein-coupled receptor 4							37.0	42.0	40.0					19																	46094361		2202	4300	6502	SO:0001583	missense	2828					integral to plasma membrane	G-protein coupled receptor activity	g.chr19:46094361G>T	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.764C>A	19.37:g.46094361G>T	ENSP00000319744:p.Pro255His		Somatic				OPA3_uc010xxk.1_Intron	p.P255H	NM_005282	NP_005273	WXS	Illumina HiSeq	Unspecified	P46093	GPR4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)	2	1709	-			255	P -> L (in Ref. 5; BAF83387).		Extracellular (Potential).		A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	37	c.764C>A	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434740	0.25813	.	.	ENSG00000177464	ENST00000323040	T	0.63580	-0.05	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.72534	0.3472	L	0.60455	1.87	0.38414	D	0.946002	D	0.76494	0.999	D	0.70487	0.969	T	0.74633	-0.3600	10	0.48119	T	0.1	.	11.0153	0.47685	0.0:0.1886:0.8114:0.0	.	255	P46093	GPR4_HUMAN	H	255	ENSP00000319744:P255H	ENSP00000319744:P255H	P	-	2	0	GPR4	50786201	1.000000	0.71417	0.834000	0.33040	0.780000	0.44128	4.480000	0.60243	2.467000	0.83353	0.455000	0.32223	CCC		0.627	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282		14	32	1	0	1.5842e-08	0.001855	2.09374e-08	14	32				
CCDC61	729440	broad.mit.edu	37	19	46509878	46509878	+	Missense_Mutation	SNP	G	G	T	rs377508784		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:46509878G>T	ENST00000595358.1	+	4	342	c.293G>T	c.(292-294)cGc>cTc	p.R98L	CCDC61_ENST00000536603.1_Missense_Mutation_p.R98L|CCDC61_ENST00000594087.1_Missense_Mutation_p.R98L|CCDC61_ENST00000263284.2_Missense_Mutation_p.R155L	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61	98						centrosome (GO:0005813)		p.R155L(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		CTGCGGAACCGCAAGATGGGG	0.632																																							uc002pdw.2		NA																	1	Substitution - Missense(1)	p.R155S(1)	lung(1)	ovary(1)	1						c.(463-465)CGC>CTC		coiled-coil domain containing 61							24.0	29.0	27.0					19																	46509878		1929	4123	6052	SO:0001583	missense	729440							g.chr19:46509878G>T		CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488	ENST00000595358.1:c.293G>T	19.37:g.46509878G>T	ENSP00000471454:p.Arg98Leu		Somatic					p.R155L	NM_001080402	NP_001073871	WXS	Illumina HiSeq	Unspecified				OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)	5	464	+		all_neural(266;0.113)|Ovarian(192;0.127)						C8CAP4|Q9HDB6	Missense_Mutation	SNP	ENST00000595358.1	37	c.464G>T	CCDS46120.2	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684281	0.68157	.	.	ENSG00000104983	ENST00000263284;ENST00000536603	T;T	0.42900	0.96;0.96	3.96	1.81	0.25067	.	0.287816	0.33180	N	0.005185	T	0.44307	0.1287	M	0.68952	2.095	0.47621	D	0.999479	P	0.42620	0.785	P	0.45881	0.496	T	0.40346	-0.9568	10	0.66056	D	0.02	-10.5302	8.341	0.32243	0.1981:0.0:0.8019:0.0	.	98	Q9Y6R9	CCD61_HUMAN	L	155;98	ENSP00000263284:R155L;ENSP00000444279:R98L	ENSP00000263284:R155L	R	+	2	0	CCDC61	51201718	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	4.741000	0.62095	0.489000	0.27749	-0.222000	0.12452	CGC		0.632	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461689.1	NM_001080402		17	18	1	0	9.16793e-09	0.00499	1.22601e-08	17	18				
MEIS3	56917	broad.mit.edu	37	19	47912735	47912735	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:47912735C>T	ENST00000558555.1	-	7	854	c.667G>A	c.(667-669)Ggg>Agg	p.G223R	MEIS3_ENST00000560253.1_5'UTR|MEIS3_ENST00000561096.1_Missense_Mutation_p.G311R|MEIS3_ENST00000441740.2_Missense_Mutation_p.G206R|MEIS3_ENST00000331559.5_Missense_Mutation_p.G206R|MEIS3_ENST00000561293.1_Missense_Mutation_p.G223R|MEIS3_ENST00000559524.1_Missense_Mutation_p.G223R			Q99687	MEIS3_HUMAN	Meis homeobox 3	223	Ser/Thr-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.G223R(1)		breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		GCCAGGCCCCCACTGGATGGA	0.502																																							uc002pgu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(667-669)GGG>AGG		Meis1, myeloid ecotropic viral integration site							75.0	75.0	75.0					19																	47912735		2203	4300	6503	SO:0001583	missense	56917					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:47912735C>T	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.667G>A	19.37:g.47912735C>T	ENSP00000454073:p.Gly223Arg		Somatic				MEIS3_uc010xyp.1_5'Flank|MEIS3_uc002pgo.2_Missense_Mutation_p.G22R|MEIS3_uc002pgp.2_Missense_Mutation_p.G55R|MEIS3_uc002pgq.2_Missense_Mutation_p.G304R|MEIS3_uc002pgr.2_Missense_Mutation_p.G91R|MEIS3_uc002pgt.2_Missense_Mutation_p.G206R|MEIS3_uc002pgv.2_Missense_Mutation_p.G206R|MEIS3_uc002pgs.2_Missense_Mutation_p.G223R|MEIS3_uc010eld.2_Missense_Mutation_p.G223R	p.G223R	NM_001009813	NP_001009813	WXS	Illumina HiSeq	Unspecified	Q99687	MEIS3_HUMAN		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)	7	1114	-		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	223			Ser/Thr-rich.		A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37	c.667G>A		.	.	.	.	.	.	.	.	.	.	C	15.66	2.900338	0.52227	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	D	0.87334	-2.24	4.59	4.59	0.56863	.	0.350898	0.26692	N	0.022990	D	0.90304	0.6967	L	0.45581	1.43	0.41569	D	0.988671	D;B;P;D;D	0.63046	0.987;0.003;0.573;0.992;0.987	P;B;B;D;P	0.65874	0.831;0.016;0.369;0.939;0.831	D	0.90581	0.4529	10	0.52906	T	0.07	-6.4166	15.2951	0.73898	0.0:1.0:0.0:0.0	.	115;223;206;223;98	Q8TCW1;Q99687;Q99687-3;Q99687-2;Q59FK5	.;MEIS3_HUMAN;.;.;.	R	223;206	ENSP00000388667:G206R	ENSP00000333552:G223R	G	-	1	0	MEIS3	52604547	0.793000	0.28825	0.845000	0.33349	0.966000	0.64601	2.880000	0.48530	2.538000	0.85594	0.655000	0.94253	GGG		0.502	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929		23	37	0	0	0	0.003954	0	23	37				
ELSPBP1	64100	broad.mit.edu	37	19	48519179	48519179	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:48519179T>A	ENST00000339841.2	+	4	416	c.238T>A	c.(238-240)Tat>Aat	p.Y80N	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	80	Fibronectin type-II 2. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)		p.Y80N(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CCCTTTCATCTATCGAGGAAA	0.468																																							uc002pht.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)TAT>AAT		epididymal sperm binding protein 1 precursor							111.0	89.0	97.0					19																	48519179		2203	4300	6503	SO:0001583	missense	64100				single fertilization	extracellular region		g.chr19:48519179T>A	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.238T>A	19.37:g.48519179T>A	ENSP00000340660:p.Tyr80Asn		Somatic					p.Y80N	NM_022142	NP_071425	WXS	Illumina HiSeq	Unspecified	Q96BH3	ESPB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)	4	393	+		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)	80			Fibronectin type-II 2.		Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	c.238T>A	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886313	0.33348	.	.	ENSG00000169393	ENST00000339841	T	0.64260	-0.09	3.4	3.4	0.38934	Fibronectin, type II, collagen-binding (4);Kringle-like fold (1);	0.578217	0.14324	N	0.326807	T	0.81884	0.4917	M	0.93241	3.395	0.27834	N	0.941358	D	0.89917	1.0	D	0.81914	0.995	T	0.72959	-0.4133	10	0.66056	D	0.02	.	8.7835	0.34807	0.0:0.0:0.0:1.0	.	80	Q96BH3	ESPB1_HUMAN	N	80	ENSP00000340660:Y80N	ENSP00000340660:Y80N	Y	+	1	0	ELSPBP1	53210991	0.434000	0.25570	0.658000	0.29665	0.121000	0.20230	2.554000	0.45845	1.481000	0.48307	0.443000	0.29094	TAT		0.468	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1			26	29	0	0	0	0.004656	0	26	29				
ADM5	199800	broad.mit.edu	37	19	50189881	50189881	+	5'Flank	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:50189881G>T	ENST00000420022.3	+	0	0				PRMT1_ENST00000391851.4_Silent_p.T292T|PRMT1_ENST00000454376.2_Silent_p.T310T|PRMT1_ENST00000532489.1_Silent_p.T264T|CTB-33G10.6_ENST00000596472.1_RNA	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)							extracellular region (GO:0005576)		p.T286T(1)									CCCCGTACACGCACTGGAAGC	0.677																																							uc010enf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(928-930)ACG>ACT		HMT1 hnRNP methyltransferase-like 2 isoform 1							40.0	35.0	37.0					19																	50189881		2203	4300	6503	SO:0001631	upstream_gene_variant	3276					cytoplasm	protein methyltransferase activity	g.chr19:50189881G>T	BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6			19.37:g.50189881G>T	Exception_encountered		Somatic				PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Silent_p.T286T|PRMT1_uc002ppe.2_Silent_p.T292T|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Silent_p.T257T|PRMT1_uc010ybb.1_5'Flank|C19orf76_uc002pph.2_5'Flank	p.T310T	NM_001536	NP_001527	WXS	Illumina HiSeq	Unspecified	Q8WUW5	Q8WUW5_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)	10	972	+		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	291						Silent	SNP	ENST00000420022.3	37	c.930G>T	CCDS46146.1																																																																																				0.677	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465777.1	NM_001101340		16	18	1	0	1.15088e-07	0.004007	1.47225e-07	16	18				
LILRB2	10288	broad.mit.edu	37	19	54780746	54780746	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:54780746C>A	ENST00000391749.4	-	10	1669	c.1398G>T	c.(1396-1398)ttG>ttT	p.L466F	LILRB2_ENST00000391746.1_Missense_Mutation_p.L466F|LILRB2_ENST00000391748.1_Missense_Mutation_p.L465F|LILRB2_ENST00000434421.1_Missense_Mutation_p.L350F|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000314446.5_Missense_Mutation_p.L465F	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	466					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.L466F(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CGACGGCCACCAAGATGCCGA	0.577																																							uc002qfb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1396-1398)TTG>TTT		leukocyte immunoglobulin-like receptor,							215.0	149.0	171.0					19																	54780746		2203	4300	6503	SO:0001583	missense	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54780746C>A	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1398G>T	19.37:g.54780746C>A	ENSP00000375629:p.Leu466Phe		Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.L466F|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.L465F|LILRB2_uc010yet.1_Missense_Mutation_p.L350F	p.L466F	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	10	1664	-	Ovarian(34;0.19)		466			Helical; (Potential).		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	c.1398G>T	CCDS12886.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.694153	0.00731	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.00530	6.89;6.89;6.89;6.77;6.8	1.5	-2.99	0.05497	.	21.499800	0.00166	U	0.000002	T	0.00552	0.0018	L	0.52905	1.665	0.09310	N	1	P;P;P	0.48640	0.913;0.82;0.761	B;B;B	0.43575	0.424;0.282;0.276	T	0.43278	-0.9401	10	0.66056	D	0.02	.	2.1226	0.03730	0.2473:0.3893:0.0:0.3634	.	466;482;466	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	F	465;465;466;466;350	ENSP00000375628:L465F;ENSP00000319960:L465F;ENSP00000375629:L466F;ENSP00000375626:L466F;ENSP00000410117:L350F	ENSP00000319960:L465F	L	-	3	2	LILRB2	59472558	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-3.626000	0.00410	-0.740000	0.04803	-0.734000	0.03567	TTG		0.577	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			19	32	1	0	1.45105e-14	0.006122	2.24103e-14	19	32				
USP29	57663	broad.mit.edu	37	19	57640280	57640280	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:57640280C>A	ENST00000254181.4	+	4	691	c.237C>A	c.(235-237)aaC>aaA	p.N79K	USP29_ENST00000598197.1_Missense_Mutation_p.N79K	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	79					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.N79K(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAAAAACAACGTGTTCTTGT	0.333																																							uc002qny.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(235-237)AAC>AAA		ubiquitin specific peptidase 29							51.0	51.0	51.0					19																	57640280		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57640280C>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.237C>A	19.37:g.57640280C>A	ENSP00000254181:p.Asn79Lys		Somatic					p.N79K	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	593	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	79						Missense_Mutation	SNP	ENST00000254181.4	37	c.237C>A	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	C	9.186	1.024763	0.19433	.	.	ENSG00000131864	ENST00000254181	T	0.51817	0.69	2.79	-5.58	0.02512	.	0.446678	0.16574	N	0.208518	T	0.42337	0.1198	L	0.55990	1.75	0.09310	N	1	P	0.48016	0.904	P	0.47251	0.542	T	0.49370	-0.8947	10	0.54805	T	0.06	-5.5862	9.5757	0.39457	0.1226:0.731:0.0:0.1464	.	79	Q9HBJ7	UBP29_HUMAN	K	79	ENSP00000254181:N79K	ENSP00000254181:N79K	N	+	3	2	USP29	62332092	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.542000	0.00935	-2.482000	0.00522	-2.153000	0.00332	AAC		0.333	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			10	18	1	0	0.000673444	0.008291	0.00074607	10	18				
RSAD2	91543	broad.mit.edu	37	2	7035912	7035912	+	Missense_Mutation	SNP	C	C	A	rs182219558	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:7035912C>A	ENST00000382040.3	+	6	1061	c.925C>A	c.(925-927)Cgc>Agc	p.R309S	RSAD2_ENST00000541728.1_Missense_Mutation_p.R202S	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2									p.R309S(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		TTTCTAGATGCGCTTTCTGAA	0.368																																							uc002qyp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(925-927)CGC>AGC		radical S-adenosyl methionine domain containing							69.0	69.0	69.0					2																	7035912		2203	4300	6503	SO:0001583	missense	91543				defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding	g.chr2:7035912C>A	AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.925C>A	2.37:g.7035912C>A	ENSP00000371471:p.Arg309Ser		Somatic					p.R309S	NM_080657	NP_542388	WXS	Illumina HiSeq	Unspecified	Q8WXG1	RSAD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.191)	6	1061	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		309						Missense_Mutation	SNP	ENST00000382040.3	37	c.925C>A	CCDS1656.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019526	0.93462	.	.	ENSG00000134321	ENST00000382040;ENST00000541728	D;D	0.91843	-2.92;-2.92	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.96318	0.8799	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.96022	0.9010	10	0.59425	D	0.04	-34.6299	19.912	0.97027	0.0:1.0:0.0:0.0	.	309	Q8WXG1	RSAD2_HUMAN	S	309;202	ENSP00000371471:R309S;ENSP00000440859:R202S	ENSP00000371471:R309S	R	+	1	0	RSAD2	6953363	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.356000	0.79445	2.791000	0.96007	0.655000	0.94253	CGC		0.368	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206724.2	NM_080657		8	41	1	0	0.00307968	0.00308	0.00334084	8	41				
ROCK2	9475	broad.mit.edu	37	2	11484250	11484250	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:11484250G>A	ENST00000315872.6	-	1	461	c.13C>T	c.(13-15)Ccg>Tcg	p.P5S	ROCK2_ENST00000462366.1_Intron	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	5					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)	p.P5S(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CCCGTCGGCGGGGGCCGGCTC	0.766																																							uc002rbd.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(2)|skin(2)	4						c.(13-15)CCG>TCG		Rho-associated, coiled-coil containing protein							4.0	5.0	5.0					2																	11484250		1428	3317	4745	SO:0001583	missense	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11484250G>A	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.13C>T	2.37:g.11484250G>A	ENSP00000317985:p.Pro5Ser		Somatic					p.P5S	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	1	462	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		5					Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	c.13C>T	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494857	0.26774	.	.	ENSG00000134318	ENST00000315872	T	0.61510	0.1	2.27	1.38	0.22167	.	.	.	.	.	T	0.36771	0.0979	N	0.22421	0.69	0.80722	D	1	B	0.28439	0.212	B	0.15870	0.014	T	0.15607	-1.0431	9	0.49607	T	0.09	.	7.3265	0.26557	0.1372:0.0:0.8628:0.0	.	5	O75116	ROCK2_HUMAN	S	5	ENSP00000317985:P5S	ENSP00000261535:P5S	P	-	1	0	ROCK2	11401701	0.905000	0.30787	0.619000	0.29118	0.989000	0.77384	0.750000	0.26334	0.502000	0.28037	0.455000	0.32223	CCG		0.766	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			3	5	0	0	0	0.009096	0	3	5				
MYCN	4613	broad.mit.edu	37	2	16082194	16082194	+	Missense_Mutation	SNP	G	G	T	rs373683425	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:16082194G>T	ENST00000281043.3	+	2	305	c.8G>T	c.(7-9)aGc>aTc	p.S3I	MYCNOS_ENST00000420452.1_RNA|MYCNOS_ENST00000419083.1_RNA|MYCNOS_ENST00000448719.1_RNA|MYCNOS_ENST00000439180.1_RNA|MYCNOS_ENST00000453400.1_RNA	NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	3					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S3I(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			CCGATGCCGAGCTGCTCCACG	0.632			A		neuroblastoma																																		uc002rci.2		NA		Dom	yes		2	2p24.1	4613	A	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""			O			neuroblastoma		1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5						c.(7-9)AGC>ATC		v-myc myelocytomatosis viral related oncogene,							43.0	45.0	44.0					2																	16082194		2203	4300	6503	SO:0001583	missense	4613				regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr2:16082194G>T	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.8G>T	2.37:g.16082194G>T	ENSP00000281043:p.Ser3Ile		Somatic				MYCNOS_uc002rch.1_5'Flank|MYCN_uc010yjr.1_5'UTR	p.S3I	NM_005378	NP_005369	WXS	Illumina HiSeq	Unspecified	P04198	MYCN_HUMAN	GBM - Glioblastoma multiforme(3;0.000332)		2	308	+	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		3					Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	37	c.8G>T	CCDS1687.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168135	0.57476	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	D	0.81659	-1.52	3.38	2.46	0.29980	.	0.922344	0.09004	U	0.862530	T	0.70465	0.3227	L	0.36672	1.1	0.23735	N	0.996983	B	0.19331	0.035	B	0.09377	0.004	T	0.61907	-0.6966	10	0.87932	D	0	-7.8985	6.2253	0.20703	0.2327:0.0:0.7673:0.0	.	3	P04198	MYCN_HUMAN	I	3	ENSP00000281043:S3I	ENSP00000281043:S3I	S	+	2	0	MYCN	15999645	0.002000	0.14202	1.000000	0.80357	0.983000	0.72400	0.269000	0.18589	1.604000	0.50143	0.561000	0.74099	AGC		0.632	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378		5	25	1	0	3.59834e-05	0.001168	4.1491e-05	5	25				
RAD51AP2	729475	broad.mit.edu	37	2	17696481	17696481	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:17696481G>T	ENST00000399080.2	-	1	3225	c.3202C>A	c.(3202-3204)Cca>Aca	p.P1068T		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1068								p.P1068T(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GATCTACTTGGATAACAACTC	0.323																																							uc002rcl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3202-3204)CCA>ACA		RAD51 associated protein 2							89.0	81.0	83.0					2																	17696481		1821	4075	5896	SO:0001583	missense	729475							g.chr2:17696481G>T	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.3202C>A	2.37:g.17696481G>T	ENSP00000382030:p.Pro1068Thr		Somatic				RAD51AP2_uc010exn.1_Missense_Mutation_p.P1059T	p.P1068T	NM_001099218	NP_001092688	WXS	Illumina HiSeq	Unspecified	Q09MP3	R51A2_HUMAN			1	3226	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		1068						Missense_Mutation	SNP	ENST00000399080.2	37	c.3202C>A	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138592	0.37728	.	.	ENSG00000214842	ENST00000399080	T	0.23552	1.9	5.23	-1.95	0.07548	.	.	.	.	.	T	0.14399	0.0348	N	0.24115	0.695	0.09310	N	1	B	0.25312	0.123	B	0.28638	0.092	T	0.30937	-0.9961	9	0.49607	T	0.09	.	3.7065	0.08403	0.4026:0.0:0.1861:0.4113	.	1068	Q09MP3	R51A2_HUMAN	T	1068	ENSP00000382030:P1068T	ENSP00000382030:P1068T	P	-	1	0	RAD51AP2	17559962	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	0.030000	0.13688	-0.202000	0.10268	-0.140000	0.14226	CCA		0.323	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218		4	20	1	0	0.00909568	0.009096	0.00968112	4	20				
ITSN2	50618	broad.mit.edu	37	2	24443819	24443819	+	Missense_Mutation	SNP	C	C	A	rs150580767		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:24443819C>A	ENST00000355123.4	-	30	4137	c.3694G>T	c.(3694-3696)Gtc>Ttc	p.V1232F	AC009228.1_ENST00000413989.1_RNA|AC009228.1_ENST00000430105.1_RNA|ITSN2_ENST00000361999.3_Missense_Mutation_p.V1205F|ITSN2_ENST00000406921.3_Missense_Mutation_p.V1232F	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1232	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)	p.V1231F(1)|p.V1232F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCACCTCGACGACGAGCTGA	0.552																																							uc002rfe.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(2)|ovary(1)|central_nervous_system(1)	4						c.(3694-3696)GTC>TTC		intersectin 2 isoform 1							189.0	163.0	172.0					2																	24443819		2203	4300	6503	SO:0001583	missense	50618				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chr2:24443819C>A	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.3694G>T	2.37:g.24443819C>A	ENSP00000347244:p.Val1232Phe		Somatic				ITSN2_uc002rff.2_Missense_Mutation_p.V1205F|ITSN2_uc002rfg.2_Missense_Mutation_p.V1232F	p.V1232F	NM_006277	NP_006268	WXS	Illumina HiSeq	Unspecified	Q9NZM3	ITSN2_HUMAN			30	3952	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1232			DH.		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	c.3694G>T	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	C	7.936	0.741811	0.15642	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.67865	-0.29;-0.29;-0.29;1.42	3.78	-1.18	0.09617	Dbl homology (DH) domain (5);	1.036020	0.07797	U	0.955875	T	0.54224	0.1845	L	0.61218	1.895	0.09310	N	1	P;P;P	0.38440	0.631;0.567;0.621	B;B;B	0.39119	0.118;0.227;0.291	T	0.39603	-0.9606	10	0.09590	T	0.72	.	1.304	0.02085	0.1437:0.3648:0.2558:0.2357	.	1232;1205;1232	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	F	1205;1232;1205;1232	ENSP00000354561:V1205F;ENSP00000347244:V1232F;ENSP00000370250:V1205F;ENSP00000384499:V1232F	ENSP00000347244:V1232F	V	-	1	0	ITSN2	24297323	0.000000	0.05858	0.058000	0.19502	0.879000	0.50718	-1.688000	0.01925	-0.246000	0.09611	-0.258000	0.10820	GTC		0.552	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277		18	137	1	0	6.49762e-13	0.006122	9.53547e-13	18	137				
ALK	238	broad.mit.edu	37	2	29498008	29498008	+	Silent	SNP	G	G	C	rs549825750		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:29498008G>C	ENST00000389048.3	-	11	2904	c.1998C>G	c.(1996-1998)ccC>ccG	p.P666P	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	666					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P666P(2)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AATTTTCCCCGGGTTTCAGCT	0.463			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	2	Substitution - coding silent(2)	p.P666L(1)	lung(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(1996-1998)CCC>CCG		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)						104.0	105.0	105.0					2																	29498008		2203	4300	6503	SO:0001819	synonymous_variant	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29498008G>C	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1998C>G	2.37:g.29498008G>C			Somatic					p.P666P	NM_004304	NP_004295	WXS	Illumina HiSeq	Unspecified	Q9UM73	ALK_HUMAN			11	2905	-	Acute lymphoblastic leukemia(172;0.155)		666			Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	c.1998C>G	CCDS33172.1																																																																																				0.463	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		13	54	0	0	0	0.003163	0	13	54				
ALK	238	broad.mit.edu	37	2	29498359	29498359	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:29498359G>A	ENST00000389048.3	-	10	2727	c.1821C>T	c.(1819-1821)ttC>ttT	p.F607F	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	607	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F607F(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TCTGCAGCCAGAACCTGTACA	0.527			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(1819-1821)TTC>TTT		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)						108.0	95.0	99.0					2																	29498359		2203	4300	6503	SO:0001819	synonymous_variant	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29498359G>A	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1821C>T	2.37:g.29498359G>A			Somatic					p.F607F	NM_004304	NP_004295	WXS	Illumina HiSeq	Unspecified	Q9UM73	ALK_HUMAN			10	2728	-	Acute lymphoblastic leukemia(172;0.155)		607			MAM 2.|Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	c.1821C>T	CCDS33172.1																																																																																				0.527	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		26	47	0	0	0	0.00632	0	26	47				
LTBP1	4052	broad.mit.edu	37	2	33246225	33246225	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:33246225C>A	ENST00000404816.2	+	3	1168	c.815C>A	c.(814-816)aCc>aAc	p.T272N	LTBP1_ENST00000354476.3_Missense_Mutation_p.T272N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	272					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.T272N(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ATGACCTTAACCCTCAAGCCG	0.498																																							uc002ros.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(814-816)ACC>AAC		latent transforming growth factor beta binding							110.0	105.0	107.0					2																	33246225		2203	4300	6503	SO:0001583	missense	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33246225C>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.815C>A	2.37:g.33246225C>A	ENSP00000386043:p.Thr272Asn		Somatic					p.T272N	NM_206943	NP_996826	WXS	Illumina HiSeq	Unspecified	Q14766	LTBP1_HUMAN			3	815	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	272					A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	c.815C>A	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050758	0.55218	.	.	ENSG00000049323	ENST00000404816;ENST00000354476	T;T	0.80994	-1.44;-1.43	5.17	5.17	0.71159	.	.	.	.	.	T	0.82153	0.4975	N	0.22421	0.69	0.80722	D	1	D	0.76494	0.999	D	0.64877	0.93	T	0.80042	-0.1548	9	0.25106	T	0.35	.	18.6817	0.91548	0.0:1.0:0.0:0.0	.	272	Q14766-4	.	N	272	ENSP00000386043:T272N;ENSP00000346467:T272N	ENSP00000346467:T272N	T	+	2	0	LTBP1	33099729	0.998000	0.40836	1.000000	0.80357	0.877000	0.50540	3.455000	0.52993	2.398000	0.81561	0.551000	0.68910	ACC		0.498	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		16	88	1	0	6.49762e-13	0.006122	9.53547e-13	16	88				
LINC01317	104355287	broad.mit.edu	37	2	33952176	33952176	+	lincRNA	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:33952176T>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA														p.T223S(1)									TTGACGGCCGTCAGGTTGGTC	0.587																																							uc002rpb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(667-669)ACG>TCG		RecName: Full=Myeloid-associated differentiation marker-like protein.;																																						151325							g.chr2:33952176T>A																													2.37:g.33952176T>A			Somatic					p.T223S	NR_003143		WXS	Illumina HiSeq	Unspecified					1	1109	-									Missense_Mutation	SNP	ENST00000366209.2	37	c.667A>T																																																																																					0.587	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA	OTTHUMT00000325406.1			5	5	0	0	0	0.001168	0	5	5				
PSME4	23198	broad.mit.edu	37	2	54114547	54114547	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:54114547T>A	ENST00000404125.1	-	40	4633	c.4578A>T	c.(4576-4578)atA>atT	p.I1526I	PSME4_ENST00000421748.2_Silent_p.I670I|PSME4_ENST00000476586.1_5'Flank	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1526					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.I1526I(1)|p.I1412I(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CATGAGGCGATATGGTTGGTG	0.378																																							uc002rxp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|breast(2)|pancreas(1)	5						c.(4576-4578)ATA>ATT		proteasome (prosome, macropain) activator							110.0	102.0	105.0					2																	54114547		2203	4300	6503	SO:0001819	synonymous_variant	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54114547T>A	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.4578A>T	2.37:g.54114547T>A			Somatic				PSME4_uc010yop.1_Silent_p.I1412I|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Silent_p.I901I|PSME4_uc010fbv.1_Silent_p.I670I|PSME4_uc010fbt.1_Silent_p.I13I	p.I1526I	NM_014614	NP_055429	WXS	Illumina HiSeq	Unspecified	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		40	4634	-			1526					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	37	c.4578A>T	CCDS33197.2																																																																																				0.378	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		9	35	0	0	0	0.004482	0	9	35				
ZNF638	27332	broad.mit.edu	37	2	71577285	71577285	+	Missense_Mutation	SNP	G	G	T	rs192912662		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:71577285G>T	ENST00000409544.1	+	2	1831	c.1201G>T	c.(1201-1203)Gcc>Tcc	p.A401S	ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Missense_Mutation_p.A401S|ZNF638_ENST00000355812.3_Missense_Mutation_p.A401S|ZNF638_ENST00000377802.2_Missense_Mutation_p.A401S	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	401					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A401S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ACATGCTGATGCCCAGAAGAT	0.408													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21565	0.0		0.0	False		,,,				2504	0.0						uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(1201-1203)GCC>TCC		zinc finger protein 638							141.0	139.0	139.0					2																	71577285		2203	4300	6503	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71577285G>T	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1201G>T	2.37:g.71577285G>T	ENSP00000386433:p.Ala401Ser		Somatic				ZNF638_uc010fec.2_Missense_Mutation_p.A507S|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Missense_Mutation_p.A401S|ZNF638_uc002shy.2_Missense_Mutation_p.A401S|ZNF638_uc002shz.2_Missense_Mutation_p.A401S|ZNF638_uc002sia.2_Missense_Mutation_p.A401S|ZNF638_uc002sib.1_Missense_Mutation_p.A401S	p.A401S	NM_014497	NP_055312	WXS	Illumina HiSeq	Unspecified	Q14966	ZN638_HUMAN			2	1520	+			401					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.1201G>T	CCDS1917.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	13.11	2.138687	0.37728	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.73258	-0.14;-0.73;0.44;-0.13;1.45;1.45	5.85	4.97	0.65823	.	0.400654	0.27469	N	0.019239	T	0.61148	0.2324	N	0.24115	0.695	0.32138	N	0.585842	P;P;P;P;P	0.50272	0.933;0.882;0.868;0.792;0.675	P;B;P;B;B	0.48982	0.597;0.42;0.521;0.321;0.42	T	0.65586	-0.6132	10	0.29301	T	0.29	0.0269	8.9031	0.35507	0.1671:0.0:0.8329:0.0	.	507;401;401;401;401	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	S	401;507;401;401;401;401	ENSP00000386669:A401S;ENSP00000438189:A507S;ENSP00000348066:A401S;ENSP00000367033:A401S;ENSP00000264447:A401S;ENSP00000386433:A401S	ENSP00000264447:A401S	A	+	1	0	ZNF638	71430793	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.089000	0.30890	1.479000	0.48272	0.655000	0.94253	GCC		0.408	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		20	120	1	0	1.00905e-13	0.008871	1.52708e-13	20	120				
C2orf78	388960	broad.mit.edu	37	2	74043796	74043796	+	Missense_Mutation	SNP	A	A	G	rs190141035		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:74043796A>G	ENST00000409561.1	+	3	2567	c.2446A>G	c.(2446-2448)Aaa>Gaa	p.K816E		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	816								p.K816E(1)|p.K786E(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						ATCAGCCTACAAAACATCATC	0.512													A|||	1	0.000199681	0.0	0.0014	5008	,	,		22036	0.0		0.0	False		,,,				2504	0.0						uc002sjr.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2446-2448)AAA>GAA		hypothetical protein LOC388960							73.0	71.0	71.0					2																	74043796		2005	4166	6171	SO:0001583	missense	388960							g.chr2:74043796A>G	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2446A>G	2.37:g.74043796A>G	ENSP00000387124:p.Lys816Glu		Somatic					p.K816E	NM_001080474	NP_001073943	WXS	Illumina HiSeq	Unspecified	A6NCI8	CB078_HUMAN			3	2567	+			816						Missense_Mutation	SNP	ENST00000409561.1	37	c.2446A>G	CCDS46338.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	14.03	2.413143	0.42817	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.54479	0.57	4.99	2.59	0.31030	.	0.568057	0.14543	N	0.313183	T	0.44685	0.1305	L	0.51422	1.61	0.09310	N	1	P	0.41848	0.763	B	0.39840	0.311	T	0.33420	-0.9869	10	0.66056	D	0.02	-7.6157	6.8181	0.23843	0.8102:0.0:0.1898:0.0	.	816	A6NCI8	CB078_HUMAN	E	816;786	ENSP00000387124:K816E	ENSP00000340692:K786E	K	+	1	0	C2orf78	73897304	0.001000	0.12720	0.475000	0.27278	0.052000	0.14988	0.242000	0.18087	0.347000	0.23924	0.460000	0.39030	AAA		0.512	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		6	32	0	0	0	0.001168	0	6	32				
IGKV1-17	28937	broad.mit.edu	37	2	89417281	89417281	+	RNA	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:89417281G>A	ENST00000490686.1	-	0	54									immunoglobulin kappa variable 1-17																		AGGAGCCCCAGGAGCTGAGCG	0.537																																							uc010ytr.1		NA																	0					NA						c.e41-1		Parts of antibodies, mostly variable regions.							142.0	147.0	145.0					2																	89417281		1890	4116	6006			0							g.chr2:89417281G>A	X72808		2p11.2	2012-02-08			ENSG00000240382	ENSG00000240382		"""Immunoglobulins / IGK locus"""	5733	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV117, A30			OTTHUMG00000151650		2.37:g.89417281G>A			Somatic				uc002stl.2_Intron				WXS	Illumina HiSeq	Unspecified					41		-									Splice_Site	SNP	ENST00000490686.1	37	c.4448_splice																																																																																					0.537	IGKV1-17-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323399.1	NG_000834		6	234	0	0	0	0.008291	0	6	234				
TMEM131	23505	broad.mit.edu	37	2	98392318	98392318	+	Silent	SNP	C	C	T	rs61745536	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:98392318C>T	ENST00000186436.5	-	32	4536	c.4308G>A	c.(4306-4308)ccG>ccA	p.P1436P		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1436	Lys-rich.					integral component of membrane (GO:0016021)		p.P1323P(1)|p.P1436P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CCTTGAGGAGCGGTTCTGTGT	0.517													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18241	0.0		0.0	False		,,,				2504	0.0						uc002syh.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|central_nervous_system(2)	6						c.(4306-4308)CCG>CCA		RW1 protein		C		5,4029		0,5,2012	139.0	145.0	143.0		4308	-10.4	0.3	2	dbSNP_129	143	1,8373		0,1,4186	no	coding-synonymous	TMEM131	NM_015348.1		0,6,6198	TT,TC,CC		0.0119,0.1239,0.0484		1436/1884	98392318	6,12402	2017	4187	6204	SO:0001819	synonymous_variant	23505					integral to membrane		g.chr2:98392318C>T	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.4308G>A	2.37:g.98392318C>T			Somatic					p.P1436P	NM_015348	NP_056163	WXS	Illumina HiSeq	Unspecified	Q92545	TM131_HUMAN			32	4537	-			1436			Lys-rich.			Silent	SNP	ENST00000186436.5	37	c.4308G>A	CCDS46368.1																																																																																				0.517	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		4	28	0	0	0	0.009096	0	4	28				
NPHP1	4867	broad.mit.edu	37	2	110917777	110917777	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:110917777A>C	ENST00000393272.3	-	11	1272	c.1175T>G	c.(1174-1176)aTg>aGg	p.M392R	NPHP1_ENST00000355301.4_Missense_Mutation_p.M274R|NPHP1_ENST00000316534.4_Missense_Mutation_p.M393R|NPHP1_ENST00000417665.1_Missense_Mutation_p.M336R|NPHP1_ENST00000445609.2_Missense_Mutation_p.M337R	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	392					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.M393R(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						AAGAGGAATCATTTTACAGCT	0.333																																							uc002tfn.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1174-1176)ATG>AGG		nephrocystin 1 isoform 2							121.0	120.0	120.0					2																	110917777		2203	4300	6503	SO:0001583	missense	4867				actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity	g.chr2:110917777A>C	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1175T>G	2.37:g.110917777A>C	ENSP00000376953:p.Met392Arg		Somatic				NPHP1_uc002tfm.3_Missense_Mutation_p.M337R|NPHP1_uc002tfl.3_Missense_Mutation_p.M393R|NPHP1_uc002tfo.3_Missense_Mutation_p.M274R|NPHP1_uc010ywx.1_Missense_Mutation_p.M336R|NPHP1_uc010fjv.1_Missense_Mutation_p.M336R	p.M392R	NM_207181	NP_997064	WXS	Illumina HiSeq	Unspecified	O15259	NPHP1_HUMAN			11	1269	-			392					O14837	Missense_Mutation	SNP	ENST00000393272.3	37	c.1175T>G	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.572688	0.28092	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.7	4.54	0.55810	.	0.079811	0.85682	D	0.000000	T	0.79639	0.4480	L	0.55990	1.75	0.80722	D	1	D;P;D;D;D;D	0.69078	0.996;0.944;0.96;0.984;0.997;0.981	P;P;P;P;D;P	0.63113	0.818;0.563;0.677;0.563;0.911;0.747	T	0.77688	-0.2494	10	0.41790	T	0.15	-31.7208	9.9308	0.41521	0.9193:0.0:0.0807:0.0	.	336;336;274;392;337;393	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	R	393;337;392;274;336	ENSP00000313169:M393R;ENSP00000389879:M337R;ENSP00000376953:M392R;ENSP00000347452:M274R;ENSP00000402176:M336R	ENSP00000313169:M393R	M	-	2	0	NPHP1	110275066	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.789000	0.55454	0.981000	0.38548	0.455000	0.32223	ATG		0.333	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272		5	108	0	0	0	0.001168	0	5	108				
ZC3H6	376940	broad.mit.edu	37	2	113089652	113089652	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:113089652G>T	ENST00000409871.1	+	12	3558	c.3157G>T	c.(3157-3159)Gat>Tat	p.D1053Y	ZC3H6_ENST00000343936.4_Missense_Mutation_p.D1053Y|AC115115.2_ENST00000607612.1_RNA	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1053							metal ion binding (GO:0046872)	p.D1053Y(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						TGACCCTAGGGATCACGGTTC	0.453																																							uc002thq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3157-3159)GAT>TAT		zinc finger CCCH-type domain containing 6							67.0	61.0	63.0					2																	113089652		1907	4135	6042	SO:0001583	missense	376940						nucleic acid binding|zinc ion binding	g.chr2:113089652G>T	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3157G>T	2.37:g.113089652G>T	ENSP00000386764:p.Asp1053Tyr		Somatic					p.D1053Y	NM_198581	NP_940983	WXS	Illumina HiSeq	Unspecified	P61129	ZC3H6_HUMAN			12	3551	+			1053					A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	37	c.3157G>T	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.817117	0.32145	.	.	ENSG00000188177	ENST00000409871;ENST00000343936	T;T	0.14766	2.48;2.48	5.33	5.33	0.75918	.	0.891644	0.09991	N	0.729777	T	0.14442	0.0349	L	0.34521	1.04	0.34772	D	0.733861	B	0.33448	0.412	B	0.37833	0.259	T	0.14008	-1.0488	10	0.54805	T	0.06	-1.6716	9.7019	0.40192	0.1546:0.0:0.8454:0.0	.	1053	P61129	ZC3H6_HUMAN	Y	1053	ENSP00000386764:D1053Y;ENSP00000340298:D1053Y	ENSP00000340298:D1053Y	D	+	1	0	ZC3H6	112806123	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	4.193000	0.58385	2.473000	0.83533	0.591000	0.81541	GAT		0.453	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581		11	31	1	0	0.000673444	0.008291	0.00074607	11	31				
SLC20A1	6574	broad.mit.edu	37	2	113417307	113417307	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:113417307T>C	ENST00000272542.3	+	8	2114	c.1575T>C	c.(1573-1575)ttT>ttC	p.F525F		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	525					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)	p.F525F(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						CAGCCTGCTTTGGGTCATTCG	0.448																																							uc002tib.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1573-1575)TTT>TTC		solute carrier family 20 (phosphate							126.0	121.0	123.0					2																	113417307		2203	4300	6503	SO:0001819	synonymous_variant	6574				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity	g.chr2:113417307T>C		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1575T>C	2.37:g.113417307T>C			Somatic				SLC20A1_uc002tic.1_Silent_p.F337F	p.F525F	NM_005415	NP_005406	WXS	Illumina HiSeq	Unspecified	Q8WUM9	S20A1_HUMAN			8	2021	+			525			Helical; (Potential).		Q08344|Q6DHX8|Q9UQ82	Silent	SNP	ENST00000272542.3	37	c.1575T>C	CCDS2099.1																																																																																				0.448	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415		55	92	0	0	0	0.01441	0	55	92				
PTPN4	5775	broad.mit.edu	37	2	120725423	120725423	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:120725423G>A	ENST00000263708.2	+	26	3340	c.2569G>A	c.(2569-2571)Gga>Aga	p.G857R	PTPN4_ENST00000544261.1_Missense_Mutation_p.G490R	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	857	Substrate binding. {ECO:0000250}.|Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.G857R(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TGCTGGAATCGGAAGAACTGG	0.358																																							uc002tmf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2569-2571)GGA>AGA		protein tyrosine phosphatase, non-receptor type	Alendronate(DB00630)						154.0	155.0	154.0					2																	120725423		2203	4300	6503	SO:0001583	missense	5775					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity	g.chr2:120725423G>A		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2569G>A	2.37:g.120725423G>A	ENSP00000263708:p.Gly857Arg		Somatic				PTPN4_uc010flj.1_Missense_Mutation_p.G570R|PTPN4_uc010yyr.1_Missense_Mutation_p.G490R	p.G857R	NM_002830	NP_002821	WXS	Illumina HiSeq	Unspecified	P29074	PTN4_HUMAN			26	3340	+			857			Tyrosine-protein phosphatase.|Substrate binding (By similarity).		B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	c.2569G>A	CCDS2129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.931895|4.931895	0.92389|0.92389	.|.	.|.	ENSG00000088179|ENSG00000088179	ENST00000263708;ENST00000544261|ENST00000441089	T;T|.	0.29142|.	1.58;1.58|.	5.2|5.2	5.2|5.2	0.72013|0.72013	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.92264|0.92264	0.7546|0.7546	H|H	0.99867|0.99867	4.865|4.865	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.61722|.	0.893|.	D|D	0.96069|0.96069	0.9044|0.9044	10|5	0.87932|.	D|.	0|.	.|.	18.7366|18.7366	0.91757|0.91757	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	857|.	P29074|.	PTN4_HUMAN|.	R|Q	857;490|140	ENSP00000263708:G857R;ENSP00000445841:G490R|.	ENSP00000263708:G857R|.	G|R	+|+	1|2	0|0	PTPN4|PTPN4	120441893|120441893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.756000|9.756000	0.98918|0.98918	2.426000|2.426000	0.82243|0.82243	0.585000|0.585000	0.79938|0.79938	GGA|CGG		0.358	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			38	90	0	0	0	0.006999	0	38	90				
GLI2	2736	broad.mit.edu	37	2	121554950	121554950	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:121554950G>T	ENST00000452319.1	+	2	114	c.54G>T	c.(52-54)ggG>ggT	p.G18G	GLI2_ENST00000361492.4_Silent_p.G18G|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.G18G(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCAAAAGTGGGATCCTGGAGG	0.592																																							uc010flp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13						c.(52-54)GGG>GGT		GLI-Kruppel family member GLI2							95.0	112.0	106.0					2																	121554950		2203	4300	6503	SO:0001819	synonymous_variant	2736				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:121554950G>T		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.54G>T	2.37:g.121554950G>T			Somatic				GLI2_uc010yyu.1_Silent_p.G18G|GLI2_uc002tmp.1_Silent_p.G18G|GLI2_uc010fln.1_RNA|GLI2_uc002tmq.1_5'UTR|GLI2_uc002tmr.1_5'UTR|GLI2_uc002tmt.3_5'UTR|GLI2_uc002tmu.3_5'UTR|GLI2_uc002tmv.1_Silent_p.G18G|GLI2_uc010flo.1_5'UTR|GLI2_uc002tmw.1_Silent_p.G18G	p.G18G	NM_005270	NP_005261	WXS	Illumina HiSeq	Unspecified	P10070	GLI2_HUMAN			1	84	+	Renal(3;0.0496)	Prostate(154;0.0623)	18						Silent	SNP	ENST00000452319.1	37	c.54G>T	CCDS33283.1																																																																																				0.592	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		55	100	1	0	3.76525e-18	0.01441	6.16627e-18	55	100				
GLI2	2736	broad.mit.edu	37	2	121708821	121708821	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:121708821C>A	ENST00000452319.1	+	4	317	c.257C>A	c.(256-258)cCc>cAc	p.P86H	GLI2_ENST00000361492.4_Missense_Mutation_p.P86H|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.P86H(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTCTGCAGGCCCCCTGCCCTC	0.622																																							uc010flp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13						c.(256-258)CCC>CAC		GLI-Kruppel family member GLI2							99.0	112.0	107.0					2																	121708821		2203	4299	6502	SO:0001583	missense	2736				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:121708821C>A		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.257C>A	2.37:g.121708821C>A	ENSP00000390436:p.Pro86His		Somatic				GLI2_uc010yyu.1_Missense_Mutation_p.P86H|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_5'UTR|GLI2_uc002tmw.1_Missense_Mutation_p.P86H	p.P86H	NM_005270	NP_005261	WXS	Illumina HiSeq	Unspecified	P10070	GLI2_HUMAN			3	287	+	Renal(3;0.0496)	Prostate(154;0.0623)	86						Missense_Mutation	SNP	ENST00000452319.1	37	c.257C>A	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146192	0.37923	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.71341	-0.56;-0.56	5.28	5.28	0.74379	.	0.060591	0.64402	D	0.000002	D	0.82770	0.5109	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	0.976;1.0;0.999	P;D;P	0.67231	0.693;0.95;0.879	D	0.84499	0.0615	10	0.87932	D	0	.	15.4809	0.75524	0.0:0.8615:0.1385:0.0	.	86;86;86	B4DT63;P10070;Q0VGA0	.;GLI2_HUMAN;.	H	86	ENSP00000390436:P86H;ENSP00000354586:P86H	ENSP00000354586:P86H	P	+	2	0	GLI2	121425291	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	7.273000	0.78527	2.751000	0.94390	0.555000	0.69702	CCC		0.622	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		47	116	1	0	3.76343e-11	0.01441	5.30479e-11	47	116				
MYO7B	4648	broad.mit.edu	37	2	128346070	128346070	+	Silent	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:128346070A>G	ENST00000409816.2	+	14	1826	c.1794A>G	c.(1792-1794)gcA>gcG	p.A598A	MYO7B_ENST00000389524.4_Silent_p.A598A|MYO7B_ENST00000428314.1_Silent_p.A598A			Q6PIF6	MYO7B_HUMAN	myosin VIIB	598	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A598A(2)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TGGAGTTAGCAGAGACCAAGC	0.542																																							uc002top.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(1792-1794)GCA>GCG		myosin VIIB							78.0	83.0	82.0					2																	128346070		1975	4142	6117	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128346070A>G		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1794A>G	2.37:g.128346070A>G			Somatic					p.A598A	NM_001080527	NP_001073996	WXS	Illumina HiSeq	Unspecified	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	15	1847	+	Colorectal(110;0.1)		598			Myosin head-like.		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.1794A>G	CCDS46405.1																																																																																				0.542	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		12	71	0	0	0	0.001855	0	12	71				
PLEKHB2	55041	broad.mit.edu	37	2	131883346	131883346	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:131883346A>T	ENST00000403716.1	+	3	618	c.58A>T	c.(58-60)Aag>Tag	p.K20*	PLEKHB2_ENST00000409279.1_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000409158.1_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000439822.2_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000303908.3_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000234115.6_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000438882.2_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000409612.1_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000404460.1_Nonsense_Mutation_p.K20*|PLEKHB2_ENST00000538982.1_De_novo_Start_InFrame	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	20	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					endosome (GO:0005768)|membrane (GO:0016020)		p.K20*(2)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GAAGCGCTGGAAGAAGAACTG	0.418																																							uc002tsg.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(58-60)AAG>TAG		pleckstrin homology domain containing, family B							94.0	87.0	89.0					2																	131883346		2203	4300	6503	SO:0001587	stop_gained	55041					membrane	protein binding	g.chr2:131883346A>T		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.58A>T	2.37:g.131883346A>T	ENSP00000385892:p.Lys20*		Somatic				PLEKHB2_uc002tsh.2_Nonsense_Mutation_p.K20*|PLEKHB2_uc002tsj.3_Nonsense_Mutation_p.K20*|PLEKHB2_uc002tsf.3_Nonsense_Mutation_p.K20*|PLEKHB2_uc010zao.1_5'UTR|PLEKHB2_uc010zap.1_Nonsense_Mutation_p.K20*|PLEKHB2_uc010zaq.1_Nonsense_Mutation_p.K20*|PLEKHB2_uc002tsi.3_Nonsense_Mutation_p.K61*	p.K20*	NM_001100623	NP_001094093	WXS	Illumina HiSeq	Unspecified	Q96CS7	PKHB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0828)	3	618	+			20			PH.		B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Nonsense_Mutation	SNP	ENST00000403716.1	37	c.58A>T	CCDS46413.1	.	.	.	.	.	.	.	.	.	.	A	41	9.032760	0.99042	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000439822;ENST00000438882;ENST00000404460;ENST00000409612;ENST00000409279;ENST00000303908	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1589	12.8138	0.57654	1.0:0.0:0.0:0.0	.	.	.	.	X	20	.	ENSP00000234115:K20X	K	+	1	0	PLEKHB2	131599816	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.476000	0.73587	1.978000	0.57642	0.379000	0.24179	AAG		0.418	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958		9	31	0	0	0	0.004482	0	9	31				
NCKAP5	344148	broad.mit.edu	37	2	133541592	133541592	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:133541592G>T	ENST00000409261.1	-	14	3165	c.2792C>A	c.(2791-2793)cCc>cAc	p.P931H	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.P931H	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	931	Poly-Pro.			PP -> QS (in Ref. 5; BAA22433). {ECO:0000305}.				p.P931H(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCCTGGAGGGGGCGGAGGGGA	0.622																																							uc002ttp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2791-2793)CCC>CAC		Nck-associated protein 5 isoform 1							18.0	20.0	19.0					2																	133541592		1941	4115	6056	SO:0001583	missense	344148						protein binding	g.chr2:133541592G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2792C>A	2.37:g.133541592G>T	ENSP00000387128:p.Pro931His		Somatic				NCKAP5_uc002ttq.2_Intron	p.P931H	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	3166	-			931	PP -> QS (in Ref. 5; BAA22433).		Poly-Pro.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.2792C>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	g	14.10	2.434273	0.43224	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12774	2.65;2.65	5.18	5.18	0.71444	.	0.657771	0.12430	U	0.469676	T	0.19927	0.0479	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	P	0.61592	0.891	T	0.00847	-1.1542	10	0.33940	T	0.23	.	10.8251	0.46627	0.0925:0.0:0.9075:0.0	.	931	O14513	NCKP5_HUMAN	H	931	ENSP00000387128:P931H;ENSP00000380603:P931H	ENSP00000380603:P931H	P	-	2	0	NCKAP5	133258062	1.000000	0.71417	0.776000	0.31678	0.165000	0.22458	4.124000	0.57924	2.717000	0.92951	0.645000	0.84053	CCC		0.622	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		8	30	1	0	0.00307968	0.00308	0.00334084	8	30				
THSD7B	80731	broad.mit.edu	37	2	138169390	138169390	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:138169390C>A	ENST00000409968.1	+	14	3085	c.2907C>A	c.(2905-2907)gcC>gcA	p.A969A	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Silent_p.A969A|THSD7B_ENST00000413152.2_Silent_p.A938A			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	969	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.A938A(1)|p.A969A(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GAGCAGTAGCCTGTTCTGATA	0.512																																							uc002tva.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(2812-2814)GCC>GCA		thrombospondin, type I, domain containing 7B							61.0	63.0	62.0					2																	138169390		1952	4145	6097	SO:0001819	synonymous_variant	80731							g.chr2:138169390C>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2907C>A	2.37:g.138169390C>A			Somatic				THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Silent_p.A828A	p.A938A	NM_001080427	NP_001073896	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(221;0.19)	13	2814	+									Silent	SNP	ENST00000409968.1	37	c.2814C>A																																																																																					0.512	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		22	46	1	0	7.41877e-09	0.012319	9.96025e-09	22	46				
LRP1B	53353	broad.mit.edu	37	2	141625343	141625343	+	Silent	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:141625343A>T	ENST00000389484.3	-	27	5366	c.4395T>A	c.(4393-4395)ggT>ggA	p.G1465G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1465					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G1465G(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTATTCATGACCTCGGATGA	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4393-4395)GGT>GGA		low density lipoprotein-related protein 1B							124.0	124.0	124.0					2																	141625343		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141625343A>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4395T>A	2.37:g.141625343A>T		TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Silent_p.G647G	p.G1465G	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	27	5367	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1465			Extracellular (Potential).|LDL-receptor class B 12.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.4395T>A	CCDS2182.1																																																																																				0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		40	57	0	0	0	0.00874	0	40	57				
SCN7A	6332	broad.mit.edu	37	2	167322326	167322326	+	Missense_Mutation	SNP	A	A	T	rs372089190		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:167322326A>T	ENST00000409855.1	-	7	962	c.836T>A	c.(835-837)cTg>cAg	p.L279Q		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	279					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L279Q(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCTGTTGTGCAGGGTTTCATT	0.383																																							uc002udu.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(835-837)CTG>CAG		sodium channel, voltage-gated, type VII, alpha							121.0	115.0	117.0					2																	167322326		1828	4086	5914	SO:0001583	missense	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167322326A>T	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.836T>A	2.37:g.167322326A>T	ENSP00000386796:p.Leu279Gln		Somatic				SCN7A_uc010fpm.1_RNA	p.L279Q	NM_002976	NP_002967	WXS	Illumina HiSeq	Unspecified	Q01118	SCN7A_HUMAN			7	963	-			279						Missense_Mutation	SNP	ENST00000409855.1	37	c.836T>A	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081120	0.55753	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98455	-4.32;-4.31;-4.94	4.84	3.64	0.41730	Ion transport (1);	0.760251	0.11101	N	0.599695	D	0.97455	0.9167	L	0.28556	0.865	0.09310	N	1	D	0.58970	0.984	P	0.60541	0.876	D	0.92557	0.6055	10	0.66056	D	0.02	.	10.2875	0.43575	0.8517:0.0:0.0:0.1483	.	279	Q01118	SCN7A_HUMAN	Q	279	ENSP00000386796:L279Q;ENSP00000413699:L279Q;ENSP00000403846:L279Q	ENSP00000259060:L279Q	L	-	2	0	SCN7A	167030572	0.002000	0.14202	0.002000	0.10522	0.972000	0.66771	1.615000	0.36922	0.894000	0.36317	0.477000	0.44152	CTG		0.383	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			16	93	0	0	0	0.004007	0	16	93				
G6PC2	57818	broad.mit.edu	37	2	169763212	169763212	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:169763212T>G	ENST00000375363.3	+	4	571	c.479T>G	c.(478-480)aTt>aGt	p.I160S	G6PC2_ENST00000421979.1_Intron|G6PC2_ENST00000429379.2_Intron|G6PC2_ENST00000461586.1_Intron|SPC25_ENST00000472216.2_Intron	NM_021176.2	NP_066999.1	Q9NQR9	G6PC2_HUMAN	glucose-6-phosphatase, catalytic, 2	160					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)	p.I160S(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	13						TTTTGGTTGATTCAAATCAGT	0.353																																							uc002uem.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(478-480)ATT>AGT		islet-specific glucose-6-phosphatase-related							218.0	201.0	207.0					2																	169763212		2203	4300	6503	SO:0001583	missense	57818				gluconeogenesis|glucose homeostasis|glucose transport|regulation of insulin secretion|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity	g.chr2:169763212T>G	AF283575	CCDS2230.1, CCDS46443.1	2q24-q31	2008-02-05			ENSG00000152254	ENSG00000152254			28906	protein-coding gene	gene with protein product	"""islet specific glucose 6 phosphatase catalytic subunit related protein"""	608058				10078553, 10078554	Standard	NM_021176		Approved	IGRP	uc002uem.3	Q9NQR9	OTTHUMG00000132182	ENST00000375363.3:c.479T>G	2.37:g.169763212T>G	ENSP00000364512:p.Ile160Ser		Somatic				G6PC2_uc002uen.2_Intron|G6PC2_uc010fpv.2_Missense_Mutation_p.I44S	p.I160S	NM_021176	NP_066999	WXS	Illumina HiSeq	Unspecified	Q9NQR9	G6PC2_HUMAN			4	571	+			160			Helical; (Potential).		E9PAX2|Q6AHZ0	Missense_Mutation	SNP	ENST00000375363.3	37	c.479T>G	CCDS2230.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.676887	0.67928	.	.	ENSG00000152254	ENST00000375363	T	0.75821	-0.97	5.9	5.9	0.94986	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81093	0.4751	L	0.42245	1.32	0.80722	D	1	D	0.69078	0.997	D	0.67382	0.951	T	0.79988	-0.1571	10	0.38643	T	0.18	-20.316	16.3538	0.83227	0.0:0.0:0.0:1.0	.	160	Q9NQR9	G6PC2_HUMAN	S	160	ENSP00000364512:I160S	ENSP00000364512:I160S	I	+	2	0	G6PC2	169471458	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.600000	0.82769	2.254000	0.74563	0.524000	0.50904	ATT		0.353	G6PC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255234.2	NM_021176		38	65	0	0	0	0.00623	0	38	65				
LRP2	4036	broad.mit.edu	37	2	170063626	170063626	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:170063626T>C	ENST00000263816.3	-	39	6889	c.6604A>G	c.(6604-6606)Aga>Gga	p.R2202G		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2202					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R2202G(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAGAGGTATCTGTTCTTGGGA	0.458																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(6604-6606)AGA>GGA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						153.0	144.0	147.0					2																	170063626		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170063626T>C		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6604A>G	2.37:g.170063626T>C	ENSP00000263816:p.Arg2202Gly		Somatic					p.R2202G	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	39	6817	-			2202			LDL-receptor class B 22.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.6604A>G	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.175113	0.57692	.	.	ENSG00000081479	ENST00000263816	D	0.86497	-2.13	5.98	3.59	0.41128	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.85371	0.5681	N	0.11064	0.09	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82388	-0.0482	10	0.27082	T	0.32	.	13.0957	0.59190	0.0:0.0:0.2679:0.7321	.	2202	P98164	LRP2_HUMAN	G	2202	ENSP00000263816:R2202G	ENSP00000263816:R2202G	R	-	1	2	LRP2	169771872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.212000	0.42835	0.494000	0.27859	0.528000	0.53228	AGA		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		27	127	0	0	0	0.009535	0	27	127				
SCRN3	79634	broad.mit.edu	37	2	175268882	175268882	+	Missense_Mutation	SNP	G	G	A	rs140532560	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:175268882G>A	ENST00000272732.6	+	5	675	c.593G>A	c.(592-594)cGg>cAg	p.R198Q	SCRN3_ENST00000409673.3_Missense_Mutation_p.R191Q	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	198							dipeptidase activity (GO:0016805)	p.R191Q(1)|p.R198Q(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			AAGATTGCCCGGGAACACCCA	0.398													G|||	4	0.000798722	0.003	0.0	5008	,	,		14368	0.0		0.0	False		,,,				2504	0.0						uc002uiq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(592-594)CGG>CAG		secernin 3		G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	95.0	87.0	90.0		572,593	1.6	1.0	2	dbSNP_134	90	0,8600		0,0,4300	no	missense,missense	SCRN3	NM_001193528.1,NM_024583.4	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	191/418,198/425	175268882	1,13005	2203	4300	6503	SO:0001583	missense	79634				proteolysis		dipeptidase activity	g.chr2:175268882G>A	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.593G>A	2.37:g.175268882G>A	ENSP00000272732:p.Arg198Gln		Somatic				SCRN3_uc010zen.1_Missense_Mutation_p.R191Q|SCRN3_uc010zeo.1_5'UTR	p.R198Q	NM_024583	NP_078859	WXS	Illumina HiSeq	Unspecified	Q0VDG4	SCRN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.229)		5	681	+			198					B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	37	c.593G>A	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601440	0.28534	2.27E-4	0.0	ENSG00000144306	ENST00000458563;ENST00000409673;ENST00000272732;ENST00000548031	T;T;T;T	0.21191	2.21;2.02;2.02;2.23	5.42	1.65	0.23941	.	0.242891	0.40302	N	0.001136	T	0.19208	0.0461	M	0.77103	2.36	0.28471	N	0.915439	P;B	0.36577	0.558;0.151	B;B	0.28709	0.093;0.028	T	0.21381	-1.0247	10	0.16420	T	0.52	-0.3872	10.182	0.42975	0.2704:0.0:0.7296:0.0	.	191;198	B4DI11;Q0VDG4	.;SCRN3_HUMAN	Q	198;191;198;198	ENSP00000396884:R198Q;ENSP00000387142:R191Q;ENSP00000272732:R198Q;ENSP00000446727:R198Q	ENSP00000272732:R198Q	R	+	2	0	SCRN3	174977128	1.000000	0.71417	0.979000	0.43373	0.899000	0.52679	2.638000	0.46562	0.018000	0.15052	0.563000	0.77884	CGG		0.398	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583		4	39	0	0	0	0.000602	0	4	39				
NEUROD1	4760	broad.mit.edu	37	2	182543486	182543486	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:182543486G>A	ENST00000295108.3	-	2	559	c.102C>T	c.(100-102)caC>caT	p.H34H	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	34					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.H34H(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTCTGCCTCGTGCTCCTCGT	0.587																																							uc002uof.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(100-102)CAC>CAT		neurogenic differentiation 1							109.0	85.0	93.0					2																	182543486		2203	4300	6503	SO:0001819	synonymous_variant	4760				amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr2:182543486G>A	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.102C>T	2.37:g.182543486G>A			Somatic				CERKL_uc002uod.1_Intron	p.H34H	NM_002500	NP_002491	WXS	Illumina HiSeq	Unspecified	Q13562	NDF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		2	338	-			34					B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	c.102C>T	CCDS2283.1																																																																																				0.587	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		5	16	0	0	0	0.000602	0	5	16				
ZNF804A	91752	broad.mit.edu	37	2	185802769	185802769	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:185802769C>A	ENST00000302277.6	+	4	3240	c.2646C>A	c.(2644-2646)caC>caA	p.H882Q		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	882							metal ion binding (GO:0046872)	p.H882Q(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TGTCTTTCCACCCTAACAATC	0.373																																							uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(2644-2646)CAC>CAA		zinc finger protein 804A							95.0	86.0	89.0					2																	185802769		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185802769C>A	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2646C>A	2.37:g.185802769C>A	ENSP00000303252:p.His882Gln		Somatic					p.H882Q	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	3240	+			882					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.2646C>A	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	0.731	-0.779809	0.02929	.	.	ENSG00000170396	ENST00000302277	T	0.05258	3.47	5.42	3.55	0.40652	.	1.035180	0.07640	N	0.930082	T	0.04998	0.0134	L	0.27053	0.805	0.09310	N	1	B	0.23128	0.08	B	0.19946	0.027	T	0.47032	-0.9148	10	0.25751	T	0.34	0.0311	3.783	0.08687	0.1806:0.5754:0.1528:0.0913	.	882	Q7Z570	Z804A_HUMAN	Q	882	ENSP00000303252:H882Q	ENSP00000303252:H882Q	H	+	3	2	ZNF804A	185511014	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	-0.088000	0.11198	0.598000	0.29829	0.591000	0.81541	CAC		0.373	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		28	58	1	0	3.1745e-13	0.008361	4.70965e-13	28	58				
ZSWIM2	151112	broad.mit.edu	37	2	187692918	187692918	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:187692918C>A	ENST00000295131.2	-	9	1734	c.1695G>T	c.(1693-1695)gaG>gaT	p.E565D		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	565					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E565D(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TCTTGTTGTCCTCTCTTATTT	0.378																																							uc002upu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1693-1695)GAG>GAT		zinc finger, SWIM domain containing 2							112.0	111.0	111.0					2																	187692918		2203	4300	6503	SO:0001583	missense	151112				apoptosis		zinc ion binding	g.chr2:187692918C>A	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1695G>T	2.37:g.187692918C>A	ENSP00000295131:p.Glu565Asp		Somatic					p.E565D	NM_182521	NP_872327	WXS	Illumina HiSeq	Unspecified	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)		9	1735	-			565					B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	37	c.1695G>T	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	C	3.463	-0.109492	0.06924	.	.	ENSG00000163012	ENST00000295131	T	0.23950	1.88	5.46	-8.67	0.00863	.	0.589034	0.15811	N	0.243496	T	0.10121	0.0248	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.12941	-1.0528	10	0.31617	T	0.26	-3.9752	2.9272	0.05788	0.115:0.312:0.1055:0.4674	.	565	Q8NEG5	ZSWM2_HUMAN	D	565	ENSP00000295131:E565D	ENSP00000295131:E565D	E	-	3	2	ZSWIM2	187401163	0.000000	0.05858	0.017000	0.16124	0.011000	0.07611	-1.877000	0.01631	-0.745000	0.04772	-0.658000	0.03865	GAG		0.378	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		12	36	1	0	1.5842e-08	0.001855	2.09374e-08	12	36				
COL3A1	1281	broad.mit.edu	37	2	189856407	189856407	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:189856407G>C	ENST00000304636.3	+	13	1080	c.910G>C	c.(910-912)Gct>Cct	p.A304P	COL3A1_ENST00000317840.5_Missense_Mutation_p.A304P	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	304	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.A304_G309delAPGERG(1)|p.A304P(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TCCAAGAGGGGCTCCTGGTGA	0.463																																							uc002uqj.1		NA																	2	Substitution - Missense(1)|Deletion - In frame(1)		lung(2)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(910-912)GCT>CCT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						122.0	140.0	134.0					2																	189856407		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189856407G>C	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.910G>C	2.37:g.189856407G>C	ENSP00000304408:p.Ala304Pro		Somatic				COL3A1_uc010frw.1_RNA	p.A304P	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		13	1027	+			304			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.910G>C	CCDS2297.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.617|7.617	0.676025|0.676025	0.14841|0.14841	.|.	.|.	ENSG00000168542|ENSG00000168542	ENST00000304636;ENST00000317840|ENST00000450867	D;D|D	0.94417|0.99329	-3.42;-1.99|-5.75	5.79|5.79	-4.3|-4.3	0.03710|0.03710	.|.	0.608290|.	0.14576|.	N|.	0.311177|.	D|D	0.91442|0.91442	0.7299|0.7299	N|N	0.00538|0.00538	-1.39|-1.39	0.09310|0.09310	N|N	0.999996|0.999996	B|.	0.02656|.	0.0|.	B|.	0.08055|.	0.003|.	D|D	0.87789|0.87789	0.2617|0.2617	10|7	0.19147|0.87932	T|D	0.46|0	.|.	0.4499|0.4499	0.00500|0.00500	0.2238:0.2846:0.1922:0.2994|0.2238:0.2846:0.1922:0.2994	.|.	304|.	P02461|.	CO3A1_HUMAN|.	P|A	304|3	ENSP00000304408:A304P;ENSP00000315243:A304P|ENSP00000415346:G3A	ENSP00000304408:A304P|ENSP00000415346:G3A	A|G	+|+	1|2	0|0	COL3A1|COL3A1	189564652|189564652	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.215000|0.215000	0.24574|0.24574	-0.256000|-0.256000	0.08757|0.08757	-0.453000|-0.453000	0.07076|0.07076	-0.894000|-0.894000	0.02916|0.02916	GCT|GGC		0.463	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		21	166	0	0	0	0.00333	0	21	166				
HIBCH	26275	broad.mit.edu	37	2	191159310	191159310	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:191159310G>A	ENST00000359678.5	-	4	560	c.266C>T	c.(265-267)gCa>gTa	p.A89V	HIBCH_ENST00000392332.3_Missense_Mutation_p.A89V	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	89					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)	p.A89V(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			CTTTCCTCCTGCTCCCTTTAT	0.398																																							uc002uru.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(265-267)GCA>GTA		3-hydroxyisobutyryl-Coenzyme A hydrolase isoform							85.0	82.0	83.0					2																	191159310		2203	4300	6503	SO:0001583	missense	26275				branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding	g.chr2:191159310G>A	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.266C>T	2.37:g.191159310G>A	ENSP00000352706:p.Ala89Val		Somatic				HIBCH_uc002urv.2_Missense_Mutation_p.A89V	p.A89V	NM_014362	NP_055177	WXS	Illumina HiSeq	Unspecified	Q6NVY1	HIBCH_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)		4	349	-			89					D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	c.266C>T	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946692	0.53186	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.74737	-0.38;-0.87;-0.38	5.43	5.43	0.79202	Crotonase, core (1);	0.377447	0.31976	N	0.006768	T	0.66386	0.2784	M	0.64404	1.975	0.80722	D	1	P;P	0.42735	0.788;0.485	B;B	0.32980	0.156;0.047	T	0.70521	-0.4849	10	0.51188	T	0.08	1.6996	10.2198	0.43190	0.0899:0.0:0.9101:0.0	.	89;89	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	V	89;89;143	ENSP00000376144:A89V;ENSP00000352706:A89V;ENSP00000387247:A143V	ENSP00000352706:A89V	A	-	2	0	HIBCH	190867555	1.000000	0.71417	0.981000	0.43875	0.984000	0.73092	3.514000	0.53422	2.538000	0.85594	0.563000	0.77884	GCA		0.398	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1			21	41	0	0	0	0.004656	0	21	41				
SDPR	8436	broad.mit.edu	37	2	192700895	192700895	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:192700895G>A	ENST00000304141.4	-	2	1361	c.1032C>T	c.(1030-1032)agC>agT	p.S344S		NM_004657.5	NP_004648.1			serum deprivation response									p.S344S(1)		NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			CCACCAGAGCGCTGGCGAGGG	0.562																																							uc002utb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1030-1032)AGC>AGT		serum deprivation response protein	Phosphatidylserine(DB00144)						107.0	107.0	107.0					2																	192700895		2203	4300	6503	SO:0001819	synonymous_variant	8436					caveola|cytosol	phosphatidylserine binding|protein binding	g.chr2:192700895G>A	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1032C>T	2.37:g.192700895G>A			Somatic					p.S344S	NM_004657	NP_004648	WXS	Illumina HiSeq	Unspecified	O95810	SDPR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0647)		2	1362	-			344						Silent	SNP	ENST00000304141.4	37	c.1032C>T	CCDS2313.1																																																																																				0.562	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657		52	98	0	0	0	0.01441	0	52	98				
SDPR	8436	broad.mit.edu	37	2	192701129	192701129	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:192701129C>G	ENST00000304141.4	-	2	1127	c.798G>C	c.(796-798)gaG>gaC	p.E266D		NM_004657.5	NP_004648.1			serum deprivation response									p.E266D(1)		NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			TCTCTCTCCTCTCTACAGATA	0.453																																							uc002utb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(796-798)GAG>GAC		serum deprivation response protein	Phosphatidylserine(DB00144)						207.0	225.0	219.0					2																	192701129		2203	4300	6503	SO:0001583	missense	8436					caveola|cytosol	phosphatidylserine binding|protein binding	g.chr2:192701129C>G	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.798G>C	2.37:g.192701129C>G	ENSP00000305675:p.Glu266Asp		Somatic					p.E266D	NM_004657	NP_004648	WXS	Illumina HiSeq	Unspecified	O95810	SDPR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0647)		2	1128	-			266			Potential.			Missense_Mutation	SNP	ENST00000304141.4	37	c.798G>C	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.472025	0.63737	.	.	ENSG00000168497	ENST00000304141	T	0.68624	-0.34	5.01	1.91	0.25777	.	0.000000	0.85682	D	0.000000	T	0.78904	0.4357	M	0.81802	2.56	0.46113	D	0.998877	D	0.89917	1.0	D	0.83275	0.996	T	0.76849	-0.2807	10	0.72032	D	0.01	-34.5918	8.177	0.31287	0.0:0.519:0.0:0.481	.	266	O95810	SDPR_HUMAN	D	266	ENSP00000305675:E266D	ENSP00000305675:E266D	E	-	3	2	SDPR	192409374	0.837000	0.29446	0.987000	0.45799	0.925000	0.55904	-0.022000	0.12480	0.190000	0.20209	-0.244000	0.11960	GAG		0.453	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657		111	207	0	0	0	0.01441	0	111	207				
CLK1	1195	broad.mit.edu	37	2	201726036	201726036	+	Silent	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:201726036A>G	ENST00000321356.4	-	3	450	c.315T>C	c.(313-315)tcT>tcC	p.S105S	Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000434813.2_Silent_p.S147S|CLK1_ENST00000492793.1_5'UTR	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	105					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.S105S(2)|p.S147S(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CACTTCTACCAGAAGACTTGC	0.408																																							uc002uwe.2		NA																	3	Substitution - coding silent(3)	p.S105S(1)	lung(2)|pancreas(1)	pancreas(2)	2						c.(313-315)TCT>TCC		CDC-like kinase 1 isoform 1							189.0	187.0	188.0					2																	201726036		2203	4300	6503	SO:0001819	synonymous_variant	1195				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity	g.chr2:201726036A>G	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.315T>C	2.37:g.201726036A>G			Somatic				CLK1_uc010zhi.1_Silent_p.S147S|CLK1_uc002uwf.2_5'UTR|CLK1_uc002uwg.2_5'UTR|CLK1_uc010fsv.2_RNA	p.S105S	NM_004071	NP_004062	WXS	Illumina HiSeq	Unspecified	P49759	CLK1_HUMAN			3	496	-			105					B4DFW7|Q0P694|Q8N5V8	Silent	SNP	ENST00000321356.4	37	c.315T>C	CCDS2331.1																																																																																				0.408	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2			52	120	0	0	0	0.01441	0	52	120				
ADAM23	8745	broad.mit.edu	37	2	207436511	207436511	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:207436511G>T	ENST00000264377.3	+	17	1955	c.1627G>T	c.(1627-1629)Ggg>Tgg	p.G543W	ADAM23_ENST00000374416.1_Missense_Mutation_p.G543W|ADAM23_ENST00000374415.3_Missense_Mutation_p.G543W	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	543	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G543W(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CTGCAGCGACGGGCCCTGCTG	0.443																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1627-1629)GGG>TGG		ADAM metallopeptidase domain 23 preproprotein							132.0	125.0	127.0					2																	207436511		2203	4300	6503	SO:0001583	missense	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207436511G>T	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1627G>T	2.37:g.207436511G>T	ENSP00000264377:p.Gly543Trp		Somatic				ADAM23_uc010ziv.1_RNA	p.G543W	NM_003812	NP_003803	WXS	Illumina HiSeq	Unspecified	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	17	1850	+			543			Disintegrin.|Extracellular (Potential).		A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	c.1627G>T	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948239	0.73787	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.17213	2.29;2.29;2.29	6.16	6.16	0.99307	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.64402	D	0.000007	T	0.65729	0.2719	H	0.99507	4.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80708	-0.1262	10	0.87932	D	0	.	19.6313	0.95704	0.0:0.0:1.0:0.0	.	543	O75077	ADA23_HUMAN	W	543;543;437;543	ENSP00000264377:G543W;ENSP00000363537:G543W;ENSP00000363536:G543W	ENSP00000264377:G543W	G	+	1	0	ADAM23	207144756	1.000000	0.71417	0.993000	0.49108	0.536000	0.34869	8.216000	0.89764	2.937000	0.99478	0.650000	0.86243	GGG		0.443	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		23	37	1	0	2.21704e-12	0.00278	3.20501e-12	23	37				
C2orf80	389073	broad.mit.edu	37	2	209045986	209045986	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:209045986C>G	ENST00000341287.4	-	5	445	c.250G>C	c.(250-252)Gaa>Caa	p.E84Q	C2orf80_ENST00000451346.1_Missense_Mutation_p.E65Q|C2orf80_ENST00000453017.1_Missense_Mutation_p.E84Q	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	84								p.E84Q(1)		endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						GCTTCTCGTTCTCTACGATTT	0.348																																							uc002vcr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(250-252)GAA>CAA		hypothetical protein LOC389073							126.0	116.0	119.0					2																	209045986		1834	4081	5915	SO:0001583	missense	389073							g.chr2:209045986C>G	AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.250G>C	2.37:g.209045986C>G	ENSP00000343171:p.Glu84Gln		Somatic					p.E84Q	NM_001099334	NP_001092804	WXS	Illumina HiSeq	Unspecified	Q0P641	CB080_HUMAN			5	422	-			84					A6NKZ3	Missense_Mutation	SNP	ENST00000341287.4	37	c.250G>C	CCDS42809.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.91|15.91	2.971555|2.971555	0.53614|0.53614	.|.	.|.	ENSG00000188674|ENSG00000188674	ENST00000451342;ENST00000341287;ENST00000451346;ENST00000453017|ENST00000428015	T;T;T;T|T	0.56776|0.26518	0.84;1.35;1.23;0.44|1.73	4.97|4.97	4.1|4.1	0.47936|0.47936	.|.	0.103551|.	0.42964|.	D|.	0.000621|.	T|T	0.23492|0.23492	0.0568|0.0568	L|L	0.34521|0.34521	1.04|1.04	0.31710|0.31710	N|N	0.639613|0.639613	D|.	0.57257|.	0.979|.	P|.	0.54026|.	0.74|.	T|T	0.19712|0.19712	-1.0297|-1.0297	10|7	0.72032|0.39692	D|T	0.01|0.17	-18.8798|-18.8798	7.719|7.719	0.28721|0.28721	0.0:0.8134:0.0:0.1866|0.0:0.8134:0.0:0.1866	.|.	84|.	Q0P641|.	CB080_HUMAN|.	Q|T	9;84;65;84|35	ENSP00000389385:E9Q;ENSP00000343171:E84Q;ENSP00000405393:E65Q;ENSP00000397144:E84Q|ENSP00000408378:R35T	ENSP00000343171:E84Q|ENSP00000408378:R35T	E|R	-|-	1|2	0|0	C2orf80|C2orf80	208754231|208754231	0.978000|0.978000	0.34361|0.34361	0.973000|0.973000	0.42090|0.42090	0.683000|0.683000	0.39861|0.39861	2.255000|2.255000	0.43222|0.43222	1.466000|1.466000	0.48025|0.48025	0.563000|0.563000	0.77884|0.77884	GAA|AGA		0.348	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336931.1	NM_001099334		24	40	0	0	0	0.00278	0	24	40				
ERBB4	2066	broad.mit.edu	37	2	212522492	212522492	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:212522492G>T	ENST00000342788.4	-	16	2243	c.1933C>A	c.(1933-1935)Cca>Aca	p.P645T	ERBB4_ENST00000402597.1_Intron|ERBB4_ENST00000436443.1_Missense_Mutation_p.P645T	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	645					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P645T(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GCATGTTGTGGTAAAGTGGAA	0.408										TSP Lung(8;0.080)																													uc002veg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(1933-1935)CCA>ACA		v-erb-a erythroblastic leukemia viral oncogene							247.0	196.0	214.0					2																	212522492		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212522492G>T	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1933C>A	2.37:g.212522492G>T	ENSP00000342235:p.Pro645Thr	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.P645T|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Missense_Mutation_p.P645T	p.P645T	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	16	2031	-		Renal(323;0.06)|Lung NSC(271;0.197)	645			Extracellular (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.1933C>A	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805933	0.50421	.	.	ENSG00000178568	ENST00000342788;ENST00000436443	T;T	0.75589	-0.95;-0.95	5.14	5.14	0.70334	.	0.248313	0.41294	D	0.000903	T	0.59418	0.2192	N	0.11201	0.11	0.80722	D	1	B;B;B	0.25105	0.007;0.118;0.037	B;B;B	0.26517	0.009;0.07;0.023	T	0.55205	-0.8177	10	0.23891	T	0.37	.	18.9781	0.92746	0.0:0.0:1.0:0.0	.	504;645;645	Q53QS8;Q15303-3;Q15303	.;.;ERBB4_HUMAN	T	645	ENSP00000342235:P645T;ENSP00000403204:P645T	ENSP00000342235:P645T	P	-	1	0	ERBB4	212230737	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.014000	0.76380	2.557000	0.86248	0.650000	0.86243	CCA		0.408	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		13	110	1	0	1.52009e-12	0.003163	2.21639e-12	13	110				
IKZF2	22807	broad.mit.edu	37	2	213886733	213886733	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:213886733C>G	ENST00000434687.1	-	7	1005	c.696G>C	c.(694-696)caG>caC	p.Q232H	IKZF2_ENST00000342002.2_Missense_Mutation_p.Q238H|IKZF2_ENST00000374327.4_Missense_Mutation_p.Q87H|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374319.4_Missense_Mutation_p.Q206H|IKZF2_ENST00000457361.1_Missense_Mutation_p.Q232H|IKZF2_ENST00000451136.2_Intron|IKZF2_ENST00000413091.3_Missense_Mutation_p.Q232H|IKZF2_ENST00000421754.2_Missense_Mutation_p.Q206H			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	232					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q232H(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GACTCATGACCTGCCCAGCAG	0.458																																							uc002vem.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(694-696)CAG>CAC		helios isoform 1							137.0	113.0	121.0					2																	213886733		2203	4300	6503	SO:0001583	missense	22807				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:213886733C>G	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.696G>C	2.37:g.213886733C>G	ENSP00000412869:p.Gln232His		Somatic				IKZF2_uc010fuu.2_Missense_Mutation_p.Q87H|IKZF2_uc002vej.2_Missense_Mutation_p.Q179H|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.Q206H|IKZF2_uc002vel.2_Missense_Mutation_p.Q153H|IKZF2_uc010fuw.2_Missense_Mutation_p.Q6H|IKZF2_uc010fux.2_Missense_Mutation_p.Q6H|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Missense_Mutation_p.Q206H	p.Q232H	NM_016260	NP_057344	WXS	Illumina HiSeq	Unspecified	Q9UKS7	IKZF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)	6	865	-		Esophageal squamous(248;0.0559)|Renal(323;0.218)	232					Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	c.696G>C	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.389578	0.61956	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000421754;ENST00000374327;ENST00000413091	T;T;T;T;T;T;T	0.14640	3.14;3.11;3.14;3.19;3.26;2.49;3.27	5.8	4.92	0.64577	.	0.000000	0.64402	D	0.000001	T	0.06280	0.0162	N	0.01109	-1.01	0.44736	D	0.997736	P;B;B;B	0.40794	0.729;0.005;0.065;0.303	P;B;B;B	0.46975	0.533;0.004;0.21;0.305	T	0.50440	-0.8828	10	0.16420	T	0.52	-7.8737	10.1167	0.42596	0.0:0.8474:0.0:0.1526	.	206;87;206;232	C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7	.;.;.;IKZF2_HUMAN	H	232;238;232;206;206;87;232	ENSP00000410447:Q232H;ENSP00000342876:Q238H;ENSP00000412869:Q232H;ENSP00000363439:Q206H;ENSP00000399574:Q206H;ENSP00000363447:Q87H;ENSP00000402334:Q232H	ENSP00000342876:Q238H	Q	-	3	2	IKZF2	213594978	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.045000	0.41250	1.447000	0.47661	0.650000	0.86243	CAG		0.458	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260		31	60	0	0	0	0.009535	0	31	60				
TNS1	7145	broad.mit.edu	37	2	218713343	218713343	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:218713343G>A	ENST00000171887.4	-	17	1974	c.1522C>T	c.(1522-1524)Cag>Tag	p.Q508*	TNS1_ENST00000430930.1_Nonsense_Mutation_p.Q508*|TNS1_ENST00000419504.1_Nonsense_Mutation_p.Q508*|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	508					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.Q508*(1)|p.Q633*(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGACCATCCTGGTTTGGCAAT	0.607																																							uc002vgt.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|breast(1)	4						c.(1522-1524)CAG>TAG		tensin							91.0	86.0	88.0					2																	218713343		2203	4300	6503	SO:0001587	stop_gained	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218713343G>A	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1522C>T	2.37:g.218713343G>A	ENSP00000171887:p.Gln508*		Somatic				TNS1_uc002vgr.2_Nonsense_Mutation_p.Q508*|TNS1_uc002vgs.2_Nonsense_Mutation_p.Q508*|TNS1_uc010zjv.1_Nonsense_Mutation_p.Q508*|TNS1_uc010fvj.1_Nonsense_Mutation_p.Q576*|TNS1_uc010fvk.1_Nonsense_Mutation_p.Q633*|TNS1_uc010fvi.1_Nonsense_Mutation_p.Q195*	p.Q508*	NM_022648	NP_072174	WXS	Illumina HiSeq	Unspecified	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	17	1920	-		Renal(207;0.0483)|Lung NSC(271;0.213)	508					Q4ZG71|Q6IPI5	Nonsense_Mutation	SNP	ENST00000171887.4	37	c.1522C>T	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	G	38	6.641223	0.97726	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	.	.	.	4.63	4.63	0.57726	.	0.061373	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	18.0254	0.89268	0.0:0.0:1.0:0.0	.	.	.	.	X	508;508;508;633	.	ENSP00000171887:Q508X	Q	-	1	0	TNS1	218421588	1.000000	0.71417	1.000000	0.80357	0.219000	0.24729	7.614000	0.82996	2.558000	0.86282	0.655000	0.94253	CAG		0.607	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		17	60	0	0	0	0.00499	0	17	60				
PTPRN	5798	broad.mit.edu	37	2	220164027	220164027	+	Splice_Site	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:220164027C>A	ENST00000295718.2	-	11	1843	c.1603G>T	c.(1603-1605)Ggg>Tgg	p.G535W	PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000423636.2_Splice_Site_p.G445W|PTPRN_ENST00000409251.3_Splice_Site_p.G506W|AC114803.3_ENST00000417355.1_RNA	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	535					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G535W(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		AGATATTTACCTGCTTGTTGG	0.547											OREG0015221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002vkz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(1603-1605)GGG>TGG		protein tyrosine phosphatase, receptor type, N							156.0	153.0	154.0					2																	220164027		2203	4300	6503	SO:0001630	splice_region_variant	5798				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr2:220164027C>A		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1603+1G>T	2.37:g.220164027C>A			Somatic	OREG0015221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2264	PTPRN_uc010zlc.1_Missense_Mutation_p.G445W|PTPRN_uc002vla.2_Missense_Mutation_p.G506W	p.G535W	NM_002846	NP_002837	WXS	Illumina HiSeq	Unspecified	Q16849	PTPRN_HUMAN		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)	11	1692	-		Renal(207;0.0474)	535			Extracellular (Potential).		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	c.1603G>T	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367341	0.82463	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.03580	3.94;3.88;3.88	5.59	5.59	0.84812	.	0.083821	0.48767	D	0.000174	T	0.12518	0.0304	L	0.38175	1.15	0.53005	D	0.999966	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.98	T	0.10753	-1.0616	9	.	.	.	.	19.207	0.93734	0.0:1.0:0.0:0.0	.	506;535	Q6NSL1;Q16849	.;PTPRN_HUMAN	W	506;535;506;445	ENSP00000386638:G506W;ENSP00000295718:G535W;ENSP00000444244:G445W	.	G	-	1	0	PTPRN	219872271	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.753000	0.62183	2.622000	0.88805	0.561000	0.74099	GGG		0.547	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		Missense_Mutation	15	94	1	0	2.23348e-06	0.004007	2.70895e-06	15	94				
IRS1	3667	broad.mit.edu	37	2	227662710	227662710	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:227662710T>G	ENST00000305123.5	-	1	1765	c.745A>C	c.(745-747)Atg>Ctg	p.M249L	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	249	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.M249L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GTCTCGTGCATGTTCTGGGCC	0.607											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002voh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12						c.(745-747)ATG>CTG		insulin receptor substrate 1							86.0	91.0	89.0					2																	227662710		2203	4300	6503	SO:0001583	missense	3667				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr2:227662710T>G		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.745A>C	2.37:g.227662710T>G	ENSP00000304895:p.Met249Leu		Somatic	OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2321		p.M249L	NM_005544	NP_005535	WXS	Illumina HiSeq	Unspecified	P35568	IRS1_HUMAN		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)	1	797	-		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)	249			IRS-type PTB.			Missense_Mutation	SNP	ENST00000305123.5	37	c.745A>C	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699509	0.68501	.	.	ENSG00000169047	ENST00000305123	T	0.71103	-0.54	5.79	4.57	0.56435	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (4);	0.000000	0.85682	D	0.000000	T	0.71617	0.3361	M	0.81341	2.54	0.54753	D	0.999982	B	0.26845	0.161	B	0.28385	0.089	T	0.74064	-0.3785	10	0.62326	D	0.03	-25.6389	11.8522	0.52417	0.1309:0.0:0.0:0.8691	.	249	P35568	IRS1_HUMAN	L	249	ENSP00000304895:M249L	ENSP00000304895:M249L	M	-	1	0	IRS1	227370954	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.214000	0.72200	2.208000	0.71279	0.459000	0.35465	ATG		0.607	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		17	70	0	0	0	0.00499	0	17	70				
SPHKAP	80309	broad.mit.edu	37	2	228883814	228883814	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:228883814T>G	ENST00000392056.3	-	7	1802	c.1756A>C	c.(1756-1758)Agt>Cgt	p.S586R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S586R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	586						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S586R(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGGCTACCACTTGGAGCCACT	0.562																																							uc002vpq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(4)|lung(1)	10						c.(1756-1758)AGT>CGT		sphingosine kinase type 1-interacting protein							49.0	46.0	47.0					2																	228883814		2203	4299	6502	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228883814T>G		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1756A>C	2.37:g.228883814T>G	ENSP00000375909:p.Ser586Arg		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.S586R|SPHKAP_uc010zlx.1_Missense_Mutation_p.S586R	p.S586R	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	1803	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	586					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.1756A>C	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	7.985	0.751928	0.15778	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.49720	0.77;0.77	5.84	-3.36	0.04913	.	0.986267	0.08317	N	0.964423	T	0.47820	0.1466	M	0.73598	2.24	0.09310	N	1	P;B	0.41265	0.744;0.061	B;B	0.39068	0.289;0.032	T	0.55742	-0.8093	10	0.87932	D	0	.	12.9044	0.58143	0.0:0.4862:0.0:0.5138	.	586;586	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	586	ENSP00000375909:S586R;ENSP00000339886:S586R	ENSP00000339886:S586R	S	-	1	0	SPHKAP	228592058	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.065000	0.14466	-0.340000	0.08388	0.533000	0.62120	AGT		0.562	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		11	41	0	0	0	0.008291	0	11	41				
SPHKAP	80309	broad.mit.edu	37	2	229046284	229046284	+	Splice_Site	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:229046284T>A	ENST00000392056.3	-	1	77	c.31A>T	c.(31-33)Agc>Tgc	p.S11C	SPHKAP_ENST00000344657.5_Splice_Site_p.S11C	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	11						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S11C(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGGTCTTACCTTGGTACCGAG	0.547																																							uc002vpq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(4)|lung(1)	10						c.(31-33)AGC>TGC		sphingosine kinase type 1-interacting protein							238.0	212.0	221.0					2																	229046284		2203	4300	6503	SO:0001630	splice_region_variant	80309					cytoplasm	protein binding	g.chr2:229046284T>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.32+1A>T	2.37:g.229046284T>A			Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.S11C|SPHKAP_uc010zlx.1_Missense_Mutation_p.S11C	p.S11C	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	1	78	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	11					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.31A>T	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	19.64	3.864766	0.71949	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.46063	0.88;0.88	3.5	3.5	0.40072	.	0.330186	0.28093	N	0.016622	T	0.43233	0.1238	N	0.14661	0.345	0.34908	D	0.747177	D;D	0.89917	0.999;1.0	D;D	0.85130	0.99;0.997	T	0.56950	-0.7894	10	0.87932	D	0	.	8.7059	0.34354	0.0:0.0:0.0:1.0	.	11;11	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	C	11	ENSP00000375909:S11C;ENSP00000339886:S11C	ENSP00000339886:S11C	S	-	1	0	SPHKAP	228754528	0.987000	0.35691	0.877000	0.34402	0.373000	0.29922	3.044000	0.49830	1.833000	0.53350	0.379000	0.24179	AGC		0.547	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	Missense_Mutation	29	135	0	0	0	0.007291	0	29	135				
SP100	6672	broad.mit.edu	37	2	231311581	231311581	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:231311581G>T	ENST00000264052.5	+	5	842	c.487G>T	c.(487-489)Gag>Tag	p.E163*	SP100_ENST00000409897.1_Nonsense_Mutation_p.E128*|SP100_ENST00000409341.1_Nonsense_Mutation_p.E163*|SP100_ENST00000409112.1_Nonsense_Mutation_p.E163*|SP100_ENST00000427101.2_Nonsense_Mutation_p.E138*|SP100_ENST00000409824.1_Nonsense_Mutation_p.E138*|SP100_ENST00000340126.4_Nonsense_Mutation_p.E163*|SP100_ENST00000341950.4_Nonsense_Mutation_p.E163*	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	163	Poly-Glu.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.E163*(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGAAGAGAGGGAGGAGAGGTC	0.438																																							uc002vqt.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(487-489)GAG>TAG		nuclear antigen Sp100 isoform 2							85.0	76.0	79.0					2																	231311581		2203	4300	6503	SO:0001587	stop_gained	6672				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding	g.chr2:231311581G>T	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.487G>T	2.37:g.231311581G>T	ENSP00000264052:p.Glu163*		Somatic				SP100_uc002vqs.2_Nonsense_Mutation_p.E163*|SP100_uc002vqu.1_Nonsense_Mutation_p.E163*|SP100_uc010zmb.1_Nonsense_Mutation_p.E163*|SP100_uc002vqq.1_Nonsense_Mutation_p.E163*|SP100_uc002vqr.1_Nonsense_Mutation_p.E138*|SP100_uc010zmc.1_Nonsense_Mutation_p.E138*|SP100_uc002vqv.1_Nonsense_Mutation_p.E127*	p.E163*	NM_003113	NP_003104	WXS	Illumina HiSeq	Unspecified	P23497	SP100_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	5	628	+		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)	163			Poly-Glu.		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Nonsense_Mutation	SNP	ENST00000264052.5	37	c.487G>T	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527569	0.44969	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000432979;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	.	.	.	3.28	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	10.3634	0.44008	0.0:0.0:1.0:0.0	.	.	.	.	X	163;138;138;138;163;163;163;163;128	.	ENSP00000264052:E163X	E	+	1	0	SP100	231019825	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-0.089000	0.11180	2.150000	0.67090	0.655000	0.94253	GAG		0.438	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113		3	14	1	0	0.00024832	0.009096	0.000278283	3	14				
DGKD	8527	broad.mit.edu	37	2	234365975	234365975	+	Splice_Site	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr2:234365975G>C	ENST00000264057.2	+	21	2592		c.e21+1		DGKD_ENST00000409813.3_Splice_Site	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa						blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.?(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GGAAGATGATGTATGTATGGG	0.582																																							uc002vui.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5						c.e21+1		diacylglycerol kinase, delta 130kDa isoform 2	Phosphatidylserine(DB00144)						63.0	65.0	64.0					2																	234365975		2203	4300	6503	SO:0001630	splice_region_variant	8527				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr2:234365975G>C	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2580+1G>C	2.37:g.234365975G>C			Somatic				DGKD_uc002vuj.1_Splice_Site_p.D816_splice|DGKD_uc010fyh.1_Missense_Mutation_p.V728L|DGKD_uc010fyi.1_Splice_Site	p.D860_splice	NM_152879	NP_690618	WXS	Illumina HiSeq	Unspecified	Q16760	DGKD_HUMAN		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	21	2592	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)						Q14158|Q6PK55|Q8NG53	Splice_Site	SNP	ENST00000264057.2	37	c.2580_splice	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.956099	0.53293	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7746	0.88503	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DGKD	234030714	1.000000	0.71417	0.997000	0.53966	0.533000	0.34776	9.425000	0.97467	2.620000	0.88729	0.655000	0.94253	.		0.582	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	Intron	11	59	0	0	0	0.008291	0	11	59				
SNAP25	6616	broad.mit.edu	37	20	10280043	10280043	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:10280043G>T	ENST00000254976.2	+	7	746	c.535G>T	c.(535-537)Gac>Tac	p.D179Y	SNAP25_ENST00000304886.2_Missense_Mutation_p.D179Y|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25_ENST00000495883.1_3'UTR|SNAP25-AS1_ENST00000453544.1_RNA	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	179	t-SNARE coiled-coil homology 2. {ECO:0000255|PROSITE-ProRule:PRU00202}.				energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)	p.D179Y(2)		endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	TCGCCAGATCGACAGGATCAT	0.512																																							uc002wnq.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(535-537)GAC>TAC		synaptosomal-associated protein 25 isoform	Botulinum Toxin Type A(DB00083)						85.0	75.0	78.0					20																	10280043		2203	4300	6503	SO:0001583	missense	6616				energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome		g.chr20:10280043G>T		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.535G>T	20.37:g.10280043G>T	ENSP00000254976:p.Asp179Tyr		Somatic				SNAP25_uc002wnr.1_Missense_Mutation_p.D179Y|SNAP25_uc002wns.1_Missense_Mutation_p.D116Y|SNAP25_uc010gca.1_Missense_Mutation_p.D179Y|SNAP25_uc010gcb.1_Missense_Mutation_p.D116Y|SNAP25_uc010gcc.1_Missense_Mutation_p.D73Y	p.D179Y	NM_130811	NP_570824	WXS	Illumina HiSeq	Unspecified	P60880	SNP25_HUMAN			7	747	+			179			t-SNARE coiled-coil homology 2.		B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	37	c.535G>T	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086166	0.94100	.	.	ENSG00000132639	ENST00000254976;ENST00000304886	.	.	.	6.17	6.17	0.99709	Target SNARE coiled-coil domain (3);	0.000000	0.85682	D	0.000000	D	0.87589	0.6215	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.977;0.986	D	0.89168	0.3535	9	0.87932	D	0	-5.7303	20.8794	0.99867	0.0:0.0:1.0:0.0	.	179;179	P60880-2;P60880	.;SNP25_HUMAN	Y	179	.	ENSP00000254976:D179Y	D	+	1	0	SNAP25	10228043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GAC		0.512	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811		20	29	1	0	3.99206e-14	0.007413	6.09598e-14	20	29				
ZNF133	7692	broad.mit.edu	37	20	18286371	18286371	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:18286371A>T	ENST00000316358.4	+	2	138	c.41A>T	c.(40-42)gAg>gTg	p.E14V	ZNF133_ENST00000396026.3_Missense_Mutation_p.E17V|ZNF133_ENST00000377671.3_Missense_Mutation_p.E14V|ZNF133_ENST00000402618.2_5'UTR|ZNF133_ENST00000401790.1_Missense_Mutation_p.E14V|ZNF133_ENST00000535822.1_Intron|ZNF133_ENST00000538547.1_Intron	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E14V(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						ACCCAGGATGAGTGGAGGCTG	0.537																																							uc010gcq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(40-42)GAG>GTG		zinc finger protein 133							110.0	100.0	103.0					20																	18286371		2203	4300	6503	SO:0001583	missense	7692					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:18286371A>T	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.41A>T	20.37:g.18286371A>T	ENSP00000346090:p.Glu14Val		Somatic				ZNF133_uc010zrv.1_Missense_Mutation_p.E17V|ZNF133_uc010zrw.1_5'UTR|ZNF133_uc010gcr.2_Missense_Mutation_p.E14V|ZNF133_uc010zrx.1_Intron|ZNF133_uc002wql.3_Missense_Mutation_p.E14V|ZNF133_uc010gcs.2_Missense_Mutation_p.E14V|ZNF133_uc010zry.1_Intron|ZNF133_uc002wqm.2_Missense_Mutation_p.E14V	p.E14V	NM_003434	NP_003425	WXS	Illumina HiSeq	Unspecified	P52736	ZN133_HUMAN			3	346	+			14			KRAB.		A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	ENST00000316358.4	37	c.41A>T		.	.	.	.	.	.	.	.	.	.	A	18.66	3.672224	0.67928	.	.	ENSG00000125846	ENST00000377671;ENST00000360010;ENST00000396026;ENST00000401790;ENST00000434018;ENST00000316358;ENST00000425686	T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69	3.69	3.69	0.42338	Krueppel-associated box (4);	0.000000	0.38959	N	0.001514	T	0.52613	0.1745	H	0.99058	4.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.68804	-0.5312	10	0.87932	D	0	-32.4563	10.6256	0.45506	1.0:0.0:0.0:0.0	.	17;14;14	B4DHU7;P52736;P52736-2	.;ZN133_HUMAN;.	V	14;14;17;14;14;14;14	ENSP00000366899:E14V;ENSP00000353105:E14V;ENSP00000400897:E17V;ENSP00000383945:E14V;ENSP00000403835:E14V;ENSP00000346090:E14V;ENSP00000406638:E14V	ENSP00000346090:E14V	E	+	2	0	ZNF133	18234371	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.173000	0.71937	1.689000	0.51079	0.482000	0.46254	GAG		0.537	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434		16	64	0	0	0	0.004007	0	16	64				
CD93	22918	broad.mit.edu	37	20	23066072	23066072	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:23066072G>A	ENST00000246006.4	-	1	905	c.758C>T	c.(757-759)tCg>tTg	p.S253L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	253					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.S253L(3)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GAGGGGGCCCGAGCTGCCCCA	0.602																																							uc002wsv.2		NA																	3	Substitution - Missense(3)		NS(1)|lung(1)|skin(1)	large_intestine(2)	2						c.(757-759)TCG>TTG		CD93 antigen precursor							79.0	82.0	81.0					20																	23066072		2203	4300	6503	SO:0001583	missense	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23066072G>A	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.758C>T	20.37:g.23066072G>A	ENSP00000246006:p.Ser253Leu		Somatic					p.S253L	NM_012072	NP_036204	WXS	Illumina HiSeq	Unspecified	Q9NPY3	C1QR1_HUMAN			1	906	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		253			Extracellular (Potential).		O00274	Missense_Mutation	SNP	ENST00000246006.4	37	c.758C>T	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	9.233	1.036273	0.19669	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.80824	-1.42	5.52	3.52	0.40303	.	0.490180	0.18950	N	0.126708	T	0.67683	0.2919	L	0.51914	1.62	0.09310	N	1	P	0.44659	0.84	B	0.24541	0.054	T	0.58685	-0.7593	10	0.41790	T	0.15	-0.5046	10.8645	0.46847	0.0716:0.1308:0.7975:0.0	.	253	Q9NPY3	C1QR1_HUMAN	L	253	ENSP00000246006:S253L	ENSP00000246006:S253L	S	-	2	0	CD93	23014072	0.008000	0.16893	0.001000	0.08648	0.340000	0.28889	1.656000	0.37355	0.758000	0.33059	0.655000	0.94253	TCG		0.602	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		15	106	0	0	0	0.003163	0	15	106				
REM1	28954	broad.mit.edu	37	20	30064325	30064326	+	Missense_Mutation	DNP	GG	GG	TT	rs575294536		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:30064325_30064326GG>TT	ENST00000201979.2	+	2	370_371	c.77_78GG>TT	c.(76-78)cGG>cTT	p.R26L	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	26					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.R26L(1)		kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CTGTCCCCACGGGGCCACCAGC	0.644																																							uc002wwa.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|pancreas(2)	4						c.(76-78)CGG>CTT		RAS-like GTP-binding protein REM																																				SO:0001583	missense	28954				small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity	g.chr20:30064325_30064326GG>TT	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	Exception_encountered	20.37:g.30064325_30064326delinsTT	ENSP00000201979:p.Arg26Leu		Somatic					p.R26L	NM_014012	NP_054731	WXS	Illumina HiSeq	Unspecified	O75628	REM1_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		2	361_362	+	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		26					E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	DNP	ENST00000201979.2	37	c.77_78GG>TT	CCDS13181.1																																																																																				0.644	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012		9	49	0	0	0	0.004672	0	9	49				
DUSP15	128853	broad.mit.edu	37	20	30436290	30436290	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:30436290G>C	ENST00000278979.3	-	10	881	c.805C>G	c.(805-807)Cct>Gct	p.P269A	FOXS1_ENST00000375978.3_5'Flank			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	269					positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.P269A(1)		large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGGTTGCCAGGGGTTGAGGAC	0.642																																							uc002wwu.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(805-807)CCT>GCT		RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;							31.0	30.0	30.0					20																	30436290		876	1991	2867	SO:0001583	missense	128853					cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr20:30436290G>C		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.805C>G	20.37:g.30436290G>C	ENSP00000278979:p.Pro269Ala		Somatic				FOXS1_uc002wwt.1_5'Flank	p.P269A			WXS	Illumina HiSeq	Unspecified	Q9H1R2	DUS15_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		10	882	-			269					A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37	c.805C>G		.	.	.	.	.	.	.	.	.	.	G	6.638	0.486105	0.12641	.	.	ENSG00000149599	ENST00000278979	T	0.08807	3.05	0.0465	0.0465	0.14256	.	1.345370	0.06826	U	0.793127	T	0.07324	0.0185	.	.	.	0.18873	N	0.999982	P	0.46912	0.886	B	0.39419	0.299	T	0.37150	-0.9718	9	0.87932	D	0	.	6.0719	0.19893	0.0:0.0:1.0:0.0	.	269	Q9H1R2	DUS15_HUMAN	A	269	ENSP00000278979:P269A	ENSP00000278979:P269A	P	-	1	0	DUSP15	29899951	0.023000	0.18921	0.011000	0.14972	0.095000	0.18619	0.347000	0.20014	0.132000	0.18615	0.134000	0.15878	CCT		0.642	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611		15	19	0	0	0	0.003163	0	15	19				
TM9SF4	9777	broad.mit.edu	37	20	30730905	30730905	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:30730905G>T	ENST00000398022.2	+	6	884	c.649G>T	c.(649-651)Gag>Tag	p.E217*	TM9SF4_ENST00000217315.5_Nonsense_Mutation_p.E200*	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	217						integral component of membrane (GO:0016021)		p.E200*(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CATCAGGCTGGAGGGTGAGTG	0.617																																							uc002wxj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(649-651)GAG>TAG		transmembrane 9 superfamily protein member 4							94.0	73.0	81.0					20																	30730905		2203	4300	6503	SO:0001587	stop_gained	9777					integral to membrane		g.chr20:30730905G>T	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.649G>T	20.37:g.30730905G>T	ENSP00000381104:p.Glu217*		Somatic				TM9SF4_uc010ztr.1_Nonsense_Mutation_p.E143*|TM9SF4_uc010zts.1_Nonsense_Mutation_p.E124*|TM9SF4_uc002wxk.2_Nonsense_Mutation_p.E200*|TM9SF4_uc010gdz.2_Nonsense_Mutation_p.E124*	p.E217*	NM_014742	NP_055557	WXS	Illumina HiSeq	Unspecified	Q92544	TM9S4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		6	884	+			217					B0QYT7|Q9NUA3	Nonsense_Mutation	SNP	ENST00000398022.2	37	c.649G>T	CCDS13196.2	.	.	.	.	.	.	.	.	.	.	G	39	7.398458	0.98258	.	.	ENSG00000101337	ENST00000398022;ENST00000421148;ENST00000217315	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-21.3186	16.9894	0.86349	0.0:0.0:1.0:0.0	.	.	.	.	X	217;143;200	.	ENSP00000217315:E200X	E	+	1	0	TM9SF4	30194566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.434000	0.80377	2.684000	0.91462	0.555000	0.69702	GAG		0.617	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742		11	44	1	0	3.07112e-06	0.010729	3.69843e-06	11	44				
PLCG1	5335	broad.mit.edu	37	20	39792419	39792419	+	Missense_Mutation	SNP	C	C	G	rs150381500	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:39792419C>G	ENST00000373271.1	+	10	1361	c.956C>G	c.(955-957)cCg>cGg	p.P319R	PLCG1_ENST00000244007.3_Missense_Mutation_p.P319R|PLCG1_ENST00000373272.2_Missense_Mutation_p.P319R	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	319					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.P319R(1)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GCAGTATGCCCGGACACCATG	0.547																																							uc002xjp.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(3)|skin(2)	8						c.(955-957)CCG>CGG		phospholipase C, gamma 1 isoform b							153.0	143.0	147.0					20																	39792419		2203	4300	6503	SO:0001583	missense	5335				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity	g.chr20:39792419C>G	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.956C>G	20.37:g.39792419C>G	ENSP00000362368:p.Pro319Arg		Somatic				PLCG1_uc002xjo.1_Missense_Mutation_p.P319R|PLCG1_uc010zwe.1_5'Flank|PLCG1_uc010ggf.2_5'Flank	p.P319R	NM_182811	NP_877963	WXS	Illumina HiSeq	Unspecified	P19174	PLCG1_HUMAN			10	1077	+		Myeloproliferative disorder(115;0.00878)	319					B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	c.956C>G	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939355	0.34189	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.66815	-0.23;-0.23;-0.23	5.69	4.55	0.56014	.	0.150748	0.64402	D	0.000010	T	0.68668	0.3026	M	0.77103	2.36	0.58432	D	0.999997	B;B	0.25007	0.116;0.1	B;B	0.32864	0.154;0.134	T	0.65240	-0.6216	10	0.25751	T	0.34	.	14.3991	0.67031	0.0:0.8752:0.0:0.1248	.	319;319	P19174;A2A284	PLCG1_HUMAN;.	R	319	ENSP00000244007:P319R;ENSP00000362368:P319R;ENSP00000362369:P319R	ENSP00000244007:P319R	P	+	2	0	PLCG1	39225833	0.085000	0.21516	0.975000	0.42487	0.798000	0.45092	2.093000	0.41710	2.677000	0.91161	0.655000	0.94253	CCG		0.547	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811		18	85	0	0	0	0.006122	0	18	85				
PTPRT	11122	broad.mit.edu	37	20	40748600	40748600	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:40748600T>A	ENST00000373187.1	-	20	2858	c.2859A>T	c.(2857-2859)cgA>cgT	p.R953R	PTPRT_ENST00000373193.3_Silent_p.R956R|PTPRT_ENST00000356100.2_Silent_p.R962R|PTPRT_ENST00000373198.4_Silent_p.R972R|PTPRT_ENST00000373190.1_Silent_p.R952R|PTPRT_ENST00000373184.1_Silent_p.R943R|PTPRT_ENST00000373201.1_Silent_p.R943R			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	953	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R975R(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGTGCCGAGGTCGATGGTATC	0.493																																							uc002xkg.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(8)|ovary(7)|lung(5)	20						c.(2857-2859)CGA>CGT		protein tyrosine phosphatase, receptor type, T							127.0	128.0	127.0					20																	40748600		1922	4136	6058	SO:0001819	synonymous_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40748600T>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2859A>T	20.37:g.40748600T>A			Somatic				PTPRT_uc010ggj.2_Silent_p.R972R|PTPRT_uc010ggi.2_Silent_p.R156R	p.R953R	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			20	3043	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	953			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	c.2859A>T	CCDS42874.1																																																																																				0.493	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			38	86	0	0	0	0.011902	0	38	86				
MMP9	4318	broad.mit.edu	37	20	44639949	44639949	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:44639949A>T	ENST00000372330.3	+	5	836	c.817A>T	c.(817-819)Agc>Tgc	p.S273C	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	273	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S273C(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CTTCTGCCCCAGCGAGAGTGA	0.652																																							uc002xqz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(817-819)AGC>TGC		matrix metalloproteinase 9 preproprotein	Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)						38.0	42.0	41.0					20																	44639949		2202	4298	6500	SO:0001583	missense	4318				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding	g.chr20:44639949A>T		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.817A>T	20.37:g.44639949A>T	ENSP00000361405:p.Ser273Cys		Somatic					p.S273C	NM_004994	NP_004985	WXS	Illumina HiSeq	Unspecified	P14780	MMP9_HUMAN			5	836	+		Myeloproliferative disorder(115;0.0122)	273			Fibronectin type-II 1.		B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	c.817A>T	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016837	0.75161	.	.	ENSG00000100985	ENST00000372330	T	0.10005	2.92	4.56	4.56	0.56223	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (2);Peptidase, metallopeptidase (1);	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	M	0.88310	2.945	0.53688	D	0.999976	D	0.89917	1.0	D	0.97110	1.0	T	0.40059	-0.9583	10	0.52906	T	0.07	.	13.5392	0.61664	1.0:0.0:0.0:0.0	.	273	P14780	MMP9_HUMAN	C	273	ENSP00000361405:S273C	ENSP00000361405:S273C	S	+	1	0	MMP9	44073356	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.339000	0.52135	2.034000	0.60081	0.528000	0.53228	AGC		0.652	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1			22	57	0	0	0	0.00278	0	22	57				
SLC2A10	81031	broad.mit.edu	37	20	45354645	45354645	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:45354645G>T	ENST00000359271.2	+	2	1220	c.970G>T	c.(970-972)Gac>Tac	p.D324Y		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	324					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.D324Y(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				CGTGCCCATGGACTCAGGCCC	0.652																																							uc002xsl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(970-972)GAC>TAC		solute carrier family 2 member 10							63.0	56.0	58.0					20																	45354645		2203	4300	6503	SO:0001583	missense	81031					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr20:45354645G>T	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.970G>T	20.37:g.45354645G>T	ENSP00000352216:p.Asp324Tyr		Somatic					p.D324Y	NM_030777	NP_110404	WXS	Illumina HiSeq	Unspecified	O95528	GTR10_HUMAN			2	1067	+		Myeloproliferative disorder(115;0.0122)	324			Extracellular (Potential).		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	c.970G>T	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639649	0.47153	.	.	ENSG00000197496	ENST00000359271	D	0.82984	-1.67	5.86	2.84	0.33178	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.929690	0.02684	N	0.109942	D	0.83839	0.5341	L	0.59436	1.845	0.44024	D	0.996747	P	0.42871	0.792	P	0.44732	0.459	T	0.65944	-0.6045	10	0.17369	T	0.5	-11.264	11.326	0.49448	0.0641:0.2389:0.697:0.0	.	324	O95528	GTR10_HUMAN	Y	324	ENSP00000352216:D324Y	ENSP00000352216:D324Y	D	+	1	0	SLC2A10	44788052	1.000000	0.71417	0.587000	0.28692	0.697000	0.40408	3.265000	0.51561	0.384000	0.24942	-0.165000	0.13383	GAC		0.652	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			17	42	1	0	1.5739e-10	0.004007	2.19568e-10	17	42				
ZNFX1	57169	broad.mit.edu	37	20	47886764	47886764	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:47886764C>T	ENST00000396105.1	-	3	1831	c.1585G>A	c.(1585-1587)Gat>Aat	p.D529N	ZNFX1_ENST00000371754.4_Missense_Mutation_p.D529N|ZNFX1_ENST00000371752.1_Missense_Mutation_p.D529N	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	529							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AAGGGAACATCTTCCTCCTGG	0.512																																							uc002xui.2		NA																	0				ovary(2)	2						c.(1585-1587)GAT>AAT		zinc finger, NFX1-type containing 1							85.0	86.0	85.0					20																	47886764		2203	4300	6503	SO:0001583	missense	57169						metal ion binding	g.chr20:47886764C>T	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1585G>A	20.37:g.47886764C>T	ENSP00000379412:p.Asp529Asn		Somatic					p.D529N	NM_021035	NP_066363	WXS	Illumina HiSeq	Unspecified	Q9P2E3	ZNFX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		3	1832	-			529					Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	c.1585G>A	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	C	8.631	0.893638	0.17613	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;T	0.86432	-1.82;-2.12;-2.12;-0.76;-1.47	5.71	5.71	0.89125	.	0.197145	0.53938	D	0.000059	T	0.80939	0.4720	L	0.38838	1.175	0.41931	D	0.99056	B	0.19817	0.039	B	0.14578	0.011	T	0.74896	-0.3508	10	0.21014	T	0.42	-20.5309	14.0769	0.64895	0.0:0.8492:0.1508:0.0	.	529	Q9P2E3	ZNFX1_HUMAN	N	529;529;529;529;529;333	ENSP00000360819:D529N;ENSP00000360817:D529N;ENSP00000379412:D529N;ENSP00000360809:D529N;ENSP00000413800:D333N	ENSP00000360809:D529N	D	-	1	0	ZNFX1	47320171	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	3.032000	0.49736	2.686000	0.91538	0.655000	0.94253	GAT		0.512	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035		13	117	0	0	0	0.001855	0	13	117				
ZNFX1	57169	broad.mit.edu	37	20	47886771	47886771	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:47886771C>T	ENST00000396105.1	-	3	1824	c.1578G>A	c.(1576-1578)caG>caA	p.Q526Q	ZNFX1_ENST00000371754.4_Silent_p.Q526Q|ZNFX1_ENST00000371752.1_Silent_p.Q526Q	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	526							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.Q526Q(2)|p.Q330Q(1)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CATCTTCCTCCTGGACCTCCT	0.527																																							uc002xui.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)	2						c.(1576-1578)CAG>CAA		zinc finger, NFX1-type containing 1							80.0	81.0	80.0					20																	47886771		2203	4300	6503	SO:0001819	synonymous_variant	57169						metal ion binding	g.chr20:47886771C>T	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1578G>A	20.37:g.47886771C>T			Somatic					p.Q526Q	NM_021035	NP_066363	WXS	Illumina HiSeq	Unspecified	Q9P2E3	ZNFX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		3	1825	-			526					Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	ENST00000396105.1	37	c.1578G>A	CCDS13417.1																																																																																				0.527	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035		12	107	0	0	0	0.013537	0	12	107				
SALL4	57167	broad.mit.edu	37	20	50408856	50408856	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:50408856C>A	ENST00000217086.4	-	2	277	c.166G>T	c.(166-168)Gcg>Tcg	p.A56S	SALL4_ENST00000483130.1_5'UTR|SALL4_ENST00000395997.3_Missense_Mutation_p.A56S|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	56					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A56S(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCTCACTCGCCACCTCGTCA	0.552																																							uc002xwh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(166-168)GCG>TCG		sal-like 4							50.0	52.0	51.0					20																	50408856		2203	4300	6503	SO:0001583	missense	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50408856C>A	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.166G>T	20.37:g.50408856C>A	ENSP00000217086:p.Ala56Ser		Somatic				SALL4_uc010gii.2_Missense_Mutation_p.A56S|SALL4_uc002xwi.3_Intron	p.A56S	NM_020436	NP_065169	WXS	Illumina HiSeq	Unspecified	Q9UJQ4	SALL4_HUMAN			2	267	-			56					A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	c.166G>T	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	C	6.406	0.443116	0.12164	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.54866	0.55;0.55	4.88	-1.24	0.09435	.	1.887100	0.02908	N	0.136370	T	0.43122	0.1233	L	0.57536	1.79	0.09310	N	1	B;B	0.27559	0.008;0.181	B;B	0.23419	0.007;0.046	T	0.17715	-1.0360	10	0.05833	T	0.94	-0.134	6.9008	0.24281	0.0:0.5447:0.1204:0.3349	.	56;56	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	S	56	ENSP00000217086:A56S;ENSP00000379319:A56S	ENSP00000217086:A56S	A	-	1	0	SALL4	49842263	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.290000	0.02777	-0.059000	0.13154	0.655000	0.94253	GCG		0.552	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			23	61	1	0	2.98393e-07	0.00278	3.78151e-07	23	61				
MC3R	4159	broad.mit.edu	37	20	54824480	54824480	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:54824480C>T	ENST00000243911.2	+	1	693	c.581C>T	c.(580-582)aCc>aTc	p.T194I		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	194					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.T231I(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			TGCCTCATCACCATGTTCTTC	0.582																																							uc002xxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(580-582)ACC>ATC		melanocortin 3 receptor							214.0	184.0	194.0					20																	54824480		2203	4300	6503	SO:0001583	missense	4159				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding	g.chr20:54824480C>T		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.581C>T	20.37:g.54824480C>T	ENSP00000243911:p.Thr194Ile		Somatic					p.T194I	NM_019888	NP_063941	WXS	Illumina HiSeq	Unspecified	P41968	MC3R_HUMAN	Colorectal(105;0.202)		1	693	+			231			Helical; Name=5; (Potential).		Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	37	c.581C>T	CCDS13449.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162552	0.78226	.	.	ENSG00000124089	ENST00000243911	T	0.34859	1.34	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.39911	0.1096	L	0.45698	1.435	0.54753	D	0.999989	P	0.46859	0.885	B	0.44224	0.444	T	0.35699	-0.9778	10	0.62326	D	0.03	.	18.4242	0.90604	0.0:1.0:0.0:0.0	.	231	P41968	MC3R_HUMAN	I	194	ENSP00000243911:T194I	ENSP00000243911:T194I	T	+	2	0	MC3R	54257887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.910000	0.69931	2.430000	0.82344	0.555000	0.69702	ACC		0.582	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			27	84	0	0	0	0.004656	0	27	84				
MC3R	4159	broad.mit.edu	37	20	54824808	54824808	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:54824808C>A	ENST00000243911.2	+	1	1021	c.909C>A	c.(907-909)agC>agA	p.S303R		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	303					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.S340R(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CTTTCCGGAGCCTGGAATTGC	0.537																																							uc002xxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(907-909)AGC>AGA		melanocortin 3 receptor							177.0	167.0	170.0					20																	54824808		2203	4300	6503	SO:0001583	missense	4159				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding	g.chr20:54824808C>A		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.909C>A	20.37:g.54824808C>A	ENSP00000243911:p.Ser303Arg		Somatic					p.S303R	NM_019888	NP_063941	WXS	Illumina HiSeq	Unspecified	P41968	MC3R_HUMAN	Colorectal(105;0.202)		1	1021	+			340			Cytoplasmic (Potential).		Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	37	c.909C>A	CCDS13449.2	.	.	.	.	.	.	.	.	.	.	C	14.59	2.582317	0.46006	.	.	ENSG00000124089	ENST00000243911	T	0.42900	0.96	5.09	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.68842	0.3045	M	0.93375	3.41	0.41066	D	0.985412	D	0.76494	0.999	D	0.80764	0.994	T	0.75033	-0.3460	10	0.72032	D	0.01	.	8.6383	0.33962	0.0:0.7665:0.0:0.2335	.	340	P41968	MC3R_HUMAN	R	303	ENSP00000243911:S303R	ENSP00000243911:S303R	S	+	3	2	MC3R	54258215	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	1.244000	0.32778	2.362000	0.80069	0.555000	0.69702	AGC		0.537	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			49	143	1	0	3.50607e-19	0.01441	5.78373e-19	49	143				
BMP7	655	broad.mit.edu	37	20	55758937	55758937	+	Silent	SNP	G	G	T	rs148287752		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:55758937G>T	ENST00000395863.3	-	4	1304	c.799C>A	c.(799-801)Cgg>Agg	p.R267R	BMP7_ENST00000450594.2_Silent_p.R267R|BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000395864.3_Intron	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	267					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)	p.R267R(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GGCCCGTGCCGCCCAATCAGG	0.627																																							uc010gip.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(799-801)CGG>AGG		bone morphogenetic protein 7 precursor							37.0	37.0	37.0					20																	55758937		2203	4300	6503	SO:0001819	synonymous_variant	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55758937G>T		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.799C>A	20.37:g.55758937G>T			Somatic				BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Silent_p.R267R	p.R267R	NM_001719	NP_001710	WXS	Illumina HiSeq	Unspecified	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		4	1328	-	all_lung(29;0.0133)|Melanoma(10;0.242)		267					Q9H512|Q9NTQ7	Silent	SNP	ENST00000395863.3	37	c.799C>A	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377891	0.24944	.	.	ENSG00000101144	ENST00000433911	.	.	.	5.48	3.38	0.38709	.	.	.	.	.	T	0.62732	0.2452	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61337	-0.7083	4	.	.	.	.	11.9636	0.53021	0.0:0.0:0.4105:0.5895	.	.	.	.	E	188	.	.	A	-	2	0	BMP7	55192344	0.990000	0.36364	1.000000	0.80357	0.995000	0.86356	1.856000	0.39389	1.284000	0.44531	0.643000	0.83706	GCG		0.627	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			9	26	1	0	7.48243e-07	0.006214	9.29137e-07	9	26				
ZNF831	128611	broad.mit.edu	37	20	57829644	57829644	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:57829644T>C	ENST00000371030.2	+	5	4880	c.4880T>C	c.(4879-4881)gTg>gCg	p.V1627A		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1627							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.V1627A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AAAGATTCTGTGGTTCCTTCT	0.488																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(4879-4881)GTG>GCG		zinc finger protein 831							73.0	71.0	72.0					20																	57829644		1867	4110	5977	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57829644T>C	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4880T>C	20.37:g.57829644T>C	ENSP00000360069:p.Val1627Ala		Somatic					p.V1627A	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			5	4880	+	all_lung(29;0.0085)		1627					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.4880T>C	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.316587	0.23908	.	.	ENSG00000124203	ENST00000371030	T	0.04454	3.62	5.66	-0.965	0.10323	.	0.972377	0.08395	N	0.952289	T	0.03053	0.0090	L	0.31294	0.92	0.09310	N	1	B	0.26120	0.142	B	0.18263	0.021	T	0.46665	-0.9175	10	0.32370	T	0.25	-2.9174	0.9542	0.01382	0.1518:0.2684:0.1569:0.4228	.	1627	Q5JPB2	ZN831_HUMAN	A	1627	ENSP00000360069:V1627A	ENSP00000360069:V1627A	V	+	2	0	ZNF831	57263039	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.574000	0.05868	0.099000	0.17552	0.528000	0.53228	GTG		0.488	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		31	62	0	0	0	0.009535	0	31	62				
CHRNA4	1137	broad.mit.edu	37	20	61981902	61981902	+	Silent	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:61981902G>C	ENST00000370263.4	-	5	1082	c.861C>G	c.(859-861)gtC>gtG	p.V287V	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	287					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.V287V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCAGCAGGAAGACGGTGAGCG	0.592																																							uc002yes.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(859-861)GTC>GTG		cholinergic receptor, nicotinic, alpha 4 subunit	Nicotine(DB00184)|Varenicline(DB01273)						261.0	192.0	215.0					20																	61981902		2203	4300	6503	SO:0001819	synonymous_variant	1137				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr20:61981902G>C		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.861C>G	20.37:g.61981902G>C			Somatic				CHRNA4_uc002yet.1_Silent_p.V111V|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Silent_p.V216V|CHRNA4_uc002yev.1_Silent_p.V111V|CHRNA4_uc010gkf.1_Silent_p.V111V	p.V287V	NM_000744	NP_000735	WXS	Illumina HiSeq	Unspecified	P43681	ACHA4_HUMAN			5	1039	-	all_cancers(38;1.71e-10)		287			Helical; (Potential).		Q4JGR7|Q4VAQ5|Q4VAQ6	Silent	SNP	ENST00000370263.4	37	c.861C>G	CCDS13517.1																																																																																				0.592	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			15	51	0	0	0	0.003163	0	15	51				
CHRNA4	1137	broad.mit.edu	37	20	61982063	61982063	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:61982063T>C	ENST00000370263.4	-	5	921	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	234					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.T234A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	AAGGCATAGGTGATGTCCGGG	0.592																																							uc002yes.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(700-702)ACC>GCC		cholinergic receptor, nicotinic, alpha 4 subunit	Nicotine(DB00184)|Varenicline(DB01273)						215.0	163.0	181.0					20																	61982063		2203	4300	6503	SO:0001583	missense	1137				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr20:61982063T>C		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.700A>G	20.37:g.61982063T>C	ENSP00000359285:p.Thr234Ala		Somatic				CHRNA4_uc002yet.1_Missense_Mutation_p.T58A|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Missense_Mutation_p.T163A|CHRNA4_uc002yev.1_Missense_Mutation_p.T58A|CHRNA4_uc010gkf.1_Missense_Mutation_p.T58A	p.T234A	NM_000744	NP_000735	WXS	Illumina HiSeq	Unspecified	P43681	ACHA4_HUMAN			5	878	-	all_cancers(38;1.71e-10)		234			Extracellular (Potential).		Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	c.700A>G	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.859802	0.51376	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.79653	-1.29	4.77	4.77	0.60923	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90748	0.7096	H	0.97214	3.96	0.80722	D	1	B;B	0.30236	0.274;0.126	B;B	0.43809	0.432;0.338	D	0.91846	0.5487	10	0.66056	D	0.02	.	14.281	0.66211	0.0:0.0:0.0:1.0	.	163;234	Q4VAQ5;P43681	.;ACHA4_HUMAN	A	140;234;163	ENSP00000359285:T234A	ENSP00000359280:T140A	T	-	1	0	CHRNA4	61452507	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	5.023000	0.64084	1.760000	0.52011	0.459000	0.35465	ACC		0.592	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			24	50	0	0	0	0.00632	0	24	50				
TPTE	7179	broad.mit.edu	37	21	10910328	10910328	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr21:10910328C>G	ENST00000361285.4	-	22	1757	c.1428G>C	c.(1426-1428)gtG>gtC	p.V476V	TPTE_ENST00000342420.5_Silent_p.V438V|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Silent_p.V458V	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	476	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V476V(1)|p.V458V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACTGCACTTTCACATCATCAT	0.343																																							uc002yip.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1426-1428)GTG>GTC		transmembrane phosphatase with tensin homology							187.0	189.0	189.0					21																	10910328		2203	4300	6503	SO:0001819	synonymous_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10910328C>G	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1428G>C	21.37:g.10910328C>G			Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.V458V|TPTE_uc002yir.1_Silent_p.V438V|TPTE_uc010gkv.1_Silent_p.V338V	p.V476V	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	22	1796	-			476			C2 tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	c.1428G>C	CCDS13560.2																																																																																				0.343	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			17	104	0	0	0	0.008871	0	17	104				
KRTAP19-2	337969	broad.mit.edu	37	21	31859528	31859528	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr21:31859528C>A	ENST00000334055.3	-	1	227	c.140G>T	c.(139-141)aGa>aTa	p.R47I		NM_181608.1	NP_853639.1	Q3LHN2	KR192_HUMAN	keratin associated protein 19-2	47						intermediate filament (GO:0005882)		p.R47I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GCCAGTGAATCTATATCTTCT	0.458																																							uc011acy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)AGA>ATA		keratin associated protein 19-2							98.0	96.0	97.0					21																	31859528		2203	4300	6503	SO:0001583	missense	337969					intermediate filament		g.chr21:31859528C>A	AP001708	CCDS13595.1	21q22.1	2006-03-13			ENSG00000186965	ENSG00000186965		"""Keratin associated proteins"""	18937	protein-coding gene	gene with protein product						12359730	Standard	NM_181608		Approved	KAP19.2	uc011acy.2	Q3LHN2	OTTHUMG00000057772	ENST00000334055.3:c.140G>T	21.37:g.31859528C>A	ENSP00000335660:p.Arg47Ile		Somatic					p.R47I	NM_181608	NP_853639	WXS	Illumina HiSeq	Unspecified	Q3LHN2	KR192_HUMAN			1	140	-			47						Missense_Mutation	SNP	ENST00000334055.3	37	c.140G>T	CCDS13595.1	.	.	.	.	.	.	.	.	.	.	-	8.741	0.918912	0.17982	.	.	ENSG00000186965	ENST00000334055	T	0.32753	1.44	4.34	3.45	0.39498	.	0.315094	0.23005	N	0.053034	T	0.20577	0.0495	.	.	.	0.09310	N	1	P	0.39964	0.697	B	0.35353	0.201	T	0.20538	-1.0272	9	0.87932	D	0	.	7.5025	0.27526	0.0:0.8845:0.0:0.1155	.	47	Q3LHN2	KR192_HUMAN	I	47	ENSP00000335660:R47I	ENSP00000335660:R47I	R	-	2	0	KRTAP19-2	30781399	0.004000	0.15560	0.049000	0.19019	0.012000	0.07955	1.169000	0.31871	2.437000	0.82529	0.651000	0.88453	AGA		0.458	KRTAP19-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128224.3			40	100	1	0	4.07013e-28	0.00874	7.28113e-28	40	100				
KRTAP19-3	337970	broad.mit.edu	37	21	31864067	31864067	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr21:31864067G>A	ENST00000334063.4	-	1	208	c.209C>T	c.(208-210)tCa>tTa	p.S70L		NM_181609.3	NP_853640.1	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	70						intermediate filament (GO:0005882)		p.S70L(1)		large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	9						TCCATAGTATGATGGGCGGTA	0.483																																							uc002yog.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(208-210)TCA>TTA		keratin associated protein 19-3							135.0	145.0	142.0					21																	31864067		2203	4300	6503	SO:0001583	missense	337970					intermediate filament		g.chr21:31864067G>A	AP001708	CCDS13596.1	21q22.1	2011-02-10			ENSG00000244025	ENSG00000244025		"""Keratin associated proteins"""	18938	protein-coding gene	gene with protein product						12359730	Standard	NM_181609		Approved	KAP19.3	uc002yog.1	Q7Z4W3	OTTHUMG00000057782	ENST00000334063.4:c.209C>T	21.37:g.31864067G>A	ENSP00000386376:p.Ser70Leu		Somatic					p.S70L	NM_181609	NP_853640	WXS	Illumina HiSeq	Unspecified	Q7Z4W3	KR193_HUMAN			1	209	-			70						Missense_Mutation	SNP	ENST00000334063.4	37	c.209C>T	CCDS13596.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255524	0.22965	.	.	ENSG00000244025	ENST00000334063	T	0.10005	2.92	5.0	-3.02	0.05446	.	3.046760	0.02105	N	0.054325	T	0.09024	0.0223	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.39187	-0.9626	9	0.87932	D	0	.	6.1088	0.20090	0.5298:0.1372:0.333:0.0	.	70	Q7Z4W3	KR193_HUMAN	L	70	ENSP00000386376:S70L	ENSP00000386376:S70L	S	-	2	0	KRTAP19-3	30785938	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.165000	0.09968	-0.953000	0.03645	0.650000	0.86243	TCA		0.483	KRTAP19-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128234.2			96	130	0	0	0	0.01441	0	96	130				
KRTAP11-1	337880	broad.mit.edu	37	21	32253560	32253560	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr21:32253560G>T	ENST00000332378.4	-	1	314	c.284C>A	c.(283-285)cCc>cAc	p.P95H		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	95						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.P95H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						AGTTGAGCAGGGGTTGGAAAT	0.572																																							uc002yov.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(283-285)CCC>CAC		keratin associated protein 11-1							85.0	83.0	84.0					21																	32253560		2203	4300	6503	SO:0001583	missense	337880					keratin filament	structural molecule activity	g.chr21:32253560G>T	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.284C>A	21.37:g.32253560G>T	ENSP00000330720:p.Pro95His		Somatic					p.P95H	NM_175858	NP_787054	WXS	Illumina HiSeq	Unspecified	Q8IUC1	KR111_HUMAN			1	315	-			95					A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	c.284C>A	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135079	0.56828	.	.	ENSG00000182591	ENST00000332378	T	0.04654	3.58	5.4	5.4	0.78164	.	0.922491	0.09256	N	0.827275	T	0.29524	0.0736	M	0.87547	2.89	0.40130	D	0.976708	D	0.89917	1.0	D	0.79108	0.992	T	0.00724	-1.1593	10	0.62326	D	0.03	-19.5167	17.0969	0.86637	0.0:0.0:1.0:0.0	.	95	Q8IUC1	KR111_HUMAN	H	95	ENSP00000330720:P95H	ENSP00000330720:P95H	P	-	2	0	KRTAP11-1	31175431	1.000000	0.71417	0.879000	0.34478	0.534000	0.34807	4.048000	0.57390	2.722000	0.93159	0.650000	0.86243	CCC		0.572	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			10	58	1	0	0.00621372	0.006214	0.00664495	10	58				
PCNT	5116	broad.mit.edu	37	21	47783764	47783764	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr21:47783764G>T	ENST00000359568.5	+	14	2631	c.2524G>T	c.(2524-2526)Gag>Tag	p.E842*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	842					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.E842*(1)|p.E842K(1)|p.E842Q(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTGTGGGCGGGAGCCGCCCAC	0.662																																							uc002zji.3		NA																	3	Substitution - Missense(2)|Substitution - Nonsense(1)		lung(3)	ovary(4)|breast(2)|pancreas(2)	8						c.(2524-2526)GAG>TAG		pericentrin							69.0	81.0	77.0					21																	47783764		2193	4278	6471	SO:0001587	stop_gained	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47783764G>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2524G>T	21.37:g.47783764G>T	ENSP00000352572:p.Glu842*		Somatic				PCNT_uc002zjj.2_Nonsense_Mutation_p.E724*	p.E842*	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			14	2631	+	Breast(49;0.112)		842					O43152|Q7Z7C9	Nonsense_Mutation	SNP	ENST00000359568.5	37	c.2524G>T	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	38	6.744518	0.97805	.	.	ENSG00000160299	ENST00000359568	.	.	.	4.43	3.52	0.40303	.	0.000000	0.33346	N	0.005003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	11.972	0.53069	0.0:0.3333:0.6667:0.0	.	.	.	.	X	842	.	ENSP00000352572:E842X	E	+	1	0	PCNT	46608192	0.939000	0.31865	0.869000	0.34112	0.269000	0.26545	3.996000	0.57009	0.816000	0.34421	0.491000	0.48974	GAG		0.662	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		15	142	1	0	4.75885e-15	0.00499	7.4515e-15	15	142				
GAB4	128954	broad.mit.edu	37	22	17447089	17447089	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:17447089C>A	ENST00000400588.1	-	6	1296	c.1189G>T	c.(1189-1191)Ggc>Tgc	p.G397C	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	397								p.G397C(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				AGTGGGGAGCCAAGCAGGTCA	0.602																																							uc002zlw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1189-1191)GGC>TGC		GRB2-associated binding protein family, member							74.0	82.0	79.0					22																	17447089		2040	4214	6254	SO:0001583	missense	128954							g.chr22:17447089C>A	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1189G>T	22.37:g.17447089C>A	ENSP00000383431:p.Gly397Cys		Somatic				GAB4_uc010gqs.1_3'UTR	p.G397C	NM_001037814	NP_001032903	WXS	Illumina HiSeq	Unspecified	Q2WGN9	GAB4_HUMAN			6	1297	-		all_epithelial(15;0.112)|Lung NSC(13;0.248)	397						Missense_Mutation	SNP	ENST00000400588.1	37	c.1189G>T	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572392	0.28092	.	.	ENSG00000215568	ENST00000400588	T	0.17528	2.27	2.96	1.91	0.25777	.	0.174573	0.49916	D	0.000132	T	0.27454	0.0674	L	0.43923	1.385	0.36963	D	0.893465	D	0.89917	1.0	D	0.67548	0.952	T	0.11743	-1.0575	10	0.87932	D	0	.	8.2375	0.31636	0.0:0.8661:0.0:0.1339	.	397	Q2WGN9	GAB4_HUMAN	C	397	ENSP00000383431:G397C	ENSP00000383431:G397C	G	-	1	0	GAB4	15827089	0.004000	0.15560	0.082000	0.20525	0.015000	0.08874	0.066000	0.14489	0.516000	0.28340	0.411000	0.27672	GGC		0.602	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882		12	53	1	0	3.07112e-06	0.010729	3.69843e-06	12	53				
SCARF2	91179	broad.mit.edu	37	22	20781790	20781790	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:20781790G>A	ENST00000266214.5	-	10	1707	c.1603C>T	c.(1603-1605)Cca>Tca	p.P535S	SCARF2_ENST00000405555.3_Missense_Mutation_p.P530S	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	535					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.P535S(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CCTGAGGGTGGCTCCAGGAAG	0.627																																							uc002zsj.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1603-1605)CCA>TCA		scavenger receptor class F, member 2 isoform 1							116.0	105.0	108.0					22																	20781790		2203	4300	6503	SO:0001583	missense	91179				cell adhesion	integral to membrane	protein binding|receptor activity	g.chr22:20781790G>A	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.1603C>T	22.37:g.20781790G>A	ENSP00000266214:p.Pro535Ser		Somatic				SCARF2_uc002zsk.1_Missense_Mutation_p.P530S	p.P535S	NM_153334	NP_699165	WXS	Illumina HiSeq	Unspecified	Q96GP6	SREC2_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)		10	1708	-	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	530			Cytoplasmic (Potential).		E5RFB8|Q58A83|Q8IXF3|Q9BW74	Missense_Mutation	SNP	ENST00000266214.5	37	c.1603C>T	CCDS13779.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771194	0.69992	.	.	ENSG00000244486	ENST00000405555;ENST00000341328;ENST00000266214	T;T	0.34072	1.38;1.38	4.62	4.62	0.57501	.	0.072387	0.56097	D	0.000038	T	0.35189	0.0923	L	0.58969	1.84	0.44780	D	0.997781	B;P	0.43352	0.297;0.804	B;B	0.37480	0.172;0.251	T	0.32214	-0.9915	10	0.46703	T	0.11	-6.6369	15.335	0.74244	0.0:0.0:1.0:0.0	.	530;530	E5RFB8;Q96GP6	.;SREC2_HUMAN	S	530;530;535	ENSP00000385589:P530S;ENSP00000266214:P535S	ENSP00000266214:P535S	P	-	1	0	SCARF2	19111790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.546000	0.82137	2.307000	0.77673	0.462000	0.41574	CCA		0.627	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1			17	138	0	0	0	0.00499	0	17	138				
PIWIL3	440822	broad.mit.edu	37	22	25115791	25115791	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:25115791T>C	ENST00000332271.5	-	20	2872	c.2456A>G	c.(2455-2457)tAt>tGt	p.Y819C	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.Y701C|PIWIL3_ENST00000527701.1_Missense_Mutation_p.Y701C	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	819	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.Y819C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AATCGTGTCATAGATGACGTT	0.383																																							uc003abd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(2455-2457)TAT>TGT		piwi-like 3							101.0	96.0	97.0					22																	25115791		2203	4300	6503	SO:0001583	missense	440822				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding	g.chr22:25115791T>C	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.2456A>G	22.37:g.25115791T>C	ENSP00000330031:p.Tyr819Cys		Somatic				PIWIL3_uc011ajx.1_Missense_Mutation_p.Y701C|PIWIL3_uc011ajy.1_Missense_Mutation_p.Y701C|PIWIL3_uc010gut.1_Missense_Mutation_p.Y810C	p.Y819C	NM_001008496	NP_001008496	WXS	Illumina HiSeq	Unspecified	Q7Z3Z3	PIWL3_HUMAN			20	2873	-			819			Piwi.			Missense_Mutation	SNP	ENST00000332271.5	37	c.2456A>G	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481356	0.26598	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.33216	1.42;1.42;1.42	2.81	2.81	0.32909	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.218037	0.39985	N	0.001207	T	0.50718	0.1632	M	0.76328	2.33	0.36573	D	0.873122	D;B;D	0.89917	0.999;0.403;1.0	D;B;D	0.75484	0.975;0.316;0.986	T	0.61700	-0.7009	10	0.72032	D	0.01	-9.3321	9.3936	0.38388	0.0:0.0:0.0:1.0	.	701;810;819	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	C	819;701;701	ENSP00000330031:Y819C;ENSP00000431843:Y701C;ENSP00000435718:Y701C	ENSP00000330031:Y819C	Y	-	2	0	PIWIL3	23445791	1.000000	0.71417	0.338000	0.25549	0.111000	0.19643	3.430000	0.52807	1.538000	0.49270	0.459000	0.35465	TAT		0.383	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496		5	68	0	0	0	0.001984	0	5	68				
LINC00207	388910	broad.mit.edu	37	22	44967363	44967363	+	lincRNA	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:44967363G>A	ENST00000605505.1	+	0	354					NR_028409.1				long intergenic non-protein coding RNA 207									p.R78K(2)		lung(3)	3						CAGCAGAGCAGGCTGGACTGG	0.557																																							uc003bev.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(232-234)AGG>AAG		SubName: Full=Novel gene;							63.0	69.0	67.0					22																	44967363		2083	4204	6287			388910							g.chr22:44967363G>A	BC144508		22q13.31	2012-10-12	2011-08-11	2011-08-11	ENSG00000187012	ENSG00000187012		"""Long non-coding RNAs"""	37255	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 207"""	NCRNA00207			Standard	NR_028409		Approved		uc021wre.2		OTTHUMG00000150462		22.37:g.44967363G>A			Somatic				NCRNA00207_uc011aqg.1_RNA|NCRNA00207_uc011aqh.1_RNA	p.R78K	NM_001012986	NP_001013004	WXS	Illumina HiSeq	Unspecified					3	300	+									Missense_Mutation	SNP	ENST00000605505.1	37	c.233G>A		.	.	.	.	.	.	.	.	.	.	G	3.343	-0.134121	0.06711	.	.	ENSG00000187012	ENST00000334566	.	.	.	0.6	0.6	0.17524	.	.	.	.	.	T	0.43433	0.1247	.	.	.	0.09310	N	1	P	0.41597	0.756	P	0.48114	0.567	T	0.35375	-0.9791	6	0.87932	D	0	.	.	.	.	.	78	Q5JZ73	.	K	78	.	ENSP00000334101:R78K	R	+	2	0	NCRNA00207	43346027	0.585000	0.26774	0.060000	0.19600	0.029000	0.11900	0.790000	0.26900	0.591000	0.29711	0.436000	0.28706	AGG		0.557	LINC00207-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000468439.1	NR_028409		5	29	0	0	0	0.000602	0	5	29				
PLXNB2	23654	broad.mit.edu	37	22	50724601	50724601	+	Splice_Site	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:50724601C>T	ENST00000449103.1	-	9	2018		c.e9+1		PLXNB2_ENST00000359337.4_Splice_Site|PLXNB2_ENST00000496720.1_Splice_Site			O15031	PLXB2_HUMAN	plexin B2						brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.?(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AAGACACTCACGGCAGGTTCT	0.627																																							uc003bkv.3		NA																	1	Unknown(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.e9+1		plexin B2 precursor							94.0	112.0	106.0					22																	50724601		2104	4227	6331	SO:0001630	splice_region_variant	23654				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity	g.chr22:50724601C>T		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1877+1G>A	22.37:g.50724601C>T			Somatic					p.P626_splice	NM_012401	NP_036533	WXS	Illumina HiSeq	Unspecified	O15031	PLXB2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	9	1983	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)						A6QRH0|Q7KZU3|Q9BSU7	Splice_Site	SNP	ENST00000449103.1	37	c.1877_splice	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793882	0.70452	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	.	.	.	4.1	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.191	0.65637	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNB2	49066728	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.544000	0.67231	2.013000	0.59113	0.561000	0.74099	.		0.627	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	Intron	10	86	0	0	0	0.008291	0	10	86				
ZNF445	353274	broad.mit.edu	37	3	44496980	44496980	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:44496980C>A	ENST00000396077.2	-	3	409	c.62G>T	c.(61-63)gGg>gTg	p.G21V	ZNF445_ENST00000425708.2_Missense_Mutation_p.G21V	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	21					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G21V(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CTGAAGCCGCCCTCGCTCCCT	0.577																																							uc003cnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(61-63)GGG>GTG		zinc finger protein 445							67.0	64.0	65.0					3																	44496980		2203	4300	6503	SO:0001583	missense	353274				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44496980C>A	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.62G>T	3.37:g.44496980C>A	ENSP00000379387:p.Gly21Val		Somatic				ZNF445_uc011azv.1_Missense_Mutation_p.G21V|ZNF445_uc011azw.1_Missense_Mutation_p.G21V	p.G21V	NM_181489	NP_852466	WXS	Illumina HiSeq	Unspecified	P59923	ZN445_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)	3	410	-			21					Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	c.62G>T	CCDS2713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.708|4.708	0.131729|0.131729	0.08981|0.08981	.|.	.|.	ENSG00000185219|ENSG00000185219	ENST00000425708;ENST00000396077|ENST00000340674;ENST00000430301	T;T|.	0.05649|.	3.41;3.41|.	4.02|4.02	1.19|1.19	0.21007|0.21007	.|.	0.346876|.	0.21194|.	N|.	0.078598|.	T|T	0.15132|0.15132	0.0365|0.0365	N|N	0.08118|0.08118	0|0	0.19300|0.19300	N|N	0.99998|0.99998	P;P|.	0.48694|.	0.914;0.914|.	B;B|.	0.43623|.	0.425;0.425|.	T|T	0.21552|0.21552	-1.0242|-1.0242	10|6	0.72032|0.25751	D|T	0.01|0.34	.|.	2.7288|2.7288	0.05221|0.05221	0.1898:0.5242:0.1837:0.1023|0.1898:0.5242:0.1837:0.1023	.|.	21;21|.	B7ZKX2;P59923|.	.;ZN445_HUMAN|.	V|S	21|19;20	ENSP00000413073:G21V;ENSP00000379387:G21V|.	ENSP00000379387:G21V|ENSP00000342436:R19S	G|R	-|-	2|3	0|2	ZNF445|ZNF445	44471984|44471984	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.029000|0.029000	0.11900|0.11900	-0.093000|-0.093000	0.11111|0.11111	0.250000|0.250000	0.21479|0.21479	-0.302000|-0.302000	0.09304|0.09304	GGG|AGG		0.577	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489		35	34	1	0	2.09667e-21	0.003755	3.50997e-21	35	34				
ZDHHC3	51304	broad.mit.edu	37	3	44986781	44986781	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:44986781C>T	ENST00000424952.2	-	3	578	c.310G>A	c.(310-312)Gca>Aca	p.A104T	ZDHHC3_ENST00000342790.4_Missense_Mutation_p.A138T|ZDHHC3_ENST00000296127.3_Missense_Mutation_p.A104T	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	104					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A104T(1)		endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		TTGGGCACTGCCCCCTGTAGG	0.488																																							uc003cod.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)GCA>ACA		zinc finger, DHHC-type containing 3 isoform 2							110.0	114.0	113.0					3																	44986781		2203	4300	6503	SO:0001583	missense	51304					Golgi membrane|integral to membrane	zinc ion binding	g.chr3:44986781C>T	AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.310G>A	3.37:g.44986781C>T	ENSP00000395502:p.Ala104Thr		Somatic				ZDHHC3_uc003cog.2_Missense_Mutation_p.A104T|ZDHHC3_uc011bad.1_Missense_Mutation_p.A104T	p.A104T	NM_016598	NP_057682	WXS	Illumina HiSeq	Unspecified	Q9NYG2	ZDHC3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)	3	584	-			104			Cytoplasmic (Potential).		Q53A17|Q96BL0	Missense_Mutation	SNP	ENST00000424952.2	37	c.310G>A	CCDS46811.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495356	0.85069	.	.	ENSG00000163812	ENST00000296127;ENST00000424952;ENST00000342790	T;T;T	0.36340	1.92;1.92;1.26	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.32912	0.0845	N	0.25245	0.725	0.80722	D	1	B;B;B	0.30889	0.299;0.155;0.187	B;B;B	0.37833	0.256;0.111;0.259	T	0.05920	-1.0856	9	.	.	.	.	19.7813	0.96417	0.0:1.0:0.0:0.0	.	104;104;104	E9PGS3;Q9NYG2-2;Q9NYG2	.;.;ZDHC3_HUMAN	T	104;104;138	ENSP00000296127:A104T;ENSP00000395502:A104T;ENSP00000345268:A138T	.	A	-	1	0	ZDHHC3	44961785	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.694000	0.84235	2.688000	0.91661	0.591000	0.81541	GCA		0.488	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347004.1	NM_016598		5	152	0	0	0	0.000602	0	5	152				
DALRD3	55152	broad.mit.edu	37	3	49055934	49055934	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:49055934C>G	ENST00000341949.4	-	1	70	c.64G>C	c.(64-66)Ggc>Cgc	p.G22R	DALRD3_ENST00000313778.5_Intron|NDUFAF3_ENST00000326925.6_5'Flank|NDUFAF3_ENST00000326912.4_5'Flank|MIR191_ENST00000384873.1_RNA|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000496568.1_Intron|DALRD3_ENST00000395462.4_5'UTR|DALRD3_ENST00000440857.1_5'UTR|NDUFAF3_ENST00000395458.2_5'Flank|DALRD3_ENST00000441576.2_Missense_Mutation_p.G22R	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	22					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)	p.G22R(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACCGGACCGCCTGGCCCCAGG	0.682																																							uc003cvk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(64-66)GGC>CGC		DALR anticodon binding domain containing 3							9.0	14.0	12.0					3																	49055934		2160	4263	6423	SO:0001583	missense	55152				arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding	g.chr3:49055934C>G	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.64G>C	3.37:g.49055934C>G	ENSP00000344989:p.Gly22Arg		Somatic				DALRD3_uc003cvl.1_Missense_Mutation_p.G22R|DALRD3_uc003cvm.1_Intron|DALRD3_uc010hko.1_5'UTR|DALRD3_uc011bca.1_Missense_Mutation_p.G22R|NDUFAF3_uc003cvn.2_5'Flank|NDUFAF3_uc003cvp.2_5'Flank	p.G22R	NM_001009996	NP_001009996	WXS	Illumina HiSeq	Unspecified	Q5D0E6	DALD3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	1	84	-			22					Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	ENST00000341949.4	37	c.64G>C	CCDS33754.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525680	0.44969	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000420952	T;T;T	0.49720	0.77;0.87;0.78	4.41	2.44	0.29823	.	0.060183	0.64402	D	0.000003	T	0.61236	0.2331	M	0.66939	2.045	0.32624	N	0.522941	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.67738	-0.5593	10	0.54805	T	0.06	-18.4872	8.1458	0.31110	0.0:0.6673:0.2377:0.095	.	22;22;22	B7Z727;Q5D0E6-2;Q5D0E6	.;.;DALD3_HUMAN	R	22	ENSP00000410623:G22R;ENSP00000344989:G22R;ENSP00000397385:G22R	ENSP00000344989:G22R	G	-	1	0	DALRD3	49030938	0.023000	0.18921	0.165000	0.22776	0.012000	0.07955	1.167000	0.31847	0.973000	0.38340	-0.258000	0.10820	GGC		0.682	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114		3	6	0	0	0	0.004672	0	3	6				
IQCF3	401067	broad.mit.edu	37	3	51864584	51864584	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:51864584C>A	ENST00000456080.1	+	8	1397	c.232C>A	c.(232-234)Cgg>Agg	p.R78R	IQCF3_ENST00000444293.1_Missense_Mutation_p.A41E|IQCF3_ENST00000446775.1_Silent_p.R78R|IQCF3_ENST00000440739.2_Silent_p.R78R|IQCF3_ENST00000437810.2_Silent_p.R78R|IQCF3_ENST00000462079.1_3'UTR			P0C7M6	IQCF3_HUMAN	IQ motif containing F3	78								p.R78R(2)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GATCCGTCAGCGGCGGCAGGC	0.647																																							uc010hlx.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(232-234)CGG>AGG		IQ motif containing F3							67.0	81.0	76.0					3																	51864584		2196	4289	6485	SO:0001819	synonymous_variant	401067							g.chr3:51864584C>A	AK057432	CCDS46837.1	3p21.31	2008-06-12			ENSG00000229972	ENSG00000229972			31816	protein-coding gene	gene with protein product							Standard	NM_001085479		Approved		uc021wyz.1	P0C7M6	OTTHUMG00000156910	ENST00000456080.1:c.232C>A	3.37:g.51864584C>A			Somatic				IQCF1_uc003dbq.3_Intron|IQCF3_uc010hlw.1_RNA|IQCF3_uc011bdw.1_RNA	p.R78R	NM_001085479	NP_001078948	WXS	Illumina HiSeq	Unspecified	P0C7M6	IQCF3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	5	573	+			78					B2RUV0	Silent	SNP	ENST00000456080.1	37	c.232C>A	CCDS46837.1	.	.	.	.	.	.	.	.	.	.	c	8.551	0.875607	0.17395	.	.	ENSG00000229972	ENST00000444293	.	.	.	4.72	2.93	0.34026	.	.	.	.	.	T	0.42988	0.1227	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35992	-0.9766	5	0.87932	D	0	.	7.3227	0.26536	0.0:0.8008:0.0:0.1992	.	.	.	.	E	41	.	ENSP00000402530:A41E	A	+	2	0	IQCF3	51839624	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.054000	0.14205	0.723000	0.32274	0.655000	0.94253	GCG		0.647	IQCF3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346579.2	NM_001085479		38	36	1	0	2.04263e-09	0.004289	2.76981e-09	38	36				
RRP9	9136	broad.mit.edu	37	3	51968721	51968721	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:51968721C>G	ENST00000232888.6	-	12	1179	c.1106G>C	c.(1105-1107)gGa>gCa	p.G369A		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	369					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.G369A(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		GCCTGGCTCTCCCCGCAGCCC	0.617																																							uc003dbw.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(1105-1107)GGA>GCA		RNA, U3 small nucleolar interacting protein 2							54.0	55.0	55.0					3																	51968721		2203	4300	6503	SO:0001583	missense	9136				rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding	g.chr3:51968721C>G	AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.1106G>C	3.37:g.51968721C>G	ENSP00000232888:p.Gly369Ala		Somatic					p.G369A	NM_004704	NP_004695	WXS	Illumina HiSeq	Unspecified	O43818	U3IP2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)	12	1145	-			369					B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	c.1106G>C	CCDS2837.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534792	0.64972	.	.	ENSG00000114767	ENST00000232888	T	0.52295	0.67	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	L	0.52011	1.625	0.80722	D	1	P	0.36144	0.539	B	0.24974	0.057	T	0.38090	-0.9677	10	0.49607	T	0.09	-37.9188	12.5802	0.56386	0.0:0.9167:0.0:0.0833	.	369	O43818	U3IP2_HUMAN	A	369	ENSP00000232888:G369A	ENSP00000232888:G369A	G	-	2	0	RRP9	51943761	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.768000	0.62293	2.305000	0.77605	0.462000	0.41574	GGA		0.617	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704		41	25	0	0	0	0.00874	0	41	25				
NEK4	6787	broad.mit.edu	37	3	52802578	52802578	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:52802578C>A	ENST00000233027.5	-	2	338	c.136G>T	c.(136-138)Gag>Tag	p.E46*	NEK4_ENST00000535191.1_Intron|NEK4_ENST00000383721.4_Nonsense_Mutation_p.E46*	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	46	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.E46*(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GCTCGCCGCTCTCGGCTAGAG	0.453																																							uc003dfq.3		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)	1						c.(136-138)GAG>TAG		NIMA-related kinase 4							104.0	102.0	103.0					3																	52802578		2203	4300	6503	SO:0001587	stop_gained	6787				cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr3:52802578C>A	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.136G>T	3.37:g.52802578C>A	ENSP00000233027:p.Glu46*		Somatic				NEK4_uc011bej.1_Intron|NEK4_uc003dfr.2_Nonsense_Mutation_p.E46*	p.E46*	NM_003157	NP_003148	WXS	Illumina HiSeq	Unspecified	P51957	NEK4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)	2	325	-			46			Protein kinase.		A5YM70|B2R633|B7Z200|Q6P576	Nonsense_Mutation	SNP	ENST00000233027.5	37	c.136G>T	CCDS2863.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226124	0.95173	.	.	ENSG00000114904	ENST00000233027;ENST00000383721	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.8926	0.96935	0.0:1.0:0.0:0.0	.	.	.	.	X	46	.	ENSP00000233027:E46X	E	-	1	0	NEK4	52777618	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	7.162000	0.77515	2.709000	0.92574	0.563000	0.77884	GAG		0.453	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157		77	75	1	0	8.70839e-23	0.01441	1.48723e-22	77	75				
OR5H15	403274	broad.mit.edu	37	3	97888150	97888150	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:97888150T>A	ENST00000356526.2	+	1	607	c.607T>A	c.(607-609)Tca>Aca	p.S203T		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S203T(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TTTTATTTTCTCAGGTTCAAT	0.313																																							uc011bgu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(607-609)TCA>ACA		olfactory receptor, family 5, subfamily H,							35.0	40.0	38.0					3																	97888150		2203	4295	6498	SO:0001583	missense	403274				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97888150T>A		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.607T>A	3.37:g.97888150T>A	ENSP00000373195:p.Ser203Thr		Somatic					p.S203T	NM_001005515	NP_001005515	WXS	Illumina HiSeq	Unspecified	A6NDH6	O5H15_HUMAN			1	607	+			203			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000356526.2	37	c.607T>A	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	12.14	1.847705	0.32606	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.37584	1.19	2.48	-2.85	0.05734	GPCR, rhodopsin-like superfamily (1);	0.310256	0.23491	N	0.047606	T	0.36138	0.0956	L	0.49699	1.58	0.09310	N	1	P	0.46621	0.881	P	0.53760	0.734	T	0.23940	-1.0174	10	0.62326	D	0.03	.	4.9774	0.14148	0.1806:0.0:0.5309:0.2885	.	203	A6NDH6	O5H15_HUMAN	T	203	ENSP00000373195:S203T	ENSP00000373195:S203T	S	+	1	0	OR5H15	99370840	0.000000	0.05858	0.010000	0.14722	0.006000	0.05464	-0.017000	0.12590	-0.206000	0.10203	0.155000	0.16302	TCA		0.313	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1			7	34	0	0	0	0.00308	0	7	34				
ALCAM	214	broad.mit.edu	37	3	105266233	105266234	+	Splice_Site	DNP	GG	GG	TT			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:105266233_105266234GG>TT	ENST00000306107.5	+	11	1740_1741	c.1240_1241GG>TT	c.(1240-1242)GGc>TTc	p.G414F	ALCAM_ENST00000389927.4_Splice_Site_p.G136F|ALCAM_ENST00000472644.2_Splice_Site_p.G414F|ALCAM_ENST00000486979.2_Splice_Site_p.G363F	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	414					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)	p.?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TAATATTTCAGGCAAACCTCAA	0.322																																							uc003dvx.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|breast(1)	3						c.e11-1		activated leukocyte cell adhesion molecule																																				SO:0001630	splice_region_variant	214				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr3:105266233_105266234GG>TT	AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	Exception_encountered	3.37:g.105266233_105266234delinsTT			Somatic				ALCAM_uc003dvw.1_Splice_Site_p.G414_splice|ALCAM_uc003dvy.2_Splice_Site_p.G414_splice|ALCAM_uc010hpp.2_Splice_Site_p.G136_splice|ALCAM_uc003dvz.2_Splice_Site_p.G48_splice	p.G414_splice	NM_001627	NP_001618	WXS	Illumina HiSeq	Unspecified	Q13740	CD166_HUMAN			11	1781	+								B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Splice_Site	DNP	ENST00000306107.5	37	c.1241_splice	CCDS33810.1																																																																																				0.322	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353764.1	NM_001627	Missense_Mutation	13	13	0	0	0	0.004672	0	13	13				
ABHD10	55347	broad.mit.edu	37	3	111700675	111700675	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:111700675C>G	ENST00000273359.3	+	2	214	c.187C>G	c.(187-189)Ctt>Gtt	p.L63V	ABHD10_ENST00000534857.1_Intron|ABHD10_ENST00000494817.1_Missense_Mutation_p.L63V	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	63					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.L63V(1)		large_intestine(2)|lung(7)|skin(1)	10						TCGACCAGACCTTCCAAACCT	0.378																																							uc003dyk.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(187-189)CTT>GTT		abhydrolase domain containing 10 precursor							129.0	128.0	128.0					3																	111700675		2203	4300	6503	SO:0001583	missense	55347					mitochondrion	serine-type peptidase activity	g.chr3:111700675C>G	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.187C>G	3.37:g.111700675C>G	ENSP00000273359:p.Leu63Val		Somatic				ABHD10_uc011bhq.1_Intron	p.L63V	NM_018394	NP_060864	WXS	Illumina HiSeq	Unspecified	Q9NUJ1	ABHDA_HUMAN			2	268	+			63					B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	37	c.187C>G	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404291	0.62288	.	.	ENSG00000144827	ENST00000273359;ENST00000494817	T	0.53423	0.62	5.57	4.69	0.59074	.	0.070004	0.56097	D	0.000022	T	0.56171	0.1967	M	0.72894	2.215	0.80722	D	1	D	0.63880	0.993	P	0.55749	0.783	T	0.53034	-0.8495	10	0.30078	T	0.28	-1.8505	9.1297	0.36837	0.0:0.838:0.0:0.162	.	63	Q9NUJ1	ABHDA_HUMAN	V	63	ENSP00000273359:L63V	ENSP00000273359:L63V	L	+	1	0	ABHD10	113183365	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	4.667000	0.61561	2.618000	0.88619	0.561000	0.74099	CTT		0.378	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394		63	68	0	0	0	0.01441	0	63	68				
DRD3	1814	broad.mit.edu	37	3	113866281	113866281	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:113866281C>G	ENST00000460779.1	-	5	796	c.507G>C	c.(505-507)ctG>ctC	p.L169L	DRD3_ENST00000383673.2_Silent_p.L169L|DRD3_ENST00000295881.7_Silent_p.L169L|DRD3_ENST00000467632.1_Silent_p.L169L	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	169					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)	p.L169L(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TAAAGCCAAACAGAAGAGGGC	0.542																																							uc003ebd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(505-507)CTG>CTC		dopamine receptor D3 isoform a	Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)						149.0	131.0	137.0					3																	113866281		2203	4300	6503	SO:0001819	synonymous_variant	1814				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding	g.chr3:113866281C>G		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.507G>C	3.37:g.113866281C>G			Somatic				DRD3_uc010hqn.1_Silent_p.L169L|DRD3_uc003ebb.1_Silent_p.L169L|DRD3_uc003ebc.1_Silent_p.L169L	p.L169L	NM_000796	NP_000787	WXS	Illumina HiSeq	Unspecified	P35462	DRD3_HUMAN			5	930	-			169			Helical; Name=4.		A1A4V5|Q4VBM8	Silent	SNP	ENST00000460779.1	37	c.507G>C	CCDS2978.1																																																																																				0.542	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		50	63	0	0	0	0.01441	0	50	63				
TIMMDC1	51300	broad.mit.edu	37	3	119236107	119236107	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:119236107C>T	ENST00000494664.1	+	6	854	c.652C>T	c.(652-654)Cag>Tag	p.Q218*	TIMMDC1_ENST00000493694.1_Nonsense_Mutation_p.Q84*	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	218						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.Q218*(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						TGAGACTGTTCAGGAAAGAAA	0.478																																							uc003ecn.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(652-654)CAG>TAG		hypothetical protein LOC51300							134.0	137.0	136.0					3																	119236107		2203	4300	6503	SO:0001587	stop_gained	51300					integral to membrane|mitochondrial inner membrane	protein transporter activity	g.chr3:119236107C>T	AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.652C>T	3.37:g.119236107C>T	ENSP00000418803:p.Gln218*		Somatic				C3orf1_uc003eco.2_RNA|C3orf1_uc003ecp.2_RNA	p.Q218*	NM_016589	NP_057673	WXS	Illumina HiSeq	Unspecified	Q9NPL8	TIDC1_HUMAN		GBM - Glioblastoma multiforme(114;0.186)	6	865	+			218					D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Nonsense_Mutation	SNP	ENST00000494664.1	37	c.652C>T	CCDS33831.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671231	0.29693	.	.	ENSG00000113845	ENST00000494664;ENST00000493694;ENST00000466984	.	.	.	5.28	3.31	0.37934	.	0.225738	0.37577	N	0.002034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-12.324	5.7428	0.18104	0.0:0.6921:0.2011:0.1068	.	.	.	.	X	218;84;133	.	ENSP00000420122:Q133X	Q	+	1	0	TIMMDC1	120718797	0.997000	0.39634	0.687000	0.30102	0.148000	0.21650	1.008000	0.29872	1.429000	0.47314	0.563000	0.77884	CAG		0.478	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3	NM_016589		81	58	0	0	0	0.01441	0	81	58				
UROC1	131669	broad.mit.edu	37	3	126211293	126211293	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:126211293T>C	ENST00000290868.2	-	16	1629	c.1576A>G	c.(1576-1578)Att>Gtt	p.I526V	UROC1_ENST00000383579.3_Missense_Mutation_p.I586V	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	526					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)	p.I526V(1)|p.I586V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GCCTGGTTAATGGCCACAGCG	0.617																																							uc003eiz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1576-1578)ATT>GTT		urocanase domain containing 1 isoform 1							125.0	80.0	95.0					3																	126211293		2203	4300	6503	SO:0001583	missense	131669				histidine catabolic process	cytosol	urocanate hydratase activity	g.chr3:126211293T>C	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1576A>G	3.37:g.126211293T>C	ENSP00000290868:p.Ile526Val		Somatic				UROC1_uc010hsi.1_Missense_Mutation_p.I586V	p.I526V	NM_144639	NP_653240	WXS	Illumina HiSeq	Unspecified	Q96N76	HUTU_HUMAN		GBM - Glioblastoma multiforme(114;0.17)	16	1608	-			526					E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	c.1576A>G	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.476196	0.26511	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.42900	0.96;0.96	4.58	3.4	0.38934	Urocanase domain (2);	0.051221	0.85682	D	0.000000	T	0.37679	0.1012	L	0.48986	1.54	0.50632	D	0.999882	B;B	0.22003	0.063;0.016	B;B	0.30316	0.114;0.101	T	0.24261	-1.0165	10	0.87932	D	0	-17.4781	7.7749	0.29030	0.2332:0.0:0.0:0.7668	.	586;526	E9PE13;Q96N76	.;HUTU_HUMAN	V	526;586	ENSP00000290868:I526V;ENSP00000373073:I586V	ENSP00000290868:I526V	I	-	1	0	UROC1	127693983	1.000000	0.71417	0.977000	0.42913	0.133000	0.20885	5.619000	0.67729	0.583000	0.29574	0.377000	0.23210	ATT		0.617	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639		11	8	0	0	0	0.008291	0	11	8				
ZIC4	84107	broad.mit.edu	37	3	147114033	147114033	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:147114033G>T	ENST00000383075.3	-	3	806	c.294C>A	c.(292-294)taC>taA	p.Y98*	ZIC4_ENST00000425731.3_Nonsense_Mutation_p.Y136*|ZIC4_ENST00000473123.1_Nonsense_Mutation_p.Y98*|ZIC4_ENST00000484399.1_Nonsense_Mutation_p.Y98*|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000525172.2_Nonsense_Mutation_p.Y148*	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	98						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y98*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TCATGCCCCCGTAGCCATGCA	0.687																																							uc003ewd.1		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(292-294)TAC>TAA		zinc finger protein of the cerebellum 4							16.0	20.0	19.0					3																	147114033		2123	4258	6381	SO:0001587	stop_gained	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147114033G>T	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.294C>A	3.37:g.147114033G>T	ENSP00000372553:p.Tyr98*		Somatic				ZIC4_uc003ewc.1_Nonsense_Mutation_p.Y28*|ZIC4_uc011bno.1_Nonsense_Mutation_p.Y148*	p.Y98*	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	567	-			98					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Nonsense_Mutation	SNP	ENST00000383075.3	37	c.294C>A	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749157	0.69533	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	.	.	.	4.98	-0.495	0.12030	.	0.162858	0.29080	N	0.013205	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5102	0.39071	0.3921:0.0:0.6079:0.0	.	.	.	.	X	98;136;148;98;98;98	.	ENSP00000372553:Y98X	Y	-	3	2	ZIC4	148596723	1.000000	0.71417	0.931000	0.37212	0.939000	0.58152	1.439000	0.35013	-0.462000	0.06984	-0.258000	0.10820	TAC		0.687	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			20	17	1	0	3.51602e-12	0.008871	5.05055e-12	20	17				
PQLC2L	152078	broad.mit.edu	37	3	157271098	157271098	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:157271098A>T	ENST00000449199.2	+	2	193	c.52A>T	c.(52-54)Acg>Tcg	p.T18S	C3orf55_ENST00000459838.1_Missense_Mutation_p.T18S|C3orf55_ENST00000468043.1_Missense_Mutation_p.T18S|C3orf55_ENST00000426338.2_Missense_Mutation_p.T18S|C3orf55_ENST00000498159.1_Intron|C3orf55_ENST00000312275.5_Missense_Mutation_p.T18S|C3orf55_ENST00000461040.1_Missense_Mutation_p.T18S	NM_001130002.2	NP_001123474.1	A1A4F0	CC055_HUMAN		18								p.T18S(2)		breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			AAGCACTGATACGTCCGGAGA	0.403																																							uc003fbp.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(52-54)ACG>TCG		hypothetical protein LOC152078 isoform 1							98.0	104.0	102.0					3																	157271098		1963	4141	6104	SO:0001583	missense	152078							g.chr3:157271098A>T																												ENST00000449199.2:c.52A>T	3.37:g.157271098A>T	ENSP00000413228:p.Thr18Ser		Somatic				C3orf55_uc011bos.1_RNA|C3orf55_uc003fbo.2_Missense_Mutation_p.T18S|C3orf55_uc011bot.1_RNA|C3orf55_uc010hvv.2_Missense_Mutation_p.T18S	p.T18S	NM_001130002	NP_001123474	WXS	Illumina HiSeq	Unspecified	A1A4F0	CC055_HUMAN	Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)		2	220	+			18					C9JP04|C9JXB5|Q8N6Q6	Missense_Mutation	SNP	ENST00000449199.2	37	c.52A>T	CCDS46943.1	.	.	.	.	.	.	.	.	.	.	A	2.773	-0.255301	0.05829	.	.	ENSG00000174899	ENST00000312275;ENST00000468043;ENST00000459838;ENST00000461040;ENST00000449199;ENST00000426338	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	1.78	-3.55	0.04639	.	.	.	.	.	T	0.13927	0.0337	L	0.29908	0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38972	-0.9636	9	0.02654	T	1	.	4.3534	0.11167	0.3081:0.2187:0.4732:0.0	.	18;18;18	C9JXB5;A1A4F0;A1A4F0-2	.;CC055_HUMAN;.	S	18	ENSP00000312323:T18S;ENSP00000420049:T18S;ENSP00000420317:T18S;ENSP00000417372:T18S;ENSP00000413228:T18S;ENSP00000387918:T18S	ENSP00000312323:T18S	T	+	1	0	C3orf55	158753792	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.190000	0.03058	-1.239000	0.02532	-0.353000	0.07706	ACG		0.403	C3orf55-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352018.1			15	3	0	0	0	0.008871	0	15	3				
SLITRK3	22865	broad.mit.edu	37	3	164906575	164906575	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:164906575G>T	ENST00000475390.1	-	2	2487	c.2044C>A	c.(2044-2046)Cgt>Agt	p.R682S	SLITRK3_ENST00000241274.3_Missense_Mutation_p.R682S			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	682					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R682S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TTCTTTCGACGCCTTCGGAGC	0.542										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(2044-2046)CGT>AGT		slit and trk like 3 protein precursor							72.0	61.0	65.0					3																	164906575		2203	4300	6503	SO:0001583	missense	22865					integral to membrane		g.chr3:164906575G>T	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2044C>A	3.37:g.164906575G>T	ENSP00000420091:p.Arg682Ser	HNSCC(40;0.11)	Somatic				SLITRK3_uc003fek.2_Missense_Mutation_p.R682S	p.R682S	NM_014926	NP_055741	WXS	Illumina HiSeq	Unspecified	O94933	SLIK3_HUMAN			2	2488	-			682			Cytoplasmic (Potential).		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.2044C>A	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795610	0.50208	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.60424	0.19;0.19	5.0	4.11	0.48088	.	0.000000	0.37955	N	0.001878	T	0.59689	0.2212	M	0.79011	2.435	0.47737	D	0.999507	P	0.48998	0.918	B	0.41299	0.353	T	0.69431	-0.5147	10	0.87932	D	0	-13.5825	14.1562	0.65419	0.0:0.0:0.8488:0.1512	.	682	O94933	SLIK3_HUMAN	S	682	ENSP00000420091:R682S;ENSP00000241274:R682S	ENSP00000241274:R682S	R	-	1	0	SLITRK3	166389269	1.000000	0.71417	0.155000	0.22561	0.553000	0.35397	4.619000	0.61218	1.447000	0.47661	0.655000	0.94253	CGT		0.542	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		24	22	1	0	1.17739e-12	0.005443	1.72413e-12	24	22				
NLGN1	22871	broad.mit.edu	37	3	173322580	173322580	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:173322580G>T	ENST00000457714.1	+	3	621	c.192G>T	c.(190-192)ggG>ggT	p.G64G	NLGN1_ENST00000545397.1_Silent_p.G64G|NLGN1_ENST00000361589.4_Silent_p.G64G|NLGN1_ENST00000401917.3_Silent_p.G64G	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	64					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.G64G(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AGATAAGAGGGATTAAGAAGG	0.453																																							uc003fio.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7						c.(190-192)GGG>GGT		neuroligin 1							116.0	121.0	119.0					3																	173322580		2203	4300	6503	SO:0001819	synonymous_variant	22871				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity	g.chr3:173322580G>T	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.192G>T	3.37:g.173322580G>T			Somatic				NLGN1_uc010hww.1_Silent_p.G64G|NLGN1_uc003fip.1_Silent_p.G64G	p.G64G	NM_014932	NP_055747	WXS	Illumina HiSeq	Unspecified	Q8N2Q7	NLGN1_HUMAN	LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)		3	615	+	Ovarian(172;0.0025)		64			Extracellular (Potential).		Q9UPT2	Silent	SNP	ENST00000457714.1	37	c.192G>T	CCDS3222.1																																																																																				0.453	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932		91	68	1	0	5.66823e-36	0.01441	1.03031e-35	91	68				
NAALADL2	254827	broad.mit.edu	37	3	175520882	175520882	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:175520882A>T	ENST00000454872.1	+	14	2407	c.2279A>T	c.(2278-2280)gAg>gTg	p.E760V		NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	760						integral component of membrane (GO:0016021)		p.E760V(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GCATCAAATGAGACCCTTCAA	0.433																																							uc003fit.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2278-2280)GAG>GTG		N-acetylated alpha-linked acidic dipeptidase 2							89.0	82.0	84.0					3																	175520882		1835	4090	5925	SO:0001583	missense	254827				proteolysis	integral to membrane	peptidase activity	g.chr3:175520882A>T		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.2279A>T	3.37:g.175520882A>T	ENSP00000404705:p.Glu760Val		Somatic					p.E760V	NM_207015	NP_996898	WXS	Illumina HiSeq	Unspecified	Q58DX5	NADL2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)	14	2366	+	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	760			Extracellular (Potential).		Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	c.2279A>T	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.776218	0.49786	.	.	ENSG00000177694	ENST00000454872	T	0.33654	1.4	5.67	5.67	0.87782	Transferrin receptor-like, dimerisation domain (2);	0.212364	0.38605	N	0.001640	T	0.46288	0.1385	L	0.27053	0.805	0.33023	D	0.529077	D	0.71674	0.998	D	0.64687	0.928	T	0.58934	-0.7548	10	0.56958	D	0.05	-18.8098	15.9017	0.79384	1.0:0.0:0.0:0.0	.	760	Q58DX5	NADL2_HUMAN	V	760	ENSP00000404705:E760V	ENSP00000404705:E760V	E	+	2	0	NAALADL2	177003576	1.000000	0.71417	0.982000	0.44146	0.108000	0.19459	6.310000	0.72830	2.137000	0.66172	0.467000	0.42956	GAG		0.433	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015		26	24	0	0	0	0.003954	0	26	24				
RTP2	344892	broad.mit.edu	37	3	187416656	187416656	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:187416656C>A	ENST00000358241.1	-	2	736	c.308G>T	c.(307-309)cGg>cTg	p.R103L		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	103					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.R103L(1)		large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		CTCGTCCAGCCGCGCCGTGCC	0.652																																							uc003fro.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)CGG>CTG		receptor transporting protein 2							24.0	22.0	23.0					3																	187416656		2200	4276	6476	SO:0001583	missense	344892				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding	g.chr3:187416656C>A	AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.308G>T	3.37:g.187416656C>A	ENSP00000350976:p.Arg103Leu		Somatic					p.R103L	NM_001004312	NP_001004312	WXS	Illumina HiSeq	Unspecified	Q5QGT7	RTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)	2	737	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		103			Cytoplasmic (Potential).		Q6NVH4	Missense_Mutation	SNP	ENST00000358241.1	37	c.308G>T	CCDS33911.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.703211	0.30232	.	.	ENSG00000198471	ENST00000358241	T	0.22743	1.94	4.17	4.17	0.49024	.	0.284824	0.36101	N	0.002782	T	0.17066	0.0410	L	0.37630	1.12	0.35638	D	0.810727	B	0.24651	0.108	B	0.25614	0.062	T	0.11542	-1.0583	10	0.30854	T	0.27	-42.7074	12.2956	0.54844	0.0:1.0:0.0:0.0	.	103	Q5QGT7	RTP2_HUMAN	L	103	ENSP00000350976:R103L	ENSP00000350976:R103L	R	-	2	0	RTP2	188899350	0.875000	0.30112	1.000000	0.80357	0.338000	0.28826	1.280000	0.33202	2.621000	0.88768	0.563000	0.77884	CGG		0.652	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312		14	7	1	0	3.27435e-08	0.00245	4.26925e-08	14	7				
LSG1	55341	broad.mit.edu	37	3	194366963	194366963	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:194366963C>A	ENST00000265245.5	-	12	1867	c.1553G>T	c.(1552-1554)gGa>gTa	p.G518V	AC046143.3_ENST00000447139.1_RNA	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	518					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G518V(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		TGTCATGAATCCTCGCATGTC	0.453																																							uc003fui.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1552-1554)GGA>GTA		large subunit GTPase 1							158.0	139.0	145.0					3																	194366963		2203	4300	6503	SO:0001583	missense	55341				nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity	g.chr3:194366963C>A		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.1553G>T	3.37:g.194366963C>A	ENSP00000265245:p.Gly518Val		Somatic					p.G518V	NM_018385	NP_060855	WXS	Illumina HiSeq	Unspecified	Q9H089	LSG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)	12	1868	-	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		518					A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	37	c.1553G>T	CCDS33922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.029855|4.029855	0.75504|0.75504	.|.	.|.	ENSG00000041802|ENSG00000041802	ENST00000437613|ENST00000265245	.|T	.|0.33865	.|1.39	5.58|5.58	5.58|5.58	0.84498|0.84498	.|GTP-binding protein, orthogonal bundle domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70237|0.70237	0.3201|0.3201	M|M	0.91872|0.91872	3.25|3.25	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.77120|0.77120	-0.2705|-0.2705	5|10	.|0.87932	.|D	.|0	.|.	19.5831|19.5831	0.95478|0.95478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|518	.|Q9H089	.|LSG1_HUMAN	Y|V	235|518	.|ENSP00000265245:G518V	.|ENSP00000265245:G518V	D|G	-|-	1|2	0|0	LSG1|LSG1	195848252|195848252	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.392000|0.392000	0.30506|0.30506	7.783000|7.783000	0.85696|0.85696	2.641000|2.641000	0.89580|0.89580	0.563000|0.563000	0.77884|0.77884	GAT|GGA		0.453	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385		18	126	1	0	1.67942e-08	0.006122	2.21526e-08	18	126				
LINC00969	440993	broad.mit.edu	37	3	195400795	195400795	+	lincRNA	SNP	C	C	T	rs7615357	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:195400795C>T	ENST00000445430.1	+	0	1391									long intergenic non-protein coding RNA 969																		GGGGCAAACTCGCTGTTGGAC	0.592																																							uc003fuw.2		NA																	0					0						c.(91-93)CGC>TGC		SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						727956							g.chr3:195400795C>T	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400795C>T			Somatic				SDHAP2_uc011btb.1_Missense_Mutation_p.S178L|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA	p.R31C			WXS	Illumina HiSeq	Unspecified					9	1285	+									Missense_Mutation	SNP	ENST00000445430.1	37	c.91C>T																																																																																					0.592	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1			4	9	0	0	0	0.000602	0	4	9				
LINC00969	440993	broad.mit.edu	37	3	195400822	195400822	+	lincRNA	SNP	G	G	A	rs56170658		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr3:195400822G>A	ENST00000445430.1	+	0	1418									long intergenic non-protein coding RNA 969																		GTCTGGTCAGGCATGTGCCCT	0.572																																							uc003fuw.2		NA																	0					0						c.(118-120)GCA>ACA		SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						727956							g.chr3:195400822G>A	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400822G>A			Somatic				SDHAP2_uc011btb.1_Missense_Mutation_p.G187D|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA	p.A40T			WXS	Illumina HiSeq	Unspecified					9	1312	+									Missense_Mutation	SNP	ENST00000445430.1	37	c.118G>A																																																																																					0.572	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1			3	9	0	0	0	0.000602	0	3	9				
FAM193A	8603	broad.mit.edu	37	4	2698298	2698298	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:2698298G>A	ENST00000324666.5	+	16	2963	c.2612G>A	c.(2611-2613)cGa>cAa	p.R871Q	FAM193A_ENST00000505311.1_Missense_Mutation_p.R871Q|FAM193A_ENST00000382839.3_Missense_Mutation_p.R871Q|FAM193A_ENST00000545951.1_Missense_Mutation_p.R871Q|FAM193A_ENST00000502458.1_Missense_Mutation_p.R893Q	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	871								p.R871Q(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GCAGCGAAGCGAGCAAGGCAT	0.552																																							uc010icl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2611-2613)CGA>CAA		hypothetical protein LOC8603							60.0	57.0	58.0					4																	2698298		2203	4300	6503	SO:0001583	missense	8603							g.chr4:2698298G>A	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2612G>A	4.37:g.2698298G>A	ENSP00000324587:p.Arg871Gln		Somatic				FAM193A_uc010ick.2_Missense_Mutation_p.R1071Q|FAM193A_uc003gfd.2_Missense_Mutation_p.R871Q|FAM193A_uc011bvm.1_Missense_Mutation_p.R893Q|FAM193A_uc011bvn.1_Missense_Mutation_p.R871Q|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.R725Q	p.R871Q	NM_003704	NP_003695	WXS	Illumina HiSeq	Unspecified	P78312	F193A_HUMAN			16	2963	+			871					B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	c.2612G>A	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427483	0.83667	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.49432	0.81;1.21;0.79;0.81;0.78	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.996;0.997	T	0.72007	-0.4420	10	0.66056	D	0.02	-16.0167	17.8501	0.88744	0.0:0.0:1.0:0.0	.	871;893;871;893;871	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	Q	871;871;871;893;725	ENSP00000372290:R871Q;ENSP00000324587:R871Q;ENSP00000443617:R871Q;ENSP00000427505:R893Q;ENSP00000427260:R725Q	ENSP00000324587:R871Q	R	+	2	0	FAM193A	2668096	1.000000	0.71417	0.937000	0.37676	0.263000	0.26337	9.644000	0.98468	2.464000	0.83262	0.603000	0.83216	CGA		0.552	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		4	30	0	0	0	0.009096	0	4	30				
STK32B	55351	broad.mit.edu	37	4	5170126	5170126	+	Missense_Mutation	SNP	G	G	T	rs200882867		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:5170126G>T	ENST00000282908.5	+	3	631	c.209G>T	c.(208-210)cGg>cTg	p.R70L	STK32B_ENST00000512636.1_Missense_Mutation_p.R23L|STK32B_ENST00000510398.1_Missense_Mutation_p.R23L	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.R70L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						AATGTTTTCCGGGAGCTGCAG	0.537																																							uc003gih.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(208-210)CGG>CTG		serine/threonine kinase 32B							99.0	89.0	92.0					4																	5170126		2203	4300	6503	SO:0001583	missense	55351						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr4:5170126G>T	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.209G>T	4.37:g.5170126G>T	ENSP00000282908:p.Arg70Leu		Somatic				STK32B_uc010ida.1_Missense_Mutation_p.R23L	p.R70L	NM_018401	NP_060871	WXS	Illumina HiSeq	Unspecified	Q9NY57	ST32B_HUMAN			3	273	+			70			Protein kinase.			Missense_Mutation	SNP	ENST00000282908.5	37	c.209G>T	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809959	0.50421	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.27720	1.65;1.65;1.65	5.03	5.03	0.67393	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38897	U	0.001526	T	0.51770	0.1694	L	0.59912	1.85	0.53005	D	0.999966	D	0.71674	0.998	D	0.67725	0.953	T	0.53648	-0.8409	10	0.62326	D	0.03	.	17.3654	0.87362	0.0:0.0:1.0:0.0	.	70	Q9NY57	ST32B_HUMAN	L	70;23;23	ENSP00000282908:R70L;ENSP00000423209:R23L;ENSP00000420984:R23L	ENSP00000282908:R70L	R	+	2	0	STK32B	5221027	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	3.550000	0.53691	2.331000	0.79229	0.655000	0.94253	CGG		0.537	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401		10	31	1	0	1.08611e-07	0.010729	1.39466e-07	10	31				
EVC	2121	broad.mit.edu	37	4	5750028	5750028	+	Missense_Mutation	SNP	G	G	T	rs370388849		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:5750028G>T	ENST00000264956.6	+	8	1277	c.1093G>T	c.(1093-1095)Gct>Tct	p.A365S	EVC_ENST00000382674.2_Missense_Mutation_p.A365S|EVC_ENST00000509451.1_Missense_Mutation_p.A365S	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	365					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A365S(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GGAGCTGCAGGCTCTGGTAAT	0.478																																							uc003gil.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1093-1095)GCT>TCT		Ellis van Creveld syndrome protein							50.0	51.0	51.0					4																	5750028		2203	4300	6503	SO:0001583	missense	2121				muscle organ development	integral to membrane		g.chr4:5750028G>T	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1093G>T	4.37:g.5750028G>T	ENSP00000264956:p.Ala365Ser		Somatic				EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Missense_Mutation_p.P459T	p.A365S	NM_153717	NP_714928	WXS	Illumina HiSeq	Unspecified	P57679	EVC_HUMAN			8	1277	+		Myeloproliferative disorder(84;0.117)	365						Missense_Mutation	SNP	ENST00000264956.6	37	c.1093G>T	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	G	5.686	0.311204	0.10789	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.53857	0.6;0.6;0.61	5.09	0.736	0.18307	.	0.567419	0.18548	N	0.137992	T	0.40815	0.1132	L	0.55481	1.735	0.80722	D	1	B	0.19331	0.035	B	0.19391	0.025	T	0.11591	-1.0581	10	0.23891	T	0.37	.	5.902	0.18972	0.2706:0.0:0.5884:0.1409	.	365	P57679	EVC_HUMAN	S	365	ENSP00000264956:A365S;ENSP00000372120:A365S;ENSP00000426774:A365S	ENSP00000264956:A365S	A	+	1	0	EVC	5800929	0.955000	0.32602	0.674000	0.29902	0.153000	0.21895	0.319000	0.19522	0.162000	0.19483	-0.192000	0.12808	GCT		0.478	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1			12	32	1	0	0.000151284	0.001855	0.000171237	12	32				
ZNF518B	85460	broad.mit.edu	37	4	10445318	10445318	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:10445318G>C	ENST00000326756.3	-	3	3073	c.2635C>G	c.(2635-2637)Ctg>Gtg	p.L879V		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	879					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L879V(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CTGGAAAGCAGTCTCCCTTGC	0.393																																							uc003gmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(2635-2637)CTG>GTG		zinc finger protein 518B							69.0	72.0	71.0					4																	10445318		2203	4300	6503	SO:0001583	missense	85460				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:10445318G>C	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2635C>G	4.37:g.10445318G>C	ENSP00000317614:p.Leu879Val		Somatic					p.L879V	NM_053042	NP_444270	WXS	Illumina HiSeq	Unspecified	Q9C0D4	Z518B_HUMAN			3	3122	-			879					Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	c.2635C>G	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	G	4.299	0.054731	0.08291	.	.	ENSG00000178163	ENST00000326756	T	0.01560	4.77	6.02	3.98	0.46160	.	0.981245	0.08303	N	0.966634	T	0.02267	0.0070	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.45101	-0.9284	10	0.34782	T	0.22	-0.8404	12.1229	0.53902	0.0747:0.1254:0.7999:0.0	.	879	Q9C0D4	Z518B_HUMAN	V	879	ENSP00000317614:L879V	ENSP00000317614:L879V	L	-	1	2	ZNF518B	10054416	0.027000	0.19231	0.005000	0.12908	0.062000	0.15995	1.371000	0.34250	1.532000	0.49169	0.655000	0.94253	CTG		0.393	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		10	85	0	0	0	0.006214	0	10	85				
CLNK	116449	broad.mit.edu	37	4	10566338	10566338	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:10566338G>C	ENST00000226951.6	-	7	595	c.356C>G	c.(355-357)tCc>tGc	p.S119C	CLNK_ENST00000507719.1_Missense_Mutation_p.S77C|CLNK_ENST00000442825.2_Missense_Mutation_p.S77C	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	119					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)	p.S119C(2)		NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						CTGTCCAATGGAGATAGAGGT	0.453																																					GBM(87;402 1286 6949 13902 35851)	GBM(87;402 1286 6949 13902 35851)	uc003gmo.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(355-357)TCC>TGC		mast cell immunoreceptor signal transducer							200.0	190.0	194.0					4																	10566338		1989	4151	6140	SO:0001583	missense	116449				immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity	g.chr4:10566338G>C	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.356C>G	4.37:g.10566338G>C	ENSP00000226951:p.Ser119Cys		Somatic				CLNK_uc003gmp.2_Missense_Mutation_p.S77C	p.S119C	NM_052964	NP_443196	WXS	Illumina HiSeq	Unspecified	Q7Z7G1	CLNK_HUMAN			7	493	-			119					Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	c.356C>G	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974106	0.34848	.	.	ENSG00000109684	ENST00000226951;ENST00000429087;ENST00000442825;ENST00000507719	T;T;T	0.53423	1.68;0.62;0.62	5.39	4.55	0.56014	.	1.920360	0.02476	N	0.088004	T	0.47469	0.1447	N	0.24115	0.695	0.09310	N	1	P;P	0.44816	0.844;0.833	P;B	0.46479	0.518;0.293	T	0.47195	-0.9136	10	0.87932	D	0	0.0049	10.7377	0.46135	0.0888:0.0:0.9112:0.0	.	77;119	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	C	119;119;77;77	ENSP00000226951:S119C;ENSP00000390744:S77C;ENSP00000427208:S77C	ENSP00000226951:S119C	S	-	2	0	CLNK	10175436	0.070000	0.21116	0.002000	0.10522	0.009000	0.06853	2.764000	0.47613	1.425000	0.47237	0.644000	0.83932	TCC		0.453	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964		6	21	0	0	0	0.001168	0	6	21				
ARAP2	116984	broad.mit.edu	37	4	36149351	36149351	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:36149351A>T	ENST00000303965.4	-	18	3507	c.3018T>A	c.(3016-3018)ttT>ttA	p.F1006L		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1006			F -> L (in dbSNP:rs35218548).		regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.F1006L(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						AGTTTTCAGCAAATAAGGGAA	0.373																																							uc003gsq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(3016-3018)TTT>TTA		ArfGAP with RhoGAP domain, ankyrin repeat and PH							53.0	51.0	51.0					4																	36149351		2203	4299	6502	SO:0001583	missense	116984				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding	g.chr4:36149351A>T	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3018T>A	4.37:g.36149351A>T	ENSP00000302895:p.Phe1006Leu		Somatic					p.F1006L	NM_015230	NP_056045	WXS	Illumina HiSeq	Unspecified	Q8WZ64	ARAP2_HUMAN			18	3356	-			1006					Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	c.3018T>A	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	A	8.865	0.947782	0.18356	.	.	ENSG00000047365	ENST00000303965	D	0.93076	-3.16	5.56	1.54	0.23209	.	0.351400	0.30311	N	0.009911	T	0.74635	0.3742	N	0.02539	-0.55	0.26599	N	0.973058	B	0.09022	0.002	B	0.04013	0.001	T	0.62120	-0.6921	10	0.11485	T	0.65	.	0.3746	0.00385	0.3856:0.2134:0.1494:0.2516	.	1006	Q8WZ64	ARAP2_HUMAN	L	1006	ENSP00000302895:F1006L	ENSP00000302895:F1006L	F	-	3	2	ARAP2	35825746	0.987000	0.35691	1.000000	0.80357	0.999000	0.98932	0.195000	0.17155	0.916000	0.36871	0.528000	0.53228	TTT		0.373	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230		13	20	0	0	0	0.001855	0	13	20				
N4BP2	55728	broad.mit.edu	37	4	40115128	40115128	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:40115128G>T	ENST00000261435.6	+	7	2080	c.1664G>T	c.(1663-1665)aGg>aTg	p.R555M		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	555					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.R555M(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						GAACTTGCAAGGTAAAACTTG	0.363																																							uc003guy.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(1663-1665)AGG>ATG		Nedd4 binding protein 2							119.0	124.0	123.0					4																	40115128		2203	4297	6500	SO:0001630	splice_region_variant	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40115128G>T	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1664+1G>T	4.37:g.40115128G>T			Somatic				N4BP2_uc010ifq.2_Missense_Mutation_p.R475M|N4BP2_uc010ifr.2_Missense_Mutation_p.R475M	p.R555M	NM_018177	NP_060647	WXS	Illumina HiSeq	Unspecified	Q86UW6	N4BP2_HUMAN			7	2002	+			555					A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	c.1664G>T	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.346815|4.346815	0.82022|0.82022	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.44083	.|0.93	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.134454	.|0.64402	.|D	.|0.000003	T|T	0.56891|0.56891	0.2016|0.2016	L|L	0.31371|0.31371	0.925|0.925	0.54753|0.54753	D|D	0.999981|0.999981	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.998;0.999	T|T	0.57837|0.57837	-0.7742|-0.7742	5|10	.|0.87932	.|D	.|0	-20.2777|-20.2777	20.4324|20.4324	0.99085|0.99085	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|555;555	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	N|M	201|555;475	.|ENSP00000261435:R555M	.|ENSP00000261435:R555M	K|R	+|+	3|2	2|0	N4BP2|N4BP2	39791523|39791523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.701000|4.701000	0.61810|0.61810	2.833000|2.833000	0.97629|0.97629	0.585000|0.585000	0.79938|0.79938	AAG|AGG		0.363	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	Missense_Mutation	63	134	1	0	2.92391e-54	0.01441	5.43126e-54	63	134				
GABRG1	2565	broad.mit.edu	37	4	46099303	46099303	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:46099303G>T	ENST00000295452.4	-	2	335	c.168C>A	c.(166-168)gcC>gcA	p.A56A		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	56					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A56A(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAATTTTTGGGGCCAAGACCC	0.368																																							uc003gxb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(166-168)GCC>GCA		gamma-aminobutyric acid A receptor, gamma 1							181.0	184.0	183.0					4																	46099303		2203	4300	6503	SO:0001819	synonymous_variant	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46099303G>T	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.168C>A	4.37:g.46099303G>T			Somatic					p.A56A	NM_173536	NP_775807	WXS	Illumina HiSeq	Unspecified	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	2	320	-			56			Extracellular (Probable).		Q5H9T8	Silent	SNP	ENST00000295452.4	37	c.168C>A	CCDS3470.1																																																																																				0.368	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		60	155	1	0	7.55815e-43	0.01441	1.3963e-42	60	155				
PDGFRA	5156	broad.mit.edu	37	4	55131107	55131107	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:55131107A>T	ENST00000257290.5	+	5	981	c.650A>T	c.(649-651)gAa>gTa	p.E217V	FIP1L1_ENST00000507166.1_Intron|PDGFRA_ENST00000508170.1_3'UTR	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	217	Ig-like C2-type 3.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.E217V(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	CTGGATCTAGAAATGGAAGCT	0.383			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		1	Substitution - Missense(1)		lung(1)	soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(649-651)GAA>GTA		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)						144.0	143.0	143.0					4																	55131107		2203	4300	6503	SO:0001583	missense	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55131107A>T	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.650A>T	4.37:g.55131107A>T	ENSP00000257290:p.Glu217Val	TSP Lung(21;0.16)	Somatic				PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Missense_Mutation_p.E111V|PDGFRA_uc003ham.2_RNA	p.E217V	NM_006206	NP_006197	WXS	Illumina HiSeq	Unspecified	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		5	981	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		217			Ig-like C2-type 3.|Extracellular (Potential).		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	c.650A>T	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.678633	0.88542	.	.	ENSG00000134853	ENST00000257290	T	0.75477	-0.94	5.26	5.26	0.73747	Immunoglobulin-like (1);	0.000000	0.32314	U	0.006279	D	0.84593	0.5506	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.962;1.0	T	0.82754	-0.0301	10	0.23302	T	0.38	.	15.175	0.72903	1.0:0.0:0.0:0.0	.	217;217	P16234-3;P16234	.;PGFRA_HUMAN	V	217	ENSP00000257290:E217V	ENSP00000257290:E217V	E	+	2	0	PDGFRA	54825864	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.171000	0.77595	1.999000	0.58509	0.402000	0.26972	GAA		0.383	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		5	67	0	0	0	0.000602	0	5	67				
UGT2B28	54490	broad.mit.edu	37	4	70146539	70146540	+	Missense_Mutation	DNP	AT	AT	TC			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	AT	AT	-	-	AT	AT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:70146539_70146540AT>TC	ENST00000335568.5	+	1	323_324	c.321_322AT>TC	c.(319-324)ttATat>ttTCat	p.107_108LY>FH	UGT2B28_ENST00000511240.1_Missense_Mutation_p.107_108LY>FH	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	107					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.L107_Y108>FH(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GCTTTTGGTTATATTTTTCACA	0.292																																							uc003hej.2		NA																	1	Complex - compound substitution(1)		lung(1)	skin(1)	1						c.(319-324)TTATAT>TTTCAT		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)																																			SO:0001583	missense	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70146539_70146540AT>TC	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	Exception_encountered	4.37:g.70146539_70146540delinsTC	ENSP00000334276:p.L107_Y108delinsFH		Somatic				UGT2B28_uc010ihr.2_Missense_Mutation_p.107_108LY>FH	p.107_108LY>FH	NM_053039	NP_444267	WXS	Illumina HiSeq	Unspecified	Q9BY64	UDB28_HUMAN			1	323_324	+			107_108					B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	DNP	ENST00000335568.5	37	c.321_322AT>TC	CCDS3528.1																																																																																				0.292	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039		37	123	0	0	0	0.004672	0	37	123				
UGT2B4	7363	broad.mit.edu	37	4	70352326	70352326	+	Splice_Site	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:70352326C>G	ENST00000305107.6	-	4	1137		c.e4+1		UGT2B4_ENST00000381096.3_Splice_Site|UGT2B4_ENST00000512583.1_Splice_Site|UGT2B4_ENST00000506580.1_Splice_Site	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4						cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.?(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	CAGAGACTTACCAAGAAGATC	0.338																																							uc003hek.3		NA																	1	Unknown(1)		lung(1)	skin(2)	2						c.e4+1		UDP glucuronosyltransferase 2B4 precursor							105.0	109.0	107.0					4																	70352326		2201	4300	6501	SO:0001630	splice_region_variant	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70352326C>G	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1090+1G>C	4.37:g.70352326C>G			Somatic				UGT2B4_uc011cap.1_Splice_Site_p.G228_splice|UGT2B4_uc003hel.3_Splice_Site_p.D364_splice	p.G364_splice	NM_021139	NP_066962	WXS	Illumina HiSeq	Unspecified	P06133	UD2B4_HUMAN			4	1137	-								A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Splice_Site	SNP	ENST00000305107.6	37	c.1090_splice	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537519	0.27475	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000381096	.	.	.	1.97	1.97	0.26223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9494	0.41630	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UGT2B4	70386915	1.000000	0.71417	0.977000	0.42913	0.011000	0.07611	4.863000	0.62983	1.429000	0.47314	0.313000	0.20887	.		0.338	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	Intron	13	96	0	0	0	0.013537	0	13	96				
PLAC8	51316	broad.mit.edu	37	4	84028990	84028990	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:84028990C>T	ENST00000426923.2	-	2	163	c.85G>A	c.(85-87)Ggc>Agc	p.G29S	PLAC8_ENST00000509973.1_Intron|PLAC8_ENST00000515389.1_Intron|PLAC8_ENST00000411416.2_Missense_Mutation_p.G29S|PLAC8_ENST00000505406.1_Missense_Mutation_p.G29S|PLAC8_ENST00000311507.4_Missense_Mutation_p.G29S	NM_001130715.1	NP_001124187.1	Q9UHV8	PP13_HUMAN	placenta-specific 8	17	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)	p.G29S(1)		large_intestine(2)|lung(3)|ovary(1)	6		Hepatocellular(203;0.114)				TCACACATGCCTGTCTGCCAG	0.562																																							uc003hoe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(85-87)GGC>AGC		placenta-specific 8							49.0	47.0	47.0					4																	84028990		2203	4300	6503	SO:0001583	missense	51316							g.chr4:84028990C>T	AF208846	CCDS3601.1	4q21.22	2006-05-20			ENSG00000145287	ENSG00000145287			19254	protein-coding gene	gene with protein product		607515				12758124, 12384430	Standard	NM_016619		Approved	onzin, C15	uc003hoe.3	Q9NZF1	OTTHUMG00000130294	ENST00000426923.2:c.85G>A	4.37:g.84028990C>T	ENSP00000399700:p.Gly29Ser		Somatic				PLAC8_uc011cco.1_Missense_Mutation_p.G29S|PLAC8_uc010ijy.2_Intron|PLAC8_uc010ijz.2_Intron|PLAC8_uc003hod.2_Missense_Mutation_p.G29S	p.G29S	NM_001130716	NP_001124188	WXS	Illumina HiSeq	Unspecified	Q9NZF1	PLAC8_HUMAN			2	246	-		Hepatocellular(203;0.114)	29					C5HZ15	Missense_Mutation	SNP	ENST00000426923.2	37	c.85G>A	CCDS3601.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458492	0.26248	.	.	ENSG00000145287	ENST00000311507;ENST00000411416;ENST00000505406;ENST00000426923	.	.	.	5.47	-0.03	0.13916	.	0.230731	0.44097	N	0.000484	T	0.42426	0.1202	M	0.63208	1.945	0.09310	N	1	B	0.31413	0.322	B	0.32980	0.156	T	0.28870	-1.0030	9	0.38643	T	0.18	-26.5622	10.8774	0.46919	0.0:0.5896:0.0:0.4104	.	29	Q9NZF1	PLAC8_HUMAN	S	29	.	ENSP00000309509:G29S	G	-	1	0	PLAC8	84248014	0.133000	0.22466	0.000000	0.03702	0.444000	0.32077	2.200000	0.42724	-0.705000	0.05035	-1.937000	0.00501	GGC		0.562	PLAC8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363079.1	NM_016619		10	38	0	0	0	0.008291	0	10	38				
IBSP	3381	broad.mit.edu	37	4	88731895	88731895	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:88731895T>A	ENST00000226284.5	+	6	451	c.384T>A	c.(382-384)gcT>gcA	p.A128A		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	128	Asp/Glu-rich (acidic).				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.A128A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		CAGGGTTAGCTGCAATCCAGC	0.398																																							uc003hqx.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(382-384)GCT>GCA		integrin-binding sialoprotein precursor							98.0	97.0	97.0					4																	88731895		2203	4300	6503	SO:0001819	synonymous_variant	3381				biomineral tissue development|cell adhesion|ossification			g.chr4:88731895T>A		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.384T>A	4.37:g.88731895T>A			Somatic					p.A128A	NM_004967	NP_004958	WXS	Illumina HiSeq	Unspecified	P21815	SIAL_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)	6	482	+		Hepatocellular(203;0.114)	128			Asp/Glu-rich (acidic).			Silent	SNP	ENST00000226284.5	37	c.384T>A	CCDS3624.1																																																																																				0.398	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2			21	68	0	0	0	0.008871	0	21	68				
TBCK	93627	broad.mit.edu	37	4	107156448	107156448	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:107156448C>A	ENST00000273980.5	-	16	1874	c.1427G>T	c.(1426-1428)tGg>tTg	p.W476L	TBCK_ENST00000394706.3_Missense_Mutation_p.W437L|TBCK_ENST00000432496.2_Missense_Mutation_p.W476L|TBCK_ENST00000361687.4_Missense_Mutation_p.W413L|TBCK_ENST00000394708.2_Missense_Mutation_p.W476L					TBC1 domain containing kinase									p.W476L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						AAGAGCAGCCCAGGTTAAACC	0.358																																							uc010ilv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						c.(1426-1428)TGG>TTG		TBC domain-containing protein kinase-like							78.0	69.0	72.0					4																	107156448		2203	4300	6503	SO:0001583	missense	93627					intracellular	Rab GTPase activator activity	g.chr4:107156448C>A		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1427G>T	4.37:g.107156448C>A	ENSP00000273980:p.Trp476Leu		Somatic				TBCK_uc003hyb.2_Missense_Mutation_p.W219L|TBCK_uc003hye.2_Missense_Mutation_p.W437L|TBCK_uc003hyc.2_Missense_Mutation_p.W413L|TBCK_uc003hyd.2_Missense_Mutation_p.W304L|TBCK_uc003hyf.2_Missense_Mutation_p.W476L	p.W476L	NM_001163435	NP_001156907	WXS	Illumina HiSeq	Unspecified	Q8TEA7	TBCK_HUMAN			15	1792	-			476			Rab-GAP TBC.			Missense_Mutation	SNP	ENST00000273980.5	37	c.1427G>T	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103778	0.94245	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708;ENST00000503516	T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5	5.9	5.9	0.94986	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	D	0.82342	0.5016	H	0.95043	3.615	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.86674	0.1912	10	0.87932	D	0	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	476;437;413	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	L	476;476;413;437;476;6	ENSP00000273980:W476L;ENSP00000405847:W476L;ENSP00000355338:W413L;ENSP00000378196:W437L;ENSP00000378198:W476L;ENSP00000423834:W6L	ENSP00000273980:W476L	W	-	2	0	TBCK	107375897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.294000	0.78760	2.788000	0.95919	0.650000	0.86243	TGG		0.358	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		11	28	1	0	0.00316338	0.003163	0.00342069	11	28				
PITX2	5308	broad.mit.edu	37	4	111539486	111539486	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:111539486C>T	ENST00000354925.2	-	7	2454	c.749G>A	c.(748-750)aGc>aAc	p.S250N	PITX2_ENST00000306732.3_Missense_Mutation_p.S257N|PITX2_ENST00000556049.1_5'Flank|PITX2_ENST00000394595.3_3'UTR|PITX2_ENST00000355080.5_Missense_Mutation_p.S204N|PITX2_ENST00000394598.2_Missense_Mutation_p.S250N|RP11-380D23.2_ENST00000503456.1_lincRNA	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	250					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.S257N(1)|p.S250N(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CAGCGACGGGCTACTCAGGTT	0.597																																							uc003iad.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(748-750)AGC>AAC		paired-like homeodomain transcription factor 2							49.0	53.0	52.0					4																	111539486		2203	4300	6503	SO:0001583	missense	5308				determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding	g.chr4:111539486C>T	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.749G>A	4.37:g.111539486C>T	ENSP00000347004:p.Ser250Asn		Somatic				PITX2_uc003iac.2_Missense_Mutation_p.S257N|PITX2_uc003iae.2_Missense_Mutation_p.S204N|PITX2_uc010iml.2_Missense_Mutation_p.S121N|PITX2_uc003iaf.2_Missense_Mutation_p.S250N	p.S250N	NM_153426	NP_700475	WXS	Illumina HiSeq	Unspecified	Q99697	PITX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00222)	5	1331	-		Hepatocellular(203;0.217)	250					A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	37	c.749G>A	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328331	0.24080	.	.	ENSG00000164093	ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925;ENST00000511837	D;D;D;D;D	0.93366	-2.83;-3.01;-3.15;-3.01;-3.21	5.68	5.68	0.88126	.	0.076758	0.85682	D	0.000000	D	0.87168	0.6110	L	0.35854	1.095	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.0;0.001;0.001;0.002	T	0.79415	-0.1813	10	0.17369	T	0.5	.	7.4367	0.27160	0.0:0.8014:0.0:0.1986	.	204;204;250;257	A8K6C6;Q99697-3;Q99697;Q99697-2	.;.;PITX2_HUMAN;.	N	257;250;204;250;250	ENSP00000304169:S257N;ENSP00000378097:S250N;ENSP00000347192:S204N;ENSP00000347004:S250N;ENSP00000421454:S250N	ENSP00000304169:S257N	S	-	2	0	PITX2	111758935	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.289000	0.51747	2.689000	0.91719	0.655000	0.94253	AGC		0.597	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2			19	30	0	0	0	0.006122	0	19	30				
FAT4	79633	broad.mit.edu	37	4	126336245	126336245	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:126336245G>T	ENST00000394329.3	+	5	6140	c.6127G>T	c.(6127-6129)Gat>Tat	p.D2043Y	FAT4_ENST00000335110.5_Missense_Mutation_p.D341Y	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2043	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D2043Y(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TATTTTGTTGGATGTAAATGA	0.403																																							uc003ifj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(6127-6129)GAT>TAT		FAT tumor suppressor homolog 4 precursor							167.0	167.0	167.0					4																	126336245		2203	4300	6503	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126336245G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6127G>T	4.37:g.126336245G>T	ENSP00000377862:p.Asp2043Tyr		Somatic				FAT4_uc011cgp.1_Missense_Mutation_p.D341Y	p.D2043Y	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			5	6127	+			2043			Cadherin 19.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.6127G>T	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090945	0.76756	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.67865	-0.29;-0.29	5.0	5.0	0.66597	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.35378	U	0.003259	D	0.89712	0.6794	H	0.98980	4.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94181	0.7432	10	0.87932	D	0	.	18.3262	0.90255	0.0:0.0:1.0:0.0	.	341;2043	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	Y	2043;341	ENSP00000377862:D2043Y;ENSP00000335169:D341Y	ENSP00000335169:D341Y	D	+	1	0	FAT4	126555695	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.604000	0.98317	2.308000	0.77769	0.557000	0.71058	GAT		0.403	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		41	139	1	0	2.26627e-22	0.007835	3.83176e-22	41	139				
ARHGAP10	79658	broad.mit.edu	37	4	148744109	148744109	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:148744109G>T	ENST00000336498.3	+	3	551		c.e3+1			NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10						establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.?(1)		autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		AGAAATTATGGTGAGTTGAGA	0.383																																							uc003ilf.2		NA																	1	Unknown(1)		lung(1)	skin(2)|pancreas(1)|lung(1)	4						c.e3+1		Rho GTPase activating protein 10							64.0	64.0	64.0					4																	148744109		2203	4300	6503	SO:0001630	splice_region_variant	79658				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding	g.chr4:148744109G>T	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.312+1G>T	4.37:g.148744109G>T			Somatic				ARHGAP10_uc003ile.1_Splice_Site_p.M104_splice	p.M104_splice	NM_024605	NP_078881	WXS	Illumina HiSeq	Unspecified	A1A4S6	RHG10_HUMAN		GBM - Glioblastoma multiforme(119;0.0423)	3	312	+	all_hematologic(180;0.151)	Renal(17;0.0166)						Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Splice_Site	SNP	ENST00000336498.3	37	c.312_splice	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489608	0.84962	.	.	ENSG00000071205	ENST00000336498	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5178	0.95171	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP10	148963559	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.453000	0.73488	2.681000	0.91329	0.555000	0.69702	.		0.383	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	Intron	15	36	1	0	1.37285e-15	0.004007	2.16968e-15	15	36				
ASIC5	51802	broad.mit.edu	37	4	156787352	156787352	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:156787352T>C	ENST00000537611.2	-	1	73	c.27A>G	c.(25-27)gtA>gtG	p.V9V		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	9					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.V9V(1)									TCTCAGCATATACTTTTGATT	0.353																																							uc003ipe.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(25-27)GTA>GTG		amiloride-sensitive cation channel 5,							162.0	147.0	152.0					4																	156787352		2203	4299	6502	SO:0001819	synonymous_variant	51802					integral to membrane|plasma membrane		g.chr4:156787352T>C	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.27A>G	4.37:g.156787352T>C			Somatic					p.V9V	NM_017419	NP_059115	WXS	Illumina HiSeq	Unspecified	Q9NY37	ACCN5_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)	1	74	-	all_hematologic(180;0.24)	Renal(120;0.0458)	9			Cytoplasmic (Potential).			Silent	SNP	ENST00000537611.2	37	c.27A>G	CCDS3793.1																																																																																				0.353	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1			35	90	0	0	0	0.004289	0	35	90				
GRIA2	2891	broad.mit.edu	37	4	158262431	158262431	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:158262431C>A	ENST00000264426.9	+	12	2139	c.1860C>A	c.(1858-1860)cgC>cgA	p.R620R	GRIA2_ENST00000296526.7_Silent_p.R620R|GRIA2_ENST00000393815.2_Silent_p.R573R|GRIA2_ENST00000507898.1_Silent_p.R573R|GRIA2_ENST00000449365.1_Silent_p.R573R	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	620					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.R620R(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TCTCTGGGCGCATTGTTGGAG	0.408																																							uc003ipm.3		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(3)|ovary(1)	4						c.(1858-1860)CGC>CGA		glutamate receptor, ionotropic, AMPA 2 isoform 2	L-Glutamic Acid(DB00142)						164.0	160.0	161.0					4																	158262431		2203	4299	6502	SO:0001819	synonymous_variant	2891				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr4:158262431C>A		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1860C>A	4.37:g.158262431C>A			Somatic				GRIA2_uc011cit.1_Silent_p.R573R|GRIA2_uc003ipl.3_Silent_p.R620R|GRIA2_uc003ipk.3_Silent_p.R573R|GRIA2_uc010iqh.1_RNA	p.R620R	NM_001083619	NP_001077088	WXS	Illumina HiSeq	Unspecified	P42262	GRIA2_HUMAN		COAD - Colon adenocarcinoma(41;0.0294)	12	2319	+	all_hematologic(180;0.24)	Renal(120;0.0458)	620			Cytoplasmic (Potential).		A8MT92|I6L997|Q96FP6	Silent	SNP	ENST00000264426.9	37	c.1860C>A	CCDS43274.1																																																																																				0.408	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			25	142	1	0	6.32553e-13	0.004656	9.34359e-13	25	142				
KLHL2	11275	broad.mit.edu	37	4	166200358	166200358	+	Intron	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:166200358G>T	ENST00000226725.6	+	6	803				KLHL2_ENST00000509028.1_Intron|KLHL2_ENST00000506761.1_Intron|KLHL2_ENST00000514860.1_Intron|KLHL2_ENST00000538127.1_Intron|KLHL2_ENST00000421009.2_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		ACTGAAGTAAGTGCTAAGTGG	0.413																																							uc003ird.3		NA																	0					0						c.(439-441)ACT>AAT		glycerol kinase isoform b																																				SO:0001627	intron_variant	2713							g.chr4:166200358G>T	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.545-15153G>T	4.37:g.166200358G>T			Somatic				KLHL2_uc003irb.2_Intron|KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	p.T147N	NM_000167	NP_000158	WXS	Illumina HiSeq	Unspecified					1	818	-								A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	ENST00000226725.6	37	c.440C>A	CCDS34094.1																																																																																				0.413	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1			23	94	1	0	3.08376e-08	0.00333	4.0285e-08	23	94				
NEK1	4750	broad.mit.edu	37	4	170345816	170345816	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:170345816G>A	ENST00000439128.2	-	29	3666	c.3026C>T	c.(3025-3027)cCa>cTa	p.P1009L	NEK1_ENST00000510533.1_Missense_Mutation_p.P965L|NEK1_ENST00000511633.1_Missense_Mutation_p.P993L|NEK1_ENST00000507142.1_Missense_Mutation_p.P1037L|NEK1_ENST00000512193.1_Missense_Mutation_p.P940L	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1009					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.P1037L(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GGATTCTTCTGGTGAACACTG	0.393																																							uc003isb.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|large_intestine(1)	6						c.(3025-3027)CCA>CTA		NIMA-related kinase 1							110.0	105.0	106.0					4																	170345816		1875	4099	5974	SO:0001583	missense	4750				cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:170345816G>A	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.3026C>T	4.37:g.170345816G>A	ENSP00000408020:p.Pro1009Leu		Somatic				NEK1_uc003isc.1_Missense_Mutation_p.P965L|NEK1_uc003isd.1_Missense_Mutation_p.P1037L|NEK1_uc003ise.1_Missense_Mutation_p.P993L|NEK1_uc003isf.1_Missense_Mutation_p.P940L	p.P1009L	NM_012224	NP_036356	WXS	Illumina HiSeq	Unspecified	Q96PY6	NEK1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)	29	3518	-		Prostate(90;0.00601)|Renal(120;0.0183)	1009					G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	c.3026C>T	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	G	8.932	0.963591	0.18583	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.67345	-0.25;-0.24;-0.25;-0.26;-0.24	5.59	1.46	0.22682	.	0.392083	0.24485	N	0.038104	T	0.41903	0.1179	N	0.25144	0.715	0.09310	N	0.999999	B;B;B;B;B	0.15141	0.007;0.007;0.007;0.012;0.004	B;B;B;B;B	0.13407	0.009;0.009;0.009;0.009;0.004	T	0.09552	-1.0669	10	0.24483	T	0.36	.	0.8733	0.01219	0.3379:0.1107:0.3436:0.2078	.	940;993;1037;965;1009	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	L	1009;993;965;1037;940	ENSP00000408020:P1009L;ENSP00000423332:P993L;ENSP00000427653:P965L;ENSP00000424757:P1037L;ENSP00000424938:P940L	ENSP00000408020:P1009L	P	-	2	0	NEK1	170582391	1.000000	0.71417	0.725000	0.30721	0.233000	0.25261	0.849000	0.27723	0.315000	0.23110	0.655000	0.94253	CCA		0.393	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			22	60	0	0	0	0.00333	0	22	60				
ENPP6	133121	broad.mit.edu	37	4	185045347	185045347	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:185045347G>A	ENST00000296741.2	-	3	641	c.500C>T	c.(499-501)gCc>gTc	p.A167V		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	167					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)	p.A167V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GACTGCATTGGCAAAATTGAT	0.443																																							uc003iwc.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(499-501)GCC>GTC		ectonucleotide pyrophosphatase/phosphodiesterase							157.0	164.0	161.0					4																	185045347		2203	4300	6503	SO:0001583	missense	133121				lipid catabolic process	extracellular region|integral to membrane|plasma membrane		g.chr4:185045347G>A	AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.500C>T	4.37:g.185045347G>A	ENSP00000296741:p.Ala167Val		Somatic					p.A167V	NM_153343	NP_699174	WXS	Illumina HiSeq	Unspecified	Q6UWR7	ENPP6_HUMAN		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)	3	642	-		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)	167			Extracellular (Potential).		Q4W5Q1|Q96M57	Missense_Mutation	SNP	ENST00000296741.2	37	c.500C>T	CCDS3834.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526897	0.27299	.	.	ENSG00000164303	ENST00000296741;ENST00000512353	T;T	0.72615	-0.67;-0.67	5.67	4.83	0.62350	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.418837	0.28011	N	0.016947	T	0.54303	0.1850	L	0.35854	1.095	0.39263	D	0.964256	B	0.06786	0.001	B	0.11329	0.006	T	0.48198	-0.9056	10	0.02654	T	1	-26.8746	9.9305	0.41519	0.073:0.1383:0.7887:0.0	.	167	Q6UWR7	ENPP6_HUMAN	V	167;79	ENSP00000296741:A167V;ENSP00000423497:A79V	ENSP00000296741:A167V	A	-	2	0	ENPP6	185282341	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	4.727000	0.61993	1.410000	0.46936	0.655000	0.94253	GCC		0.443	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343		4	230	0	0	0	0.000602	0	4	230				
ACSL1	2180	broad.mit.edu	37	4	185679038	185679038	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:185679038T>C	ENST00000515030.1	-	19	2144	c.1819A>G	c.(1819-1821)Aca>Gca	p.T607A	ACSL1_ENST00000454703.2_Missense_Mutation_p.T436A|ACSL1_ENST00000281455.2_Missense_Mutation_p.T607A|ACSL1_ENST00000507295.1_Missense_Mutation_p.T573A|ACSL1_ENST00000504342.1_Missense_Mutation_p.T607A|ACSL1_ENST00000437665.3_Missense_Mutation_p.T436A|ACSL1_ENST00000513317.1_Missense_Mutation_p.T607A			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	607					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.T607A(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GAACATAATGTCTCAACATCT	0.403																																							uc003iww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1819-1821)ACA>GCA		acyl-CoA synthetase long-chain family member 1	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						177.0	170.0	172.0					4																	185679038		2203	4300	6503	SO:0001583	missense	2180				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr4:185679038T>C	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1819A>G	4.37:g.185679038T>C	ENSP00000422607:p.Thr607Ala		Somatic				ACSL1_uc011ckm.1_Missense_Mutation_p.T436A|ACSL1_uc003iwt.1_Missense_Mutation_p.T607A|ACSL1_uc003iwu.1_Missense_Mutation_p.T607A|ACSL1_uc011ckn.1_Missense_Mutation_p.T573A|ACSL1_uc003iws.1_Missense_Mutation_p.T167A	p.T607A	NM_001995	NP_001986	WXS	Illumina HiSeq	Unspecified	P33121	ACSL1_HUMAN		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	19	2113	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)	607			Cytoplasmic (Potential).		B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	c.1819A>G	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	T	4.668	0.124215	0.08931	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	T;T;T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33	5.6	2.01	0.26516	.	0.932323	0.09261	N	0.826557	T	0.07954	0.0199	N	0.04090	-0.28	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.36553	-0.9743	10	0.21540	T	0.41	-0.3701	9.207	0.37296	0.0:0.2593:0.0:0.7407	.	573;607;607;597	E7EPM6;B7Z452;P33121;P33121-2	.;.;ACSL1_HUMAN;.	A	436;607;203;607;573;436;607;607	ENSP00000407165:T436A;ENSP00000422607:T607A;ENSP00000425098:T203A;ENSP00000281455:T607A;ENSP00000426244:T573A;ENSP00000405687:T436A;ENSP00000425006:T607A;ENSP00000426150:T607A	ENSP00000281455:T607A	T	-	1	0	ACSL1	185916032	0.000000	0.05858	0.139000	0.22197	0.144000	0.21451	0.226000	0.17776	0.962000	0.38057	0.533000	0.62120	ACA		0.403	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995		10	95	0	0	0	0.008291	0	10	95				
FAM149A	25854	broad.mit.edu	37	4	187077278	187077278	+	Missense_Mutation	SNP	G	G	A	rs201494456		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:187077278G>A	ENST00000356371.5	+	7	1381	c.1381G>A	c.(1381-1383)Gtc>Atc	p.V461I	FAM149A_ENST00000502970.1_Missense_Mutation_p.V170I|FAM149A_ENST00000514153.1_Missense_Mutation_p.V170I|FAM149A_ENST00000503432.1_Missense_Mutation_p.V170I|FAM149A_ENST00000227065.4_Missense_Mutation_p.V170I|FAM149A_ENST00000389354.5_Missense_Mutation_p.V170I|FAM149A_ENST00000514829.1_3'UTR			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	461								p.V170I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GTTTGATCACGTCTGGACAAA	0.463																																							uc003iyt.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(508-510)GTC>ATC		hypothetical protein LOC25854		G	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	120.0	112.0	114.0		508,508	2.8	0.3	4		114	0,8600		0,0,4300	yes	missense,missense	FAM149A	NM_015398.2,NM_001006655.2	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	170/483,170/483	187077278	1,13005	2203	4300	6503	SO:0001583	missense	25854							g.chr4:187077278G>A	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1381G>A	4.37:g.187077278G>A	ENSP00000348732:p.Val461Ile		Somatic				FAM149A_uc011cla.1_Missense_Mutation_p.V170I|FAM149A_uc010isj.2_Missense_Mutation_p.V170I|FAM149A_uc010isk.2_RNA|FAM149A_uc003iyu.3_Missense_Mutation_p.V170I|FAM149A_uc010isl.2_Missense_Mutation_p.V170I|FAM149A_uc011clb.1_Missense_Mutation_p.V170I	p.V170I	NM_015398	NP_056213	WXS	Illumina HiSeq	Unspecified	A5PLN7	F149A_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)	7	1087	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	461					B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37	c.508G>A		.	.	.	.	.	.	.	.	.	.	G	6.974	0.549723	0.13374	2.27E-4	0.0	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	T;T;T;T;T;T	0.16196	2.42;2.36;2.42;2.42;2.42;2.42	5.46	2.83	0.33086	.	0.777035	0.12119	N	0.497815	T	0.15522	0.0374	M	0.61703	1.905	0.09310	N	1	P;B;B	0.37500	0.597;0.339;0.304	B;B;B	0.26094	0.066;0.018;0.012	T	0.09335	-1.0679	10	0.36615	T	0.2	-12.3057	9.8554	0.41082	0.2838:0.0:0.7162:0.0	.	461;461;170	A5PLN7-3;A5PLN7;B4DHZ9	.;F149A_HUMAN;.	I	170;461;170;170;170;170	ENSP00000426835:V170I;ENSP00000348732:V461I;ENSP00000227065:V170I;ENSP00000427155:V170I;ENSP00000424380:V170I;ENSP00000374005:V170I	ENSP00000227065:V170I	V	+	1	0	FAM149A	187314272	0.036000	0.19791	0.305000	0.25099	0.089000	0.18198	0.262000	0.18460	0.445000	0.26639	0.650000	0.86243	GTC		0.463	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655		17	62	0	0	0	0.004007	0	17	62				
TUBB7P	56604	broad.mit.edu	37	4	190905449	190905449	+	IGR	SNP	G	G	T	rs563006966	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:190905449G>T								FRG1 (21090 upstream) : RNA5SP174 (30843 downstream)														p.P79T(2)									TGCCCGAAGGGCCCCGAGCGC	0.667																																							uc011clg.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(235-237)CCC>ACC		tubulin, beta polypeptide 4, member Q							28.0	44.0	39.0					4																	190905449		2186	4292	6478	SO:0001628	intergenic_variant	56604				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr4:190905449G>T																													4.37:g.190905449G>T			Somatic					p.P79T	NM_020040	NP_064424	WXS	Illumina HiSeq	Unspecified	Q99867	TBB4Q_HUMAN		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)	3	238	-		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)	80						Missense_Mutation	SNP		37	c.235C>A																																																																																				0	0.667									17	62	1	0	1.96895e-08	0.00278	2.58711e-08	17	62				
AHRR	57491	broad.mit.edu	37	5	434671	434671	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:434671A>T	ENST00000505113.1	+	11	1872	c.1828A>T	c.(1828-1830)Agg>Tgg	p.R610W	AHRR_ENST00000316418.5_Missense_Mutation_p.R628W|AHRR_ENST00000512529.1_Missense_Mutation_p.R456W|AHRR_ENST00000506456.1_Missense_Mutation_p.R466W	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	610	Needed for transcriptional repression. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.R624W(1)		breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TGGGCGCAGCAGGGAGCTGAC	0.687																																							uc003jav.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(1882-1884)AGG>TGG		arylhydrocarbon receptor repressor							17.0	21.0	19.0					5																	434671		2065	4183	6248	SO:0001583	missense	57491				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr5:434671A>T	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1828A>T	5.37:g.434671A>T	ENSP00000424601:p.Arg610Trp		Somatic				AHRR_uc003jaw.2_Missense_Mutation_p.R606W|AHRR_uc010isy.2_Missense_Mutation_p.R456W|AHRR_uc010isz.2_Missense_Mutation_p.R606W|AHRR_uc003jax.2_Missense_Mutation_p.R369W|AHRR_uc003jay.2_Missense_Mutation_p.R466W|AHRR_uc003jaz.2_Missense_Mutation_p.R227W	p.R628W	NM_020731	NP_065782	WXS	Illumina HiSeq	Unspecified	A9YTQ3	AHRR_HUMAN	Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)		12	1926	+			610			Needed for transcriptional repression (By similarity).		A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	ENST00000505113.1	37	c.1882A>T	CCDS56355.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.617729	0.28801	.	.	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456	T;T;T;T	0.29142	1.89;1.89;1.58;1.58	4.19	1.54	0.23209	.	0.439592	0.21707	U	0.070333	T	0.36468	0.0968	L	0.32530	0.975	0.09310	N	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.74348	0.975;0.962;0.983	T	0.11251	-1.0595	10	0.87932	D	0	.	4.9378	0.13950	0.705:0.1819:0.1131:0.0	.	466;610;628	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	W	610;628;456;466	ENSP00000424601:R610W;ENSP00000323816:R628W;ENSP00000424880:R456W;ENSP00000426932:R466W	ENSP00000323816:R628W	R	+	1	2	AHRR	487671	0.195000	0.23338	0.042000	0.18584	0.006000	0.05464	1.274000	0.33132	0.091000	0.17302	-0.366000	0.07423	AGG		0.687	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	NM_020731		5	15	0	0	0	0.000602	0	5	15				
CDH12	1010	broad.mit.edu	37	5	21783506	21783506	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:21783506T>G	ENST00000382254.1	-	11	2440	c.1354A>C	c.(1354-1356)Act>Cct	p.T452P	CDH12_ENST00000522262.1_Missense_Mutation_p.T412P|CDH12_ENST00000504376.2_Missense_Mutation_p.T452P|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T452P(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TACTGCGCAGTGCTTTCTCTG	0.378										HNSCC(59;0.17)																													uc010iuc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1354-1356)ACT>CCT		cadherin 12, type 2 preproprotein							197.0	191.0	193.0					5																	21783506		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21783506T>G	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1354A>C	5.37:g.21783506T>G	ENSP00000371689:p.Thr452Pro	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Missense_Mutation_p.T412P|CDH12_uc003jgk.2_Missense_Mutation_p.T452P	p.T452P	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			8	1812	-			452			Extracellular (Potential).|Cadherin 4.		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.1354A>C	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.749067	0.49257	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.52526	0.66;0.66;0.66	5.54	4.39	0.52855	Cadherin (4);Cadherin-like (1);	0.190534	0.56097	D	0.000035	T	0.52677	0.1749	M	0.67953	2.075	0.38331	D	0.943804	B;B	0.27316	0.162;0.175	B;B	0.40101	0.319;0.21	T	0.59085	-0.7520	10	0.46703	T	0.11	.	10.8691	0.46872	0.0:0.0735:0.0:0.9265	.	412;452	B7Z2U6;P55289	.;CAD12_HUMAN	P	452;452;412	ENSP00000423577:T452P;ENSP00000371689:T452P;ENSP00000428786:T412P	ENSP00000371689:T452P	T	-	1	0	CDH12	21819263	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	4.764000	0.62264	2.099000	0.63709	0.533000	0.62120	ACT		0.378	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		22	130	0	0	0	0.00278	0	22	130				
SPEF2	79925	broad.mit.edu	37	5	35779385	35779385	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:35779385G>T	ENST00000356031.3	+	30	4538	c.4384G>T	c.(4384-4386)Ggt>Tgt	p.G1462C	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_5'UTR|SPEF2_ENST00000440995.2_Missense_Mutation_p.G1457C	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1462					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.G1462C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAAGAAGATGGTACCCTGAC	0.383																																							uc003jjo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(4384-4386)GGT>TGT		KPL2 protein isoform 1							100.0	90.0	93.0					5																	35779385		1884	4113	5997	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35779385G>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4384G>T	5.37:g.35779385G>T	ENSP00000348314:p.Gly1462Cys		Somatic				SPEF2_uc003jjp.1_Missense_Mutation_p.G948C|SPEF2_uc003jjr.2_5'UTR	p.G1462C	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		30	4495	+	all_lung(31;7.56e-05)		1462					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.4384G>T	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024534	0.35701	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.06294	3.33;3.32	5.5	2.56	0.30785	.	0.889887	0.10045	N	0.722939	T	0.13500	0.0327	L	0.44542	1.39	0.09310	N	0.999999	D;D	0.67145	0.996;0.993	P;P	0.59288	0.855;0.72	T	0.20638	-1.0269	10	0.72032	D	0.01	.	8.0205	0.30406	0.3222:0.0:0.6778:0.0	.	1457;1462	Q9C093-2;Q9C093	.;SPEF2_HUMAN	C	1462;1457	ENSP00000348314:G1462C;ENSP00000412125:G1457C	ENSP00000348314:G1462C	G	+	1	0	SPEF2	35815142	0.618000	0.27051	0.488000	0.27440	0.338000	0.28826	0.773000	0.26661	0.875000	0.35847	0.650000	0.86243	GGT		0.383	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		13	72	1	0	7.93312e-07	0.00245	9.79719e-07	13	72				
IL7R	3575	broad.mit.edu	37	5	35876570	35876570	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:35876570C>A	ENST00000303115.3	+	8	1491	c.1362C>A	c.(1360-1362)agC>agA	p.S454R	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	454					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.S454R(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			CCATGTCCAGCTTCTACCAAA	0.453			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(1360-1362)AGC>AGA		interleukin 7 receptor precursor							37.0	35.0	36.0					5																	35876570		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876570C>A	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1362C>A	5.37:g.35876570C>A	ENSP00000306157:p.Ser454Arg		Somatic				IL7R_uc011cop.1_RNA	p.S454R	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1451	+	all_lung(31;0.00015)		454			Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1362C>A	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188834	0.57909	.	.	ENSG00000168685	ENST00000303115	T	0.36157	1.27	5.33	0.412	0.16397	.	0.095449	0.64402	D	0.000001	T	0.48223	0.1488	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	T	0.40534	-0.9558	10	0.87932	D	0	-26.046	4.4846	0.11783	0.1434:0.5324:0.0:0.3242	.	454	P16871	IL7RA_HUMAN	R	454	ENSP00000306157:S454R	ENSP00000306157:S454R	S	+	3	2	IL7R	35912327	0.998000	0.40836	0.994000	0.49952	0.801000	0.45260	0.267000	0.18552	-0.230000	0.09840	-0.258000	0.10820	AGC		0.453	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			7	21	1	0	0.00198382	0.001984	0.00216243	7	21				
C7	730	broad.mit.edu	37	5	40945338	40945338	+	Silent	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:40945338T>C	ENST00000313164.9	+	7	965	c.606T>C	c.(604-606)aaT>aaC	p.N202N		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	202	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.N202N(1)					Ovarian(839;0.0112)				AATTTTACAATAGTACTTGGT	0.303																																							uc003jmh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(604-606)AAT>AAC		complement component 7 precursor							74.0	66.0	68.0					5																	40945338		1819	4075	5894	SO:0001819	synonymous_variant	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40945338T>C	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.606T>C	5.37:g.40945338T>C			Somatic				C7_uc011cpn.1_Intron	p.N202N	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			7	720	+		Ovarian(839;0.0112)	202			MACPF.		Q6P3T5|Q92489	Silent	SNP	ENST00000313164.9	37	c.606T>C	CCDS47201.1																																																																																				0.303	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			6	9	0	0	0	0.001168	0	6	9				
ADAMTS6	11174	broad.mit.edu	37	5	64587298	64587298	+	IGR	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:64587298C>A								ADAMTS6 (92706 upstream) : ADAMTS6 (5736 downstream)														p.?(1)									ACGGCCTGAACTGTTCAACAT	0.423																																							uc003jtp.2		NA																	1	Unknown(1)		lung(1)		0						c.e11-1		ADAM metallopeptidase with thrombospondin type 1							83.0	75.0	78.0					5																	64587298		2203	4300	6503	SO:0001628	intergenic_variant	11174				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:64587298C>A																													5.37:g.64587298C>A			Somatic				ADAMTS6_uc003jto.2_Splice_Site|ADAMTS6_uc003jtq.2_Splice_Site|ADAMTS6_uc003jtr.1_Splice_Site_p.D78_splice	p.D457_splice	NM_197941	NP_922932	WXS	Illumina HiSeq	Unspecified	Q9UKP5	ATS6_HUMAN		Lung(70;0.00942)	11	2185	-		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)							Splice_Site	SNP		37	c.1371_splice		.	.	.	.	.	.	.	.	.	.	C	19.76	3.888342	0.72524	.	.	ENSG00000049192	ENST00000381055;ENST00000464680	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2223	0.93803	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS6	64623054	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.328000	0.79160	2.620000	0.88729	0.655000	0.94253	.	0	0.423									14	28	1	0	0.000151284	0.001855	0.000171237	14	28				
RAD17	5884	broad.mit.edu	37	5	68670537	68670537	+	Splice_Site	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:68670537A>T	ENST00000509734.1	+	5	1061	c.383A>T	c.(382-384)cAg>cTg	p.Q128L	RAD17_ENST00000361732.2_Splice_Site_p.Q117L|RAD17_ENST00000521422.1_De_novo_Start_OutOfFrame|RAD17_ENST00000354868.5_Splice_Site_p.Q117L|RAD17_ENST00000354312.3_Splice_Site_p.Q117L|RAD17_ENST00000305138.4_Splice_Site_p.Q117L|RAD17_ENST00000282891.6_Splice_Site_p.Q31L|RAD17_ENST00000358030.2_De_novo_Start_OutOfFrame|RAD17_ENST00000345306.6_Splice_Site_p.Q117L|RAD17_ENST00000380774.3_Splice_Site_p.Q128L|RAD17_ENST00000504177.1_Intron			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	128					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.Q117L(1)					Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		CAACCAAAACAGGTAACTAAG	0.279								Other conserved DNA damage response genes																															uc003jwo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(382-384)CAG>CTG	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	RAD17 homolog isoform 2							42.0	47.0	45.0					5																	68670537		2203	4298	6501	SO:0001630	splice_region_variant	5884				cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr5:68670537A>T	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.384+1A>T	5.37:g.68670537A>T			Somatic				RAD17_uc003jwg.2_Missense_Mutation_p.Q117L|RAD17_uc003jwh.2_Missense_Mutation_p.Q117L|RAD17_uc003jwi.2_Missense_Mutation_p.Q117L|RAD17_uc003jwj.2_Missense_Mutation_p.Q117L|RAD17_uc003jwk.2_Missense_Mutation_p.Q117L|RAD17_uc003jwl.2_Missense_Mutation_p.Q117L|RAD17_uc003jwm.2_5'UTR|RAD17_uc003jwn.2_Missense_Mutation_p.Q31L	p.Q128L	NM_133339	NP_579917	WXS	Illumina HiSeq	Unspecified	O75943	RAD17_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)	3	445	+		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)	128					A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	ENST00000509734.1	37	c.383A>T	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	A	14.91	2.677228	0.47886	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000354312;ENST00000345306;ENST00000506564;ENST00000305138;ENST00000282891;ENST00000380774	T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.21	5.21	0.72293	.	0.269388	0.43747	D	0.000538	T	0.26268	0.0641	L	0.54323	1.7	0.80722	D	1	B;B;B	0.19200	0.023;0.034;0.003	B;B;B	0.17722	0.012;0.019;0.004	T	0.03641	-1.1017	10	0.27082	T	0.32	-27.6717	14.3504	0.66697	1.0:0.0:0.0:0.0	.	128;31;117	O75943;O75943-4;O75943-2	RAD17_HUMAN;.;.	L	117;128;117;117;117;117;117;31;128	ENSP00000355226:Q117L;ENSP00000426191:Q128L;ENSP00000346938:Q117L;ENSP00000346271:Q117L;ENSP00000311227:Q117L;ENSP00000424696:Q117L;ENSP00000303134:Q117L;ENSP00000282891:Q31L;ENSP00000370151:Q128L	ENSP00000282891:Q31L	Q	+	2	0	RAD17	68706293	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	4.468000	0.60162	2.101000	0.63845	0.496000	0.49642	CAG		0.279	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344	Missense_Mutation	20	25	0	0	0	0.008871	0	20	25				
ANKRD34B	340120	broad.mit.edu	37	5	79855837	79855837	+	Start_Codon_SNP	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:79855837A>G	ENST00000338682.3	-	5	674	c.2T>C	c.(1-3)aTg>aCg	p.M1T		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	1						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M1T(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		ACCTTCATCCATCTTCGGAGG	0.423																																							uc010jam.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1-3)ATG>ACG		ankyrin repeat domain 34B							32.0	33.0	32.0					5																	79855837		2203	4299	6502	SO:0001582	initiator_codon_variant	340120					cytoplasm|nucleus		g.chr5:79855837A>G		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.2T>C	5.37:g.79855837A>G	ENSP00000339802:p.Met1Thr		Somatic				ANKRD34B_uc003kgw.2_Missense_Mutation_p.M1T|ANKRD34B_uc010jan.2_Missense_Mutation_p.M1T	p.M1T	NM_001004441	NP_001004441	WXS	Illumina HiSeq	Unspecified	A5PLL1	AN34B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)	4	352	-		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)	1					B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	37	c.2T>C	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	A	11.58	1.682501	0.29872	.	.	ENSG00000189127	ENST00000338682;ENST00000508916	T	0.29397	1.57	5.68	5.68	0.88126	Ankyrin repeat-containing domain (1);	0.000000	0.85682	U	0.000000	T	0.49745	0.1575	.	.	.	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.53746	-0.8395	9	0.87932	D	0	-20.1291	11.4454	0.50120	0.8495:0.1505:0.0:0.0	.	1	A5PLL1	AN34B_HUMAN	T	1	ENSP00000339802:M1T	ENSP00000339802:M1T	M	-	2	0	ANKRD34B	79891593	1.000000	0.71417	0.997000	0.53966	0.833000	0.47200	8.389000	0.90172	2.179000	0.69175	0.459000	0.35465	ATG		0.423	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	Missense_Mutation	7	13	0	0	0	0.001984	0	7	13				
TMEM161B	153396	broad.mit.edu	37	5	87502892	87502892	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:87502892T>A	ENST00000296595.6	-	6	676	c.552A>T	c.(550-552)gcA>gcT	p.A184A	TMEM161B_ENST00000514135.1_Silent_p.A184A|TMEM161B_ENST00000509387.1_Silent_p.A57A|TMEM161B_ENST00000511218.1_Silent_p.A2A|TMEM161B_ENST00000512429.1_Silent_p.A173A|TMEM161B_ENST00000506536.1_Silent_p.A2A	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	184						integral component of membrane (GO:0016021)		p.A184A(1)		endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		CAATCAACACTGCCATTGCTT	0.289																																							uc003kjc.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(550-552)GCA>GCT		transmembrane protein 161B							56.0	59.0	58.0					5																	87502892		2202	4297	6499	SO:0001819	synonymous_variant	153396					integral to membrane		g.chr5:87502892T>A	BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.552A>T	5.37:g.87502892T>A			Somatic				TMEM161B_uc011cty.1_Silent_p.A173A|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctz.1_Silent_p.A51A|TMEM161B_uc011ctx.1_Silent_p.A2A	p.A184A	NM_153354	NP_699185	WXS	Illumina HiSeq	Unspecified	Q8NDZ6	T161B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)	6	677	-		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)	184			Helical; (Potential).		Q5CZH7|Q6UWQ6	Silent	SNP	ENST00000296595.6	37	c.552A>T	CCDS4065.1																																																																																				0.289	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254094.1	NM_153354		9	23	0	0	0	0.010729	0	9	23				
FBN2	2201	broad.mit.edu	37	5	127700347	127700347	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:127700347G>T	ENST00000508053.1	-	24	3348	c.2374C>A	c.(2374-2376)Cgt>Agt	p.R792S	FBN2_ENST00000508989.1_Missense_Mutation_p.R759S|FBN2_ENST00000511489.1_5'Flank|FBN2_ENST00000262464.4_Missense_Mutation_p.R792S			P35556	FBN2_HUMAN	fibrillin 2	792	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CAATTACAACGGTAACTACCA	0.333																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(2374-2376)CGT>AGT		fibrillin 2 precursor							91.0	86.0	87.0					5																	127700347		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127700347G>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2374C>A	5.37:g.127700347G>T	ENSP00000424571:p.Arg792Ser		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.R759S	p.R792S	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	18	2813	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	792			EGF-like 11; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.2374C>A	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246161	0.80024	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87256	-2.23;-2.23;-2.23	4.43	4.43	0.53597	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	D	0.88618	0.6485	N	0.21448	0.665	0.50171	D	0.999851	D;P	0.71674	0.998;0.895	D;P	0.69479	0.964;0.49	D	0.88794	0.3280	10	0.45353	T	0.12	.	18.3499	0.90335	0.0:0.0:1.0:0.0	.	759;792	D6RJI3;P35556	.;FBN2_HUMAN	S	792;792;759	ENSP00000262464:R792S;ENSP00000424571:R792S;ENSP00000425596:R759S	ENSP00000262464:R792S	R	-	1	0	FBN2	127728246	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.421000	0.44688	2.756000	0.94617	0.655000	0.94253	CGT		0.333	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		11	20	1	0	3.86212e-05	0.008291	4.4457e-05	11	20				
SLC26A2	1836	broad.mit.edu	37	5	149357616	149357616	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:149357616G>T	ENST00000286298.4	+	2	669	c.401G>T	c.(400-402)gGc>gTc	p.G134V		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	134					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.G134V(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTGCTGGCTGGCCAAGAACCT	0.438																																							uc003lrh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(400-402)GGC>GTC		solute carrier family 26 member 2							144.0	139.0	141.0					5																	149357616		2203	4300	6503	SO:0001583	missense	1836					integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity	g.chr5:149357616G>T	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.401G>T	5.37:g.149357616G>T	ENSP00000286298:p.Gly134Val		Somatic					p.G134V	NM_000112	NP_000103	WXS	Illumina HiSeq	Unspecified	P50443	S26A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		2	669	+			134			Extracellular (Potential).		A8K2U3|B2R6J1|Q6N051	Missense_Mutation	SNP	ENST00000286298.4	37	c.401G>T	CCDS4300.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896107	0.91962	.	.	ENSG00000155850	ENST00000286298;ENST00000503336	D;D	0.93426	-3.22;-3.22	5.68	5.68	0.88126	.	0.045120	0.85682	D	0.000000	D	0.98248	0.9420	H	0.98525	4.255	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.98338	1.0537	10	0.44086	T	0.13	.	19.7751	0.96389	0.0:0.0:1.0:0.0	.	134	P50443	S26A2_HUMAN	V	134;25	ENSP00000286298:G134V;ENSP00000426053:G25V	ENSP00000286298:G134V	G	+	2	0	SLC26A2	149337809	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.720000	0.68470	2.664000	0.90586	0.655000	0.94253	GGC		0.438	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112		35	54	1	0	1.56738e-10	0.004289	2.19568e-10	35	54				
FAM114A2	10827	broad.mit.edu	37	5	153390880	153390880	+	Splice_Site	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:153390880C>A	ENST00000351797.4	-	9	990	c.914G>T	c.(913-915)gGg>gTg	p.G305V	FAM114A2_ENST00000520667.1_Splice_Site_p.G305V|FAM114A2_ENST00000522858.1_Splice_Site_p.G305V|FAM114A2_ENST00000520313.1_Splice_Site_p.G235V	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	305							purine nucleotide binding (GO:0017076)	p.G305V(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						ATCTTCATCCCCTAAAAAACC	0.468																																							uc003lvb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(913-915)GGG>GTG		hypothetical protein LOC10827							85.0	82.0	83.0					5																	153390880		2203	4300	6503	SO:0001630	splice_region_variant	10827						purine nucleotide binding	g.chr5:153390880C>A	AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.914-1G>T	5.37:g.153390880C>A			Somatic				FAM114A2_uc003lvc.2_Missense_Mutation_p.G305V|FAM114A2_uc003lvd.2_Missense_Mutation_p.G305V|FAM114A2_uc003lve.2_Missense_Mutation_p.G121V|FAM114A2_uc011dda.1_Missense_Mutation_p.G235V	p.G305V	NM_018691	NP_061161	WXS	Illumina HiSeq	Unspecified	Q9NRY5	F1142_HUMAN			9	1502	-			305					B2R8D8|Q9H7E0	Missense_Mutation	SNP	ENST00000351797.4	37	c.914G>T	CCDS4323.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934293	0.52866	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.19105	2.41;2.41;2.41;2.17	4.67	1.85	0.25348	.	0.210182	0.42053	D	0.000763	T	0.22898	0.0553	L	0.52126	1.63	0.80722	D	1	P;P	0.49253	0.893;0.921	B;P	0.47744	0.391;0.556	T	0.01537	-1.1330	10	0.46703	T	0.11	.	8.5178	0.33257	0.0:0.6616:0.0:0.3384	.	235;305	E7ESJ7;Q9NRY5	.;F1142_HUMAN	V	305;305;305;235	ENSP00000341597:G305V;ENSP00000430489:G305V;ENSP00000430384:G305V;ENSP00000429088:G235V	ENSP00000341597:G305V	G	-	2	0	FAM114A2	153371073	0.934000	0.31675	0.999000	0.59377	0.993000	0.82548	0.420000	0.21263	0.515000	0.28320	0.563000	0.77884	GGG		0.468	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252455.1	NM_018691	Missense_Mutation	20	19	1	0	2.94398e-08	0.007413	3.85332e-08	20	19				
BTNL8	79908	broad.mit.edu	37	5	180338550	180338550	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr5:180338550C>A	ENST00000340184.4	+	3	815	c.609C>A	c.(607-609)agC>agA	p.S203R	BTNL8_ENST00000505126.1_5'UTR|BTNL8_ENST00000511704.1_Missense_Mutation_p.S87R|BTNL8_ENST00000508408.1_Missense_Mutation_p.S203R|BTNL8_ENST00000533815.2_Missense_Mutation_p.S19R|BTNL8_ENST00000231229.4_Missense_Mutation_p.S203R|BTNL8_ENST00000400707.3_Missense_Mutation_p.S78R|Y_RNA_ENST00000410920.1_RNA	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	203	Ig-like V-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.S203R(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACGCCGGGAGCATATCCTGTT	0.547																																							uc003mmp.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|skin(1)	2						c.(607-609)AGC>AGA		butyrophilin-like 8 isoform 2 precursor							75.0	74.0	74.0					5																	180338550		2203	4296	6499	SO:0001583	missense	79908					integral to membrane		g.chr5:180338550C>A	AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.609C>A	5.37:g.180338550C>A	ENSP00000342197:p.Ser203Arg		Somatic				BTNL8_uc003mmq.2_Missense_Mutation_p.S203R|BTNL8_uc011dhg.1_Missense_Mutation_p.S78R|BTNL8_uc010jll.2_Missense_Mutation_p.S203R|BTNL8_uc010jlm.2_Missense_Mutation_p.S87R|BTNL8_uc011dhh.1_Missense_Mutation_p.S19R	p.S203R	NM_001040462	NP_001035552	WXS	Illumina HiSeq	Unspecified	Q6UX41	BTNL8_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	843	+	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	203			Ig-like V-type 2.|Extracellular (Potential).		A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Missense_Mutation	SNP	ENST00000340184.4	37	c.609C>A	CCDS43413.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767811	0.31320	.	.	ENSG00000113303	ENST00000231229;ENST00000340184;ENST00000400707;ENST00000508408;ENST00000511704;ENST00000533815	T;T;T;T;T;T	0.60171	3.3;3.3;3.3;3.3;3.3;0.21	3.59	-6.66	0.01789	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47322	0.1439	L	0.42686	1.345	0.09310	N	1	P;P;P;P;P	0.52842	0.895;0.743;0.907;0.956;0.956	P;P;B;B;B	0.46362	0.514;0.514;0.444;0.444;0.366	T	0.53251	-0.8465	9	0.72032	D	0.01	.	8.11	0.30909	0.0:0.6311:0.1572:0.2117	.	78;87;203;203;203	E9PG07;E9PEF6;F2Z2B2;A6NEX6;Q6UX41	.;.;.;.;BTNL8_HUMAN	R	203;203;78;203;87;19	ENSP00000231229:S203R;ENSP00000342197:S203R;ENSP00000383543:S78R;ENSP00000424585:S203R;ENSP00000425207:S87R;ENSP00000435098:S19R	ENSP00000231229:S203R	S	+	3	2	BTNL8	180271156	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.155000	0.10115	-1.387000	0.02095	0.205000	0.17691	AGC		0.547	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1	NM_024850		26	47	1	0	4.87955e-14	0.005443	7.43447e-14	26	47				
DUSP22	56940	broad.mit.edu	37	6	348120	348120	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:348120G>T	ENST00000344450.5	+	6	724	c.281G>T	c.(280-282)aGg>aTg	p.R94M	DUSP22_ENST00000604971.1_5'UTR|DUSP22_ENST00000605035.1_5'UTR|DUSP22_ENST00000605315.1_5'UTR|DUSP22_ENST00000605863.1_5'UTR|DUSP22_ENST00000603453.1_5'UTR|DUSP22_ENST00000419235.2_Missense_Mutation_p.R94M	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	94	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R94M(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		GGGGTCTCCAGGAGCGTGACA	0.617																																							uc003msx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(280-282)AGG>ATG		dual specificity phosphatase 22							166.0	157.0	160.0					6																	348120		2203	4300	6503	SO:0001583	missense	56940				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:348120G>T	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.281G>T	6.37:g.348120G>T	ENSP00000345281:p.Arg94Met		Somatic				DUSP22_uc011dhn.1_Missense_Mutation_p.R94M|DUSP22_uc003msy.1_Missense_Mutation_p.R51M	p.R94M	NM_020185	NP_064570	WXS	Illumina HiSeq	Unspecified	Q9NRW4	DUS22_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)	6	720	+	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)	94			Tyrosine-protein phosphatase.		B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	c.281G>T	CCDS4468.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.340099|5.340099	0.95783|0.95783	.|.	.|.	ENSG00000112679|ENSG00000112679	ENST00000419235|ENST00000344450	.|D	.|0.98381	.|-4.9	5.82|5.82	5.82|5.82	0.92795|0.92795	.|Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99654|0.99654	0.9872|0.9872	H|H	0.99922|0.99922	4.955|4.955	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.97301|0.97301	0.9931|0.9931	5|10	.|0.87932	.|D	.|0	.|.	20.0852|20.0852	0.97797|0.97797	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|94;51;94	.|Q9NRW4-2;B3KSA8;Q9NRW4	.|.;.;DUS22_HUMAN	H|M	31|94	.|ENSP00000345281:R94M	.|ENSP00000345281:R94M	Q|R	+|+	3|2	2|0	DUSP22|DUSP22	293120|293120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.807000|9.807000	0.99171|0.99171	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	CAG|AGG		0.617	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185		13	157	1	0	9.05144e-12	0.001855	1.28387e-11	13	157				
SLC17A4	10050	broad.mit.edu	37	6	25777157	25777157	+	Missense_Mutation	SNP	C	C	G	rs142556117		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:25777157C>G	ENST00000377905.4	+	10	1357	c.1238C>G	c.(1237-1239)gCc>gGc	p.A413G	SLC17A4_ENST00000397076.2_Missense_Mutation_p.A211G|SLC17A4_ENST00000439485.2_Missense_Mutation_p.A183G	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	413					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.A413G(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GAATCAGGAGCCCTTGTTAAC	0.502																																							uc003nfe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1237-1239)GCC>GGC		solute carrier family 17 (sodium phosphate),							125.0	113.0	117.0					6																	25777157		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25777157C>G	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1238C>G	6.37:g.25777157C>G	ENSP00000367137:p.Ala413Gly		Somatic				SLC17A4_uc011djx.1_Missense_Mutation_p.A183G|SLC17A4_uc003nff.1_Missense_Mutation_p.A202G|SLC17A4_uc003nfg.2_Missense_Mutation_p.A350G|SLC17A4_uc010jqa.2_Intron	p.A413G	NM_005495	NP_005486	WXS	Illumina HiSeq	Unspecified	Q9Y2C5	S17A4_HUMAN			10	1357	+			413			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.1238C>G	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753242	0.69648	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.71934	0.31;0.56;-0.61	5.62	1.21	0.21127	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.160740	0.06404	N	0.719369	T	0.50803	0.1637	L	0.50333	1.59	0.09310	N	1	P;P;B	0.49961	0.698;0.93;0.024	B;P;B	0.47376	0.341;0.545;0.091	T	0.41070	-0.9529	10	0.48119	T	0.1	.	3.7891	0.08713	0.0:0.4796:0.1801:0.3404	.	183;211;413	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	G	413;183;211	ENSP00000367137:A413G;ENSP00000391345:A183G;ENSP00000380266:A211G	ENSP00000367137:A413G	A	+	2	0	SLC17A4	25885136	0.012000	0.17670	0.023000	0.16930	0.951000	0.60555	0.458000	0.21892	0.668000	0.31126	0.650000	0.86243	GCC		0.502	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			36	105	0	0	0	0.004289	0	36	105				
SLC17A4	10050	broad.mit.edu	37	6	25777188	25777188	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:25777188G>T	ENST00000377905.4	+	10	1387		c.e10+1		SLC17A4_ENST00000397076.2_Silent_p.R221R|SLC17A4_ENST00000439485.2_Splice_Site	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4						phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.?(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTGCTCCTCGGTAGGGACCTC	0.473																																							uc003nfe.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e10+1		solute carrier family 17 (sodium phosphate),							94.0	90.0	91.0					6																	25777188		2203	4300	6503	SO:0001630	splice_region_variant	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25777188G>T	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1268+1G>T	6.37:g.25777188G>T			Somatic				SLC17A4_uc011djx.1_Splice_Site_p.R193_splice|SLC17A4_uc003nff.1_Silent_p.R212R|SLC17A4_uc003nfg.2_Splice_Site_p.R360_splice|SLC17A4_uc010jqa.2_Intron	p.R423_splice	NM_005495	NP_005486	WXS	Illumina HiSeq	Unspecified	Q9Y2C5	S17A4_HUMAN			10	1387	+								B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Splice_Site	SNP	ENST00000377905.4	37	c.1268_splice	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888101	0.72524	.	.	ENSG00000146039	ENST00000377905;ENST00000439485	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3776	0.74621	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC17A4	25885167	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	6.218000	0.72224	2.780000	0.95670	0.655000	0.94253	.		0.473	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		Intron	23	86	1	0	1.85244e-09	0.00333	2.51694e-09	23	86				
SLC17A1	6568	broad.mit.edu	37	6	25813412	25813412	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:25813412A>T	ENST00000244527.4	-	7	761	c.646T>A	c.(646-648)Tgg>Agg	p.W216R	SLC17A1_ENST00000476801.1_Missense_Mutation_p.W216R|SLC17A1_ENST00000468082.1_Missense_Mutation_p.W216R|SLC17A1_ENST00000427328.1_Missense_Mutation_p.W216R	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	216					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.W216R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AGAACGAACCAGAGAAGACAT	0.448																																							uc003nfh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(646-648)TGG>AGG		solute carrier family 17 (sodium phosphate),							125.0	117.0	120.0					6																	25813412		2203	4300	6503	SO:0001583	missense	6568				sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr6:25813412A>T		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.646T>A	6.37:g.25813412A>T	ENSP00000244527:p.Trp216Arg		Somatic				SLC17A1_uc011djy.1_Intron|SLC17A1_uc010jqb.1_Missense_Mutation_p.W214R|SLC17A1_uc010jqc.1_Missense_Mutation_p.W214R	p.W216R	NM_005074	NP_005065	WXS	Illumina HiSeq	Unspecified	Q14916	NPT1_HUMAN			7	762	-			216			Helical; (Potential).		A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	c.646T>A	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.430091	0.43122	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	3.83	3.83	0.44106	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.387514	0.19178	N	0.120744	T	0.68513	0.3009	M	0.93241	3.395	0.29331	N	0.866722	D;D	0.76494	0.998;0.999	D;D	0.70016	0.945;0.967	T	0.66126	-0.6001	10	0.87932	D	0	.	9.2422	0.37504	1.0:0.0:0.0:0.0	.	216;216	Q14916-2;Q14916	.;NPT1_HUMAN	R	216	ENSP00000244527:W216R;ENSP00000410549:W216R;ENSP00000420614:W216R;ENSP00000420546:W216R	ENSP00000244527:W216R	W	-	1	0	SLC17A1	25921391	1.000000	0.71417	0.856000	0.33681	0.505000	0.33919	4.542000	0.60677	1.755000	0.51935	0.456000	0.33151	TGG		0.448	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			21	64	0	0	0	0.010504	0	21	64				
HIST1H4B	8366	broad.mit.edu	37	6	26027319	26027319	+	Missense_Mutation	SNP	C	C	G	rs147907725		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:26027319C>G	ENST00000377364.3	-	1	161	c.162G>C	c.(160-162)gaG>gaC	p.E54D		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	54					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.E54D(1)		large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						CGCCACGAGTCTCCTCATAAA	0.562											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003nfr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(160-162)GAG>GAC		histone cluster 1, H4b		C	ASP/GLU	0,4406		0,0,2203	89.0	78.0	82.0		162	3.8	1.0	6	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	missense	HIST1H4B	NM_003544.2	45	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	possibly-damaging	54/104	26027319	1,13005	2203	4300	6503	SO:0001583	missense	8366				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26027319C>G	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.162G>C	6.37:g.26027319C>G	ENSP00000366581:p.Glu54Asp		Somatic	OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	783		p.E54D	NM_003544	NP_003535	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	162	-			54					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	c.162G>C	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	c	16.72	3.201981	0.58234	0.0	1.16E-4	ENSG00000124529	ENST00000377364	T	0.68624	-0.34	4.65	3.78	0.43462	.	0.000000	0.53938	U	0.000051	T	0.66127	0.2758	.	.	.	0.36948	D	0.89273	.	.	.	.	.	.	T	0.71583	-0.4549	7	0.62326	D	0.03	.	12.3839	0.55322	0.0:0.9167:0.0:0.0833	.	.	.	.	D	54	ENSP00000366581:E54D	ENSP00000366581:E54D	E	-	3	2	HIST1H4B	26135298	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	4.510000	0.60455	1.261000	0.44149	0.563000	0.77884	GAG		0.562	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544		3	78	0	0	0	0.004672	0	3	78				
BTN3A1	11119	broad.mit.edu	37	6	26413835	26413835	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:26413835T>C	ENST00000289361.6	+	10	1825	c.1457T>C	c.(1456-1458)cTg>cCg	p.L486P	BTN3A1_ENST00000414912.2_Missense_Mutation_p.L434P	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	486	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L486P(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						CATACTTTCCTGGACGTCTCC	0.468																																							uc003nhv.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1456-1458)CTG>CCG		butyrophilin, subfamily 3, member A1 isoform a							155.0	144.0	148.0					6																	26413835		2203	4300	6503	SO:0001583	missense	11119				lipid metabolic process	integral to membrane		g.chr6:26413835T>C	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1457T>C	6.37:g.26413835T>C	ENSP00000289361:p.Leu486Pro		Somatic				BTN3A1_uc011dkj.1_3'UTR|BTN3A1_uc011dkk.1_Missense_Mutation_p.L434P|BTN3A1_uc010jqj.2_3'UTR	p.L486P	NM_007048	NP_008979	WXS	Illumina HiSeq	Unspecified	O00481	BT3A1_HUMAN			10	1825	+			486			Cytoplasmic (Potential).|B30.2/SPRY.		A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	c.1457T>C	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.250594	0.00268	.	.	ENSG00000026950	ENST00000289361;ENST00000414912	T;T	0.68903	-0.36;-0.36	2.31	-0.0116	0.13991	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.08403	0.0209	N	0.00566	-1.37	0.20074	N	0.999935	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.44128	-0.9348	9	0.02654	T	1	.	8.8374	0.35119	0.0:0.8086:0.0:0.1914	.	434;486	E9PGB4;O00481	.;BT3A1_HUMAN	P	486;434	ENSP00000289361:L486P;ENSP00000406667:L434P	ENSP00000289361:L486P	L	+	2	0	BTN3A1	26521814	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.804000	0.27098	-0.053000	0.13289	-1.372000	0.01188	CTG		0.468	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3			34	131	0	0	0	0.004289	0	34	131				
HIST1H2AH	85235	broad.mit.edu	37	6	27115267	27115267	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:27115267G>A	ENST00000377459.1	+	1	407	c.360G>A	c.(358-360)aaG>aaA	p.K120K	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000396891.4_5'Flank|HIST1H2BK_ENST00000356950.1_5'Flank	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	120						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K120K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						TGCCTAAGAAGACTGAGAGCC	0.522																																							uc003niz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(358-360)AAG>AAA		histone cluster 1, H2ah							62.0	64.0	63.0					6																	27115267		2203	4300	6503	SO:0001819	synonymous_variant	85235				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27115267G>A	AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.360G>A	6.37:g.27115267G>A			Somatic				HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	p.K120K	NM_080596	NP_542163	WXS	Illumina HiSeq	Unspecified	Q96KK5	H2A1H_HUMAN			1	360	+			120						Silent	SNP	ENST00000377459.1	37	c.360G>A	CCDS4622.1																																																																																				0.522	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040136.1	NM_080596		15	67	0	0	0	0.003163	0	15	67				
OR2J2	26707	broad.mit.edu	37	6	29142112	29142112	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:29142112G>T	ENST00000377167.2	+	1	802	c.700G>T	c.(700-702)Ggg>Tgg	p.G234W		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G234W(2)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						ATCAACCACTGGGCTTCAGAA	0.453																																							uc011dlm.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(700-702)GGG>TGG		olfactory receptor, family 2, subfamily J,							136.0	118.0	124.0					6																	29142112		1931	4139	6070	SO:0001583	missense	26707				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29142112G>T		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.700G>T	6.37:g.29142112G>T	ENSP00000366372:p.Gly234Trp		Somatic					p.G234W	NM_030905	NP_112167	WXS	Illumina HiSeq	Unspecified	O76002	OR2J2_HUMAN			1	802	+			234			Cytoplasmic (Potential).		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	c.700G>T	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	G	8.731	0.916743	0.17907	.	.	ENSG00000204700	ENST00000377167	T	0.00304	8.19	2.0	1.09	0.20402	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00524	0.0017	H	0.98754	4.32	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39522	-0.9610	9	0.87932	D	0	.	7.2215	0.25990	0.152:0.0:0.8479:0.0	.	234	O76002	OR2J2_HUMAN	W	234	ENSP00000366372:G234W	ENSP00000366372:G234W	G	+	1	0	OR2J2	29250091	0.027000	0.19231	0.148000	0.22405	0.439000	0.31926	0.592000	0.23984	0.167000	0.19631	0.205000	0.17691	GGG		0.453	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			33	108	1	0	5.20006e-24	0.011902	8.99398e-24	33	108				
MDC1	9656	broad.mit.edu	37	6	30675788	30675788	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:30675788T>A	ENST00000376406.3	-	8	3215	c.2568A>T	c.(2566-2568)aaA>aaT	p.K856N	MDC1_ENST00000376405.2_Intron|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	856				Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.K856N(1)		breast(2)|kidney(1)|ovary(1)	4						CTCTGTCCTGTTTCCCCTTGG	0.468								Other conserved DNA damage response genes																															uc003nrg.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|kidney(1)	4						c.(2566-2568)AAA>AAT	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							270.0	310.0	296.0					6																	30675788		1511	2709	4220	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30675788T>A	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.2568A>T	6.37:g.30675788T>A	ENSP00000365588:p.Lys856Asn		Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	p.K856N	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			8	3008	-			856	Missing (in Ref. 2; CAH18685).				A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.2568A>T	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	t	9.713	1.157478	0.21454	.	.	ENSG00000137337	ENST00000376406;ENST00000429610	T	0.02498	4.27	4.27	-1.22	0.09494	.	0.982736	0.08257	N	0.973719	T	0.00440	0.0014	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.45041	-0.9288	10	0.18276	T	0.48	0.3987	4.2339	0.10616	0.1423:0.2622:0.0:0.5955	.	856	Q14676	MDC1_HUMAN	N	856	ENSP00000365588:K856N	ENSP00000365588:K856N	K	-	3	2	MDC1	30783767	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-0.859000	0.04277	-0.306000	0.08818	-0.621000	0.04028	AAA		0.468	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		110	284	0	0	0	0.01441	0	110	284				
BAG6	7917	broad.mit.edu	37	6	31616977	31616977	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:31616977G>T	ENST00000375964.6	-	4	735	c.422C>A	c.(421-423)cCt>cAt	p.P141H	BAG6_ENST00000362049.6_Splice_Site_p.P141H|BAG6_ENST00000439687.2_Splice_Site_p.P141H|BAG6_ENST00000375976.4_Splice_Site_p.P141H|BAG6_ENST00000211379.5_Splice_Site_p.P141H|BAG6_ENST00000404765.2_Splice_Site_p.P141H	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	141					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)	p.P141H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						TAAGCTTACAGGAAGATTGAA	0.512																																							uc003nvg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)CCT>CAT		HLA-B associated transcript-3 isoform a							116.0	137.0	130.0					6																	31616977		1511	2709	4220	SO:0001630	splice_region_variant	7917				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding	g.chr6:31616977G>T	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.423+1C>A	6.37:g.31616977G>T			Somatic				BAT3_uc003nvf.3_Missense_Mutation_p.P141H|BAT3_uc003nvh.3_Missense_Mutation_p.P141H|BAT3_uc003nvi.3_Missense_Mutation_p.P141H|BAT3_uc011dnw.1_Missense_Mutation_p.P141H|BAT3_uc011dnx.1_Missense_Mutation_p.P141H|BAT3_uc003nvj.1_Missense_Mutation_p.P141H	p.P141H	NM_004639	NP_004630	WXS	Illumina HiSeq	Unspecified	P46379	BAG6_HUMAN			4	736	-			141					A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	c.422C>A	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379895	0.82682	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771;ENST00000435080;ENST00000434444;ENST00000452994;ENST00000456622;ENST00000428326;ENST00000451898;ENST00000433828;ENST00000424480;ENST00000424176;ENST00000446826;ENST00000441054;ENST00000456286;ENST00000454165	T;T;T;T;T;T;T;T	0.50548	1.32;1.22;1.32;1.34;0.74;1.33;0.78;1.39	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.57681	0.2070	L	0.52573	1.65	0.53688	D	0.999974	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.996;0.998;0.998;0.996;0.998	T	0.60929	-0.7165	10	0.87932	D	0	.	17.1309	0.86726	0.0:0.0:1.0:0.0	.	141;141;141;141;141	E7EMZ4;F8VXY4;B0UX85;P46379;P46379-2	.;.;.;BAG6_HUMAN;.	H	141	ENSP00000365143:P141H;ENSP00000365131:P141H;ENSP00000211379:P141H;ENSP00000384494:P141H;ENSP00000402856:P141H;ENSP00000354875:P141H;ENSP00000397978:P141H;ENSP00000396503:P141H	ENSP00000211379:P141H	P	-	2	0	BAG6	31724956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.950000	0.87804	2.597000	0.87782	0.655000	0.94253	CCT		0.512	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	Missense_Mutation	6	151	1	0	8.12818e-05	0.001984	9.26203e-05	6	151				
MDGA1	266727	broad.mit.edu	37	6	37623622	37623622	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:37623622C>T	ENST00000434837.3	-	4	1611	c.433G>A	c.(433-435)Ggc>Agc	p.G145S	MDGA1_ENST00000505425.1_Missense_Mutation_p.G145S|MDGA1_ENST00000297153.7_Missense_Mutation_p.G145S	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	145	Ig-like 2.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)		p.G145S(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TAGAAGTTGCCTCGCACATCG	0.602																																							uc003onu.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(433-435)GGC>AGC		MAM domain containing							49.0	51.0	50.0					6																	37623622		2126	4223	6349	SO:0001583	missense	266727				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane		g.chr6:37623622C>T	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.433G>A	6.37:g.37623622C>T	ENSP00000402584:p.Gly145Ser		Somatic					p.G145S	NM_153487	NP_705691	WXS	Illumina HiSeq	Unspecified	Q8NFP4	MDGA1_HUMAN			4	1612	-			145			Ig-like 2.		A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	37	c.433G>A	CCDS47417.1	.	.	.	.	.	.	.	.	.	.	C	34	5.372936	0.95923	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425;ENST00000515437	T;T;T;T	0.35048	1.33;1.33;1.33;2.65	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.000000	0.51477	D	0.000091	T	0.34571	0.0902	L	0.28274	0.84	0.58432	D	0.999999	D	0.89917	1.0	D	0.76071	0.987	T	0.03325	-1.1048	10	0.10902	T	0.67	.	19.0349	0.92972	0.0:1.0:0.0:0.0	.	145	Q8NFP4	MDGA1_HUMAN	S	145;145;145;89	ENSP00000402584:G145S;ENSP00000297153:G145S;ENSP00000422042:G145S;ENSP00000421510:G89S	ENSP00000297153:G145S	G	-	1	0	MDGA1	37731600	1.000000	0.71417	0.991000	0.47740	0.845000	0.48019	4.878000	0.63093	2.749000	0.94314	0.655000	0.94253	GGC		0.602	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3			12	20	0	0	0	0.003163	0	12	20				
SLC22A7	10864	broad.mit.edu	37	6	43267478	43267478	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:43267478G>T	ENST00000372585.5	+	4	712	c.617G>T	c.(616-618)gGc>gTc	p.G206V	SLC22A7_ENST00000372574.3_Missense_Mutation_p.G204V|SLC22A7_ENST00000487175.1_3'UTR|SLC22A7_ENST00000372589.3_Missense_Mutation_p.G204V	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	206					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.G206V(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	ACCCTTACTGGCTCAGCCCTG	0.577																																							uc003out.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(616-618)GGC>GTC		solute carrier family 22 member 7 isoform b							71.0	66.0	68.0					6																	43267478		2203	4300	6503	SO:0001583	missense	10864					basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity	g.chr6:43267478G>T	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.617G>T	6.37:g.43267478G>T	ENSP00000361666:p.Gly206Val		Somatic				SLC22A7_uc010jyl.1_Missense_Mutation_p.G204V|SLC22A7_uc003ous.2_Missense_Mutation_p.G204V	p.G206V	NM_153320	NP_696961	WXS	Illumina HiSeq	Unspecified	Q9Y694	S22A7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		4	716	+			206			Helical; (Potential).		B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	c.617G>T	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612511	0.87258	.	.	ENSG00000137204	ENST00000451757;ENST00000449231;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.26	5.26	0.73747	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91955	0.7452	H	0.97783	4.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94426	0.7645	10	0.87932	D	0	.	16.134	0.81465	0.0:0.0:1.0:0.0	.	206;204;204	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	V	75;265;204;206;204	ENSP00000416052:G75V;ENSP00000411818:G265V;ENSP00000361670:G204V;ENSP00000361666:G206V;ENSP00000361655:G204V	ENSP00000361655:G204V	G	+	2	0	SLC22A7	43375456	1.000000	0.71417	0.959000	0.39883	0.994000	0.84299	7.941000	0.87700	2.610000	0.88304	0.462000	0.41574	GGC		0.577	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1			25	44	1	0	1.1804e-14	0.003954	1.82719e-14	25	44				
OPN5	221391	broad.mit.edu	37	6	47754282	47754282	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:47754282C>T	ENST00000371211.2	+	2	190	c.162C>T	c.(160-162)gtC>gtT	p.V54V	OPN5_ENST00000393699.2_Silent_p.V54V|OPN5_ENST00000489301.2_Silent_p.V54V	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	54					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.V54V(1)		endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						ATGGATATGTCCTTTACATGT	0.368																																					Melanoma(28;740 973 10870 42660 45347)	Melanoma(28;740 973 10870 42660 45347)	uc003ozc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(160-162)GTC>GTT		opsin 5 isoform 1							135.0	127.0	129.0					6																	47754282		2203	4300	6503	SO:0001819	synonymous_variant	221391				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity	g.chr6:47754282C>T	AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.162C>T	6.37:g.47754282C>T			Somatic				OPN5_uc003ozd.2_5'Flank	p.V54V	NM_181744	NP_859528	WXS	Illumina HiSeq	Unspecified	Q6U736	OPN5_HUMAN			2	167	+			54			Helical; Name=1; (Potential).		A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Silent	SNP	ENST00000371211.2	37	c.162C>T	CCDS4923.1																																																																																				0.368	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359451.1	NM_181744		24	66	0	0	0	0.00333	0	24	66				
PTCHD4	442213	broad.mit.edu	37	6	47846147	47846147	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:47846147G>A	ENST00000339488.4	-	3	2466	c.2433C>T	c.(2431-2433)ccC>ccT	p.P811P		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	811						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.P811P(1)									TTTTGGAAGGGGGGAAAAACG	0.453																																							uc011dwm.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(2380-2382)CCC>CCT		hypothetical protein LOC442213							103.0	104.0	103.0					6																	47846147		2203	4300	6503	SO:0001819	synonymous_variant	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846147G>A		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2433C>T	6.37:g.47846147G>A			Somatic				C6orf138_uc011dwn.1_Silent_p.P558P	p.P794P	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			3	2467	-			811					B0QZ29|B4DRK3|Q5T884	Silent	SNP	ENST00000339488.4	37	c.2382C>T	CCDS34473.2																																																																																				0.453	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		37	77	0	0	0	0.003755	0	37	77				
PGK2	5232	broad.mit.edu	37	6	49754640	49754640	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:49754640G>A	ENST00000304801.3	-	1	413	c.261C>T	c.(259-261)tcC>tcT	p.S87S		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	87					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.S87S(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					TGCCCAGCAAGGATTTGAGCT	0.517																																							uc003ozu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(259-261)TCC>TCT		phosphoglycerate kinase 2							148.0	129.0	135.0					6																	49754640		2203	4300	6503	SO:0001819	synonymous_variant	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754640G>A	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.261C>T	6.37:g.49754640G>A			Somatic					p.S87S	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	368	-	Lung NSC(77;0.0402)		87					B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	c.261C>T	CCDS4930.1																																																																																				0.517	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			36	109	0	0	0	0.003271	0	36	109				
TINAG	27283	broad.mit.edu	37	6	54219385	54219385	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:54219385G>T	ENST00000259782.4	+	9	1297	c.1201G>T	c.(1201-1203)Gaa>Taa	p.E401*		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	401					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E401*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CACAAATAAAGAATCAGAAAA	0.323																																							uc003pcj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1201-1203)GAA>TAA		tubulointerstitial nephritis antigen							77.0	77.0	77.0					6																	54219385		2202	4299	6501	SO:0001587	stop_gained	27283				cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity	g.chr6:54219385G>T	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1201G>T	6.37:g.54219385G>T	ENSP00000259782:p.Glu401*		Somatic				TINAG_uc010jzt.2_RNA	p.E401*	NM_014464	NP_055279	WXS	Illumina HiSeq	Unspecified	Q9UJW2	TINAG_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.246)		9	1347	+	Lung NSC(77;0.0518)		401					Q5T467|Q9UJW1|Q9ULZ4	Nonsense_Mutation	SNP	ENST00000259782.4	37	c.1201G>T	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	G	36	5.751019	0.96890	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	.	.	.	5.11	4.24	0.50183	.	1.784400	0.02422	N	0.082666	.	.	.	.	.	.	0.20764	N	0.99985	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	11.6325	0.51185	0.0877:0.0:0.9123:0.0	.	.	.	.	X	260;401;80	.	ENSP00000259782:E401X	E	+	1	0	TINAG	54327344	0.997000	0.39634	0.102000	0.21198	0.210000	0.24377	2.156000	0.42310	1.274000	0.44362	0.591000	0.81541	GAA		0.323	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464		15	57	1	0	1.3612e-06	0.003163	1.66588e-06	15	57				
GFRAL	389400	broad.mit.edu	37	6	55216299	55216299	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:55216299A>T	ENST00000340465.2	+	5	705	c.619A>T	c.(619-621)Agc>Tgc	p.S207C		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	207					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S207C(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AGCTCTTCACAGCAAGACATG	0.423																																							uc003pcm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(619-621)AGC>TGC		GDNF family receptor alpha like precursor							119.0	117.0	118.0					6																	55216299		2203	4300	6503	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55216299A>T	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.619A>T	6.37:g.55216299A>T	ENSP00000343636:p.Ser207Cys		Somatic					p.S207C	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		5	705	+	Lung NSC(77;0.0875)|Renal(3;0.122)		207			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.619A>T	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155797	0.57259	.	.	ENSG00000187871	ENST00000340465	T	0.65178	-0.14	6.05	3.67	0.42095	GDNF/GAS1 (2);	0.090289	0.64402	D	0.000001	T	0.51109	0.1655	L	0.27053	0.805	0.37080	D	0.898947	D	0.89917	1.0	D	0.81914	0.995	T	0.54403	-0.8299	10	0.37606	T	0.19	-10.2318	8.3124	0.32080	0.7317:0.0:0.2683:0.0	.	207	Q6UXV0	GFRAL_HUMAN	C	207	ENSP00000343636:S207C	ENSP00000343636:S207C	S	+	1	0	GFRAL	55324258	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.910000	0.63321	0.527000	0.28560	-0.297000	0.09499	AGC		0.423	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		30	97	0	0	0	0.008361	0	30	97				
DST	667	broad.mit.edu	37	6	56328453	56328453	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:56328453T>A	ENST00000361203.3	-	96	21916	c.21909A>T	c.(21907-21909)tcA>tcT	p.S7303S	DST_ENST00000446842.2_Silent_p.S7088S|DST_ENST00000421834.2_Silent_p.S5299S|DST_ENST00000244364.6_Silent_p.S4976S|DST_ENST00000370769.4_Silent_p.S7414S|DST_ENST00000370754.5_Silent_p.S7592S|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Silent_p.S5217S			Q03001	DYST_HUMAN	dystonin	7412	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.S7387S(1)|p.S4976S(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGCGCCTCGTGATGATGGCC	0.592																																							uc003pdf.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(16438-16440)TCA>TCT		dystonin isoform 2							104.0	113.0	110.0					6																	56328453		2011	4167	6178	SO:0001819	synonymous_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56328453T>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21909A>T	6.37:g.56328453T>A			Somatic				DST_uc003pcz.3_Silent_p.S5302S|DST_uc011dxj.1_Silent_p.S5331S|DST_uc011dxk.1_Silent_p.S5342S|DST_uc003pcy.3_Silent_p.S4976S|DST_uc003pcv.3_Silent_p.S98S|DST_uc003pcw.3_Silent_p.S59S|DST_uc003pcx.3_Silent_p.S59S	p.S5480S	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		94	16468	-	Lung NSC(77;0.103)		7412					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37	c.16440A>T		.	.	.	.	.	.	.	.	.	.	T	4.320	0.058817	0.08339	.	.	ENSG00000151914	ENST00000523292	.	.	.	5.73	-11.5	0.00074	.	.	.	.	.	T	0.02230	0.0069	.	.	.	.	.	.	.	.	.	.	.	.	T	0.36625	-0.9740	3	.	.	.	.	0.2227	0.00170	0.2993:0.2035:0.2493:0.2479	.	.	.	.	L	101	.	.	H	-	2	0	DST	56436412	0.000000	0.05858	0.000000	0.03702	0.789000	0.44602	-4.708000	0.00196	-6.495000	0.00004	-0.327000	0.08410	CAC		0.592	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		32	82	0	0	0	0.012213	0	32	82				
DST	667	broad.mit.edu	37	6	56371508	56371508	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:56371508C>A	ENST00000361203.3	-	71	18366	c.18359G>T	c.(18358-18360)tGt>tTt	p.C6120F	DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Missense_Mutation_p.C5905F|DST_ENST00000421834.2_Missense_Mutation_p.C4143F|DST_ENST00000244364.6_Missense_Mutation_p.C3817F|DST_ENST00000370769.4_Missense_Mutation_p.C6231F|DST_ENST00000370754.5_Missense_Mutation_p.C6409F|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.C4034F			Q03001	DYST_HUMAN	dystonin	6116					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.C6231F(1)|p.C3817F(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGGCTCCCCACATGCCGCAAT	0.373																																							uc003pdf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(12961-12963)TGT>TTT		dystonin isoform 2							115.0	115.0	115.0					6																	56371508		1875	4111	5986	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56371508C>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18359G>T	6.37:g.56371508C>A	ENSP00000354508:p.Cys6120Phe		Somatic				DST_uc003pcz.3_Missense_Mutation_p.C4143F|DST_uc011dxj.1_Missense_Mutation_p.C4172F|DST_uc011dxk.1_Missense_Mutation_p.C4183F|DST_uc003pcy.3_Missense_Mutation_p.C3817F	p.C4321F	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		70	12990	-	Lung NSC(77;0.103)		6229			Spectrin 13.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.12962G>T		.	.	.	.	.	.	.	.	.	.	C	18.54	3.646390	0.67358	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.41	5.41	0.78517	.	0.000000	0.52532	D	0.000071	T	0.63558	0.2521	M	0.78456	2.415	0.37971	D	0.933274	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.998	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.996	T	0.59069	-0.7523	9	0.26408	T	0.33	.	19.195	0.93684	0.0:1.0:0.0:0.0	.	4143;6231;6409;6229;3817	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	F	3817;6409;6231;4143;5905;4034;6120;233	ENSP00000244364:C3817F;ENSP00000359790:C6409F;ENSP00000359805:C6231F;ENSP00000400883:C4143F;ENSP00000393645:C5905F;ENSP00000359824:C4034F;ENSP00000354508:C6120F	ENSP00000244364:C3817F	C	-	2	0	DST	56479467	1.000000	0.71417	0.859000	0.33776	0.992000	0.81027	7.792000	0.85828	2.531000	0.85337	0.585000	0.79938	TGT		0.373	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		34	73	1	0	8.4185e-14	0.012213	1.27976e-13	34	73				
KHDC3L	154288	broad.mit.edu	37	6	74072525	74072525	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:74072525G>C	ENST00000370367.3	+	1	126	c.73G>C	c.(73-75)Ggt>Cgt	p.G25R		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	25							RNA binding (GO:0003723)	p.G25S(2)|p.G25R(1)									GGAGGTGCTCGGTCACCTCCC	0.577																																							uc003pgt.3		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)	2						c.(73-75)GGT>CGT		hypothetical protein LOC154288							98.0	91.0	93.0					6																	74072525		2203	4300	6503	SO:0001583	missense	154288							g.chr6:74072525G>C	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.73G>C	6.37:g.74072525G>C	ENSP00000359392:p.Gly25Arg		Somatic					p.G25R	NM_001017361	NP_001017361	WXS	Illumina HiSeq	Unspecified	Q587J8	ECAT1_HUMAN			1	126	+			25					B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	37	c.73G>C	CCDS34484.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355342	0.41700	.	.	ENSG00000203908	ENST00000370367	T	0.60672	0.17	3.43	0.365	0.16131	.	0.000000	0.40144	N	0.001170	T	0.39784	0.1091	L	0.27053	0.805	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.25537	-1.0129	10	0.72032	D	0.01	-2.5869	3.2351	0.06762	0.2794:0.2233:0.4974:0.0	.	25	Q587J8	ECAT1_HUMAN	R	25	ENSP00000359392:G25R	ENSP00000359392:G25R	G	+	1	0	C6orf221	74129246	0.006000	0.16342	0.000000	0.03702	0.005000	0.04900	0.578000	0.23773	0.064000	0.16427	0.561000	0.74099	GGT		0.577	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041202.3	NM_001017361		23	48	0	0	0	0.014323	0	23	48				
COL12A1	1303	broad.mit.edu	37	6	75875291	75875291	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:75875291C>A	ENST00000322507.8	-	14	3224	c.2915G>T	c.(2914-2916)aGa>aTa	p.R972I	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.R972I|COL12A1_ENST00000416123.2_Missense_Mutation_p.R972I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	972	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R972I(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TACTGAAATTCTGTATTTGGT	0.408																																							uc003phs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(2914-2916)AGA>ATA		collagen, type XII, alpha 1 long isoform							133.0	130.0	131.0					6																	75875291		1901	4116	6017	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75875291C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2915G>T	6.37:g.75875291C>A	ENSP00000325146:p.Arg972Ile		Somatic				COL12A1_uc003pht.2_Intron	p.R972I	NM_004370	NP_004361	WXS	Illumina HiSeq	Unspecified	Q99715	COCA1_HUMAN			14	3081	-			972			Fibronectin type-III 6.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.2915G>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086582	0.55861	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.57595	0.39;0.39;0.39	5.55	0.238	0.15480	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.169796	0.39834	N	0.001251	T	0.27241	0.0668	L	0.39245	1.2	0.41821	D	0.990027	B	0.31931	0.347	B	0.38194	0.267	T	0.07424	-1.0773	10	0.36615	T	0.2	.	10.4515	0.44524	0.0:0.4574:0.0:0.5426	.	972	Q99715	COCA1_HUMAN	I	972	ENSP00000325146:R972I;ENSP00000412864:R972I;ENSP00000421216:R972I	ENSP00000325146:R972I	R	-	2	0	COL12A1	75932011	1.000000	0.71417	0.971000	0.41717	0.974000	0.67602	1.420000	0.34804	-0.187000	0.10516	-0.345000	0.07892	AGA		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		44	119	1	0	1.23713e-20	0.01441	2.05582e-20	44	119				
BCKDHB	594	broad.mit.edu	37	6	80878601	80878601	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:80878601G>A	ENST00000320393.6	+	5	534	c.487G>A	c.(487-489)Gaa>Aaa	p.E163K	BCKDHB_ENST00000545529.1_Missense_Mutation_p.E163K|BCKDHB_ENST00000356489.5_Missense_Mutation_p.E163K|BCKDHB_ENST00000369760.4_Missense_Mutation_p.E163K	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	163					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)	p.E163K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		GATTGTTAATGAAGCTGCCAA	0.522																																							uc003pjd.2		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CM062457	BCKDHB	M		c.(487-489)GAA>AAA		branched chain keto acid dehydrogenase E1 beta							160.0	152.0	155.0					6																	80878601		2203	4300	6503	SO:0001583	missense	594				branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding	g.chr6:80878601G>A	M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.487G>A	6.37:g.80878601G>A	ENSP00000318351:p.Glu163Lys		Somatic				BCKDHB_uc003pje.2_Missense_Mutation_p.E163K	p.E163K	NM_000056	NP_000047	WXS	Illumina HiSeq	Unspecified	P21953	ODBB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0291)	5	554	+		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)	163					Q5T2J3|Q9BQL0	Missense_Mutation	SNP	ENST00000320393.6	37	c.487G>A	CCDS4994.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792257	0.90453	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529;ENST00000541767	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.1	5.1	0.69264	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.96685	0.8918	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97875	1.0288	10	0.87932	D	0	-19.6806	17.5522	0.87879	0.0:0.0:1.0:0.0	.	163	P21953	ODBB_HUMAN	K	163;163;163;163;93	ENSP00000358775:E163K;ENSP00000318351:E163K;ENSP00000348880:E163K;ENSP00000443564:E163K	ENSP00000318351:E163K	E	+	1	0	BCKDHB	80935320	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	9.361000	0.97122	2.372000	0.80975	0.579000	0.79373	GAA		0.522	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043911.2	NM_000056		12	62	0	0	0	0.013537	0	12	62				
DOPEY1	23033	broad.mit.edu	37	6	83829489	83829489	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:83829489C>T	ENST00000349129.2	+	9	1163	c.903C>T	c.(901-903)atC>atT	p.I301I	DOPEY1_ENST00000237163.5_Intron|DOPEY1_ENST00000536812.1_3'UTR|DOPEY1_ENST00000369739.3_Intron	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	301					protein transport (GO:0015031)			p.I301I(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ACGGTGCTATCATAGGACCCA	0.338																																							uc003pjs.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)	4						c.(901-903)ATC>ATT		dopey family member 1							156.0	148.0	151.0					6																	83829489		2203	4300	6503	SO:0001819	synonymous_variant	23033				protein transport			g.chr6:83829489C>T	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.903C>T	6.37:g.83829489C>T			Somatic				DOPEY1_uc011dyy.1_Intron|DOPEY1_uc010kbl.1_Intron	p.I301I	NM_015018	NP_055833	WXS	Illumina HiSeq	Unspecified	Q5JWR5	DOP1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.053)	9	1163	+		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)	301					Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	c.903C>T	CCDS4996.1																																																																																				0.338	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018		9	94	0	0	0	0.010729	0	9	94				
MDN1	23195	broad.mit.edu	37	6	90499592	90499592	+	Silent	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:90499592T>A	ENST00000369393.3	-	7	1252	c.1137A>T	c.(1135-1137)ggA>ggT	p.G379G	MDN1_ENST00000428876.1_Silent_p.G379G			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	379					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.G379G(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ACACAAACTCTCCAGGAACAT	0.488																																							uc003pnn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|skin(2)	10						c.(1135-1137)GGA>GGT		MDN1, midasin homolog							55.0	57.0	56.0					6																	90499592		2203	4300	6503	SO:0001819	synonymous_variant	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90499592T>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.1137A>T	6.37:g.90499592T>A			Somatic				MDN1_uc003pnp.1_Silent_p.G379G	p.G379G	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	7	1253	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	379					O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	c.1137A>T	CCDS5024.1																																																																																				0.488	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			16	64	0	0	0	0.003163	0	16	64				
SIM1	6492	broad.mit.edu	37	6	100838294	100838294	+	Missense_Mutation	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:100838294T>G	ENST00000369208.3	-	12	3026	c.2244A>C	c.(2242-2244)caA>caC	p.Q748H	SIM1_ENST00000262901.4_Missense_Mutation_p.Q748H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	748	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.Q748H(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CTGGGTCTGGTTGCATCCTCA	0.413																																							uc003pqj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2242-2244)CAA>CAC		single-minded homolog 1							168.0	160.0	163.0					6																	100838294		2203	4300	6503	SO:0001583	missense	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100838294T>G	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.2244A>C	6.37:g.100838294T>G	ENSP00000358210:p.Gln748His		Somatic				SIM1_uc010kcu.2_Missense_Mutation_p.Q748H	p.Q748H	NM_005068	NP_005059	WXS	Illumina HiSeq	Unspecified	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	11	2451	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	748			Single-minded C-terminal.		Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	c.2244A>C	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.304644	0.40795	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.03951	3.75;3.75	6.1	4.25	0.50352	Single-minded, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.02418	0.0074	N	0.24115	0.695	0.49130	D	0.999752	P	0.50943	0.94	P	0.48030	0.564	T	0.55055	-0.8200	10	0.59425	D	0.04	.	10.5036	0.44821	0.0:0.7981:0.0:0.2019	.	748	P81133	SIM1_HUMAN	H	748	ENSP00000358210:Q748H;ENSP00000262901:Q748H	ENSP00000262901:Q748H	Q	-	3	2	SIM1	100945015	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.574000	0.23714	0.879000	0.35944	-0.182000	0.12963	CAA		0.413	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		41	80	0	0	0	0.010771	0	41	80				
SIM1	6492	broad.mit.edu	37	6	100838543	100838543	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:100838543G>T	ENST00000369208.3	-	12	2777	c.1995C>A	c.(1993-1995)cgC>cgA	p.R665R	SIM1_ENST00000262901.4_Silent_p.R665R			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	665	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R665R(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		ATTTTGAAATGCGATCCGAAT	0.453																																							uc003pqj.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1993-1995)CGC>CGA		single-minded homolog 1							161.0	162.0	162.0					6																	100838543		2203	4300	6503	SO:0001819	synonymous_variant	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100838543G>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1995C>A	6.37:g.100838543G>T			Somatic				SIM1_uc010kcu.2_Silent_p.R665R	p.R665R	NM_005068	NP_005059	WXS	Illumina HiSeq	Unspecified	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	11	2202	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	665			Single-minded C-terminal.		Q5TDP7	Silent	SNP	ENST00000369208.3	37	c.1995C>A	CCDS5045.1																																																																																				0.453	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		71	173	1	0	3.25985e-27	0.01441	5.78581e-27	71	173				
GRIK2	2898	broad.mit.edu	37	6	102074265	102074265	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:102074265G>T	ENST00000421544.1	+	3	784	c.294G>T	c.(292-294)caG>caT	p.Q98H	GRIK2_ENST00000369134.4_Missense_Mutation_p.Q49H|GRIK2_ENST00000358361.3_Missense_Mutation_p.Q98H|GRIK2_ENST00000413795.1_Missense_Mutation_p.Q98H|GRIK2_ENST00000369137.3_Missense_Mutation_p.Q98H|GRIK2_ENST00000318991.6_Missense_Mutation_p.Q98H|GRIK2_ENST00000369138.1_Missense_Mutation_p.Q98H	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	98					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.Q98H(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCTGTGATCAGCTGTCTCTTG	0.488																																							uc003pqp.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(292-294)CAG>CAT		glutamate receptor, ionotropic, kainate 2	L-Glutamic Acid(DB00142)						192.0	201.0	198.0					6																	102074265		2203	4300	6503	SO:0001583	missense	2898				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr6:102074265G>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.294G>T	6.37:g.102074265G>T	ENSP00000397026:p.Gln98His		Somatic				GRIK2_uc003pqn.2_Missense_Mutation_p.Q98H|GRIK2_uc003pqo.3_Missense_Mutation_p.Q98H|GRIK2_uc010kcw.2_Missense_Mutation_p.Q98H	p.Q98H	NM_021956	NP_068775	WXS	Illumina HiSeq	Unspecified	Q13002	GRIK2_HUMAN		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	3	543	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	98			Extracellular (Potential).		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	c.294G>T	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296272	0.81025	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.93	5.06	0.68205	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	M	0.85630	2.765	0.49130	D	0.999755	D;D;D	0.63880	0.992;0.993;0.992	D;D;D	0.74023	0.969;0.982;0.969	T	0.52132	-0.8616	10	0.72032	D	0.01	.	14.8618	0.70387	0.0684:0.0:0.9316:0.0	.	98;98;98	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	H	98;98;98;98;98;98;98;49;60	ENSP00000397026:Q98H;ENSP00000405596:Q98H;ENSP00000358134:Q98H;ENSP00000351128:Q98H;ENSP00000358133:Q98H;ENSP00000313276:Q98H;ENSP00000358130:Q49H	ENSP00000313276:Q98H	Q	+	3	2	GRIK2	102180958	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.417000	0.59822	1.513000	0.48852	0.655000	0.94253	CAG		0.488	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			106	250	1	0	3.29639e-60	0.01441	6.15689e-60	106	250				
AIM1	202	broad.mit.edu	37	6	106968029	106968029	+	Missense_Mutation	SNP	A	A	T	rs540395176	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:106968029A>T	ENST00000369066.3	+	2	2209	c.1722A>T	c.(1720-1722)agA>agT	p.R574S		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R574S(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CTGAAGTTAGAGAAGTGCAGT	0.542																																							uc003prh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9						c.(1720-1722)AGA>AGT		absent in melanoma 1							71.0	72.0	72.0					6																	106968029		2203	4300	6503	SO:0001583	missense	202						sugar binding	g.chr6:106968029A>T	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1722A>T	6.37:g.106968029A>T	ENSP00000358062:p.Arg574Ser		Somatic					p.R574S	NM_001624	NP_001615	WXS	Illumina HiSeq	Unspecified	Q9Y4K1	AIM1_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	2	2209	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	574					Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	c.1722A>T	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263065	0.59431	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.73152	-0.72	5.96	2.29	0.28610	.	1.121610	0.06750	N	0.779875	T	0.48768	0.1518	L	0.59436	1.845	0.80722	D	1	B	0.30482	0.281	B	0.25405	0.06	T	0.55425	-0.8143	10	0.54805	T	0.06	.	6.8977	0.24265	0.7403:0.0:0.2597:0.0	.	574	Q9Y4K1	AIM1_HUMAN	S	982;574	ENSP00000358062:R574S	ENSP00000285105:R982S	R	+	3	2	AIM1	107074722	0.961000	0.32948	0.987000	0.45799	0.991000	0.79684	0.738000	0.26158	0.490000	0.27771	0.533000	0.62120	AGA		0.542	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			20	42	0	0	0	0.007413	0	20	42				
LAMA4	3910	broad.mit.edu	37	6	112460960	112460960	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:112460960C>T	ENST00000230538.7	-	23	3501	c.3104G>A	c.(3103-3105)tGt>tAt	p.C1035Y	LAMA4_ENST00000522006.1_Missense_Mutation_p.C1028Y|LAMA4_ENST00000389463.4_Missense_Mutation_p.C1028Y|LAMA4_ENST00000424408.2_Missense_Mutation_p.C1028Y	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1035	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.C1028Y(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TTACCGGGCACATGGCACTGA	0.408																																							uc003pvu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(3103-3105)TGT>TAT		laminin, alpha 4 isoform 1 precursor							112.0	109.0	110.0					6																	112460960		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112460960C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3104G>A	6.37:g.112460960C>T	ENSP00000230538:p.Cys1035Tyr		Somatic				LAMA4_uc003pvv.2_Missense_Mutation_p.C1028Y|LAMA4_uc003pvt.2_Missense_Mutation_p.C1028Y	p.C1035Y	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	23	3413	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	1035			Laminin G-like 1.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.3104G>A	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557281	0.86231	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.18016	2.25;2.24;2.24;2.24	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);	0.041980	0.85682	D	0.000000	T	0.34308	0.0893	M	0.80422	2.495	0.80722	D	1	D;D	0.60575	0.979;0.988	P;P	0.58331	0.692;0.837	T	0.22661	-1.0210	10	0.72032	D	0.01	.	19.2521	0.93929	0.0:1.0:0.0:0.0	.	1035;1028	Q16363;Q16363-2	LAMA4_HUMAN;.	Y	1035;1028;1028;1028	ENSP00000230538:C1035Y;ENSP00000429488:C1028Y;ENSP00000374114:C1028Y;ENSP00000416470:C1028Y	ENSP00000230538:C1035Y	C	-	2	0	LAMA4	112567653	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.033000	0.64146	2.542000	0.85734	0.655000	0.94253	TGT		0.408	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		22	85	0	0	0	0.014323	0	22	85				
ROS1	6098	broad.mit.edu	37	6	117686772	117686772	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:117686772T>A	ENST00000368508.3	-	19	3143	c.2945A>T	c.(2944-2946)tAc>tTc	p.Y982F	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.Y977F	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	982	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y982F(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTCTACACTGTAGAAAACTAC	0.428			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		uc003pxp.1		NA		Dom	yes		6	6q22	6098	T	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)			"""O, E"""	GOPC|ROS1		glioblastoma|NSCLC		2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25						c.(2944-2946)TAC>TTC		proto-oncogene c-ros-1 protein precursor							80.0	70.0	73.0					6																	117686772		2203	4300	6503	SO:0001583	missense	6098				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:117686772T>A	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2945A>T	6.37:g.117686772T>A	ENSP00000357494:p.Tyr982Phe		Somatic				ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	p.Y982F	NM_002944	NP_002935	WXS	Illumina HiSeq	Unspecified	P08922	ROS_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	19	3144	-		all_cancers(87;0.00846)|all_epithelial(87;0.0242)	982			Fibronectin type-III 4.|Extracellular (Potential).		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	c.2945A>T	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329106	0.81690	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.75704	-0.96;-0.96	4.98	4.98	0.66077	.	0.125918	0.36134	N	0.002776	T	0.72439	0.3460	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.78625	-0.2131	10	0.87932	D	0	.	14.1408	0.65318	0.0:0.0:0.0:1.0	.	982	P08922	ROS1_HUMAN	F	982;977	ENSP00000357494:Y982F;ENSP00000357493:Y977F	ENSP00000357493:Y977F	Y	-	2	0	ROS1	117793465	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.672000	0.54583	1.985000	0.57927	0.528000	0.53228	TAC		0.428	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			13	39	0	0	0	0.001855	0	13	39				
EYA4	2070	broad.mit.edu	37	6	133849873	133849873	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:133849873C>A	ENST00000367895.5	+	20	2314	c.1850C>A	c.(1849-1851)cCc>cAc	p.P617H	EYA4_ENST00000531901.1_Missense_Mutation_p.P623H|EYA4_ENST00000355167.3_Missense_Mutation_p.P617H|EYA4_ENST00000355286.6_Missense_Mutation_p.P594H|EYA4_ENST00000525849.1_Missense_Mutation_p.P594H|EYA4_ENST00000431403.2_Missense_Mutation_p.P617H|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000452339.2_Missense_Mutation_p.P563H|EYA4_ENST00000430974.2_Intron	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	617					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.P617H(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CACAACATGCCCTTCTGGAGG	0.483																																					Melanoma(57;398 1237 3528 4702 7415)	Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)	2						c.(1849-1851)CCC>CAC		eyes absent 4 isoform a							303.0	281.0	289.0					6																	133849873		2203	4300	6503	SO:0001583	missense	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133849873C>A	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1850C>A	6.37:g.133849873C>A	ENSP00000356870:p.Pro617His		Somatic				EYA4_uc011ecq.1_Missense_Mutation_p.P563H|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Missense_Mutation_p.P617H|EYA4_uc003qee.3_Missense_Mutation_p.P594H|EYA4_uc011ecs.1_Missense_Mutation_p.P623H|uc003qeg.1_Intron	p.P617H	NM_004100	NP_004091	WXS	Illumina HiSeq	Unspecified	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	20	2308	+	Colorectal(23;0.221)		617					B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	c.1850C>A	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153892	0.78114	.	.	ENSG00000112319	ENST00000452339;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73	6.07	6.07	0.98685	EYA (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.998	D	0.98168	1.0450	10	0.87932	D	0	-15.0494	20.6593	0.99626	0.0:1.0:0.0:0.0	.	623;563;594;617;617	F2Z2Y1;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;EYA4_HUMAN	H	563;617;617;594;623;594;617	ENSP00000395916:P563H;ENSP00000356870:P617H;ENSP00000347294:P617H;ENSP00000347434:P594H;ENSP00000432770:P623H;ENSP00000433219:P594H;ENSP00000404558:P617H	ENSP00000347294:P617H	P	+	2	0	EYA4	133891566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CCC		0.483	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100		49	185	1	0	2.81731e-22	0.01441	4.75158e-22	49	185				
BCLAF1	9774	broad.mit.edu	37	6	136599694	136599694	+	Missense_Mutation	SNP	G	G	T	rs374838456		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:136599694G>T	ENST00000531224.1	-	4	577	c.325C>A	c.(325-327)Cgt>Agt	p.R109S	BCLAF1_ENST00000530767.1_Missense_Mutation_p.R109S|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R107S|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R107S|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R107S|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R109S	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	109					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R109S(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GAACGTGAACGACCTCGTCTA	0.468																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(325-327)CGT>AGT		BCL2-associated transcription factor 1 isoform							162.0	162.0	162.0					6																	136599694		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599694G>T	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.325C>A	6.37:g.136599694G>T	ENSP00000435210:p.Arg109Ser		Somatic				BCLAF1_uc003qgw.1_Missense_Mutation_p.R109S|BCLAF1_uc003qgy.1_Missense_Mutation_p.R107S|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R107S	p.R109S	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	578	-	Colorectal(23;0.24)		109					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.325C>A	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795783	0.31777	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000011	T	0.55497	0.1924	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.63046	0.992;0.992;0.992;0.992	D;D;D;D	0.70487	0.969;0.969;0.969;0.969	T	0.56414	-0.7983	10	0.59425	D	0.04	-5.5608	19.1308	0.93406	0.0:0.0:1.0:0.0	.	107;107;109;109	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	S	109;107;109;109;107;107;109	ENSP00000435210:R109S;ENSP00000229446:R107S;ENSP00000435441:R109S;ENSP00000436501:R109S;ENSP00000434826:R107S;ENSP00000376159:R107S;ENSP00000431734:R109S	ENSP00000229446:R107S	R	-	1	0	BCLAF1	136641387	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.388000	0.66249	2.602000	0.87976	0.557000	0.71058	CGT		0.468	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		49	209	1	0	6.81593e-30	0.01441	1.22578e-29	49	209				
BCLAF1	9774	broad.mit.edu	37	6	136599790	136599790	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:136599790C>A	ENST00000531224.1	-	4	481	c.229G>T	c.(229-231)Ggt>Tgt	p.G77C	BCLAF1_ENST00000530767.1_Missense_Mutation_p.G77C|BCLAF1_ENST00000353331.4_Missense_Mutation_p.G75C|BCLAF1_ENST00000392348.2_Missense_Mutation_p.G75C|BCLAF1_ENST00000527759.1_Missense_Mutation_p.G75C|BCLAF1_ENST00000527536.1_Missense_Mutation_p.G77C	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	77					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.G77C(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TACCCTCTACCCCTTCCTCTG	0.448																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(229-231)GGT>TGT		BCL2-associated transcription factor 1 isoform							96.0	91.0	92.0					6																	136599790		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599790C>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.229G>T	6.37:g.136599790C>A	ENSP00000435210:p.Gly77Cys		Somatic				BCLAF1_uc003qgw.1_Missense_Mutation_p.G77C|BCLAF1_uc003qgy.1_Missense_Mutation_p.G75C|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.G75C	p.G77C	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	482	-	Colorectal(23;0.24)		77					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.229G>T	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678283	0.47886	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.21932	2.38;2.34;2.35;1.98;2.37;2.34;2.18	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000004	T	0.28034	0.0691	L	0.43923	1.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71414	0.951;0.973;0.951;0.951	T	0.01553	-1.1326	10	0.87932	D	0	-9.2526	12.9743	0.58529	0.0:0.9259:0.0:0.074	.	75;75;77;77	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	C	77;75;77;77;75;75;77	ENSP00000435210:G77C;ENSP00000229446:G75C;ENSP00000435441:G77C;ENSP00000436501:G77C;ENSP00000434826:G75C;ENSP00000376159:G75C;ENSP00000431734:G77C	ENSP00000229446:G75C	G	-	1	0	BCLAF1	136641483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.066000	0.57520	2.660000	0.90430	0.557000	0.71058	GGT		0.448	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		15	130	1	0	7.41877e-09	0.012319	9.96025e-09	15	130				
TXLNB	167838	broad.mit.edu	37	6	139564044	139564044	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:139564044G>T	ENST00000358430.3	-	10	1906	c.1674C>A	c.(1672-1674)ccC>ccA	p.P558P	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	558						cytoplasm (GO:0005737)		p.P558P(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GAGGAGTTAGGGGAGGCAGGG	0.592																																							uc011eds.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1672-1674)CCC>CCA		taxilin beta							48.0	54.0	52.0					6																	139564044		2203	4300	6503	SO:0001819	synonymous_variant	167838					cytoplasm		g.chr6:139564044G>T		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1674C>A	6.37:g.139564044G>T			Somatic					p.P558P	NM_153235	NP_694967	WXS	Illumina HiSeq	Unspecified	Q8N3L3	TXLNB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)	10	1839	-			558					Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	37	c.1674C>A	CCDS34545.1																																																																																				0.592	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235		27	49	1	0	1.66031e-10	0.003954	2.30202e-10	27	49				
EPM2A	7957	broad.mit.edu	37	6	145948691	145948691	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:145948691C>T	ENST00000367519.3	-	4	1382	c.857G>A	c.(856-858)gGc>gAc	p.G286D		NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	286	Tyrosine-protein phosphatase.				autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)	p.G286D(1)		kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		CAGATTCCAGCCCATCACATA	0.592																																							uc003qkw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(856-858)GGC>GAC		laforin isoform a							56.0	59.0	58.0					6																	145948691		2203	4300	6503	SO:0001583	missense	7957				glycogen metabolic process	cytosol|endoplasmic reticulum|nucleus|plasma membrane|polysome	carbohydrate binding|identical protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:145948691C>T	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.857G>A	6.37:g.145948691C>T	ENSP00000356489:p.Gly286Asp		Somatic				EPM2A_uc003qkv.2_Missense_Mutation_p.G286D|EPM2A_uc010khr.2_Silent_p.G205G|EPM2A_uc003qkx.2_Missense_Mutation_p.G148D|EPM2A_uc003qku.2_Missense_Mutation_p.G132D	p.G286D	NM_005670	NP_005661	WXS	Illumina HiSeq	Unspecified	O95278	EPM2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)	4	1214	-		Ovarian(120;0.162)	286			Tyrosine-protein phosphatase.		B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Missense_Mutation	SNP	ENST00000367519.3	37	c.857G>A	CCDS5206.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.966153|4.966153	0.92855|0.92855	.|.	.|.	ENSG00000112425|ENSG00000112425	ENST00000435470|ENST00000367519;ENST00000392304;ENST00000324857	.|T	.|0.63913	.|-0.07	5.92|5.92	5.92|5.92	0.95590|0.95590	.|Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70116|0.70116	0.3187|0.3187	L|L	0.48174|0.48174	1.505|1.505	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.79784	.|0.985;0.983;0.993	T|T	0.64935|0.64935	-0.6290|-0.6290	5|10	.|0.37606	.|T	.|0.19	-24.8685|-24.8685	20.3167|20.3167	0.98654|0.98654	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|286;286;148	.|O95278;O95278-2;E1P599	.|EPM2A_HUMAN;.;.	T|D	206|286	.|ENSP00000356489:G286D	.|ENSP00000320279:G286D	A|G	-|-	1|2	0|0	EPM2A|EPM2A	145990384|145990384	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.453000|7.453000	0.80700|0.80700	2.809000|2.809000	0.96659|0.96659	0.557000|0.557000	0.71058|0.71058	GCT|GGC		0.592	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1			12	50	0	0	0	0.013537	0	12	50				
SASH1	23328	broad.mit.edu	37	6	148761494	148761494	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:148761494G>T	ENST00000367467.3	+	4	812	c.337G>T	c.(337-339)Gag>Tag	p.E113*	SASH1_ENST00000367469.1_Splice_Site_p.E68*|SASH1_ENST00000470750.1_3'UTR	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	113					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.E113K(1)|p.E113*(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TCTCTCGTAGGAGTCGCTTGG	0.463																																							uc003qme.1		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|breast(1)	central_nervous_system(1)	1						c.(337-339)GAG>TAG		SAM and SH3 domain containing 1							110.0	108.0	109.0					6																	148761494		2203	4300	6503	SO:0001630	splice_region_variant	23328						protein binding	g.chr6:148761494G>T	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.337-1G>T	6.37:g.148761494G>T			Somatic					p.E113*	NM_015278	NP_056093	WXS	Illumina HiSeq	Unspecified	O94885	SASH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)	4	812	+		Ovarian(120;0.0169)	113					Q5TGN5|Q8TAI0|Q9H7R7	Nonsense_Mutation	SNP	ENST00000367467.3	37	c.337G>T	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	37	5.987880	0.97179	.	.	ENSG00000111961	ENST00000367469;ENST00000367467;ENST00000392284	.	.	.	5.76	5.76	0.90799	.	0.138776	0.51477	D	0.000089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-33.3594	18.2316	0.89937	0.0:0.0:1.0:0.0	.	.	.	.	X	68;113;67	.	.	E	+	1	0	SASH1	148803187	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	6.484000	0.73621	2.740000	0.93945	0.650000	0.86243	GAG		0.463	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	Nonsense_Mutation	25	77	1	0	5.77227e-19	0.008361	9.49903e-19	25	77				
SASH1	23328	broad.mit.edu	37	6	148840928	148840928	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:148840928G>T	ENST00000367467.3	+	10	1583	c.1108G>T	c.(1108-1110)Ggg>Tgg	p.G370W		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	370					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.G370W(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CAAGAAGATGGGGACATTCTT	0.592																																							uc003qme.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1108-1110)GGG>TGG		SAM and SH3 domain containing 1							27.0	31.0	30.0					6																	148840928		2203	4300	6503	SO:0001583	missense	23328						protein binding	g.chr6:148840928G>T	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1108G>T	6.37:g.148840928G>T	ENSP00000356437:p.Gly370Trp		Somatic				SASH1_uc011eeb.1_Missense_Mutation_p.G131W	p.G370W	NM_015278	NP_056093	WXS	Illumina HiSeq	Unspecified	O94885	SASH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)	10	1583	+		Ovarian(120;0.0169)	370					Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	c.1108G>T	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880766	0.72294	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.47869	0.83	5.61	5.61	0.85477	.	0.046781	0.85682	D	0.000000	T	0.53626	0.1808	L	0.34521	1.04	0.49389	D	0.999784	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	T	0.56329	-0.7997	10	0.62326	D	0.03	-29.813	19.6426	0.95764	0.0:0.0:1.0:0.0	.	351;370	Q6P4R9;O94885	.;SASH1_HUMAN	W	370;131	ENSP00000356437:G370W	ENSP00000356437:G370W	G	+	1	0	SASH1	148882621	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.168000	0.94781	2.650000	0.89964	0.655000	0.94253	GGG		0.592	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278		20	26	1	0	1.00905e-13	0.008871	1.52708e-13	20	26				
SYNE1	23345	broad.mit.edu	37	6	152542080	152542080	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:152542080G>A	ENST00000367255.5	-	119	22359	c.21758C>T	c.(21757-21759)tCg>tTg	p.S7253L	SYNE1_ENST00000423061.1_Missense_Mutation_p.S7182L|SYNE1_ENST00000265368.4_Missense_Mutation_p.S7253L|SYNE1_ENST00000341594.5_Missense_Mutation_p.S6865L|SYNE1_ENST00000448038.1_Missense_Mutation_p.S7182L|SYNE1_ENST00000356820.4_Missense_Mutation_p.S1777L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7253					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S7253L(2)|p.S7182L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGAACTGTCGAAGCACACTG	0.488										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(21757-21759)TCG>TTG		spectrin repeat containing, nuclear envelope 1							257.0	209.0	225.0					6																	152542080		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152542080G>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21758C>T	6.37:g.152542080G>A	ENSP00000356224:p.Ser7253Leu	HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Missense_Mutation_p.S1777L|SYNE1_uc003qos.3_Missense_Mutation_p.S1777L|SYNE1_uc003qot.3_Missense_Mutation_p.S7182L|SYNE1_uc003qou.3_Missense_Mutation_p.S7253L|SYNE1_uc003qor.3_Missense_Mutation_p.S153L	p.S7253L	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	119	22360	-		Ovarian(120;0.0955)	7253			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.21758C>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	8.957	0.969655	0.18659	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.55052	0.63;0.62;0.54;0.61;0.71;2.63;1.65	5.53	5.53	0.82687	.	0.215542	0.32952	N	0.005456	T	0.31482	0.0798	M	0.67953	2.075	0.09310	N	1	P;P;P;P	0.38370	0.494;0.494;0.628;0.494	B;B;B;B	0.30401	0.054;0.054;0.115;0.054	T	0.24621	-1.0155	10	0.33940	T	0.23	.	13.0848	0.59133	0.0738:0.0:0.9262:0.0	.	7253;7253;7182;7182	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	L	7253;7182;7253;7182;6865;1777;175	ENSP00000356224:S7253L;ENSP00000396024:S7182L;ENSP00000265368:S7253L;ENSP00000390975:S7182L;ENSP00000341887:S6865L;ENSP00000349276:S1777L;ENSP00000356220:S175L	ENSP00000265368:S7253L	S	-	2	0	SYNE1	152583773	0.014000	0.17966	0.007000	0.13788	0.002000	0.02628	1.990000	0.40717	2.753000	0.94483	0.585000	0.79938	TCG		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		10	176	0	0	0	0.006214	0	10	176				
SYNE1	23345	broad.mit.edu	37	6	152623136	152623136	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:152623136C>T	ENST00000367255.5	-	92	18010	c.17409G>A	c.(17407-17409)aaG>aaA	p.K5803K	SYNE1_ENST00000423061.1_Silent_p.K5732K|SYNE1_ENST00000265368.4_Silent_p.K5803K|SYNE1_ENST00000341594.5_Silent_p.K5415K|SYNE1_ENST00000448038.1_Silent_p.K5732K|SYNE1_ENST00000356820.4_Silent_p.K327K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5803					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.K5803K(2)|p.K5732K(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGTCAGCATCTTGCACTTGG	0.587										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(17407-17409)AAG>AAA		spectrin repeat containing, nuclear envelope 1							98.0	95.0	96.0					6																	152623136		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152623136C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.17409G>A	6.37:g.152623136C>T		HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Silent_p.K327K|SYNE1_uc003qos.3_Silent_p.K327K|SYNE1_uc003qot.3_Silent_p.K5732K|SYNE1_uc003qou.3_Silent_p.K5803K|SYNE1_uc010kiy.1_Silent_p.K25K	p.K5803K	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	92	18011	-		Ovarian(120;0.0955)	5803			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.17409G>A	CCDS5236.2																																																																																				0.587	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		44	84	0	0	0	0.01441	0	44	84				
SYNE1	23345	broad.mit.edu	37	6	152658015	152658015	+	Silent	SNP	C	C	T	rs200926166		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:152658015C>T	ENST00000367255.5	-	76	13090	c.12489G>A	c.(12487-12489)ctG>ctA	p.L4163L	SYNE1_ENST00000423061.1_Silent_p.L4092L|SYNE1_ENST00000265368.4_Silent_p.L4163L|SYNE1_ENST00000341594.5_Silent_p.L4028L|SYNE1_ENST00000448038.1_Silent_p.L4092L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4163					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L4163L(2)|p.L4092L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTTCAGCTCCAGCTCAGAGT	0.468										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(12487-12489)CTG>CTA		spectrin repeat containing, nuclear envelope 1							125.0	118.0	120.0					6																	152658015		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152658015C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12489G>A	6.37:g.152658015C>T		HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Silent_p.L4092L|SYNE1_uc003qou.3_Silent_p.L4163L|SYNE1_uc010kja.1_Silent_p.L868L|SYNE1_uc010kiz.2_5'Flank	p.L4163L	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	76	13091	-		Ovarian(120;0.0955)	4163			Spectrin 11.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.12489G>A	CCDS5236.2																																																																																				0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		31	93	0	0	0	0.003755	0	31	93				
NOX3	50508	broad.mit.edu	37	6	155764448	155764448	+	Missense_Mutation	SNP	G	G	T	rs374486371		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:155764448G>T	ENST00000159060.2	-	5	547	c.445C>A	c.(445-447)Cct>Act	p.P149T		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	149	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.P149T(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CTCTCGTTAGGGGTGTTGCCC	0.572																																							uc003qqm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(445-447)CCT>ACT		NADPH oxidase 3							126.0	105.0	112.0					6																	155764448		2203	4300	6503	SO:0001583	missense	50508						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding	g.chr6:155764448G>T	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.445C>A	6.37:g.155764448G>T	ENSP00000159060:p.Pro149Thr		Somatic					p.P149T	NM_015718	NP_056533	WXS	Illumina HiSeq	Unspecified	Q9HBY0	NOX3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)	5	548	-		Breast(66;0.0183)	149			Ferric oxidoreductase.|Extracellular (Potential).		Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	c.445C>A	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557504	0.27827	.	.	ENSG00000074771	ENST00000159060	D	0.90620	-2.7	5.69	4.82	0.62117	Flavoprotein transmembrane component (1);	0.195629	0.36555	N	0.002535	D	0.83261	0.5216	L	0.45581	1.43	0.21967	N	0.999444	P	0.47841	0.901	P	0.49999	0.628	T	0.75969	-0.3130	10	0.12766	T	0.61	-6.7972	12.9692	0.58503	0.0747:0.0:0.9253:0.0	.	149	Q9HBY0	NOX3_HUMAN	T	149	ENSP00000159060:P149T	ENSP00000159060:P149T	P	-	1	0	NOX3	155806140	0.999000	0.42202	0.015000	0.15790	0.124000	0.20399	3.872000	0.56085	1.400000	0.46741	0.655000	0.94253	CCT		0.572	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1			17	34	1	0	5.35267e-07	0.007413	6.69577e-07	17	34				
LPA	4018	broad.mit.edu	37	6	161015063	161015063	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:161015063C>A	ENST00000316300.5	-	22	3600	c.3556G>T	c.(3556-3558)Gga>Tga	p.G1186*	LPA_ENST00000447678.1_Nonsense_Mutation_p.G1186*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3694	Kringle 11. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CATGTCCTTCCTGTGACAGTG	0.473																																							uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(3556-3558)GGA>TGA		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						156.0	157.0	157.0					6																	161015063		2070	4246	6316	SO:0001587	stop_gained	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161015063C>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3556G>T	6.37:g.161015063C>A	ENSP00000321334:p.Gly1186*		Somatic					p.G1186*	NM_005577	NP_005568	WXS	Illumina HiSeq	Unspecified	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	23	3676	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	3694			Kringle 33.		Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	ENST00000316300.5	37	c.3556G>T	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	38	6.752273	0.97813	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.6141	0.33820	0.0:1.0:0.0:0.0	.	.	.	.	X	1186	.	ENSP00000321334:G1186X	G	-	1	0	LPA	160935053	0.986000	0.35501	0.219000	0.23793	0.270000	0.26580	4.146000	0.58072	1.415000	0.47037	0.436000	0.28706	GGA		0.473	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		32	96	1	0	3.11337e-16	0.013726	4.96675e-16	32	96				
SDK1	221935	broad.mit.edu	37	7	4169723	4169723	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:4169723G>A	ENST00000404826.2	+	27	4262	c.4123G>A	c.(4123-4125)Gac>Aac	p.D1375N	SDK1_ENST00000389531.3_Missense_Mutation_p.D1375N	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1375	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.D1375N(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCGCACCAAAGACGATGGTAG	0.587																																							uc003smx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(4123-4125)GAC>AAC		sidekick 1 precursor							37.0	40.0	39.0					7																	4169723		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4169723G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4123G>A	7.37:g.4169723G>A	ENSP00000385899:p.Asp1375Asn		Somatic				SDK1_uc010kso.2_Missense_Mutation_p.D651N|SDK1_uc003smy.2_5'UTR	p.D1375N	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	27	4262	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1375					Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.4123G>A	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324092	0.81580	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.54071	0.59;0.59	5.67	5.67	0.87782	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.75354	0.3838	M	0.80616	2.505	0.58432	D	0.999999	D;D	0.71674	0.998;0.993	D;P	0.71414	0.973;0.837	T	0.77940	-0.2399	10	0.87932	D	0	.	19.7534	0.96277	0.0:0.0:1.0:0.0	.	1375;1375	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	N	1375	ENSP00000385899:D1375N;ENSP00000374182:D1375N	ENSP00000374182:D1375N	D	+	1	0	SDK1	4136249	1.000000	0.71417	0.738000	0.30950	0.154000	0.21943	9.038000	0.93771	2.686000	0.91538	0.655000	0.94253	GAC		0.587	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		6	36	0	0	0	0.001168	0	6	36				
RADIL	55698	broad.mit.edu	37	7	4917441	4917441	+	Nonsense_Mutation	SNP	G	G	T	rs575762308		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:4917441G>T	ENST00000399583.3	-	2	517	c.330C>A	c.(328-330)taC>taA	p.Y110*	RADIL_ENST00000536091.1_Nonsense_Mutation_p.Y110*	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	110	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)		p.Y110*(1)		NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACACAGCACGTACTGGCCGG	0.682																																							uc003snj.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7						c.(328-330)TAC>TAA		Rap GTPase interactor							37.0	44.0	42.0					7																	4917441		2034	4168	6202	SO:0001587	stop_gained	55698				cell adhesion|multicellular organismal development|signal transduction		protein binding	g.chr7:4917441G>T	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.330C>A	7.37:g.4917441G>T	ENSP00000382492:p.Tyr110*		Somatic				RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	p.Y110*	NM_018059	NP_060529	WXS	Illumina HiSeq	Unspecified	Q96JH8	RADIL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	2	503	-		Ovarian(82;0.0175)	110			Ras-associating.		A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Nonsense_Mutation	SNP	ENST00000399583.3	37	c.330C>A	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628336	0.46944	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	.	.	.	5.84	-4.83	0.03161	.	0.135049	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.08	14.9975	0.71443	0.6554:0.0:0.3446:0.0	.	.	.	.	X	110;84;110;110	.	ENSP00000320946:Y84X	Y	-	3	2	RADIL	4883967	0.077000	0.21312	0.835000	0.33067	0.499000	0.33736	-0.478000	0.06575	-0.840000	0.04206	-0.367000	0.07326	TAC		0.682	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059		33	47	1	0	3.99451e-17	0.009535	6.43296e-17	33	47				
ETV1	2115	broad.mit.edu	37	7	13935690	13935690	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:13935690T>C	ENST00000430479.1	-	14	1902	c.1235A>G	c.(1234-1236)tAc>tGc	p.Y412C	ETV1_ENST00000405218.2_Missense_Mutation_p.Y412C|ETV1_ENST00000242066.5_Missense_Mutation_p.Y394C|ETV1_ENST00000403685.1_Missense_Mutation_p.Y394C|ETV1_ENST00000405192.2_Missense_Mutation_p.Y389C|ETV1_ENST00000403527.1_Missense_Mutation_p.Y372C|ETV1_ENST00000399357.3_Missense_Mutation_p.Y309C|ETV1_ENST00000420159.2_Missense_Mutation_p.Y354C|ETV1_ENST00000405358.4_Missense_Mutation_p.Y426C|ETV1_ENST00000343495.5_Missense_Mutation_p.Y394C	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	412					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y412C(1)|p.Y372C(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CACAAACTTGTAGACATATCT	0.478			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																		uc011jxq.1		NA		Dom	yes		7	7p22	2115	T	ets variant gene 1			"""M, E"""	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3		Ewing sarcoma|prostate	TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	2	Substitution - Missense(2)		lung(2)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						c.(1234-1236)TAC>TGC		ets variant gene 1 isoform a							78.0	75.0	76.0					7																	13935690		2087	4250	6337	SO:0001583	missense	2115				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:13935690T>C		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.1235A>G	7.37:g.13935690T>C	ENSP00000405327:p.Tyr412Cys		Somatic				ETV1_uc011jxn.1_Missense_Mutation_p.Y372C|ETV1_uc011jxo.1_Missense_Mutation_p.Y309C|ETV1_uc011jxp.1_Missense_Mutation_p.Y354C|ETV1_uc003ssw.3_Missense_Mutation_p.Y389C|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.Y394C|ETV1_uc011jxs.1_Missense_Mutation_p.Y394C	p.Y412C	NM_004956	NP_004947	WXS	Illumina HiSeq	Unspecified	P50549	ETV1_HUMAN			14	1974	-			412			ETS.		A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	ENST00000430479.1	37	c.1235A>G	CCDS55088.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389459	0.61956	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685	T;T;T;T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.49	5.49	0.81192	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	D	0.88955	0.6578	M	0.91249	3.19	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.997;1.0;0.998;1.0	D	0.91475	0.5200	10	0.87932	D	0	.	15.5765	0.76392	0.0:0.0:0.0:1.0	.	400;394;426;354;309;372;412	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;P50549	.;.;.;.;.;.;ETV1_HUMAN	C	412;394;394;354;309;389;426;372;412;394	ENSP00000405327:Y412C;ENSP00000242066:Y394C;ENSP00000340853:Y394C;ENSP00000411626:Y354C;ENSP00000382293:Y309C;ENSP00000385381:Y389C;ENSP00000384085:Y426C;ENSP00000384138:Y372C;ENSP00000385551:Y412C;ENSP00000385686:Y394C	ENSP00000242066:Y394C	Y	-	2	0	ETV1	13902215	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.040000	0.89188	2.076000	0.62316	0.528000	0.53228	TAC		0.478	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956		7	18	0	0	0	0.00308	0	7	18				
FERD3L	222894	broad.mit.edu	37	7	19184872	19184872	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:19184872G>T	ENST00000275461.3	-	1	172	c.114C>A	c.(112-114)tcC>tcA	p.S38S	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	38					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S38S(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GGTCCCCCAAGGAGACCCCGG	0.662																																							uc003suo.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(112-114)TCC>TCA		nephew of atonal 3							41.0	37.0	38.0					7																	19184872		2203	4299	6502	SO:0001819	synonymous_variant	222894				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:19184872G>T	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.114C>A	7.37:g.19184872G>T			Somatic				uc003sun.1_RNA	p.S38S	NM_152898	NP_690862	WXS	Illumina HiSeq	Unspecified	Q96RJ6	FER3L_HUMAN			1	173	-			38					Q495K0	Silent	SNP	ENST00000275461.3	37	c.114C>A	CCDS5368.1																																																																																				0.662	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1			14	35	1	0	2.48551e-13	0.00499	3.70368e-13	14	35				
DNAH11	8701	broad.mit.edu	37	7	21646324	21646324	+	Silent	SNP	A	A	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:21646324A>C	ENST00000409508.3	+	20	3856	c.3825A>C	c.(3823-3825)gcA>gcC	p.A1275A	DNAH11_ENST00000328843.6_Silent_p.A1275A	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1275	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A1275A(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GATTTAATGCAGAAAATCCAT	0.328									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(3823-3825)GCA>GCC		dynein, axonemal, heavy chain 11							68.0	67.0	67.0					7																	21646324		1843	4108	5951	SO:0001819	synonymous_variant	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21646324A>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.3825A>C	7.37:g.21646324A>C			Somatic					p.A1275A	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			20	3856	+			1275			Potential.|Stem (By similarity).		Q9UJ82	Silent	SNP	ENST00000409508.3	37	c.3825A>C																																																																																					0.328	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		12	21	0	0	0	0.00245	0	12	21				
HOXA1	3198	broad.mit.edu	37	7	27134888	27134888	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:27134888G>T	ENST00000343060.4	-	1	705	c.644C>A	c.(643-645)cCc>cAc	p.P215H	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	215					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.P215H(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACCTGTTTTGGGAGGGTTTCT	0.473																																							uc003sye.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(643-645)CCC>CAC		homeobox A1 isoform a							42.0	49.0	46.0					7																	27134888		2203	4300	6503	SO:0001583	missense	3198					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27134888G>T		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.644C>A	7.37:g.27134888G>T	ENSP00000343246:p.Pro215His		Somatic				HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	p.P215H	NM_005522	NP_005513	WXS	Illumina HiSeq	Unspecified	P49639	HXA1_HUMAN			1	738	-			215					A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	c.644C>A	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111514	0.77210	.	.	ENSG00000105991	ENST00000343060	D	0.92965	-3.14	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96926	0.8996	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97757	1.0218	10	0.87932	D	0	.	17.858	0.88772	0.0:0.0:1.0:0.0	.	215	P49639	HXA1_HUMAN	H	215	ENSP00000343246:P215H	ENSP00000343246:P215H	P	-	2	0	HOXA1	27101413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.786000	0.91826	2.541000	0.85698	0.561000	0.74099	CCC		0.473	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			22	39	1	0	1.96292e-10	0.010504	2.71604e-10	22	39				
HOXA3	3200	broad.mit.edu	37	7	27147727	27147727	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:27147727G>T	ENST00000396352.4	-	3	1338	c.1139C>A	c.(1138-1140)cCa>cAa	p.P380Q	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Missense_Mutation_p.P380Q|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	380					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P380Q(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						AAAGAGGGCTGGCCCGGAGTT	0.692																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	Esophageal Squamous(136;1368 1743 5685 7935 50360)	uc011jzl.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(1138-1140)CCA>CAA		homeobox A3 isoform a							35.0	34.0	34.0					7																	27147727		2203	4299	6502	SO:0001583	missense	3200				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27147727G>T		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.1139C>A	7.37:g.27147727G>T	ENSP00000379640:p.Pro380Gln		Somatic				HOXA3_uc011jzk.1_Missense_Mutation_p.P222Q|HOXA3_uc003syk.2_Missense_Mutation_p.P380Q	p.P380Q	NM_030661	NP_109377	WXS	Illumina HiSeq	Unspecified	O43365	HXA3_HUMAN			3	1339	-			380					A4D181	Missense_Mutation	SNP	ENST00000396352.4	37	c.1139C>A	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781580	0.49891	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000396350	D;D	0.89617	-2.54;-2.54	5.79	5.79	0.91817	.	0.313191	0.39210	N	0.001423	D	0.92267	0.7547	M	0.81942	2.565	0.48511	D	0.999662	P	0.43542	0.81	P	0.46629	0.522	D	0.92837	0.6285	10	0.87932	D	0	.	20.0313	0.97540	0.0:0.0:1.0:0.0	.	380	O43365	HXA3_HUMAN	Q	380;380;222	ENSP00000379640:P380Q;ENSP00000324884:P380Q	ENSP00000324884:P380Q	P	-	2	0	HOXA3	27114252	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	6.560000	0.73950	2.746000	0.94184	0.655000	0.94253	CCA		0.692	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2			9	17	1	0	0.000274275	0.004482	0.000306357	9	17				
HOXA3	3200	broad.mit.edu	37	7	27148137	27148137	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:27148137G>T	ENST00000396352.4	-	3	928	c.729C>A	c.(727-729)cgC>cgA	p.R243R	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Silent_p.R243R|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	243					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R243R(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						TGTACTTCATGCGGCGATTCT	0.612																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	Esophageal Squamous(136;1368 1743 5685 7935 50360)	uc011jzl.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(727-729)CGC>CGA		homeobox A3 isoform a							154.0	137.0	143.0					7																	27148137		2203	4300	6503	SO:0001819	synonymous_variant	3200				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27148137G>T		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.729C>A	7.37:g.27148137G>T			Somatic				HOXA3_uc011jzk.1_Silent_p.R85R|HOXA3_uc003syk.2_Silent_p.R243R	p.R243R	NM_030661	NP_109377	WXS	Illumina HiSeq	Unspecified	O43365	HXA3_HUMAN			3	929	-			243			Homeobox.		A4D181	Silent	SNP	ENST00000396352.4	37	c.729C>A	CCDS5404.1																																																																																				0.612	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2			27	87	1	0	2.44723e-14	0.004656	3.76241e-14	27	87				
STARD3NL	83930	broad.mit.edu	37	7	38247244	38247244	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:38247244G>A	ENST00000009041.7	+	2	396	c.139G>A	c.(139-141)Ggc>Agc	p.G47S	STARD3NL_ENST00000396013.1_Missense_Mutation_p.G47S|STARD3NL_ENST00000434197.1_Missense_Mutation_p.G47S|STARD3NL_ENST00000544203.1_Missense_Mutation_p.G40S	NM_032016.3	NP_114405.1	O95772	MENTO_HUMAN	STARD3 N-terminal like	47						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.G47S(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10						GGAAAAGAAAGGCATATCTGA	0.443																																							uc003tfr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(139-141)GGC>AGC		MLN64 N-terminal homolog							190.0	166.0	174.0					7																	38247244		2203	4300	6503	SO:0001583	missense	83930					integral to membrane|late endosome membrane		g.chr7:38247244G>A	AJ492267	CCDS5455.1	7p14-p13	2003-02-06			ENSG00000010270	ENSG00000010270			19169	protein-coding gene	gene with protein product		611759				12393907	Standard	NM_032016		Approved	MENTHO, MGC3251	uc003tfr.3	O95772	OTTHUMG00000023659	ENST00000009041.7:c.139G>A	7.37:g.38247244G>A	ENSP00000009041:p.Gly47Ser		Somatic				STARD3NL_uc003tfs.2_Missense_Mutation_p.G47S|STARD3NL_uc003tft.2_Missense_Mutation_p.G47S	p.G47S	NM_032016	NP_114405	WXS	Illumina HiSeq	Unspecified	O95772	MENTO_HUMAN			2	287	+			47			Cytoplasmic (Potential).		A4D1X0	Missense_Mutation	SNP	ENST00000009041.7	37	c.139G>A	CCDS5455.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011407	0.75046	.	.	ENSG00000010270	ENST00000009041;ENST00000544203;ENST00000434197;ENST00000396013;ENST00000440144;ENST00000453225;ENST00000429075	T;T;T;T;T;T;T	0.42900	1.57;1.58;1.55;1.57;0.96;0.97;0.98	6.17	6.17	0.99709	.	0.044222	0.85682	D	0.000000	T	0.33904	0.0879	L	0.27053	0.805	0.53688	D	0.999976	P;B	0.34546	0.456;0.295	B;B	0.33521	0.165;0.165	T	0.04551	-1.0943	10	0.21014	T	0.42	-10.114	19.6509	0.95805	0.0:0.0:1.0:0.0	.	47;47	C9JKL2;O95772	.;MENTO_HUMAN	S	47;40;47;47;47;47;47	ENSP00000009041:G47S;ENSP00000439436:G40S;ENSP00000394000:G47S;ENSP00000379334:G47S;ENSP00000411933:G47S;ENSP00000395455:G47S;ENSP00000402028:G47S	ENSP00000009041:G47S	G	+	1	0	STARD3NL	38213769	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.914000	0.56401	2.941000	0.99782	0.655000	0.94253	GGC		0.443	STARD3NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226929.2			33	91	0	0	0	0.012213	0	33	91				
ABCA13	154664	broad.mit.edu	37	7	48443428	48443428	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:48443428C>A	ENST00000435803.1	+	39	12046	c.12022C>A	c.(12022-12024)Cct>Act	p.P4008T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4008	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P4008T(1)|p.P3953T(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGGGTGGACCCTTGCTCCCG	0.567																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(12022-12024)CCT>ACT		ATP binding cassette, sub-family A (ABC1),							69.0	70.0	69.0					7																	48443428		2012	4175	6187	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48443428C>A	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12022C>A	7.37:g.48443428C>A	ENSP00000411096:p.Pro4008Thr		Somatic				ABCA13_uc010kys.1_Missense_Mutation_p.P1082T|ABCA13_uc003tos.1_Missense_Mutation_p.P834T|ABCA13_uc010kyt.1_RNA	p.P4008T	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			39	12047	+			4008			ABC transporter 1.		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.12022C>A	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780100	0.90195	.	.	ENSG00000179869	ENST00000435803	D	0.95205	-3.64	6.17	5.29	0.74685	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.49305	D	0.000153	D	0.97411	0.9153	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98043	1.0383	10	0.72032	D	0.01	.	16.1338	0.81465	0.1344:0.8656:0.0:0.0	.	1710;4008	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	T	4008	ENSP00000411096:P4008T	ENSP00000411096:P4008T	P	+	1	0	ABCA13	48413974	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.864000	0.69575	1.602000	0.50124	0.655000	0.94253	CCT		0.567	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		11	36	1	0	4.68919e-08	0.008291	6.09056e-08	11	36				
POM121L12	285877	broad.mit.edu	37	7	53103916	53103916	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:53103916G>T	ENST00000408890.4	+	1	568	c.552G>T	c.(550-552)caG>caT	p.Q184H		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	184								p.Q184H(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CGCTCAGCCAGTGCCCCAAGG	0.711																																							uc003tpz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(550-552)CAG>CAT		POM121 membrane glycoprotein-like 12							34.0	40.0	38.0					7																	53103916		1928	4122	6050	SO:0001583	missense	285877							g.chr7:53103916G>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.552G>T	7.37:g.53103916G>T	ENSP00000386133:p.Gln184His		Somatic					p.Q184H	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	568	+			184					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.552G>T	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852601	0.32699	.	.	ENSG00000221900	ENST00000408890	T	0.11712	2.75	2.21	-2.14	0.07123	.	.	.	.	.	T	0.12689	0.0308	L	0.29908	0.895	0.09310	N	1	D	0.53885	0.963	P	0.57548	0.823	T	0.16778	-1.0391	9	0.87932	D	0	.	3.7949	0.08736	0.2789:0.4032:0.3179:0.0	.	184	Q8N7R1	P1L12_HUMAN	H	184	ENSP00000386133:Q184H	ENSP00000386133:Q184H	Q	+	3	2	POM121L12	53071410	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.716000	0.04991	-0.626000	0.05596	0.561000	0.74099	CAG		0.711	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		28	31	1	0	1.13719e-10	0.008361	1.59962e-10	28	31				
FKBP9P1	360132	broad.mit.edu	37	7	55759105	55759105	+	RNA	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:55759105G>T	ENST00000455909.1	-	0	0					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5						GGGGTTTGTAGTGGGAGGTGA	0.517																																							uc010kzl.2		NA																	0					0						c.(175-177)CAC>CAA		SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);																																						360132							g.chr7:55759105G>T																													7.37:g.55759105G>T			Somatic				FKBP9L_uc003tqt.2_5'Flank|FKBP9L_uc011kcs.1_5'Flank	p.H59Q	NR_003949		WXS	Illumina HiSeq	Unspecified					3	277	-								B2R7H1	Missense_Mutation	SNP	ENST00000455909.1	37	c.177C>A																																																																																					0.517	FKBP9L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000251473.2			29	118	1	0	1.75199e-13	0.007291	2.6164e-13	29	118				
CALN1	83698	broad.mit.edu	37	7	71743772	71743772	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:71743772A>T	ENST00000329008.5	-	2	315	c.17T>A	c.(16-18)gTg>gAg	p.V6E	CALN1_ENST00000412588.1_Missense_Mutation_p.V48E|CALN1_ENST00000395275.2_Missense_Mutation_p.V48E|CALN1_ENST00000431984.1_Missense_Mutation_p.V6E|CALN1_ENST00000405452.2_Missense_Mutation_p.V6E|CALN1_ENST00000395276.2_Missense_Mutation_p.V6E	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)	p.V48E(1)|p.V6E(1)		biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GCCGGCGGTCACATGGTGGAA	0.507																																							uc003twa.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(16-18)GTG>GAG		calneuron 1 isoform 2							80.0	59.0	66.0					7																	71743772		2203	4300	6503	SO:0001583	missense	83698					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding	g.chr7:71743772A>T	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.17T>A	7.37:g.71743772A>T	ENSP00000332498:p.Val6Glu		Somatic				CALN1_uc003twb.3_Missense_Mutation_p.V48E|CALN1_uc003twc.3_Missense_Mutation_p.V6E	p.V6E	NM_001017440	NP_001017440	WXS	Illumina HiSeq	Unspecified	Q9BXU9	CABP8_HUMAN			2	544	-		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)	6			Cytoplasmic (Potential).		J3KQA7	Missense_Mutation	SNP	ENST00000329008.5	37	c.17T>A	CCDS5541.1	.	.	.	.	.	.	.	.	.	.	A	41	9.112403	0.99069	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452;ENST00000446128	T;T;T;T;T;T;T	0.74842	-0.52;-0.43;-0.52;-0.52;-0.43;-0.52;-0.88	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.78848	0.4348	N	0.24115	0.695	0.50171	D	0.999851	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.81879	-0.0730	10	0.87932	D	0	-6.9385	15.5763	0.76392	1.0:0.0:0.0:0.0	.	6;6	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	E	6;48;6;6;48;6;6	ENSP00000332498:V6E;ENSP00000378690:V48E;ENSP00000378691:V6E;ENSP00000410704:V6E;ENSP00000391882:V48E;ENSP00000384354:V6E;ENSP00000411806:V6E	ENSP00000332498:V6E	V	-	2	0	CALN1	71381708	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.871000	0.92346	2.272000	0.75746	0.460000	0.39030	GTG		0.507	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320044.2	NM_031468		22	17	0	0	0	0.010504	0	22	17				
PCLO	27445	broad.mit.edu	37	7	82538323	82538323	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:82538323T>C	ENST00000333891.9	-	8	13644	c.13307A>G	c.(13306-13308)cAt>cGt	p.H4436R	PCLO_ENST00000423517.2_Missense_Mutation_p.H4436R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.H4436R(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACGACGCAGATGATAGGCTTT	0.463																																							uc003uhx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)	7						c.(13306-13308)CAT>CGT		piccolo isoform 1							85.0	76.0	79.0					7																	82538323		1945	4144	6089	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82538323T>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13307A>G	7.37:g.82538323T>C	ENSP00000334319:p.His4436Arg		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.H4436R	p.H4436R	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			8	13596	-			4367						Missense_Mutation	SNP	ENST00000333891.9	37	c.13307A>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.637444	0.47049	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.30981	1.51;1.52	5.39	5.39	0.77823	.	.	.	.	.	T	0.56819	0.2011	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.61700	-0.7009	9	0.87932	D	0	.	15.7134	0.77649	0.0:0.0:0.0:1.0	.	4436;4436	Q9Y6V0-5;Q9Y6V0-6	.;.	R	4436	ENSP00000334319:H4436R;ENSP00000388393:H4436R	ENSP00000334319:H4436R	H	-	2	0	PCLO	82376259	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.864000	0.87037	2.180000	0.69256	0.482000	0.46254	CAT		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		10	91	0	0	0	0.008291	0	10	91				
SEMA3D	223117	broad.mit.edu	37	7	84636143	84636143	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:84636143C>A	ENST00000284136.6	-	16	1926	c.1883G>T	c.(1882-1884)aGg>aTg	p.R628M	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	628	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R628M(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						ATCCCCTGACCTCTGGATATA	0.378																																					Ovarian(63;442 1191 17318 29975 31528)	Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)	5						c.(1882-1884)AGG>ATG		semaphorin 3D precursor							230.0	213.0	219.0					7																	84636143		2203	4299	6502	SO:0001583	missense	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84636143C>A	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1883G>T	7.37:g.84636143C>A	ENSP00000284136:p.Arg628Met		Somatic				SEMA3D_uc010led.2_Missense_Mutation_p.R628M|SEMA3D_uc003uib.2_Missense_Mutation_p.R267M	p.R628M	NM_152754	NP_689967	WXS	Illumina HiSeq	Unspecified	O95025	SEM3D_HUMAN			16	1923	-			628			Ig-like C2-type.		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	c.1883G>T	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595541	0.66219	.	.	ENSG00000153993	ENST00000284136	T	0.01599	4.74	6.01	4.08	0.47627	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.044850	0.07419	N	0.893664	T	0.07818	0.0196	M	0.69523	2.12	0.80722	D	1	P	0.52316	0.952	P	0.56960	0.81	T	0.02966	-1.1088	10	0.87932	D	0	.	9.0129	0.36153	0.0:0.7589:0.0:0.2411	.	628	O95025	SEM3D_HUMAN	M	628	ENSP00000284136:R628M	ENSP00000284136:R628M	R	-	2	0	SEMA3D	84474079	0.364000	0.24997	1.000000	0.80357	0.883000	0.51084	0.675000	0.25232	0.757000	0.33036	-0.355000	0.07637	AGG		0.378	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		132	156	1	0	2.32137e-38	0.01441	4.23088e-38	132	156				
KIAA1324L	222223	broad.mit.edu	37	7	86544146	86544146	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:86544146C>A	ENST00000450689.2	-	13	1809	c.1624G>T	c.(1624-1626)Gaa>Taa	p.E542*	KIAA1324L_ENST00000444627.1_Nonsense_Mutation_p.E542*|KIAA1324L_ENST00000297222.6_Nonsense_Mutation_p.E302*|KIAA1324L_ENST00000416314.1_Nonsense_Mutation_p.E375*|KIAA1324L_ENST00000490995.1_5'UTR	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	542						integral component of membrane (GO:0016021)		p.E302*(1)|p.E542*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CCCCACGATTCTACCACATTT	0.323																																							uc011kha.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)|skin(1)	7						c.(1624-1626)GAA>TAA		hypothetical protein LOC222223 isoform 1							163.0	140.0	148.0					7																	86544146		2203	4298	6501	SO:0001587	stop_gained	222223					integral to membrane		g.chr7:86544146C>A	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1624G>T	7.37:g.86544146C>A	ENSP00000413445:p.Glu542*		Somatic				KIAA1324L_uc003uif.1_Nonsense_Mutation_p.E302*|KIAA1324L_uc011kgz.1_Nonsense_Mutation_p.E428*|KIAA1324L_uc003uie.2_Nonsense_Mutation_p.E375*	p.E542*	NM_001142749	NP_001136221	WXS	Illumina HiSeq	Unspecified	A8MWY0	K132L_HUMAN			13	1809	-	Esophageal squamous(14;0.0058)		542			Extracellular (Potential).		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Nonsense_Mutation	SNP	ENST00000450689.2	37	c.1624G>T	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.684064|7.684064	0.98431|0.98431	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	.|.	.|.	.|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76622	.|0.4013	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73911	.|-0.3833	.|3	0.41790|.	T|.	0.15|.	.|.	19.3629|19.3629	0.94448|0.94448	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	542;302;542;375|502	.|.	ENSP00000297222:E302X|.	E|R	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86382082|86382082	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	5.497000|5.497000	0.66924|0.66924	2.817000|2.817000	0.96982|0.96982	0.563000|0.563000	0.77884|0.77884	GAA|AGA		0.323	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		7	58	1	0	0.00198382	0.001984	0.00216243	7	58				
ZKSCAN5	23660	broad.mit.edu	37	7	99129089	99129089	+	Nonsense_Mutation	SNP	T	T	A	rs28411998		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:99129089T>A	ENST00000394170.2	+	7	1988	c.1737T>A	c.(1735-1737)tgT>tgA	p.C579*	ZKSCAN5_ENST00000326775.5_Nonsense_Mutation_p.C579*|ZKSCAN5_ENST00000451158.1_Nonsense_Mutation_p.C579*	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C579*(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CATTCAGGTGTGAGGAATGTG	0.473																																							uc003uqv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1735-1737)TGT>TGA		zinc finger with KRAB and SCAN domains 5							90.0	86.0	87.0					7																	99129089		2203	4300	6503	SO:0001587	stop_gained	23660				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99129089T>A	AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1737T>A	7.37:g.99129089T>A	ENSP00000377725:p.Cys579*		Somatic				ZKSCAN5_uc010lfx.2_Nonsense_Mutation_p.C579*|ZKSCAN5_uc003uqw.2_Nonsense_Mutation_p.C579*|ZKSCAN5_uc003uqx.2_Nonsense_Mutation_p.C506*|ZKSCAN5_uc003uqy.2_Nonsense_Mutation_p.C315*	p.C579*	NM_145102	NP_659570	WXS	Illumina HiSeq	Unspecified	Q9Y2L8	ZKSC5_HUMAN			7	1861	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		579			C2H2-type 6.		A4D280|D6W5S9	Nonsense_Mutation	SNP	ENST00000394170.2	37	c.1737T>A	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	T	36	5.902693	0.97087	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	.	.	.	5.22	-4.75	0.03239	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6164	0.56580	0.0:0.4815:0.0:0.5185	.	.	.	.	X	579	.	ENSP00000322872:C579X	C	+	3	2	ZKSCAN5	98967025	0.000000	0.05858	0.558000	0.28319	0.964000	0.63967	-0.476000	0.06591	-0.955000	0.03636	-0.334000	0.08254	TGT		0.473	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569		33	74	0	0	0	0.009535	0	33	74				
EPHB4	2050	broad.mit.edu	37	7	100421830	100421830	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:100421830C>T	ENST00000358173.3	-	2	586	c.118G>A	c.(118-120)Ggg>Agg	p.G40R	EPHB4_ENST00000477446.1_5'UTR|RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Missense_Mutation_p.G40R	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	40	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G40R(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCACCTGCCCGTCCACCTGA	0.592																																					GBM(200;2113 3072 25865 52728)	GBM(200;2113 3072 25865 52728)	uc003uwn.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15						c.(118-120)GGG>AGG		EPH receptor B4 precursor							127.0	126.0	126.0					7																	100421830		2203	4300	6503	SO:0001583	missense	2050				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:100421830C>T	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.118G>A	7.37:g.100421830C>T	ENSP00000350896:p.Gly40Arg		Somatic				EPHB4_uc003uwm.1_5'UTR|EPHB4_uc010lhj.1_Missense_Mutation_p.G40R|EPHB4_uc011kkf.1_Missense_Mutation_p.G40R|EPHB4_uc011kkg.1_Missense_Mutation_p.G40R|EPHB4_uc011kkh.1_Missense_Mutation_p.G40R	p.G40R	NM_004444	NP_004435	WXS	Illumina HiSeq	Unspecified	P54760	EPHB4_HUMAN			2	609	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		40			Extracellular (Potential).		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	c.118G>A	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646982	0.67358	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.04234	3.67;3.67	4.05	4.05	0.47172	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.49305	D	0.000152	T	0.15219	0.0367	L	0.52011	1.625	0.46167	D	0.998906	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.98;0.984	D;D;D;P;P	0.68192	0.956;0.956;0.956;0.71;0.71	T	0.00657	-1.1623	10	0.72032	D	0.01	.	14.4958	0.67685	0.0:1.0:0.0:0.0	.	40;40;40;40;40	B5A972;B5A971;B5A970;Q96L35;P54760	.;.;.;.;EPHB4_HUMAN	R	40	ENSP00000353833:G40R;ENSP00000350896:G40R	ENSP00000350896:G40R	G	-	1	0	EPHB4	100259766	0.954000	0.32549	0.899000	0.35326	0.678000	0.39670	2.648000	0.46647	2.197000	0.70478	0.561000	0.74099	GGG		0.592	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		10	339	0	0	0	0.013537	0	10	339				
MUC17	140453	broad.mit.edu	37	7	100683533	100683533	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:100683533A>G	ENST00000306151.4	+	3	8900	c.8836A>G	c.(8836-8838)Agc>Ggc	p.S2946G		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2946	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S2946G(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCTGAGGCTAGCACCCTTTC	0.493																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8836-8838)AGC>GGC		mucin 17 precursor							219.0	226.0	223.0					7																	100683533		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683533A>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8836A>G	7.37:g.100683533A>G	ENSP00000302716:p.Ser2946Gly		Somatic				MUC17_uc010lho.1_RNA	p.S2946G	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	8889	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2946			Extracellular (Potential).|47.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8836A>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	5.336	0.247389	0.10130	.	.	ENSG00000169876	ENST00000306151	T	0.02216	4.39	0.977	-1.57	0.08506	.	.	.	.	.	T	0.02380	0.0073	L	0.34521	1.04	0.09310	N	1	P	0.43392	0.805	P	0.45506	0.483	T	0.46162	-0.9211	9	0.25106	T	0.35	.	6.0493	0.19777	0.3219:0.0:0.6781:0.0	.	2946	Q685J3	MUC17_HUMAN	G	2946	ENSP00000302716:S2946G	ENSP00000302716:S2946G	S	+	1	0	MUC17	100470253	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.766000	0.04725	-0.539000	0.06273	0.102000	0.15555	AGC		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		59	877	0	0	0	0.01441	0	59	877				
ALKBH4	54784	broad.mit.edu	37	7	102097955	102097955	+	Silent	SNP	G	G	A	rs539806636		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:102097955G>A	ENST00000292566.3	-	3	834	c.795C>T	c.(793-795)cgC>cgT	p.R265R		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	265					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.R265R(1)		kidney(1)|lung(5)|skin(2)	8						TGACGCAGACGCGGCGGGCCT	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		15970	0.0		0.0	False		,,,				2504	0.001						uc003uzl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(793-795)CGC>CGT		alkB, alkylation repair homolog 4							40.0	33.0	35.0					7																	102097955		2202	4300	6502	SO:0001819	synonymous_variant	54784					cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr7:102097955G>A	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.795C>T	7.37:g.102097955G>A			Somatic				ALKBH4_uc003uzm.2_Silent_p.R192R	p.R265R	NM_017621	NP_060091	WXS	Illumina HiSeq	Unspecified	Q9NXW9	ALKB4_HUMAN			3	800	-			265					Q53H92|Q9H6A4	Silent	SNP	ENST00000292566.3	37	c.795C>T	CCDS5723.1																																																																																				0.682	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349503.1	NM_017621		6	85	0	0	0	0.001168	0	6	85				
CBLL1	79872	broad.mit.edu	37	7	107399544	107399544	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:107399544T>C	ENST00000440859.3	+	6	1864	c.1397T>C	c.(1396-1398)tTg>tCg	p.L466S	CBLL1_ENST00000222597.2_Missense_Mutation_p.L465S	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	466	Pro-rich.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L466S(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CCTCCACGATTGCAGGGTCCG	0.488																																							uc003veq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(1396-1398)TTG>TCG		Cas-Br-M (murine) ecotropic retroviral							140.0	146.0	144.0					7																	107399544		2203	4300	6503	SO:0001583	missense	79872				cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:107399544T>C	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.1397T>C	7.37:g.107399544T>C	ENSP00000401277:p.Leu466Ser		Somatic				CBLL1_uc011kme.1_Missense_Mutation_p.L345S|CBLL1_uc011kmf.1_Missense_Mutation_p.L465S	p.L466S	NM_024814	NP_079090	WXS	Illumina HiSeq	Unspecified	Q75N03	HAKAI_HUMAN			6	1727	+			466			Pro-rich.		B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	c.1397T>C	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	t	10.35	1.325357	0.24080	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597;ENST00000417616	T;T	0.34072	1.38;1.38	5.15	3.95	0.45737	.	0.082981	0.85682	D	0.000000	T	0.22898	0.0553	N	0.14661	0.345	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.19160	-1.0314	10	0.59425	D	0.04	-0.0459	11.8652	0.52488	0.0:0.0:0.2752:0.7248	.	465;466	B7ZM03;Q75N03	.;HAKAI_HUMAN	S	466;345;465;257	ENSP00000401277:L466S;ENSP00000222597:L465S	ENSP00000222597:L465S	L	+	2	0	CBLL1	107186780	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.735000	0.62051	0.771000	0.33359	0.362000	0.22060	TTG		0.488	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814		95	247	0	0	0	0.01441	0	95	247				
LAMB1	3912	broad.mit.edu	37	7	107596050	107596050	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:107596050G>T	ENST00000222399.6	-	21	2946	c.2716C>A	c.(2716-2718)Ccc>Acc	p.P906T	LAMB1_ENST00000393561.1_Missense_Mutation_p.P930T	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	906	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.P906T(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CCAATGATGGGGTCGCCATAG	0.537																																							uc003vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(2716-2718)CCC>ACC		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						53.0	47.0	49.0					7																	107596050		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107596050G>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2716C>A	7.37:g.107596050G>T	ENSP00000222399:p.Pro906Thr		Somatic				LAMB1_uc003vev.2_Missense_Mutation_p.P930T	p.P906T	NM_002291	NP_002282	WXS	Illumina HiSeq	Unspecified	P07942	LAMB1_HUMAN			21	3051	-			906			Laminin EGF-like 8.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.2716C>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126244	0.77549	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.62498	0.02;0.02	5.06	4.17	0.49024	EGF-like, laminin (4);	.	.	.	.	T	0.77805	0.4185	M	0.83852	2.665	0.80722	D	1	B;B	0.30361	0.277;0.267	P;B	0.48901	0.594;0.094	T	0.80125	-0.1513	9	0.56958	D	0.05	.	16.0925	0.81101	0.0:0.134:0.866:0.0	.	906;930	P07942;G3XAI2	LAMB1_HUMAN;.	T	930;906	ENSP00000377191:P930T;ENSP00000222399:P906T	ENSP00000222399:P906T	P	-	1	0	LAMB1	107383286	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.566000	0.73978	1.492000	0.48499	0.591000	0.81541	CCC		0.537	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		30	50	1	0	5.45727e-16	0.008361	8.68551e-16	30	50				
NRCAM	4897	broad.mit.edu	37	7	107790398	107790398	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:107790398G>T	ENST00000425651.2	-	30	3871	c.3872C>A	c.(3871-3873)tCa>tAa	p.S1291*	NRCAM_ENST00000379028.3_Nonsense_Mutation_p.S1291*|NRCAM_ENST00000522550.2_5'UTR|NRCAM_ENST00000413765.2_Nonsense_Mutation_p.S1167*|NRCAM_ENST00000379024.4_Nonsense_Mutation_p.S1179*|NRCAM_ENST00000351718.4_Nonsense_Mutation_p.S1170*	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1291					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.S1170*(1)|p.S1291*(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						AGGTGCCTCTGAGCTTTCGTT	0.413																																							uc003vfb.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|breast(2)	5						c.(3871-3873)TCA>TAA		neuronal cell adhesion molecule isoform A							157.0	146.0	150.0					7																	107790398		2203	4300	6503	SO:0001587	stop_gained	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107790398G>T		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3872C>A	7.37:g.107790398G>T	ENSP00000401244:p.Ser1291*		Somatic				NRCAM_uc003vfc.2_Nonsense_Mutation_p.S1170*|NRCAM_uc011kmk.1_Nonsense_Mutation_p.S1193*|NRCAM_uc003vfd.2_Nonsense_Mutation_p.S1174*|NRCAM_uc003vfe.2_Nonsense_Mutation_p.S1162*|NRCAM_uc003vez.2_Nonsense_Mutation_p.S74*|NRCAM_uc003vfa.2_Nonsense_Mutation_p.S135*|NRCAM_uc011kmj.1_Nonsense_Mutation_p.S137*	p.S1291*	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			33	4343	-			1291			Cytoplasmic (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Nonsense_Mutation	SNP	ENST00000425651.2	37	c.3872C>A	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	43	10.305234	0.99379	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000437386;ENST00000351718;ENST00000379024;ENST00000425651	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	X	1295;1291;1167;135;1170;1179;1291	.	ENSP00000325269:S1170X	S	-	2	0	NRCAM	107577634	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	TCA		0.413	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		300	116	1	0	1.66838e-123	0.01441	3.13342e-123	300	116				
DOCK4	9732	broad.mit.edu	37	7	111368565	111368565	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:111368565C>A	ENST00000437633.1	-	52	5922	c.5666G>T	c.(5665-5667)gGg>gTg	p.G1889V	DOCK4_ENST00000494651.2_Missense_Mutation_p.G772V|DOCK4_ENST00000428084.1_Missense_Mutation_p.G1898V	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1889	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.G1848V(1)|p.G1889V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TGGCTCCTCCCCGCCGTAGCT	0.667																																							uc003vfx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(5665-5667)GGG>GTG		dedicator of cytokinesis 4							24.0	30.0	28.0					7																	111368565		2052	4165	6217	SO:0001583	missense	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111368565C>A		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5666G>T	7.37:g.111368565C>A	ENSP00000404179:p.Gly1889Val		Somatic				DOCK4_uc011kml.1_Missense_Mutation_p.G770V|DOCK4_uc011kmm.1_Missense_Mutation_p.G758V|DOCK4_uc003vfw.2_Missense_Mutation_p.G1301V|DOCK4_uc003vfy.2_Missense_Mutation_p.G1934V|DOCK4_uc003vfv.2_Missense_Mutation_p.G202V	p.G1889V	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			52	5935	-		Acute lymphoblastic leukemia(1;0.0441)	1889			Pro-rich.		O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.5666G>T	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.767|5.767	0.325855|0.325855	0.10900|0.10900	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|T;T	0.29397|0.31247	1.57;1.57;1.57|1.5;1.5	5.49|5.49	-5.77|-5.77	0.02369|0.02369	.|.	0.629049|0.629049	0.17208|0.17208	N|N	0.182850|0.182850	T|T	0.11452|0.11452	0.0279|0.0279	N|N	0.01705|0.01705	-0.755|-0.755	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|.	0.27416|.	0.019;0.01;0.008;0.0;0.009;0.178|.	B;B;B;B;B;B|.	0.21708|.	0.01;0.022;0.011;0.001;0.022;0.036|.	T|T	0.33777|0.33777	-0.9855|-0.9855	10|8	0.42905|0.72032	T|D	0.14|0.01	.|.	11.9451|11.9451	0.52924|0.52924	0.2518:0.1715:0.5767:0.0|0.2518:0.1715:0.5767:0.0	.|.	758;772;1934;1889;1860;202|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4|.	.;.;.;DOCK4_HUMAN;.;.|.	V|W	1877;1898;772;1889;1848|1312;1922	ENSP00000410746:G1898V;ENSP00000440944:G772V;ENSP00000404179:G1889V|ENSP00000412834:G1312W;ENSP00000397412:G1922W	ENSP00000345432:G1848V|ENSP00000412834:G1312W	G|G	-|-	2|1	0|0	DOCK4|DOCK4	111155801|111155801	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.012000|0.012000	0.07955|0.07955	0.364000|0.364000	0.20325|0.20325	-0.739000|-0.739000	0.04809|0.04809	-0.165000|-0.165000	0.13383|0.13383	GGG|GGG		0.667	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		22	184	1	0	6.33239e-15	0.010504	9.84715e-15	22	184				
DOCK4	9732	broad.mit.edu	37	7	111580244	111580244	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:111580244G>C	ENST00000437633.1	-	11	1154	c.898C>G	c.(898-900)Ccc>Gcc	p.P300A	DOCK4_ENST00000428084.1_Missense_Mutation_p.P300A|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	300					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.P300A(1)|p.P288A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CAGCCAAAGGGTCGTCGGTAC	0.448																																							uc003vfx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(898-900)CCC>GCC		dedicator of cytokinesis 4							185.0	192.0	189.0					7																	111580244		1974	4147	6121	SO:0001583	missense	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111580244G>C		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.898C>G	7.37:g.111580244G>C	ENSP00000404179:p.Pro300Ala		Somatic				DOCK4_uc003vfy.2_Missense_Mutation_p.P300A|DOCK4_uc003vga.1_5'UTR|DOCK4_uc010ljt.1_Missense_Mutation_p.P300A	p.P300A	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			11	1167	-		Acute lymphoblastic leukemia(1;0.0441)	300					O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.898C>G	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.122519|5.122519	0.94429|0.94429	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.04654	.|3.58;3.59	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.23054|0.23054	0.0557|0.0557	M|M	0.66560|0.66560	2.04|2.04	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.996;1.0;0.991	T|T	0.00006|0.00006	-1.2508|-1.2508	5|10	.|0.87932	.|D	.|0	.|.	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|300;300;300	.|A4D0S8;Q149N5;Q8N1I0	.|.;.;DOCK4_HUMAN	E|A	287|288;300;300;288;299	.|ENSP00000410746:P300A;ENSP00000404179:P300A	.|ENSP00000345432:P288A	D|P	-|-	3|1	2|0	DOCK4|DOCK4	111367480|111367480	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.995000|0.995000	0.86356|0.86356	9.151000|9.151000	0.94674|0.94674	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAC|CCC		0.448	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		129	301	0	0	0	0.01441	0	129	301				
NAA38	84316	broad.mit.edu	37	7	117828412	117828412	+	Silent	SNP	G	G	T	rs540832354		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:117828412G>T	ENST00000249299.2	+	3	345	c.153G>T	c.(151-153)ggG>ggT	p.G51G	NAA38_ENST00000424702.1_Silent_p.G51G|NAA38_ENST00000422760.1_Silent_p.G30G	NM_016200.4	NP_057284.1	Q9BRA0	LSMD1_HUMAN	N(alpha)-acetyltransferase 38, NatC auxiliary subunit	93					negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)		p.G51G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						CTTCACAGGGGGTAGAACAAG	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17711	0.0		0.0	False		,,,				2504	0.0						uc003vjg.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(151-153)GGG>GGT		U6 snRNA-associated Sm-like protein LSm8							89.0	90.0	89.0					7																	117828412		2203	4300	6503	SO:0001819	synonymous_variant	51691				nuclear mRNA splicing, via spliceosome	nucleus|ribonucleoprotein complex	protein binding|U6 snRNA binding	g.chr7:117828412G>T		CCDS11122.1	17p13.1	2014-01-21	2014-01-21	2014-01-21		ENSG00000183011		"""N(alpha)-acetyltransferase subunits"""	28212	protein-coding gene	gene with protein product			"""LSM domain containing 1"""	LSMD1		16484612, 19398576	Standard	NM_032356		Approved	MGC14151, PFAAP2	uc002gja.3	Q9BRA0		ENST00000249299.2:c.153G>T	7.37:g.117828412G>T			Somatic					p.G51G	NM_016200	NP_057284	WXS	Illumina HiSeq	Unspecified	O95777	NAA38_HUMAN			3	345	+			51					Q8N4M0	Silent	SNP	ENST00000249299.2	37	c.153G>T	CCDS5775.1																																																																																				0.348	NAA38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346774.2	NM_032356		56	50	1	0	1.00798e-23	0.01441	1.73455e-23	56	50				
GPR37	2861	broad.mit.edu	37	7	124387384	124387384	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:124387384C>A	ENST00000303921.2	-	2	1687	c.1037G>T	c.(1036-1038)gGa>gTa	p.G346V		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	346					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.G346V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGTGGTGACTCCCAGAGAAGC	0.468																																							uc003vli.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1036-1038)GGA>GTA		G protein-coupled receptor 37 precursor							54.0	56.0	56.0					7																	124387384		2203	4300	6503	SO:0001583	missense	2861					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity	g.chr7:124387384C>A		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1037G>T	7.37:g.124387384C>A	ENSP00000306449:p.Gly346Val		Somatic					p.G346V	NM_005302	NP_005293	WXS	Illumina HiSeq	Unspecified	O15354	GPR37_HUMAN			2	1688	-			346			Helical; Name=3; (Potential).		A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	c.1037G>T	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977255	0.34848	.	.	ENSG00000170775	ENST00000303921	T	0.70869	-0.52	5.77	4.89	0.63831	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000006	T	0.82167	0.4978	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84210	0.0455	10	0.87932	D	0	-17.0222	13.9362	0.64026	0.0:0.9273:0.0:0.0727	.	346	O15354	GPR37_HUMAN	V	346	ENSP00000306449:G346V	ENSP00000306449:G346V	G	-	2	0	GPR37	124174620	1.000000	0.71417	0.713000	0.30519	0.003000	0.03518	7.818000	0.86416	1.449000	0.47699	-0.140000	0.14226	GGA		0.468	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302		12	67	1	0	1.5739e-10	0.004007	2.19568e-10	12	67				
PLXNA4	91584	broad.mit.edu	37	7	131913210	131913210	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:131913210C>A	ENST00000359827.3	-	6	2585	c.1623G>T	c.(1621-1623)cgG>cgT	p.R541R	PLXNA4_ENST00000321063.4_Silent_p.R541R			Q9HCM2	PLXA4_HUMAN	plexin A4	541	PSI 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.R541R(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ACCGCTCACACCGCTCCTTCC	0.597																																							uc003vra.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1621-1623)CGG>CGT		plexin A4 isoform 1							61.0	66.0	64.0					7																	131913210		1994	4167	6161	SO:0001819	synonymous_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131913210C>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1623G>T	7.37:g.131913210C>A			Somatic					p.R541R	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			6	1852	-			541			PSI 1.|Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	c.1623G>T	CCDS43646.1																																																																																				0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		17	32	1	0	8.00594e-06	0.007413	9.48956e-06	17	32				
ATP6V0A4	50617	broad.mit.edu	37	7	138455936	138455936	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:138455936C>G	ENST00000310018.2	-	3	339	c.57G>C	c.(55-57)gtG>gtC	p.V19V	ATP6V0A4_ENST00000393054.1_Silent_p.V19V|ATP6V0A4_ENST00000353492.4_Silent_p.V19V|ATP6V0A4_ENST00000483139.1_5'UTR	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	19					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)	p.V19V(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ATGCAGCTTCCACCTGGAGAA	0.478																																							uc003vuf.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(55-57)GTG>GTC		ATPase, H+ transporting, lysosomal V0 subunit							175.0	169.0	171.0					7																	138455936		2203	4300	6503	SO:0001819	synonymous_variant	50617				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity	g.chr7:138455936C>G	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.57G>C	7.37:g.138455936C>G			Somatic				ATP6V0A4_uc003vug.2_Silent_p.V19V|ATP6V0A4_uc003vuh.2_Silent_p.V19V	p.V19V	NM_130841	NP_570856	WXS	Illumina HiSeq	Unspecified	Q9HBG4	VPP4_HUMAN			2	295	-			19			Cytoplasmic (Potential).		A4D1R4|A8KA80|Q32M47	Silent	SNP	ENST00000310018.2	37	c.57G>C	CCDS5849.1																																																																																				0.478	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632		45	263	0	0	0	0.013114	0	45	263				
TRBV2	28620	broad.mit.edu	37	7	142001010	142001010	+	RNA	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:142001010G>A	ENST00000455382.2	+	0	176									T cell receptor beta variable 2																		TCACACAGATGGGACAGGAAG	0.443																																							uc011kro.1		NA																	0					NA						c.(100-102)ATG>ATA		SubName: Full=V_segment translation product; Flags: Fragment;							40.0	39.0	39.0					7																	142001010		1940	4141	6081			0							g.chr7:142001010G>A	L36092		7q34	2012-02-07			ENSG00000226660	ENSG00000226660		"""T cell receptors / TRB locus"""	12195	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TCRBV22S1A2N1T, TCRBV2S1			OTTHUMG00000158532		7.37:g.142001010G>A			Somatic					p.M34I			WXS	Illumina HiSeq	Unspecified					2	147	+									Missense_Mutation	SNP	ENST00000455382.2	37	c.102G>A																																																																																					0.443	TRBV2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000351238.2	NG_001333		25	21	0	0	0	0.00278	0	25	21				
EPHB6	2051	broad.mit.edu	37	7	142566876	142566876	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:142566876G>T	ENST00000392957.2	+	16	3220	c.2433G>T	c.(2431-2433)gtG>gtT	p.V811V	EPHB6_ENST00000442129.1_Silent_p.V811V|EPHB6_ENST00000411471.2_Silent_p.V534V	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	811	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.V796V(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					TGTGCAAGGTGGCCCGTCTTG	0.637																																							uc011kst.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(2431-2433)GTG>GTT		ephrin receptor EphB6 precursor							65.0	56.0	59.0					7																	142566876		2203	4300	6503	SO:0001819	synonymous_variant	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142566876G>T	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2433G>T	7.37:g.142566876G>T			Somatic				EPHB6_uc011ksu.1_Silent_p.V811V|EPHB6_uc003wbs.2_Silent_p.V519V|EPHB6_uc003wbt.2_Silent_p.V285V|EPHB6_uc003wbu.2_Silent_p.V519V|EPHB6_uc003wbv.2_Silent_p.V195V	p.V811V	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			16	3220	+	Melanoma(164;0.059)		811			Cytoplasmic (Potential).|Protein kinase.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	c.2433G>T	CCDS5873.2																																																																																				0.637	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			41	22	1	0	2.00842e-17	0.010771	3.27334e-17	41	22				
KEL	3792	broad.mit.edu	37	7	142658913	142658913	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:142658913G>T	ENST00000355265.2	-	2	524	c.50C>A	c.(49-51)gCa>gAa	p.A17E	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	17					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.A17V(1)|p.A17E(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CATTCCACCTGCCTGGCTGCG	0.547																																							uc003wcb.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(3)|central_nervous_system(1)	4						c.(49-51)GCA>GAA		Kell blood group, metallo-endopeptidase							280.0	238.0	252.0					7																	142658913		2203	4300	6503	SO:0001583	missense	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142658913G>T	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.50C>A	7.37:g.142658913G>T	ENSP00000347409:p.Ala17Glu		Somatic					p.A17E	NM_000420	NP_000411	WXS	Illumina HiSeq	Unspecified	P23276	KELL_HUMAN			2	260	-	Melanoma(164;0.059)		17			Cytoplasmic (Potential).		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.50C>A	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427154	0.25726	.	.	ENSG00000197993	ENST00000355265;ENST00000476829	D;T	0.83075	-1.68;0.83	4.67	-0.861	0.10676	.	1.031460	0.07782	N	0.953499	T	0.59878	0.2226	N	0.08118	0	0.09310	N	1	B	0.26935	0.164	B	0.22601	0.04	T	0.46978	-0.9152	10	0.22706	T	0.39	0.8706	1.7361	0.02942	0.1847:0.3108:0.3554:0.1491	.	17	P23276	KELL_HUMAN	E	17	ENSP00000347409:A17E;ENSP00000419889:A17E	ENSP00000347409:A17E	A	-	2	0	KEL	142369035	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.175000	0.16762	-0.051000	0.13334	0.650000	0.86243	GCA		0.547	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		73	398	1	0	1.25089e-41	0.01441	2.29838e-41	73	398				
KRBA1	84626	broad.mit.edu	37	7	149421940	149421940	+	Splice_Site	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:149421940G>A	ENST00000485033.2	+	8	1126	c.1126G>A	c.(1126-1128)Gct>Act	p.A376T	KRBA1_ENST00000255992.10_Splice_Site_p.A376T|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Splice_Site_p.A376T			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	376								p.A376T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGAGGCTCAAGGTGAGGCCTG	0.642																																							uc003wfz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1126-1128)GCT>ACT		KRAB A domain containing 1							15.0	18.0	17.0					7																	149421940		1916	4124	6040	SO:0001630	splice_region_variant	84626							g.chr7:149421940G>A	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1126+1G>A	7.37:g.149421940G>A			Somatic				KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Missense_Mutation_p.A44T	p.A376T	NM_032534	NP_115923	WXS	Illumina HiSeq	Unspecified	A5PL33	KRBA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		9	1525	+	Melanoma(164;0.165)|Ovarian(565;0.177)		376					A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37	c.1126G>A		.	.	.	.	.	.	.	.	.	.	G	24.0	4.477912	0.84747	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.35789	1.3;1.29;1.29	4.26	3.38	0.38709	.	0.172978	0.28130	N	0.016492	T	0.30135	0.0755	L	0.34521	1.04	0.32427	N	0.548569	P;P	0.40332	0.713;0.713	B;B	0.43575	0.42;0.424	T	0.41770	-0.9490	10	0.56958	D	0.05	-6.2694	8.4769	0.33018	0.1119:0.0:0.8881:0.0	.	376;376	E7ENE9;A5PL33	.;KRBA1_HUMAN	T	376	ENSP00000255992:A376T;ENSP00000317165:A376T;ENSP00000420112:A376T	ENSP00000255992:A376T	A	+	1	0	KRBA1	149052873	1.000000	0.71417	0.935000	0.37517	0.539000	0.34962	2.517000	0.45529	1.104000	0.41587	0.655000	0.94253	GCT		0.642	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	Missense_Mutation	8	7	0	0	0	0.00308	0	8	7				
GIMAP8	155038	broad.mit.edu	37	7	150163991	150163991	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:150163991C>A	ENST00000307271.3	+	2	779	c.205C>A	c.(205-207)Ctt>Att	p.L69I		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	69	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.L69I(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CACCCCTGACCTTTTCTCCTC	0.488																																							uc003whj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(205-207)CTT>ATT		GTPase, IMAP family member 8							162.0	155.0	158.0					7																	150163991		2203	4300	6503	SO:0001583	missense	155038					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding	g.chr7:150163991C>A	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.205C>A	7.37:g.150163991C>A	ENSP00000305107:p.Leu69Ile		Somatic					p.L69I	NM_175571	NP_783161	WXS	Illumina HiSeq	Unspecified	Q8ND71	GIMA8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)	2	535	+			69						Missense_Mutation	SNP	ENST00000307271.3	37	c.205C>A	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.095944	0.36952	.	.	ENSG00000171115	ENST00000307271	T	0.10668	2.85	4.48	-0.961	0.10337	AIG1 (1);	0.000000	0.42548	D	0.000684	T	0.17109	0.0411	L	0.55213	1.73	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.16394	-1.0404	10	0.22706	T	0.39	.	2.7015	0.05149	0.4613:0.2927:0.1506:0.0954	.	69	Q8ND71	GIMA8_HUMAN	I	69	ENSP00000305107:L69I	ENSP00000305107:L69I	L	+	1	0	GIMAP8	149794924	0.000000	0.05858	0.744000	0.31058	0.837000	0.47467	-2.199000	0.01238	0.138000	0.18790	0.655000	0.94253	CTT		0.488	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		15	237	1	0	1.49906e-05	0.00245	1.74333e-05	15	237				
MICU3	286097	broad.mit.edu	37	8	16956024	16956024	+	Missense_Mutation	SNP	C	C	G	rs202243126		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:16956024C>G	ENST00000318063.5	+	9	988	c.946C>G	c.(946-948)Cgt>Ggt	p.R316G		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	316						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.R316G(1)									TACACTGAGACGTAACACAAG	0.388																																						Pancreas(177;1461 2846 10523 14242)|Colon(184;2703 2719 18484 23400)	uc003wxd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(946-948)CGT>GGT		EF-hand domain family, member A2							173.0	165.0	167.0					8																	16956024		2203	4300	6503	SO:0001583	missense	286097					integral to membrane	calcium ion binding	g.chr8:16956024C>G	BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.946C>G	8.37:g.16956024C>G	ENSP00000321455:p.Arg316Gly		Somatic					p.R316G	NM_181723	NP_859074	WXS	Illumina HiSeq	Unspecified	Q86XE3	EFHA2_HUMAN		Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)	9	988	+			316					Q8IYZ3	Missense_Mutation	SNP	ENST00000318063.5	37	c.946C>G	CCDS5999.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.30|15.30	2.794089|2.794089	0.50102|0.50102	.|.	.|.	ENSG00000155970|ENSG00000155970	ENST00000519044|ENST00000318063	.|T	.|0.49432	.|0.78	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46600|0.46600	0.1401|0.1401	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P	.|0.44380	.|0.834	.|B	.|0.43251	.|0.413	T|T	0.32322|0.32322	-0.9911|-0.9911	5|10	.|0.12766	.|T	.|0.61	-23.6797|-23.6797	19.208|19.208	0.93742|0.93742	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|316	.|Q86XE3	.|EFHA2_HUMAN	E|G	160|316	.|ENSP00000321455:R316G	.|ENSP00000321455:R316G	D|R	+|+	3|1	2|0	EFHA2|EFHA2	17000395|17000395	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.965000|0.965000	0.64279|0.64279	7.145000|7.145000	0.77365|0.77365	2.619000|2.619000	0.88677|0.88677	0.655000|0.655000	0.94253|0.94253	GAC|CGT		0.388	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723		59	94	0	0	0	0.01441	0	59	94				
ADAM2	2515	broad.mit.edu	37	8	39613420	39613420	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:39613420A>G	ENST00000265708.4	-	16	1727	c.1624T>C	c.(1624-1626)Tgc>Cgc	p.C542R	ADAM2_ENST00000347580.4_Missense_Mutation_p.C523R|AC136365.1_ENST00000408091.1_RNA|ADAM2_ENST00000521880.1_Intron|ADAM2_ENST00000379853.2_Intron	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	542	Cys-rich.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C542R(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AATTTTCCGCACTGCAGATTG	0.239																																							uc003xnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1624-1626)TGC>CGC		ADAM metallopeptidase domain 2 proprotein							40.0	45.0	43.0					8																	39613420		2199	4298	6497	SO:0001583	missense	2515				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:39613420A>G	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1624T>C	8.37:g.39613420A>G	ENSP00000265708:p.Cys542Arg		Somatic				ADAM2_uc003xnk.2_Missense_Mutation_p.C523R|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	p.C542R	NM_001464	NP_001455	WXS	Illumina HiSeq	Unspecified	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)	16	1699	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	542			Extracellular (Potential).|Cys-rich.		P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	c.1624T>C	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.612014	0.28712	.	.	ENSG00000104755	ENST00000347580;ENST00000265708	T;T	0.63580	-0.05;-0.05	4.8	4.8	0.61643	ADAM, cysteine-rich (2);	.	.	.	.	D	0.83142	0.5190	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86936	0.2076	8	.	.	.	.	11.0254	0.47743	1.0:0.0:0.0:0.0	.	523;542	Q99965-2;Q99965	.;ADAM2_HUMAN	R	523;542	ENSP00000343854:C523R;ENSP00000265708:C542R	.	C	-	1	0	ADAM2	39732577	0.986000	0.35501	0.802000	0.32245	0.023000	0.10783	3.652000	0.54439	1.909000	0.55274	0.533000	0.62120	TGC		0.239	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		14	215	0	0	0	0.00245	0	14	215				
ANK1	286	broad.mit.edu	37	8	41526069	41526069	+	Missense_Mutation	SNP	C	C	A	rs375339038		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:41526069C>A	ENST00000347528.4	-	39	5193	c.5110G>T	c.(5110-5112)Gat>Tat	p.D1704Y	ANK1_ENST00000379758.2_Missense_Mutation_p.D1704Y|ANK1_ENST00000396945.1_Missense_Mutation_p.D1704Y|ANK1_ENST00000396942.1_Missense_Mutation_p.D1704Y|ANK1_ENST00000289734.7_Missense_Mutation_p.D1704Y|ANK1_ENST00000352337.4_Missense_Mutation_p.D1704Y|RP11-930P14.1_ENST00000522388.1_RNA|ANK1_ENST00000265709.8_Missense_Mutation_p.D1745Y	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1704	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D1745Y(1)|p.D1704Y(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCGTCTGCATCCCAGTCCTGC	0.547																																							uc003xok.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(5110-5112)GAT>TAT		ankyrin 1 isoform 1							81.0	66.0	71.0					8																	41526069		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41526069C>A	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5110G>T	8.37:g.41526069C>A	ENSP00000339620:p.Asp1704Tyr		Somatic				NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.D858Y|ANK1_uc003xoi.2_Missense_Mutation_p.D1704Y|ANK1_uc003xoj.2_Missense_Mutation_p.D1704Y|ANK1_uc003xol.2_Missense_Mutation_p.D1542Y|ANK1_uc003xom.2_Missense_Mutation_p.D1745Y	p.D1704Y	NM_020476	NP_065209	WXS	Illumina HiSeq	Unspecified	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		39	5194	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	1704			55 kDa regulatory domain.		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.5110G>T	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.411|9.411	1.080429|1.080429	0.20309|0.20309	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709|ENST00000520299	T;T;T;T;T;T;T|.	0.65364|.	-0.15;-0.15;-0.13;-0.11;-0.13;-0.09;-0.15|.	4.22|4.22	2.37|2.37	0.29283|0.29283	.|.	0.759371|.	0.12182|.	N|.	0.492034|.	T|T	0.33847|0.33847	0.0877|0.0877	L|L	0.29908|0.29908	0.895|0.895	0.34156|0.34156	D|D	0.668092|0.668092	B;B;B;B;B;B|.	0.06786|.	0.001;0.0;0.001;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.09377|.	0.004;0.001;0.001;0.001;0.002;0.0|.	T|T	0.37798|0.37798	-0.9690|-0.9690	10|5	0.44086|.	T|.	0.13|.	.|.	3.6871|3.6871	0.08332|0.08332	0.1946:0.5899:0.0:0.2155|0.1946:0.5899:0.0:0.2155	.|.	1745;1542;1704;1704;1704;858|.	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39|.	.;.;ANK1_HUMAN;.;.;.|.	Y|V	1704;1704;1704;1704;1704;1704;1745|863	ENSP00000339620:D1704Y;ENSP00000289734:D1704Y;ENSP00000369082:D1704Y;ENSP00000380149:D1704Y;ENSP00000380147:D1704Y;ENSP00000309131:D1704Y;ENSP00000265709:D1745Y|.	ENSP00000265709:D1745Y|.	D|G	-|-	1|2	0|0	ANK1|ANK1	41645226|41645226	1.000000|1.000000	0.71417|0.71417	0.879000|0.879000	0.34478|0.34478	0.361000|0.361000	0.29550|0.29550	0.915000|0.915000	0.28638|0.28638	0.530000|0.530000	0.28619|0.28619	0.462000|0.462000	0.41574|0.41574	GAT|GGA		0.547	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		16	60	1	0	1.15088e-07	0.004007	1.47225e-07	16	60				
PREX2	80243	broad.mit.edu	37	8	69046421	69046421	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:69046421G>T	ENST00000288368.4	+	32	4171	c.3894G>T	c.(3892-3894)atG>atT	p.M1298I		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1298					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.M1298I(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAAATGAGATGGAAACTTGGG	0.488																																							uc003xxv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(3892-3894)ATG>ATT		DEP domain containing 2 isoform a							110.0	102.0	105.0					8																	69046421		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:69046421G>T	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3894G>T	8.37:g.69046421G>T	ENSP00000288368:p.Met1298Ile		Somatic					p.M1298I	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			32	3921	+			1298					B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.3894G>T	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.510244	0.44660	.	.	ENSG00000046889	ENST00000288368	T	0.44482	0.92	5.42	5.42	0.78866	.	0.174811	0.51477	D	0.000090	T	0.34279	0.0892	N	0.19112	0.55	0.39486	D	0.967967	B	0.15141	0.012	B	0.23275	0.045	T	0.12344	-1.0551	10	0.46703	T	0.11	.	19.2126	0.93763	0.0:0.0:1.0:0.0	.	1298	Q70Z35	PREX2_HUMAN	I	1298	ENSP00000288368:M1298I	ENSP00000288368:M1298I	M	+	3	0	PREX2	69208975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.352000	0.52239	2.559000	0.86315	0.655000	0.94253	ATG		0.488	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		33	67	1	0	5.91797e-21	0.012213	9.85843e-21	33	67				
TRAM1	23471	broad.mit.edu	37	8	71495976	71495976	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:71495976G>A	ENST00000262213.2	-	9	968	c.799C>T	c.(799-801)Ctt>Ttt	p.L267F	TRAM1_ENST00000521425.1_Missense_Mutation_p.L181F|TRAM1_ENST00000521049.1_5'UTR|TRAM1_ENST00000536748.1_Missense_Mutation_p.L236F	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	267	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L267F(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			AGTACTGAAAGAATTAAAGTC	0.388																																					Ovarian(85;984 1334 5116 12432 40638)	Ovarian(85;984 1334 5116 12432 40638)	uc003xyo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(799-801)CTT>TTT		translocation associated membrane protein 1							113.0	122.0	119.0					8																	71495976		2203	4300	6503	SO:0001583	missense	23471				cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity	g.chr8:71495976G>A	X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.799C>T	8.37:g.71495976G>A	ENSP00000262213:p.Leu267Phe		Somatic				TRAM1_uc011lfc.1_Missense_Mutation_p.L236F	p.L267F	NM_014294	NP_055109	WXS	Illumina HiSeq	Unspecified	Q15629	TRAM1_HUMAN	Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)		9	969	-			267			Helical; (Potential).|TLC.		B4E0K2	Missense_Mutation	SNP	ENST00000262213.2	37	c.799C>T	CCDS6207.1	.	.	.	.	.	.	.	.	.	.	G	30	5.052605	0.93793	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	T;T;T	0.54675	0.56;1.2;1.18	5.4	5.4	0.78164	TRAM/LAG1/CLN8 homology domain (3);	0.269944	0.36854	N	0.002372	T	0.75466	0.3853	M	0.85777	2.775	0.80722	D	1	D	0.60575	0.988	D	0.67900	0.954	T	0.76645	-0.2883	10	0.42905	T	0.14	-13.2396	19.1656	0.93555	0.0:0.0:1.0:0.0	.	267	Q15629	TRAM1_HUMAN	F	181;267;236	ENSP00000428052:L181F;ENSP00000262213:L267F;ENSP00000439359:L236F	ENSP00000262213:L267F	L	-	1	0	TRAM1	71658530	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.723000	0.98772	2.539000	0.85634	0.557000	0.71058	CTT		0.388	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1	NM_014294		46	104	0	0	0	0.01441	0	46	104				
TCEB1	6921	broad.mit.edu	37	8	74868148	74868148	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:74868148G>T	ENST00000522337.1	-	4	465	c.146C>A	c.(145-147)cCa>cAa	p.P49Q	TCEB1_ENST00000523815.1_Missense_Mutation_p.P49Q|TCEB1_ENST00000520210.1_Missense_Mutation_p.P33Q|TCEB1_ENST00000284811.8_Missense_Mutation_p.P49Q|TCEB1_ENST00000602840.1_Missense_Mutation_p.P49Q|TCEB1_ENST00000519487.1_Missense_Mutation_p.P49Q|TCEB1_ENST00000520242.1_Missense_Mutation_p.P49Q|TCEB1_ENST00000518127.1_Missense_Mutation_p.P49Q			Q15369	ELOC_HUMAN	transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)	49					cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.P49Q(1)		endometrium(2)|kidney(3)|lung(1)|prostate(1)	7	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			GTGCTTACCTGGGCCACTCAA	0.323																																							uc003xzx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(145-147)CCA>CAA		elongin C							71.0	66.0	68.0					8																	74868148		2203	4300	6503	SO:0001583	missense	6921				interspecies interaction between organisms|positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm	protein binding	g.chr8:74868148G>T	L34587	CCDS34910.1, CCDS56539.1	8q13.3	2010-04-21	2002-08-29		ENSG00000154582	ENSG00000154582			11617	protein-coding gene	gene with protein product		600788	"""transcription elongation factor B (SIII), polypeptide 1 (15kD, elongin C)"""			7821821, 7660122	Standard	NM_005648		Approved	SIII	uc003xzx.2	Q15369	OTTHUMG00000164501	ENST00000522337.1:c.146C>A	8.37:g.74868148G>T	ENSP00000429906:p.Pro49Gln		Somatic				TCEB1_uc003xzy.1_Missense_Mutation_p.P49Q|TCEB1_uc003xzz.1_Missense_Mutation_p.P33Q|TCEB1_uc003yaa.1_Missense_Mutation_p.P49Q	p.P49Q	NM_005648	NP_005639	WXS	Illumina HiSeq	Unspecified	Q15369	ELOC_HUMAN	Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)		3	231	-	Breast(64;0.0311)		49					E5RGD9|Q567Q6	Missense_Mutation	SNP	ENST00000522337.1	37	c.146C>A	CCDS34910.1	.	.	.	.	.	.	.	.	.	.	g	27.5	4.835268	0.91117	.	.	ENSG00000154582	ENST00000518127;ENST00000520210;ENST00000520242;ENST00000519487;ENST00000284811;ENST00000522337;ENST00000523815;ENST00000519082;ENST00000519021	T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.56	5.56	0.83823	BTB/POZ fold (2);SKP1 component, POZ (1);	0.000000	0.64402	D	0.000002	T	0.65903	0.2736	M	0.74881	2.28	0.80722	D	1	P	0.48350	0.909	P	0.55222	0.771	T	0.67741	-0.5592	10	0.59425	D	0.04	-3.9686	19.5334	0.95239	0.0:0.0:1.0:0.0	.	49	Q15369	ELOC_HUMAN	Q	49;33;49;49;49;49;49;49;49	ENSP00000428334:P49Q;ENSP00000430224:P33Q;ENSP00000428171:P49Q;ENSP00000429596:P49Q;ENSP00000284811:P49Q;ENSP00000429906:P49Q;ENSP00000428074:P49Q;ENSP00000429789:P49Q	ENSP00000284811:P49Q	P	-	2	0	TCEB1	75030702	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.354000	0.79424	2.616000	0.88540	0.650000	0.86243	CCA		0.323	TCEB1-010	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000379020.1	NM_005648		26	56	1	0	1.75199e-13	0.007291	2.6164e-13	26	56				
ZFHX4	79776	broad.mit.edu	37	8	77763493	77763493	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:77763493G>A	ENST00000521891.2	+	10	4784	c.4336G>A	c.(4336-4338)Gca>Aca	p.A1446T	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A1401T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A1401T|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A1420T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.A1446T(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACACTTGGAAGCAGGCCACCC	0.493										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4201-4203)GCA>ACA		zinc finger homeodomain 4							41.0	39.0	40.0					8																	77763493		1956	4157	6113	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77763493G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4336G>A	8.37:g.77763493G>A	ENSP00000430497:p.Ala1446Thr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.A1446T|ZFHX4_uc003yaw.1_Missense_Mutation_p.A1401T	p.A1401T	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	4588	+			1401			C2H2-type 11.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4201G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910408	0.52439	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.42513	0.97;1.0;0.97;0.97	5.01	5.01	0.66863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.44097	U	0.000485	T	0.12347	0.0300	N	0.00707	-1.245	0.31723	N	0.637993	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.004;0.003;0.002	T	0.13656	-1.0501	10	0.02654	T	1	.	11.9582	0.52993	0.0791:0.0:0.9209:0.0	.	1401;1401;1446	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	T	1446;1446;1401;1401;1420	ENSP00000430497:A1446T;ENSP00000399605:A1401T;ENSP00000050961:A1401T;ENSP00000430848:A1420T	ENSP00000050961:A1401T	A	+	1	0	ZFHX4	77926048	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.270000	0.78493	2.625000	0.88918	0.549000	0.68633	GCA		0.493	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		16	28	0	0	0	0.004007	0	16	28				
SLC26A7	115111	broad.mit.edu	37	8	92406044	92406044	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:92406044G>T	ENST00000276609.3	+	17	2035	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	SLC26A7_ENST00000523719.1_Missense_Mutation_p.G599V|SLC26A7_ENST00000309536.2_Missense_Mutation_p.G599V|SLC26A7_ENST00000520249.1_3'UTR	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.G599V(2)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			GACTGTAAAGGCAGGAGTGTG	0.383																																							uc003yex.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1795-1797)GGC>GTC		solute carrier family 26, member 7 isoform a							209.0	196.0	201.0					8																	92406044		2203	4300	6503	SO:0001583	missense	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92406044G>T	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1796G>T	8.37:g.92406044G>T	ENSP00000276609:p.Gly599Val		Somatic				SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.G599V|SLC26A7_uc003yfa.2_Missense_Mutation_p.G599V	p.G599V	NM_052832	NP_439897	WXS	Illumina HiSeq	Unspecified	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		18	2074	+			599			STAS.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000276609.3	37	c.1796G>T	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416186	0.25552	.	.	ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536	D;D;D	0.87809	-2.3;-2.3;-2.3	5.39	-10.8	0.00216	Sulphate transporter/antisigma-factor antagonist STAS (4);	1.445460	0.04118	N	0.315858	T	0.76278	0.3965	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.19935	0.032;0.04	B;B	0.19666	0.015;0.026	T	0.62959	-0.6743	10	0.38643	T	0.18	.	9.1217	0.36791	0.6834:0.0827:0.1506:0.0832	.	599;599	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	V	599	ENSP00000428849:G599V;ENSP00000276609:G599V;ENSP00000309504:G599V	ENSP00000276609:G599V	G	+	2	0	SLC26A7	92475220	0.000000	0.05858	0.000000	0.03702	0.846000	0.48090	-1.725000	0.01863	-2.794000	0.00355	-0.262000	0.10625	GGC		0.383	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			38	94	1	0	2.66277e-13	0.006999	3.95911e-13	38	94				
RBM12B	389677	broad.mit.edu	37	8	94747803	94747803	+	Missense_Mutation	SNP	C	C	A	rs201307950		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:94747803C>A	ENST00000399300.2	-	3	1049	c.836G>T	c.(835-837)cGt>cTt	p.R279L	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.R279L|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	279							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R279L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAGAGGGGAACGAGAACGTGT	0.368																																							uc003yfz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(835-837)CGT>CTT		RNA binding motif protein 12B							90.0	84.0	86.0					8																	94747803		1824	4090	5914	SO:0001583	missense	389677						nucleotide binding|RNA binding	g.chr8:94747803C>A		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.836G>T	8.37:g.94747803C>A	ENSP00000382239:p.Arg279Leu		Somatic					p.R279L	NM_203390	NP_976324	WXS	Illumina HiSeq	Unspecified	Q8IXT5	RB12B_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0168)		3	1029	-	Breast(36;4.14e-07)		279					A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	c.836G>T	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932513	0.52866	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.29142	1.58;1.58	5.36	4.45	0.53987	Nucleotide-binding, alpha-beta plait (1);	0.194755	0.37906	N	0.001897	T	0.45216	0.1331	L	0.52573	1.65	0.42527	D	0.993023	D	0.89917	1.0	D	0.66847	0.947	T	0.42275	-0.9461	10	0.66056	D	0.02	-12.0738	9.78	0.40643	0.1409:0.784:0.0:0.0751	.	279	Q8IXT5	RB12B_HUMAN	L	279	ENSP00000382239:R279L;ENSP00000427729:R279L	ENSP00000382239:R279L	R	-	2	0	RBM12B	94816979	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.652000	0.46682	1.323000	0.45263	0.591000	0.81541	CGT		0.368	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		36	67	1	0	2.42023e-17	0.003271	3.91627e-17	36	67				
VPS13B	157680	broad.mit.edu	37	8	100182372	100182372	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:100182372C>T	ENST00000358544.2	+	16	2425	c.2314C>T	c.(2314-2316)Ctg>Ttg	p.L772L	VPS13B_ENST00000395996.1_Silent_p.L772L|VPS13B_ENST00000355155.1_Silent_p.L772L|VPS13B_ENST00000357162.2_Silent_p.L772L|VPS13B_ENST00000521932.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	772					protein transport (GO:0015031)			p.L772L(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGGGAAACTTCTGAAACTCCC	0.403																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(2314-2316)CTG>TTG		vacuolar protein sorting 13B isoform 5							118.0	102.0	107.0					8																	100182372		2203	4299	6502	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100182372C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2314C>T	8.37:g.100182372C>T			Somatic				VPS13B_uc003yiw.2_Silent_p.L772L|VPS13B_uc003yit.2_Silent_p.L772L|VPS13B_uc003yiu.1_Silent_p.L772L|VPS13B_uc003yix.1_Silent_p.L243L	p.L772L	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		16	2425	+	Breast(36;3.73e-07)		772					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.2314C>T	CCDS6280.1																																																																																				0.403	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		10	51	0	0	0	0.008291	0	10	51				
RIMS2	9699	broad.mit.edu	37	8	105001577	105001577	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:105001577G>A	ENST00000436393.2	+	15	2547	c.2306G>A	c.(2305-2307)gGa>gAa	p.G769E	RIMS2_ENST00000262231.10_Missense_Mutation_p.G830E|RIMS2_ENST00000406091.3_Missense_Mutation_p.G991E|RIMS2_ENST00000507740.1_Missense_Mutation_p.G783E			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1053					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.G783E(2)|p.G991E(1)|p.G769E(1)|p.G1058E(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACTATGACCGGACATTATAAT	0.383										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(2305-2307)GGA>GAA		regulating synaptic membrane exocytosis 2							127.0	125.0	126.0					8																	105001577		1867	4096	5963	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105001577G>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2306G>A	8.37:g.105001577G>A	ENSP00000390665:p.Gly769Glu	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Missense_Mutation_p.G991E|RIMS2_uc003ylw.2_Missense_Mutation_p.G783E|RIMS2_uc003ylq.2_Missense_Mutation_p.G783E|RIMS2_uc003ylr.2_Missense_Mutation_p.G830E	p.G769E	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		15	2547	+			1053					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.2306G>A		.	.	.	.	.	.	.	.	.	.	G	11.27	1.589078	0.28357	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.16196	2.36;2.84;2.52;2.51;2.43;2.84	5.54	5.54	0.83059	.	.	.	.	.	T	0.08846	0.0219	N	0.03608	-0.345	0.80722	D	1	B;B;B;B;B	0.12630	0.002;0.005;0.004;0.0;0.006	B;B;B;B;B	0.11329	0.002;0.004;0.006;0.002;0.004	T	0.28170	-1.0052	9	0.33940	T	0.23	.	13.8177	0.63301	0.0:0.2725:0.7275:0.0	.	1053;769;830;783;991	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	E	991;1006;991;1053;830;783;783;769	ENSP00000427018:G991E;ENSP00000384892:G991E;ENSP00000262231:G830E;ENSP00000423559:G783E;ENSP00000386228:G783E;ENSP00000390665:G769E	ENSP00000262231:G830E	G	+	2	0	RIMS2	105070753	1.000000	0.71417	0.976000	0.42696	0.418000	0.31294	4.193000	0.58385	2.617000	0.88574	0.484000	0.47621	GGA		0.383	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		23	72	0	0	0	0.00278	0	23	72				
TRHR	7201	broad.mit.edu	37	8	110131489	110131489	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:110131489C>T	ENST00000518632.1	+	3	1353	c.1002C>T	c.(1000-1002)ctC>ctT	p.L334L	TRHR_ENST00000311762.2_Silent_p.L334L			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	334					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)	p.L334L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TCAGAAAGCTCTGCAACTGCA	0.453																																							uc003ymz.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|lung(1)	3						c.(1000-1002)CTC>CTT		thyrotropin-releasing hormone receptor							165.0	161.0	162.0					8																	110131489		2203	4299	6502	SO:0001819	synonymous_variant	7201					integral to plasma membrane	thyrotropin-releasing hormone receptor activity	g.chr8:110131489C>T		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.1002C>T	8.37:g.110131489C>T			Somatic					p.L334L	NM_003301	NP_003292	WXS	Illumina HiSeq	Unspecified	P34981	TRFR_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)		2	1018	+			334			Cytoplasmic (Potential).		Q2M339	Silent	SNP	ENST00000518632.1	37	c.1002C>T	CCDS6311.1																																																																																				0.453	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1			68	153	0	0	0	0.01441	0	68	153				
CSMD3	114788	broad.mit.edu	37	8	113348921	113348921	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:113348921C>G	ENST00000297405.5	-	44	7223	c.6979G>C	c.(6979-6981)Gtc>Ctc	p.V2327L	CSMD3_ENST00000455883.2_Missense_Mutation_p.V2223L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V2257L|CSMD3_ENST00000343508.3_Missense_Mutation_p.V2287L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2327	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V2327L(1)|p.V2287L(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTTTGAAGGACAGTAAAATTG	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(6979-6981)GTC>CTC		CUB and Sushi multiple domains 3 isoform 1							117.0	117.0	117.0					8																	113348921		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113348921C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6979G>C	8.37:g.113348921C>G	ENSP00000297405:p.Val2327Leu	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.V1529L|CSMD3_uc003ynt.2_Missense_Mutation_p.V2287L|CSMD3_uc011lhx.1_Missense_Mutation_p.V2223L|CSMD3_uc003ynw.1_Missense_Mutation_p.V38L	p.V2327L	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			44	7138	-			2327			Extracellular (Potential).|CUB 13.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.6979G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365754	0.41902	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000005	T	0.20618	0.0496	N	0.08118	0	0.58432	D	0.999999	D;D;B	0.64830	0.994;0.99;0.026	D;D;B	0.74348	0.975;0.983;0.043	T	0.02365	-1.1170	10	0.05351	T	0.99	.	19.8946	0.96949	0.0:1.0:0.0:0.0	.	2223;2327;2287	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	2287;2327;1597;2223;2257	ENSP00000345799:V2287L;ENSP00000297405:V2327L;ENSP00000341558:V1597L;ENSP00000412263:V2223L;ENSP00000343124:V2257L	ENSP00000297405:V2327L	V	-	1	0	CSMD3	113418097	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.802000	0.55553	2.937000	0.99478	0.650000	0.86243	GTC		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		48	132	0	0	0	0.01441	0	48	132				
CSMD3	114788	broad.mit.edu	37	8	113364763	113364763	+	Splice_Site	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:113364763G>T	ENST00000297405.5	-	39	6381	c.6137C>A	c.(6136-6138)gCa>gAa	p.A2046E	CSMD3_ENST00000455883.2_Splice_Site_p.A1942E|CSMD3_ENST00000352409.3_Splice_Site_p.A1976E|CSMD3_ENST00000343508.3_Splice_Site_p.A2006E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2046	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A2006E(1)|p.A2046E(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAAACCAATTGCTAAGAATAT	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(6136-6138)GCA>GAA		CUB and Sushi multiple domains 3 isoform 1							86.0	86.0	86.0					8																	113364763		2203	4300	6503	SO:0001630	splice_region_variant	114788					integral to membrane|plasma membrane		g.chr8:113364763G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6137-1C>A	8.37:g.113364763G>T		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.A1248E|CSMD3_uc003ynt.2_Missense_Mutation_p.A2006E|CSMD3_uc011lhx.1_Missense_Mutation_p.A1942E	p.A2046E	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			39	6296	-			2046			Extracellular (Potential).|CUB 11.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.6137C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205407	0.79127	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	4.82	4.82	0.62117	CUB (4);	0.000000	0.64402	D	0.000001	T	0.31918	0.0812	L	0.45051	1.395	0.80722	D	1	B;B;B	0.21606	0.058;0.004;0.016	B;B;B	0.29663	0.105;0.013;0.017	T	0.06445	-1.0826	10	0.33141	T	0.24	.	18.4564	0.90722	0.0:0.0:1.0:0.0	.	1942;2046;2006	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	2006;2046;1316;1942;1976	ENSP00000345799:A2006E;ENSP00000297405:A2046E;ENSP00000341558:A1316E;ENSP00000412263:A1942E;ENSP00000343124:A1976E	ENSP00000297405:A2046E	A	-	2	0	CSMD3	113433939	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.576000	0.98192	2.666000	0.90696	0.650000	0.86243	GCA		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Missense_Mutation	48	79	1	0	8.30282e-39	0.01441	1.51733e-38	48	79				
CSMD3	114788	broad.mit.edu	37	8	113484937	113484937	+	Splice_Site	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:113484937C>A	ENST00000297405.5	-	32	5523		c.e32-1		CSMD3_ENST00000455883.2_Splice_Site|AC024996.1_ENST00000582664.1_RNA|CSMD3_ENST00000352409.3_Splice_Site|CSMD3_ENST00000343508.3_Splice_Site	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCACAGGGCGCTAGGAAAAAA	0.313										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Unknown(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.e32-1		CUB and Sushi multiple domains 3 isoform 1							67.0	67.0	67.0					8																	113484937		2203	4300	6503	SO:0001630	splice_region_variant	114788					integral to membrane|plasma membrane		g.chr8:113484937C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5279-1G>T	8.37:g.113484937C>A		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Splice_Site_p.A1032_splice|CSMD3_uc003ynt.2_Splice_Site_p.A1720_splice|CSMD3_uc011lhx.1_Splice_Site_p.A1656_splice	p.A1760_splice	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			32	5438	-								Q96PZ3	Splice_Site	SNP	ENST00000297405.5	37	c.5279_splice	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988777	0.74589	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2401	0.89965	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSMD3	113554113	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	7.289000	0.78701	2.630000	0.89119	0.591000	0.81541	.		0.313	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Intron	21	43	1	0	1.87028e-06	0.012319	2.28067e-06	21	43				
SNTB1	6641	broad.mit.edu	37	8	121706136	121706136	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:121706136C>G	ENST00000395601.3	-	3	998	c.584G>C	c.(583-585)cGa>cCa	p.R195P	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.R195P	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	195	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)		p.R195L(1)|p.R195P(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGTGGCTTCTCGCATGTACTT	0.483																																							uc010mdg.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)	5						c.(583-585)CGA>CCA		basic beta 1 syntrophin							75.0	79.0	78.0					8																	121706136		2203	4300	6503	SO:0001583	missense	6641				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding	g.chr8:121706136C>G	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.584G>C	8.37:g.121706136C>G	ENSP00000378965:p.Arg195Pro		Somatic				SNTB1_uc003ype.2_Missense_Mutation_p.R195P	p.R195P	NM_021021	NP_066301	WXS	Illumina HiSeq	Unspecified	Q13884	SNTB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		2	810	-	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		195			PH 1.|PDZ.		A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	ENST00000395601.3	37	c.584G>C	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772771	0.90108	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.59224	0.28;0.28	5.44	5.44	0.79542	PDZ/DHR/GLGF (3);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.67353	0.2884	L	0.31664	0.95	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.988;0.999	T	0.64542	-0.6383	10	0.37606	T	0.19	.	19.443	0.94831	0.0:1.0:0.0:0.0	.	195;195	Q13884;Q13884-2	SNTB1_HUMAN;.	P	195	ENSP00000378965:R195P;ENSP00000431124:R195P	ENSP00000378965:R195P	R	-	2	0	SNTB1	121775317	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.016000	0.76393	2.814000	0.96858	0.655000	0.94253	CGA		0.483	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021		49	65	0	0	0	0.01441	0	49	65				
HAS2	3037	broad.mit.edu	37	8	122626567	122626567	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:122626567C>A	ENST00000303924.4	-	4	1978	c.1441G>T	c.(1441-1443)Gta>Tta	p.V481L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	481					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.V481L(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CAAACTGATACTGGAATGAGT	0.398																																							uc003yph.2		NA																HAS2/PLAG1(10)	1	Substitution - Missense(1)		lung(1)	soft_tissue(10)|ovary(5)	15						c.(1441-1443)GTA>TTA		hyaluronan synthase 2							112.0	112.0	112.0					8																	122626567		2203	4300	6503	SO:0001583	missense	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122626567C>A	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1441G>T	8.37:g.122626567C>A	ENSP00000306991:p.Val481Leu		Somatic					p.V481L	NM_005328	NP_005319	WXS	Illumina HiSeq	Unspecified	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		4	1979	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		481			Helical; Name=6; (Potential).		Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	c.1441G>T	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	C	1.858	-0.463349	0.04476	.	.	ENSG00000170961	ENST00000303924	T	0.38722	1.12	6.06	6.06	0.98353	.	0.049921	0.85682	D	0.000000	T	0.21022	0.0506	N	0.08118	0	0.53005	D	0.999967	B	0.02656	0.0	B	0.04013	0.001	T	0.11665	-1.0578	10	0.02654	T	1	-19.7122	13.7717	0.63029	0.0:0.9303:0.0:0.0697	.	481	Q92819	HAS2_HUMAN	L	481	ENSP00000306991:V481L	ENSP00000306991:V481L	V	-	1	0	HAS2	122695748	1.000000	0.71417	0.996000	0.52242	0.956000	0.61745	4.687000	0.61708	2.882000	0.98803	0.655000	0.94253	GTA		0.398	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		41	89	1	0	5.73237e-09	0.00623	7.74212e-09	41	89				
WISP1	8840	broad.mit.edu	37	8	134225219	134225219	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:134225219G>A	ENST00000250160.6	+	2	288	c.182G>A	c.(181-183)cGc>cAc	p.R61H	WISP1_ENST00000517423.1_Missense_Mutation_p.R61H|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.R61H	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	61	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.R61H(3)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TCCCCACCCCGCTGCCCGCTG	0.627																																							uc003yub.2		NA																	3	Substitution - Missense(3)		upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	central_nervous_system(1)|kidney(1)	2						c.(181-183)CGC>CAC		WNT1 inducible signaling pathway protein 1							36.0	36.0	36.0					8																	134225219		2203	4300	6503	SO:0001583	missense	8840				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding	g.chr8:134225219G>A	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.182G>A	8.37:g.134225219G>A	ENSP00000250160:p.Arg61His		Somatic				WISP1_uc003yuc.2_Missense_Mutation_p.R61H|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Missense_Mutation_p.R61H|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_5'Flank	p.R61H	NM_003882	NP_003873	WXS	Illumina HiSeq	Unspecified	O95388	WISP1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0107)		2	258	+	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		61			IGFBP N-terminal.		A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	c.182G>A	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030189	0.54790	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.58940	0.3;0.3;0.3	5.13	4.25	0.50352	Insulin-like growth factor-binding protein, IGFBP (3);	0.381335	0.29403	N	0.012256	T	0.41073	0.1143	L	0.46885	1.475	0.80722	D	1	B;P;P	0.40578	0.274;0.675;0.722	B;B;B	0.31946	0.045;0.085;0.138	T	0.22556	-1.0213	10	0.14252	T	0.57	-12.8409	8.5022	0.33165	0.0818:0.1535:0.7646:0.0	.	61;61;61	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	H	61	ENSP00000250160:R61H;ENSP00000427744:R61H;ENSP00000220856:R61H	ENSP00000220856:R61H	R	+	2	0	WISP1	134294401	0.996000	0.38824	1.000000	0.80357	0.937000	0.57800	1.178000	0.31981	1.170000	0.42753	0.549000	0.68633	CGC		0.627	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882		13	28	0	0	0	0.003163	0	13	28				
GML	2765	broad.mit.edu	37	8	143928046	143928046	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:143928046G>T	ENST00000220940.1	+	4	507	c.417G>T	c.(415-417)ctG>ctT	p.L139L		NM_002066.2	NP_002057.1	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule like	139					apoptotic process (GO:0006915)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of cell proliferation (GO:0008285)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)		p.L139L(1)		NS(1)|central_nervous_system(2)|endometrium(1)|large_intestine(6)|lung(8)	18	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTGTGAGGCTGGGGGTATCAA	0.478																																							uc003yxg.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(415-417)CTG>CTT		glycosylphosphatidylinositol anchored molecule							107.0	103.0	104.0					8																	143928046		2203	4300	6503	SO:0001819	synonymous_variant	2765				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|negative regulation of cell proliferation	anchored to membrane|extrinsic to membrane|plasma membrane		g.chr8:143928046G>T	D84290	CCDS6391.1	8q24.3	2014-05-14	2012-11-02						4375	protein-coding gene	gene with protein product		602370	"""GPI anchored molecule like protein"", ""glycosylphosphatidylinositol anchored molecule like protein"""			8934543, 9169150	Standard	NM_002066		Approved	LY6DL	uc003yxg.3	Q99445		ENST00000220940.1:c.417G>T	8.37:g.143928046G>T			Somatic					p.L139L	NM_002066	NP_002057	WXS	Illumina HiSeq	Unspecified	Q99445	GML_HUMAN			4	507	+	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		139					A0AVF6|O00686|O00731	Silent	SNP	ENST00000220940.1	37	c.417G>T	CCDS6391.1																																																																																				0.478	GML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379659.1	NM_002066		37	55	1	0	1.60099e-16	0.004878	2.56007e-16	37	55				
CYP11B1	1584	broad.mit.edu	37	8	143957731	143957731	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:143957731G>T	ENST00000292427.4	-	5	912	c.880C>A	c.(880-882)Ctg>Atg	p.L294M	CYP11B1_ENST00000377675.3_Missense_Mutation_p.L365M|CYP11B1_ENST00000517471.1_Missense_Mutation_p.L294M	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	294					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.L294M(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GCATTCAACAGGAGCTCCGCC	0.597									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(880-882)CTG>ATG		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						129.0	106.0	114.0					8																	143957731		2203	4300	6503	SO:0001583	missense	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143957731G>T	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.880C>A	8.37:g.143957731G>T	ENSP00000292427:p.Leu294Met		Somatic				CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_Translation_Start_Site|CYP11B1_uc003yxj.2_Missense_Mutation_p.L294M|CYP11B1_uc010mey.2_Missense_Mutation_p.L365M	p.L294M	NM_000497	NP_000488	WXS	Illumina HiSeq	Unspecified	P15538	C11B1_HUMAN			5	887	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		294					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	c.880C>A	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	8.270	0.813210	0.16537	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.73047	-0.71;-0.5;-0.71	4.1	0.788	0.18601	.	0.638474	0.12672	N	0.448650	T	0.58438	0.2122	L	0.41356	1.27	0.27802	N	0.942452	B;B;P	0.35468	0.45;0.45;0.503	B;B;B	0.39805	0.264;0.31;0.159	T	0.53767	-0.8392	10	0.51188	T	0.08	.	2.4185	0.04442	0.1024:0.1667:0.4147:0.3162	.	365;294;294	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	M	294;294;365	ENSP00000292427:L294M;ENSP00000428043:L294M;ENSP00000366903:L365M	ENSP00000292427:L294M	L	-	1	2	CYP11B1	143954733	0.974000	0.33945	0.106000	0.21319	0.004000	0.04260	1.689000	0.37700	0.251000	0.21505	-0.188000	0.12872	CTG		0.597	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			15	27	1	0	0.00316338	0.003163	0.00342069	15	27				
CPSF1	29894	broad.mit.edu	37	8	145622835	145622835	+	Missense_Mutation	SNP	G	G	A	rs576268637		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:145622835G>A	ENST00000349769.3	-	22	2346	c.2252C>T	c.(2251-2253)tCg>tTg	p.S751L	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	751					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)	p.S751L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GAGGGAGCCCGAATCCCCATA	0.677													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15486	0.0		0.0	False		,,,				2504	0.0				NSCLC(133;1088 1848 27708 34777 35269)	NSCLC(133;1088 1848 27708 34777 35269)	uc003zcj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2251-2253)TCG>TTG		cleavage and polyadenylation specific factor 1,							54.0	62.0	59.0					8																	145622835		2202	4299	6501	SO:0001583	missense	29894				mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding	g.chr8:145622835G>A	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2252C>T	8.37:g.145622835G>A	ENSP00000339353:p.Ser751Leu		Somatic					p.S751L	NM_013291	NP_037423	WXS	Illumina HiSeq	Unspecified	Q10570	CPSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)		22	2327	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		751					Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	c.2252C>T	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058653	0.76074	.	.	ENSG00000071894	ENST00000349769	T	0.29142	1.58	5.4	5.4	0.78164	.	0.067227	0.64402	N	0.000007	T	0.34221	0.0890	L	0.58101	1.795	0.80722	D	1	P	0.48764	0.915	B	0.41135	0.348	T	0.26538	-1.0100	10	0.66056	D	0.02	-7.4191	16.6317	0.85035	0.0:0.0:1.0:0.0	.	751	Q10570	CPSF1_HUMAN	L	751	ENSP00000339353:S751L	ENSP00000339353:S751L	S	-	2	0	CPSF1	145593643	1.000000	0.71417	0.950000	0.38849	0.768000	0.43524	5.659000	0.68010	2.538000	0.85594	0.491000	0.48974	TCG		0.677	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291		17	75	0	0	0	0.00499	0	17	75				
ZNF34	80778	broad.mit.edu	37	8	145998963	145998963	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr8:145998963G>C	ENST00000343459.4	-	6	1436	c.1371C>G	c.(1369-1371)agC>agG	p.S457R	ZNF34_ENST00000429371.2_Missense_Mutation_p.S436R			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S457R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		GTGTGCTTTGGCTGAAAACTT	0.488																																							uc003zdy.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1369-1371)AGC>AGG		zinc finger protein 34							83.0	84.0	84.0					8																	145998963		2203	4300	6503	SO:0001583	missense	80778				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:145998963G>C	BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.1371C>G	8.37:g.145998963G>C	ENSP00000341528:p.Ser457Arg		Somatic				ZNF34_uc010mgb.2_Missense_Mutation_p.S354R|ZNF34_uc003zdx.3_Missense_Mutation_p.S436R	p.S457R	NM_030580	NP_085057	WXS	Illumina HiSeq	Unspecified	Q8IZ26	ZNF34_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)	6	1473	-	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	457			C2H2-type 9.		D3DWN1|Q9BSZ0	Missense_Mutation	SNP	ENST00000343459.4	37	c.1371C>G	CCDS47945.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739567	0.30774	.	.	ENSG00000196378	ENST00000449516;ENST00000527190;ENST00000343459;ENST00000429371	T;T	0.07216	3.21;3.21	3.54	0.71	0.18157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38381	N	0.001717	T	0.03739	0.0106	N	0.17723	0.515	0.09310	N	1	P;P	0.38395	0.629;0.629	B;B	0.26614	0.071;0.071	T	0.42120	-0.9470	10	0.42905	T	0.14	.	6.9386	0.24481	0.4228:0.0:0.5772:0.0	.	416;457	E7EN25;Q8IZ26	.;ZNF34_HUMAN	R	416;386;457;436	ENSP00000341528:S457R;ENSP00000396894:S436R	ENSP00000341528:S457R	S	-	3	2	ZNF34	145969767	0.000000	0.05858	0.958000	0.39756	0.940000	0.58332	-6.085000	0.00081	0.121000	0.18284	0.563000	0.77884	AGC		0.488	ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580		15	45	0	0	0	0.004007	0	15	45				
UNC13B	10497	broad.mit.edu	37	9	35376131	35376131	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:35376131A>G	ENST00000378495.3	+	14	1697	c.1475A>G	c.(1474-1476)tAt>tGt	p.Y492C	UNC13B_ENST00000378496.4_Missense_Mutation_p.Y492C|UNC13B_ENST00000396787.1_Missense_Mutation_p.Y504C	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	492					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.Y492C(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ACCTACTGCTATGAGTGTGAA	0.547																																							uc003zwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(1474-1476)TAT>TGT		UNC13 (C. elegans)-like							106.0	104.0	105.0					9																	35376131		2203	4300	6503	SO:0001583	missense	10497				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity	g.chr9:35376131A>G	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1475A>G	9.37:g.35376131A>G	ENSP00000367756:p.Tyr492Cys		Somatic				UNC13B_uc003zwr.2_Missense_Mutation_p.Y492C	p.Y492C	NM_006377	NP_006368	WXS	Illumina HiSeq	Unspecified	O14795	UN13B_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)		14	1767	+	all_epithelial(49;0.212)		492			Phorbol-ester/DAG-type.		Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	c.1475A>G	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655230	0.88056	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.92446	-3.04;-3.04;-3.04	6.07	6.07	0.98685	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.91676	0.7369	N	0.11284	0.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	D	0.93592	0.6922	10	0.62326	D	0.03	-15.3561	16.6277	0.84984	1.0:0.0:0.0:0.0	.	492;492	F8W8M9;O14795	.;UN13B_HUMAN	C	504;492;492;79	ENSP00000380006:Y504C;ENSP00000367756:Y492C;ENSP00000367757:Y492C	ENSP00000367756:Y492C	Y	+	2	0	UNC13B	35366131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.330000	0.79161	0.528000	0.53228	TAT		0.547	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		41	60	0	0	0	0.011902	0	41	60				
GRIN3A	116443	broad.mit.edu	37	9	104432627	104432627	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:104432627G>A	ENST00000361820.3	-	3	2667	c.2067C>T	c.(2065-2067)gcC>gcT	p.A689A		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	689					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.A689A(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TGAGGAAGACGGCAGTGATGT	0.493																																							uc004bbp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(2065-2067)GCC>GCT		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						97.0	104.0	101.0					9																	104432627		2203	4300	6503	SO:0001819	synonymous_variant	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104432627G>A		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2067C>T	9.37:g.104432627G>A			Somatic				GRIN3A_uc004bbq.1_Silent_p.A689A	p.A689A	NM_133445	NP_597702	WXS	Illumina HiSeq	Unspecified	Q8TCU5	NMD3A_HUMAN			3	2668	-		Acute lymphoblastic leukemia(62;0.0568)	689			Helical; (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	ENST00000361820.3	37	c.2067C>T	CCDS6758.1																																																																																				0.493	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			63	64	0	0	0	0.01441	0	63	64				
OR13F1	138805	broad.mit.edu	37	9	107266855	107266855	+	Silent	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:107266855C>T	ENST00000334726.2	+	1	401	c.312C>T	c.(310-312)tcC>tcT	p.S104S		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S104S(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGTACCTCTCCCTTGCCATGG	0.517																																							uc011lvm.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(310-312)TCC>TCT		olfactory receptor, family 13, subfamily F,							98.0	85.0	90.0					9																	107266855		2203	4300	6503	SO:0001819	synonymous_variant	138805				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107266855C>T		CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.312C>T	9.37:g.107266855C>T			Somatic					p.S104S	NM_001004485	NP_001004485	WXS	Illumina HiSeq	Unspecified	Q8NGS4	O13F1_HUMAN			1	312	+			104			Helical; Name=3; (Potential).		Q6IF50	Silent	SNP	ENST00000334726.2	37	c.312C>T	CCDS35087.1																																																																																				0.517	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1			24	52	0	0	0	0.014323	0	24	52				
OR13C9	286362	broad.mit.edu	37	9	107380045	107380045	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:107380045C>G	ENST00000259362.1	-	1	440	c.441G>C	c.(439-441)ggG>ggC	p.G147G		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G147G(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						CAAACCAGGACCCAACAGCCA	0.448																																							uc011lvr.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(439-441)GGG>GGC		olfactory receptor, family 13, subfamily C,							125.0	112.0	116.0					9																	107380045		2203	4300	6503	SO:0001819	synonymous_variant	286362				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107380045C>G		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.441G>C	9.37:g.107380045C>G			Somatic					p.G147G	NM_001001956	NP_001001956	WXS	Illumina HiSeq	Unspecified	Q8NGT0	O13C9_HUMAN			1	441	-			147			Helical; Name=4; (Potential).		Q6IFL2	Silent	SNP	ENST00000259362.1	37	c.441G>C	CCDS35093.1																																																																																				0.448	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1			30	69	0	0	0	0.00632	0	30	69				
ZNF462	58499	broad.mit.edu	37	9	109687218	109687218	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:109687218C>G	ENST00000277225.5	+	3	1314	c.1025C>G	c.(1024-1026)tCt>tGt	p.S342C	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.S342C			Q96JM2	ZN462_HUMAN	zinc finger protein 462	342					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S342C(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TCGCCCATGTCTTACCCTCAG	0.483																																							uc004bcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1024-1026)TCT>TGT		zinc finger protein 462							75.0	70.0	71.0					9																	109687218		2203	4300	6503	SO:0001583	missense	58499				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:109687218C>G	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1025C>G	9.37:g.109687218C>G	ENSP00000277225:p.Ser342Cys		Somatic				ZNF462_uc010mto.2_Missense_Mutation_p.S190C|ZNF462_uc004bda.2_Missense_Mutation_p.S190C	p.S342C	NM_021224	NP_067047	WXS	Illumina HiSeq	Unspecified	Q96JM2	ZN462_HUMAN			3	1314	+			342					Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	c.1025C>G	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584116	0.46110	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.06608	3.28;3.72	5.91	5.91	0.95273	.	0.109885	0.64402	D	0.000003	T	0.14917	0.0360	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.79108	0.992;0.981	T	0.11084	-1.0602	9	.	.	.	.	18.4858	0.90828	0.0:1.0:0.0:0.0	.	342;342	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	C	342	ENSP00000277225:S342C;ENSP00000414570:S342C	.	S	+	2	0	ZNF462	108727039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.314000	0.65804	2.808000	0.96608	0.655000	0.94253	TCT		0.483	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224		15	40	0	0	0	0.00245	0	15	40				
ACTL7B	10880	broad.mit.edu	37	9	111617550	111617550	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:111617550G>T	ENST00000374667.3	-	1	1689	c.661C>A	c.(661-663)Cgc>Agc	p.R221S		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	221						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)	p.R221S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TAGTCGGCGCGGCTGGTCAGG	0.662																																							uc004bdi.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(661-663)CGC>AGC		actin-like 7B							50.0	40.0	43.0					9																	111617550		2203	4300	6503	SO:0001583	missense	10880					actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton	g.chr9:111617550G>T	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.661C>A	9.37:g.111617550G>T	ENSP00000363799:p.Arg221Ser		Somatic					p.R221S	NM_006686	NP_006677	WXS	Illumina HiSeq	Unspecified	Q9Y614	ACL7B_HUMAN			1	726	-			221					B2R9Q2|Q5JSV1	Missense_Mutation	SNP	ENST00000374667.3	37	c.661C>A	CCDS6771.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042360	0.35989	.	.	ENSG00000148156	ENST00000374667	D	0.94793	-3.52	4.63	3.74	0.42951	.	0.389949	0.18921	N	0.127476	D	0.94938	0.8363	M	0.79123	2.44	0.39406	D	0.966671	P	0.40578	0.722	P	0.47075	0.536	D	0.94934	0.8085	10	0.87932	D	0	.	10.4648	0.44600	0.0948:0.0:0.9052:0.0	.	221	Q9Y614	ACL7B_HUMAN	S	221	ENSP00000363799:R221S	ENSP00000363799:R221S	R	-	1	0	ACTL7B	110657371	0.920000	0.31207	0.018000	0.16275	0.223000	0.24884	1.915000	0.39976	1.177000	0.42855	0.655000	0.94253	CGC		0.662	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	NM_006686		14	43	1	0	4.3838e-07	0.001855	5.50411e-07	14	43				
AKNA	80709	broad.mit.edu	37	9	117138926	117138926	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:117138926C>A	ENST00000307564.4	-	3	1322	c.1161G>T	c.(1159-1161)aaG>aaT	p.K387N	AKNA_ENST00000223791.3_5'UTR|AKNA_ENST00000374075.5_Missense_Mutation_p.K306N|AKNA_ENST00000374088.3_Missense_Mutation_p.K387N|AKNA_ENST00000312033.3_Missense_Mutation_p.K387N	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	387					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.K387N(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGGCCTGAGGCTTCCTGTTGT	0.587																																							uc004biq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(1159-1161)AAG>AAT		AT-hook transcription factor							38.0	43.0	41.0					9																	117138926		2203	4300	6503	SO:0001583	missense	80709				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr9:117138926C>A	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1161G>T	9.37:g.117138926C>A	ENSP00000303769:p.Lys387Asn		Somatic				AKNA_uc004bio.3_5'UTR|AKNA_uc004bip.3_Missense_Mutation_p.K306N|AKNA_uc004bir.3_Missense_Mutation_p.K387N|AKNA_uc004bis.3_Missense_Mutation_p.K387N|AKNA_uc010mve.2_Missense_Mutation_p.K268N|AKNA_uc004biu.1_Missense_Mutation_p.K128N|AKNA_uc004biv.1_Missense_Mutation_p.K387N|AKNA_uc004biw.1_Missense_Mutation_p.K387N	p.K387N	NM_030767	NP_110394	WXS	Illumina HiSeq	Unspecified	Q7Z591	AKNA_HUMAN			2	1296	-			387					Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	c.1161G>T	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	C	5.989	0.366433	0.11352	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.32988	2.66;2.66;2.66;1.43	4.88	0.838	0.18902	.	0.858274	0.09901	N	0.741037	T	0.16557	0.0398	N	0.14661	0.345	0.09310	N	1	B;B;B	0.27732	0.095;0.118;0.187	B;B;B	0.29716	0.051;0.049;0.106	T	0.33650	-0.9860	10	0.25751	T	0.34	-0.4601	5.7247	0.18006	0.0:0.6065:0.1414:0.2521	.	387;387;306	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	N	387;228;387;306;387;387	ENSP00000303769:K387N;ENSP00000363201:K387N;ENSP00000363188:K306N;ENSP00000309222:K387N	ENSP00000303769:K387N	K	-	3	2	AKNA	116178747	0.000000	0.05858	0.021000	0.16686	0.198000	0.23893	-0.139000	0.10358	-0.127000	0.11661	-0.305000	0.09177	AAG		0.587	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		22	58	1	0	1.85244e-09	0.00333	2.51694e-09	22	58				
TLR4	7099	broad.mit.edu	37	9	120476015	120476015	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:120476015A>T	ENST00000355622.6	+	3	1710	c.1609A>T	c.(1609-1611)Acg>Tcg	p.T537S	TLR4_ENST00000394487.4_Missense_Mutation_p.T497S|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	537					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.T537S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TTCATTGGATACGTTTCCTTA	0.403																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(1609-1611)ACG>TCG		toll-like receptor 4 precursor							100.0	90.0	93.0					9																	120476015		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476015A>T	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1609A>T	9.37:g.120476015A>T	ENSP00000363089:p.Thr537Ser		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.T497S|TLR4_uc004bkb.2_Missense_Mutation_p.T337S	p.T537S	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	1900	+			537			LRR 17.|Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.1609A>T	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	A	0.049	-1.254854	0.01457	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.00864	5.6;5.6	5.82	-11.6	0.00059	.	1.147350	0.06308	N	0.702202	T	0.00412	0.0013	N	0.04705	-0.18	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48115	-0.9063	10	0.08179	T	0.78	.	4.2478	0.10680	0.106:0.4422:0.2451:0.2067	.	537	O00206	TLR4_HUMAN	S	497;537	ENSP00000377997:T497S;ENSP00000363089:T537S	ENSP00000363089:T537S	T	+	1	0	TLR4	119515836	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.198000	0.03035	-2.702000	0.00398	-2.355000	0.00241	ACG		0.403	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		19	33	0	0	0	0.012319	0	19	33				
SLC2A8	29988	broad.mit.edu	37	9	130166264	130166264	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:130166264G>T	ENST00000373371.3	+	7	983	c.894G>T	c.(892-894)gtG>gtT	p.V298V	SLC2A8_ENST00000373360.3_Silent_p.V298V|SLC2A8_ENST00000373352.1_Silent_p.V35V	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	298					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|male meiosis I (GO:0007141)|response to hypoxia (GO:0001666)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	glucose binding (GO:0005536)|glucose transmembrane transporter activity (GO:0005355)	p.V298V(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11						CGGTCGTCGTGGGTGTCATCC	0.652																																							uc004bqu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						c.(892-894)GTG>GTT		solute carrier family 2 (facilitated glucose							49.0	45.0	46.0					9																	130166264		2203	4300	6503	SO:0001819	synonymous_variant	29988					cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity	g.chr9:130166264G>T	AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856		"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""			10671487, 10821868	Standard	NM_014580		Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.894G>T	9.37:g.130166264G>T			Somatic				SLC2A8_uc010mxj.2_Silent_p.V298V|SLC2A8_uc004bqv.2_5'Flank	p.V298V	NM_014580	NP_055395	WXS	Illumina HiSeq	Unspecified	Q9NY64	GTR8_HUMAN			7	939	+			298			Helical; Name=8; (Potential).		Q8WUZ9|Q9NSC4	Silent	SNP	ENST00000373371.3	37	c.894G>T	CCDS6870.1																																																																																				0.652	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054177.1	NM_014580		7	23	1	0	8.12818e-05	0.001984	9.26203e-05	7	23				
SPTAN1	6709	broad.mit.edu	37	9	131356466	131356466	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:131356466G>T	ENST00000372731.4	+	24	3338	c.3228G>T	c.(3226-3228)ctG>ctT	p.L1076L	SPTAN1_ENST00000372739.3_Silent_p.L1076L|SPTAN1_ENST00000358161.5_Silent_p.L1076L|SPTAN1_ENST00000475367.1_3'UTR	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1076					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L1076L(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ATCATTCTCTGCTGGAACTGG	0.448																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(5)|ovary(4)|pancreas(1)	10						c.(3226-3228)CTG>CTT		spectrin, alpha, non-erythrocytic 1							115.0	104.0	108.0					9																	131356466		2203	4300	6503	SO:0001819	synonymous_variant	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131356466G>T	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3228G>T	9.37:g.131356466G>T			Somatic				SPTAN1_uc011mbg.1_Silent_p.L1056L|SPTAN1_uc011mbh.1_Silent_p.L1088L|SPTAN1_uc004bvm.3_Silent_p.L1076L|SPTAN1_uc004bvn.3_Silent_p.L1056L	p.L1076L	NM_003127	NP_003118	WXS	Illumina HiSeq	Unspecified	Q13813	SPTA2_HUMAN			24	3341	+			1076			Spectrin 11.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	c.3228G>T	CCDS6905.1																																																																																				0.448	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		24	64	1	0	2.27525e-19	0.003954	3.77169e-19	24	64				
ZER1	10444	broad.mit.edu	37	9	131502332	131502332	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:131502332G>A	ENST00000291900.2	-	13	2326	c.1920C>T	c.(1918-1920)caC>caT	p.H640H		NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	640					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.H640H(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						CAAACATGATGTGGGAGAGGA	0.582																																							uc004bwa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1918-1920)CAC>CAT		zyg-11 homolog B (C. elegans)-like							68.0	63.0	65.0					9																	131502332		2203	4300	6503	SO:0001819	synonymous_variant	10444				ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity	g.chr9:131502332G>A	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1920C>T	9.37:g.131502332G>A			Somatic					p.H640H	NM_006336	NP_006327	WXS	Illumina HiSeq	Unspecified	Q7Z7L7	ZER1_HUMAN			13	2353	-			640			ARM 4.		O00156|Q5T272|Q5T273	Silent	SNP	ENST00000291900.2	37	c.1920C>T	CCDS6910.1																																																																																				0.582	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336		9	36	0	0	0	0.006214	0	9	36				
MXRA5	25878	broad.mit.edu	37	X	3228872	3228872	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:3228872C>A	ENST00000217939.6	-	7	7526	c.7372G>T	c.(7372-7374)Ggg>Tgg	p.G2458W		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2458	Ig-like C2-type 9.					extracellular vesicular exosome (GO:0070062)		p.G2458W(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGACTGCCCCCGGCTGCTATC	0.577																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(7372-7374)GGG>TGG		adlican precursor							52.0	34.0	40.0					X																	3228872		2203	4299	6502	SO:0001583	missense	25878					extracellular region		g.chrX:3228872C>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7372G>T	X.37:g.3228872C>A	ENSP00000217939:p.Gly2458Trp		Somatic					p.G2458W	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			7	7529	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2458			Ig-like C2-type 9.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.7372G>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	7.688	0.690394	0.15039	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67171	-0.25	3.54	1.26	0.21427	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.502193	0.14831	U	0.295844	T	0.66528	0.2798	L	0.38838	1.175	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.53401	-0.8444	10	0.66056	D	0.02	.	2.2095	0.03945	0.0:0.2662:0.3007:0.4331	.	2458	Q9NR99	MXRA5_HUMAN	W	2458	ENSP00000217939:G2458W	ENSP00000217939:G2458W	G	-	1	0	MXRA5	3238872	0.014000	0.17966	0.001000	0.08648	0.004000	0.04260	1.992000	0.40737	1.406000	0.46857	0.597000	0.82753	GGG		0.577	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		14	33	1	0	1.5842e-08	0.001855	2.09374e-08	14	33				
NLGN4X	57502	broad.mit.edu	37	X	5811275	5811275	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:5811275G>T	ENST00000381095.3	-	6	2661	c.2034C>A	c.(2032-2034)acC>acA	p.T678T	NLGN4X_ENST00000381092.1_Silent_p.T678T|NLGN4X_ENST00000538097.1_Silent_p.T678T|NLGN4X_ENST00000381093.2_Silent_p.T698T|NLGN4X_ENST00000275857.6_Silent_p.T678T	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	678					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.T678T(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CGACGGCAATGGTGACACTTA	0.512																																							uc010ndh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(2032-2034)ACC>ACA		X-linked neuroligin 4 precursor							105.0	102.0	103.0					X																	5811275		2203	4298	6501	SO:0001819	synonymous_variant	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5811275G>T	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2034C>A	X.37:g.5811275G>T			Somatic				NLGN4X_uc004crp.2_Silent_p.T698T|NLGN4X_uc004crq.2_Silent_p.T678T|NLGN4X_uc010ndi.2_Silent_p.T715T|NLGN4X_uc004crr.2_Silent_p.T678T|NLGN4X_uc010ndj.2_Silent_p.T678T	p.T678T	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			6	2535	-			678			Helical; (Potential).		Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	c.2034C>A	CCDS14126.1																																																																																				0.512	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		46	119	1	0	1.81118e-26	0.01441	3.18956e-26	46	119				
ARHGAP6	395	broad.mit.edu	37	X	11204553	11204553	+	Splice_Site	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:11204553T>C	ENST00000337414.4	-	5	1950		c.e5-2		ARHGAP6_ENST00000380736.1_Splice_Site|ARHGAP6_ENST00000380732.3_Splice_Site|ARHGAP6_ENST00000303025.6_Splice_Site|ARHGAP6_ENST00000413512.3_Splice_Site|ARHGAP6_ENST00000534860.1_Splice_Site|ARHGAP6_ENST00000380718.1_Splice_Site	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6						actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.?(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CATGGCACCCTGCAAGTGACA	0.443																																							uc004cup.1		NA																	1	Unknown(1)		lung(1)	urinary_tract(1)|lung(1)	2						c.e5-1		Rho GTPase activating protein 6 isoform 1							89.0	84.0	86.0					X																	11204553		2203	4300	6503	SO:0001630	splice_region_variant	395				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity	g.chrX:11204553T>C	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1078-2A>G	X.37:g.11204553T>C			Somatic				ARHGAP6_uc004cuo.1_Splice_Site|ARHGAP6_uc004cur.1_Splice_Site_p.G360_splice|ARHGAP6_uc004cum.1_Splice_Site_p.G157_splice|ARHGAP6_uc004cun.1_Splice_Site_p.G180_splice|ARHGAP6_uc010neb.1_Splice_Site_p.G182_splice|ARHGAP6_uc011mif.1_Splice_Site_p.G157_splice	p.G360_splice	NM_013427	NP_038286	WXS	Illumina HiSeq	Unspecified	O43182	RHG06_HUMAN			5	1951	-								B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Splice_Site	SNP	ENST00000337414.4	37	c.1078_splice	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.217177	0.79352	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6981	0.69136	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGAP6	11114474	1.000000	0.71417	0.973000	0.42090	0.891000	0.51852	7.492000	0.81482	1.852000	0.53769	0.486000	0.48141	.		0.443	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	Intron	9	117	0	0	0	0.004482	0	9	117				
ACE2	59272	broad.mit.edu	37	X	15603664	15603664	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:15603664C>G	ENST00000252519.3	-	7	936	c.834G>C	c.(832-834)ctG>ctC	p.L278L	ACE2_ENST00000427411.1_Silent_p.L278L			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	278					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.L278L(1)		endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TCAAAGAGTACAGATTTGTCC	0.328																																							uc004cxa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(832-834)CTG>CTC		angiotensin I converting enzyme 2 precursor	Moexipril(DB00691)						133.0	128.0	130.0					X																	15603664		2203	4300	6503	SO:0001819	synonymous_variant	59272				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding	g.chrX:15603664C>G	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.834G>C	X.37:g.15603664C>G			Somatic				ACE2_uc004cxb.2_Silent_p.L278L	p.L278L	NM_021804	NP_068576	WXS	Illumina HiSeq	Unspecified	Q9BYF1	ACE2_HUMAN			7	1002	-	Hepatocellular(33;0.183)		278			Extracellular (Potential).		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Silent	SNP	ENST00000252519.3	37	c.834G>C	CCDS14169.1																																																																																				0.328	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			11	169	0	0	0	0.010729	0	11	169				
PPEF1	5475	broad.mit.edu	37	X	18822086	18822086	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:18822086A>G	ENST00000361511.4	+	14	1636	c.1142A>G	c.(1141-1143)tAt>tGt	p.Y381C	PPEF1_ENST00000359763.6_Missense_Mutation_p.Y328C|PPEF1_ENST00000543630.1_Intron|PPEF1_ENST00000349874.5_Intron|PPEF1_ENST00000544635.1_Missense_Mutation_p.Y316C	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	381	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.Y381C(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					GGGGGCTGCTATTTTGGACCA	0.418																																							uc004cyq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1141-1143)TAT>TGT		protein phosphatase with EF hand calcium-binding							144.0	132.0	136.0					X																	18822086		2203	4300	6503	SO:0001583	missense	5475				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	g.chrX:18822086A>G	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1142A>G	X.37:g.18822086A>G	ENSP00000354871:p.Tyr381Cys		Somatic				PPEF1_uc004cyp.2_Missense_Mutation_p.Y353C|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Missense_Mutation_p.Y381C|PPEF1_uc011mja.1_Missense_Mutation_p.Y316C|PPEF1_uc011mjb.1_Missense_Mutation_p.Y325C	p.Y381C	NM_006240	NP_006231	WXS	Illumina HiSeq	Unspecified	O14829	PPE1_HUMAN			14	1623	+	Hepatocellular(33;0.183)		381			Catalytic.		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	c.1142A>G	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208616	0.58343	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000544635	T;T;T	0.05382	3.45;3.45;3.45	5.03	5.03	0.67393	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.234992	0.30686	N	0.009086	T	0.09598	0.0236	L	0.56280	1.765	0.58432	D	0.999998	P;P	0.41929	0.641;0.765	B;B	0.43680	0.427;0.42	T	0.04495	-1.0947	10	0.49607	T	0.09	-24.4761	9.2116	0.37322	0.9148:0.0:0.0852:0.0	.	381;353	O14829;O14829-3	PPE1_HUMAN;.	C	381;328;316	ENSP00000354871:Y381C;ENSP00000352806:Y328C;ENSP00000441289:Y316C	ENSP00000352806:Y328C	Y	+	2	0	PPEF1	18732007	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.814000	0.69208	1.855000	0.53841	0.481000	0.45027	TAT		0.418	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240		39	68	0	0	0	0.006999	0	39	68				
DMD	1756	broad.mit.edu	37	X	31462673	31462673	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:31462673G>T	ENST00000357033.4	-	60	9215	c.9009C>A	c.(9007-9009)acC>acA	p.T3003T	DMD_ENST00000378707.3_Silent_p.T543T|DMD_ENST00000359836.1_Silent_p.T543T|DMD_ENST00000541735.1_Silent_p.T543T|DMD_ENST00000474231.1_Silent_p.T543T|DMD_ENST00000378677.2_Silent_p.T2999T|DMD_ENST00000343523.2_Silent_p.T543T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3003					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGCCCAAAGTGGTAAGCTGGC	0.478																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(9007-9009)ACC>ACA		dystrophin Dp427m isoform							163.0	125.0	138.0					X																	31462673		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31462673G>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9009C>A	X.37:g.31462673G>T			Somatic				DMD_uc004dcq.1_Silent_p.T274T|DMD_uc004dcr.1_Silent_p.T543T|DMD_uc004dcs.1_Silent_p.T543T|DMD_uc004dct.1_Silent_p.T543T|DMD_uc004dcu.1_Silent_p.T543T|DMD_uc004dcv.1_Silent_p.T543T|DMD_uc004dcw.2_Silent_p.T1659T|DMD_uc004dcx.2_Silent_p.T1662T|DMD_uc004dcz.2_Silent_p.T2880T|DMD_uc004dcy.1_Silent_p.T2999T|DMD_uc004ddb.1_Silent_p.T2995T	p.T3003T	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			60	9253	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	3003			Spectrin 22.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.9009C>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	9.042	0.989879	0.18966	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.56	0.43	0.16515	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.41010	D	0.984995	.	.	.	.	.	.	T	0.27088	-1.0084	4	.	.	.	.	1.6596	0.02788	0.2268:0.1135:0.4254:0.2343	.	.	.	.	N	732	.	.	H	-	1	0	DMD	31372594	0.993000	0.37304	0.974000	0.42286	0.969000	0.65631	0.183000	0.16919	0.159000	0.19401	0.538000	0.68166	CAC		0.478	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		6	63	1	0	2.7689e-08	0.001984	3.63116e-08	6	63				
FAM47B	170062	broad.mit.edu	37	X	34961736	34961736	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:34961736C>A	ENST00000329357.5	+	1	824	c.788C>A	c.(787-789)cCt>cAt	p.P263H		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	263	Pro-rich.							p.P263H(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TGCCCAGAGCCTCCCAAGACT	0.622																																							uc004ddi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(787-789)CCT>CAT		hypothetical protein LOC170062							59.0	56.0	57.0					X																	34961736		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34961736C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.788C>A	X.37:g.34961736C>A	ENSP00000328307:p.Pro263His		Somatic					p.P263H	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	806	+			263			Pro-rich.		Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.788C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	9.545	1.114497	0.20795	.	.	ENSG00000189132	ENST00000329357	T	0.23348	1.91	0.235	0.235	0.15431	.	.	.	.	.	T	0.45975	0.1369	M	0.81802	2.56	0.23602	N	0.99732	D	0.89917	1.0	D	0.78314	0.991	T	0.19877	-1.0292	9	0.44086	T	0.13	.	6.1977	0.20559	0.0:0.9996:0.0:3.0E-4	.	263	Q8NA70	FA47B_HUMAN	H	263	ENSP00000328307:P263H	ENSP00000328307:P263H	P	+	2	0	FAM47B	34871657	0.929000	0.31497	0.007000	0.13788	0.007000	0.05969	2.308000	0.43690	0.288000	0.22398	0.292000	0.19580	CCT		0.622	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		37	61	1	0	1.07121e-22	0.006999	1.82482e-22	37	61				
FAM47C	442444	broad.mit.edu	37	X	37029346	37029346	+	Nonsense_Mutation	SNP	G	G	T	rs375998369		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:37029346G>T	ENST00000358047.3	+	1	2915	c.2863G>T	c.(2863-2865)Gaa>Taa	p.E955*		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	955								p.E955*(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AAGAAGTGATGAACCTTTGAT	0.438																																							uc004ddl.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)	3						c.(2863-2865)GAA>TAA		hypothetical protein LOC442444							118.0	113.0	115.0					X																	37029346		2202	4300	6502	SO:0001587	stop_gained	442444							g.chrX:37029346G>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2863G>T	X.37:g.37029346G>T	ENSP00000367913:p.Glu955*		Somatic					p.E955*	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2877	+			955					Q6ZU46	Nonsense_Mutation	SNP	ENST00000358047.3	37	c.2863G>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933289	0.73442	.	.	ENSG00000198173	ENST00000358047	.	.	.	0.502	-0.512	0.11966	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	955	.	ENSP00000367913:E955X	E	+	1	0	FAM47C	36939267	0.033000	0.19621	0.039000	0.18376	0.023000	0.10783	0.278000	0.18753	-0.342000	0.08363	-0.707000	0.03653	GAA		0.438	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		51	122	1	0	8.5822e-43	0.01441	1.58118e-42	51	122				
OTC	5009	broad.mit.edu	37	X	38226663	38226663	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:38226663G>C	ENST00000039007.4	+	2	349	c.197G>C	c.(196-198)aGg>aCg	p.R66T	OTC_ENST00000488812.1_3'UTR|TM4SF2_ENST00000465127.1_Intron	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	66					ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)	p.R66T(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	CTGAAATTTAGGATAAAACAG	0.373																																							uc004def.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(196-198)AGG>ACG		ornithine carbamoyltransferase precursor	L-Citrulline(DB00155)|L-Ornithine(DB00129)						62.0	63.0	62.0					X																	38226663		2202	4298	6500	SO:0001583	missense	5009				arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity	g.chrX:38226663G>C	K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.197G>C	X.37:g.38226663G>C	ENSP00000039007:p.Arg66Thr		Somatic					p.R66T	NM_000531	NP_000522	WXS	Illumina HiSeq	Unspecified	P00480	OTC_HUMAN			2	411	+			66					A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Missense_Mutation	SNP	ENST00000039007.4	37	c.197G>C	CCDS14247.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266576	0.59540	.	.	ENSG00000036473	ENST00000039007	D	0.98381	-4.9	5.39	5.39	0.77823	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (1);	0.045974	0.85682	D	0.000000	D	0.97663	0.9234	L	0.44542	1.39	0.54753	D	0.999983	D	0.55385	0.971	P	0.53722	0.733	D	0.98370	1.0553	10	0.59425	D	0.04	18.1896	16.8818	0.86065	0.0:0.0:1.0:0.0	.	66	P00480	OTC_HUMAN	T	66	ENSP00000039007:R66T	ENSP00000039007:R66T	R	+	2	0	OTC	38111607	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	5.679000	0.68160	2.249000	0.74217	0.422000	0.28245	AGG		0.373	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059006.2			27	56	0	0	0	0.013726	0	27	56				
MED14	9282	broad.mit.edu	37	X	40572200	40572200	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:40572200C>A	ENST00000324817.1	-	6	865	c.747G>T	c.(745-747)aaG>aaT	p.K249N		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	249	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.K249N(1)		NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAATTTCTAGCTTGAGAAGAC	0.358																																							uc004dex.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|kidney(1)|skin(1)	4						c.(745-747)AAG>AAT		mediator complex subunit 14							80.0	64.0	69.0					X																	40572200		2203	4300	6503	SO:0001583	missense	9282				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:40572200C>A	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.747G>T	X.37:g.40572200C>A	ENSP00000323720:p.Lys249Asn		Somatic				MED14_uc010nhe.1_Missense_Mutation_p.K133N	p.K249N	NM_004229	NP_004220	WXS	Illumina HiSeq	Unspecified	O60244	MED14_HUMAN			6	887	-			249			Interaction with STAT2.		Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	c.747G>T	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323513	0.24080	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.26	3.07	0.35406	.	0.000000	0.85682	D	0.000000	T	0.31295	0.0792	N	0.14661	0.345	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.11131	-1.0600	9	0.52906	T	0.07	.	6.5037	0.22184	0.0:0.5381:0.0:0.4619	.	249	O60244	MED14_HUMAN	N	249	.	ENSP00000323720:K249N	K	-	3	2	MED14	40457144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.470000	0.35354	1.097000	0.41459	0.594000	0.82650	AAG		0.358	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229		7	17	1	0	5.18039e-06	0.00308	6.17277e-06	7	17				
CCDC120	90060	broad.mit.edu	37	X	48921447	48921447	+	Missense_Mutation	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:48921447A>T	ENST00000376396.3	+	5	458	c.239A>T	c.(238-240)cAg>cTg	p.Q80L	CCDC120_ENST00000536628.2_Missense_Mutation_p.Q68L|CCDC120_ENST00000597275.1_Missense_Mutation_p.Q80L|CCDC120_ENST00000603986.1_Missense_Mutation_p.Q115L|CCDC120_ENST00000422185.2_Missense_Mutation_p.Q80L|CCDC120_ENST00000496529.2_Missense_Mutation_p.Q80L	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	80								p.Q80L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						GAACGGCCCCAGTTGGTCCGC	0.667																																							uc010nik.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(238-240)CAG>CTG		coiled-coil domain containing 120 isoform 3							20.0	20.0	20.0					X																	48921447		2202	4296	6498	SO:0001583	missense	90060						protein binding	g.chrX:48921447A>T	BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.239A>T	X.37:g.48921447A>T	ENSP00000365577:p.Gln80Leu		Somatic				CCDC120_uc011mmq.1_Missense_Mutation_p.Q68L|CCDC120_uc004dmf.2_Missense_Mutation_p.Q80L|CCDC120_uc010nil.2_Missense_Mutation_p.Q80L|CCDC120_uc011mmr.1_Missense_Mutation_p.Q80L|CCDC120_uc011mms.1_Missense_Mutation_p.Q68L	p.Q80L	NM_033626	NP_296375	WXS	Illumina HiSeq	Unspecified	Q96HB5	CC120_HUMAN			5	746	+			80					B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	c.239A>T	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969511	0.74246	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	4.6	4.6	0.57074	.	0.264654	0.26931	N	0.021763	T	0.30665	0.0772	N	0.08118	0	0.37545	D	0.918467	P;P;P;P	0.47841	0.901;0.802;0.802;0.901	B;B;B;B	0.43754	0.43;0.43;0.43;0.353	T	0.41052	-0.9530	9	0.72032	D	0.01	-5.4937	10.7852	0.46401	1.0:0.0:0.0:0.0	.	68;115;68;80	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	L	80;80;68	.	ENSP00000365577:Q80L	Q	+	2	0	CCDC120	48808391	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.101000	0.57769	1.522000	0.49001	0.381000	0.24937	CAG		0.667	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626		4	11	0	0	0	0.009096	0	4	11				
MAGED1	9500	broad.mit.edu	37	X	51639760	51639760	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:51639760G>A	ENST00000375722.1	+	4	1261	c.1009G>A	c.(1009-1011)Gct>Act	p.A337T	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Missense_Mutation_p.A337T|MAGED1_ENST00000375772.3_Missense_Mutation_p.A337T|MAGED1_ENST00000375695.2_Missense_Mutation_p.A393T			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	337	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)	p.A393T(1)		breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GAACCCAGTCGCTTGGCAGAA	0.612										Multiple Myeloma(10;0.10)																													uc004dpm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1009-1011)GCT>ACT		melanoma antigen family D, 1 isoform b							62.0	58.0	60.0					X																	51639760		2203	4300	6503	SO:0001583	missense	9500				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding	g.chrX:51639760G>A	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1009G>A	X.37:g.51639760G>A	ENSP00000364874:p.Ala337Thr	Multiple Myeloma(10;0.10)	Somatic				MAGED1_uc004dpn.2_Missense_Mutation_p.A393T|MAGED1_uc004dpo.2_Missense_Mutation_p.A337T	p.A337T	NM_001005332	NP_001005332	WXS	Illumina HiSeq	Unspecified	Q9Y5V3	MAGD1_HUMAN			4	1104	+	Ovarian(276;0.236)		337			Pro-rich.|22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|4.		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	37	c.1009G>A	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861865	0.51482	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	3.67	2.78	0.32641	.	0.000000	0.34700	N	0.003754	T	0.50274	0.1606	N	0.22421	0.69	0.25266	N	0.98956	D;D	0.89917	1.0;0.999	D;D	0.71656	0.974;0.912	T	0.27640	-1.0068	10	0.52906	T	0.07	.	4.3442	0.11124	0.2883:0.0:0.7117:0.0	.	393;337	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	T	337;337;337;393	ENSP00000364927:A337T;ENSP00000364874:A337T;ENSP00000325333:A337T;ENSP00000364847:A393T	ENSP00000325333:A337T	A	+	1	0	MAGED1	51656500	0.985000	0.35326	1.000000	0.80357	0.901000	0.52897	0.607000	0.24209	1.779000	0.52309	0.284000	0.19432	GCT		0.612	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332		14	53	0	0	0	0.006122	0	14	53				
MAGED1	9500	broad.mit.edu	37	X	51640681	51640681	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:51640681T>A	ENST00000375722.1	+	6	1777	c.1525T>A	c.(1525-1527)Tat>Aat	p.Y509N	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Missense_Mutation_p.Y509N|MAGED1_ENST00000375772.3_Missense_Mutation_p.Y509N|MAGED1_ENST00000375695.2_Missense_Mutation_p.Y565N			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	509	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)	p.Y565N(1)		breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CACTGATGTTTATCCAGAAAT	0.488										Multiple Myeloma(10;0.10)																													uc004dpm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1525-1527)TAT>AAT		melanoma antigen family D, 1 isoform b							97.0	85.0	89.0					X																	51640681		2203	4300	6503	SO:0001583	missense	9500				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding	g.chrX:51640681T>A	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1525T>A	X.37:g.51640681T>A	ENSP00000364874:p.Tyr509Asn	Multiple Myeloma(10;0.10)	Somatic				MAGED1_uc004dpn.2_Missense_Mutation_p.Y565N|MAGED1_uc004dpo.2_Missense_Mutation_p.Y509N	p.Y509N	NM_001005332	NP_001005332	WXS	Illumina HiSeq	Unspecified	Q9Y5V3	MAGD1_HUMAN			6	1620	+	Ovarian(276;0.236)		509			MAGE.		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	37	c.1525T>A	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222760	0.39300	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.05319	3.46;3.46;3.46;3.46	3.45	3.45	0.39498	.	0.000000	0.32430	N	0.006113	T	0.19005	0.0456	L	0.61036	1.89	0.49915	D	0.999837	D;D	0.76494	0.999;0.999	D;D	0.85130	0.994;0.997	T	0.00377	-1.1778	10	0.87932	D	0	.	9.4909	0.38960	0.0:0.0:0.0:1.0	.	565;509	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	N	509;509;509;565	ENSP00000364927:Y509N;ENSP00000364874:Y509N;ENSP00000325333:Y509N;ENSP00000364847:Y565N	ENSP00000325333:Y509N	Y	+	1	0	MAGED1	51657421	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.806000	0.47947	1.595000	0.50050	0.412000	0.27726	TAT		0.488	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332		5	77	0	0	0	0.001168	0	5	77				
ALAS2	212	broad.mit.edu	37	X	55040070	55040070	+	Silent	SNP	T	T	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:55040070T>G	ENST00000330807.5	-	10	1586	c.1449A>C	c.(1447-1449)gcA>gcC	p.A483A	ALAS2_ENST00000498636.1_Intron|ALAS2_ENST00000396198.3_Silent_p.A470A|ALAS2_ENST00000335854.4_Silent_p.A446A	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	483					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)	p.A483A(1)|p.A470A(1)		central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TGTTGAGTGCTGCATTGCCCA	0.547																																							uc004dua.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1447-1449)GCA>GCC		5-aminolevulinate synthase 2 isoform a	Glycine(DB00145)						99.0	68.0	78.0					X																	55040070		2203	4300	6503	SO:0001819	synonymous_variant	212				cellular iron ion homeostasis|erythrocyte differentiation|heme biosynthetic process|hemoglobin biosynthetic process|oxygen homeostasis|response to hypoxia	mitochondrial inner membrane|mitochondrial matrix	5-aminolevulinate synthase activity|coenzyme binding|glycine binding|protein binding|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups	g.chrX:55040070T>G		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1449A>C	X.37:g.55040070T>G			Somatic				ALAS2_uc004dub.3_Silent_p.A470A|ALAS2_uc004dud.3_Silent_p.A446A	p.A483A	NM_000032	NP_000023	WXS	Illumina HiSeq	Unspecified	P22557	HEM0_HUMAN			10	1587	-			483					A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Silent	SNP	ENST00000330807.5	37	c.1449A>C	CCDS14366.1																																																																																				0.547	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032		5	37	0	0	0	0.000602	0	5	37				
AMER1	139285	broad.mit.edu	37	X	63412380	63412380	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:63412380C>G	ENST00000330258.3	-	2	1059	c.787G>C	c.(787-789)Gag>Cag	p.E263Q	AMER1_ENST00000403336.1_Missense_Mutation_p.E263Q|AMER1_ENST00000374869.3_Missense_Mutation_p.E263Q	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	263					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.E263Q(2)									GCACAGGCCTCCATGGGTTTT	0.547																																							uc004dvo.2		NA																	69	Whole gene deletion(67)|Substitution - Missense(2)	p.0?(40)	kidney(65)|lung(2)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(787-789)GAG>CAG		family with sequence similarity 123B							84.0	86.0	85.0					X																	63412380		2203	4300	6503	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63412380C>G	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.787G>C	X.37:g.63412380C>G	ENSP00000329117:p.Glu263Gln		Somatic					p.E263Q	NM_152424	NP_689637	WXS	Illumina HiSeq	Unspecified	Q5JTC6	F123B_HUMAN			2	1060	-			263					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.787G>C	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	1.439	-0.568132	0.03910	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.18016	2.24;2.24;2.24	5.22	4.35	0.52113	.	0.641907	0.15626	N	0.252646	T	0.16854	0.0405	L	0.51422	1.61	0.09310	N	1	B	0.32010	0.351	B	0.30855	0.121	T	0.11348	-1.0591	10	0.33141	T	0.24	0.1397	11.2472	0.49004	0.0:0.9074:0.0:0.0926	.	263	Q5JTC6	F123B_HUMAN	Q	263	ENSP00000364003:E263Q;ENSP00000329117:E263Q;ENSP00000384722:E263Q	ENSP00000329117:E263Q	E	-	1	0	FAM123B	63329105	0.000000	0.05858	0.014000	0.15608	0.031000	0.12232	0.098000	0.15189	1.285000	0.44548	0.600000	0.82982	GAG		0.547	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		16	215	0	0	0	0.00499	0	16	215				
ITGB1BP2	26548	broad.mit.edu	37	X	70521703	70521703	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:70521703C>G	ENST00000373829.3	+	1	120	c.47C>G	c.(46-48)cCt>cGt	p.P16R	ITGB1BP2_ENST00000538820.1_5'UTR	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	16	CHORD 1. {ECO:0000255|PROSITE- ProRule:PRU00734}.|Cys-rich.				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.P16R(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CACTTTGACCCTAATACCAAC	0.532																																							uc004dzr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(46-48)CCT>CGT		integrin beta 1 binding protein 2							77.0	64.0	68.0					X																	70521703		2203	4300	6503	SO:0001583	missense	26548				muscle organ development|signal transduction		SH3 domain binding	g.chrX:70521703C>G	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.47C>G	X.37:g.70521703C>G	ENSP00000362935:p.Pro16Arg		Somatic				BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_5'UTR	p.P16R	NM_012278	NP_036410	WXS	Illumina HiSeq	Unspecified	Q9UKP3	ITBP2_HUMAN			1	76	+	Renal(35;0.156)		16			Cys-rich.|CHORD 1.		Q32N04|Q549J7	Missense_Mutation	SNP	ENST00000373829.3	37	c.47C>G	CCDS14411.1	.	.	.	.	.	.	.	.	.	.	c	14.14	2.447762	0.43429	.	.	ENSG00000147166	ENST00000373829	.	.	.	4.9	4.9	0.64082	Cysteine/histidine-rich domain (2);	0.259165	0.39020	N	0.001498	T	0.79834	0.4514	M	0.87900	2.915	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.82860	-0.0248	9	0.62326	D	0.03	-7.0735	12.1854	0.54236	0.0:1.0:0.0:0.0	.	16	Q9UKP3	ITBP2_HUMAN	R	16	.	ENSP00000362935:P16R	P	+	2	0	ITGB1BP2	70438428	0.705000	0.27846	0.989000	0.46669	0.957000	0.61999	1.139000	0.31504	2.265000	0.75225	0.600000	0.82982	CCT		0.532	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057126.1	NM_012278		3	82	0	0	0	0.004672	0	3	82				
TAF1	6872	broad.mit.edu	37	X	70627911	70627911	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:70627911C>A	ENST00000373790.4	+	28	4342	c.4291C>A	c.(4291-4293)Cgc>Agc	p.R1431S	TAF1_ENST00000449580.1_Missense_Mutation_p.R1431S|TAF1_ENST00000276072.3_Missense_Mutation_p.R1452S|TAF1_ENST00000423759.1_Missense_Mutation_p.R1452S	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1431	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with ASF1A and ASF1B.|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R1431S(1)|p.R1452S(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ACAAACACTCCGCGAAAACGT	0.453																																							uc004dzu.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17						c.(4291-4293)CGC>AGC		TBP-associated factor 1 isoform 2							174.0	124.0	141.0					X																	70627911		2203	4300	6503	SO:0001583	missense	6872				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity	g.chrX:70627911C>A		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4291C>A	X.37:g.70627911C>A	ENSP00000362895:p.Arg1431Ser		Somatic				BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.R1452S|TAF1_uc004dzv.3_Missense_Mutation_p.R605S|TAF1_uc010nld.1_RNA|TAF1_uc010nle.1_RNA|TAF1_uc010nlf.1_5'UTR|TAF1_uc004dzx.2_RNA|TAF1_uc004dzy.2_RNA	p.R1431S	NM_138923	NP_620278	WXS	Illumina HiSeq	Unspecified	P21675	TAF1_HUMAN			28	4342	+	Renal(35;0.156)	all_lung(315;0.000321)	1431			Bromo 1.|Interaction with ASF1A and ASF1B.|Protein kinase 2.		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	c.4291C>A	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	15.98	2.992946	0.54041	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000538124;ENST00000276072	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	4.17	4.17	0.49024	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;0.989;1.0	D;P;D	0.83275	0.996;0.768;0.991	T	0.56238	-0.8012	10	0.87932	D	0	.	11.188	0.48669	0.1834:0.8166:0.0:0.0	.	1431;1431;1452	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	S	1431;1431;1452;137;137;1452	ENSP00000362895:R1431S;ENSP00000389000:R1431S;ENSP00000406549:R1452S;ENSP00000276072:R1452S	ENSP00000276072:R1452S	R	+	1	0	TAF1	70544636	1.000000	0.71417	0.999000	0.59377	0.614000	0.37383	4.431000	0.59915	1.909000	0.55274	0.422000	0.28245	CGC		0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606		9	152	1	0	0.00621372	0.006214	0.00664495	9	152				
OGT	8473	broad.mit.edu	37	X	70787503	70787503	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:70787503G>T	ENST00000373719.3	+	20	2960	c.2743G>T	c.(2743-2745)Ggc>Tgc	p.G915C	OGT_ENST00000373701.3_Missense_Mutation_p.G905C	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	915					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.G915C(1)|p.G905C(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					CGTCAGGAGAGGCCAGCTGGC	0.527																																							uc004eaa.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|kidney(1)|pancreas(1)	5						c.(2743-2745)GGC>TGC		O-linked GlcNAc transferase isoform 1							97.0	74.0	82.0					X																	70787503		2203	4300	6503	SO:0001583	missense	8473				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity	g.chrX:70787503G>T	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2743G>T	X.37:g.70787503G>T	ENSP00000362824:p.Gly915Cys		Somatic				BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.G905C|OGT_uc004eac.2_Missense_Mutation_p.G776C|OGT_uc004ead.2_Missense_Mutation_p.G534C	p.G915C	NM_181672	NP_858058	WXS	Illumina HiSeq	Unspecified	O15294	OGT1_HUMAN			20	2960	+	Renal(35;0.156)		915					Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	c.2743G>T	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688744	0.88639	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.18810	2.19;2.19	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.57585	-0.7786	10	0.41790	T	0.15	-28.2381	17.6819	0.88246	0.0:0.0:1.0:0.0	.	789;905;915	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	C	915;905	ENSP00000362824:G915C;ENSP00000362805:G905C	ENSP00000362805:G905C	G	+	1	0	OGT	70704228	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.621000	0.98376	2.362000	0.80069	0.544000	0.68410	GGC		0.527	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		6	49	1	0	2.0095e-06	0.001984	2.44603e-06	6	49				
PHKA1	5255	broad.mit.edu	37	X	71855067	71855067	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:71855067C>T	ENST00000373542.4	-	16	1811	c.1652G>A	c.(1651-1653)tGt>tAt	p.C551Y	PHKA1_ENST00000339490.3_Missense_Mutation_p.C551Y|PHKA1_ENST00000541944.1_Missense_Mutation_p.C551Y|PHKA1_ENST00000373539.3_Missense_Mutation_p.C551Y|PHKA1_ENST00000373545.3_Missense_Mutation_p.C551Y	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	551					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.C551Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					CCAGCGGCTACAGAGGTAGGA	0.483																																							uc004eax.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1651-1653)TGT>TAT		phosphorylase kinase, alpha 1 (muscle) isoform							107.0	85.0	93.0					X																	71855067		2203	4300	6503	SO:0001583	missense	5255				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:71855067C>T		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1652G>A	X.37:g.71855067C>T	ENSP00000362643:p.Cys551Tyr		Somatic				PHKA1_uc004eay.3_Missense_Mutation_p.C551Y|PHKA1_uc011mqi.1_Missense_Mutation_p.C551Y	p.C551Y	NM_002637	NP_002628	WXS	Illumina HiSeq	Unspecified	P46020	KPB1_HUMAN			16	1953	-	Renal(35;0.156)		551					B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	c.1652G>A	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	C	6.523	0.464642	0.12402	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	4.47	4.47	0.54385	Glycoside hydrolase 15-related (1);	0.179938	0.49305	D	0.000147	D	0.89770	0.6811	L	0.38692	1.165	0.53688	D	0.999979	D;B;D	0.62365	0.991;0.005;0.973	P;B;P	0.61070	0.883;0.037;0.793	D	0.89218	0.3569	10	0.39692	T	0.17	-18.4886	13.9669	0.64213	0.0:1.0:0.0:0.0	.	551;551;551	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	Y	551	ENSP00000362646:C551Y;ENSP00000362643:C551Y;ENSP00000441251:C551Y;ENSP00000342469:C551Y;ENSP00000362640:C551Y	ENSP00000342469:C551Y	C	-	2	0	PHKA1	71771792	1.000000	0.71417	0.998000	0.56505	0.344000	0.29017	5.124000	0.64709	1.956000	0.56807	0.415000	0.27848	TGT		0.483	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			11	59	0	0	0	0.008291	0	11	59				
CDX4	1046	broad.mit.edu	37	X	72667527	72667527	+	Silent	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:72667527C>A	ENST00000373514.2	+	1	438	c.438C>A	c.(436-438)gcC>gcA	p.A146A		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	146					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A146A(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					CCGCCAAGGCCAGTTCCCCCA	0.642																																							uc011mqk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(436-438)GCC>GCA		caudal type homeobox 4							23.0	22.0	22.0					X																	72667527		2165	4222	6387	SO:0001819	synonymous_variant	1046					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:72667527C>A	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.438C>A	X.37:g.72667527C>A			Somatic					p.A146A	NM_005193	NP_005184	WXS	Illumina HiSeq	Unspecified	O14627	CDX4_HUMAN			1	438	+	Renal(35;0.156)		146					A1A513|Q5JS20	Silent	SNP	ENST00000373514.2	37	c.438C>A	CCDS14424.1																																																																																				0.642	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193		15	28	1	0	1.52009e-12	0.003163	2.21639e-12	15	28				
ABCB7	22	broad.mit.edu	37	X	74290242	74290242	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:74290242C>T	ENST00000373394.3	-	10	1330	c.1323G>A	c.(1321-1323)atG>atA	p.M441I	ABCB7_ENST00000253577.3_Missense_Mutation_p.M442I|ABCB7_ENST00000534570.1_5'UTR|ABCB7_ENST00000339447.4_Missense_Mutation_p.M401I			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	441					cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)	p.M442I(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ACAAGGTGTTCATATCTATGA	0.358																																							uc004eca.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1321-1323)ATG>ATA		ATP-binding cassette, sub-family B, member 7							154.0	152.0	152.0					X																	74290242		2203	4300	6503	SO:0001583	missense	22				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity	g.chrX:74290242C>T	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1323G>A	X.37:g.74290242C>T	ENSP00000362492:p.Met441Ile		Somatic				ABCB7_uc004ebz.2_Missense_Mutation_p.M442I|ABCB7_uc011mqn.1_Missense_Mutation_p.M415I|ABCB7_uc010nls.2_Missense_Mutation_p.M402I|ABCB7_uc010nlt.2_Missense_Mutation_p.M401I	p.M441I	NM_004299	NP_004290	WXS	Illumina HiSeq	Unspecified	O75027	ABCB7_HUMAN			10	1348	-			441					G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	ENST00000373394.3	37	c.1323G>A		.	.	.	.	.	.	.	.	.	.	c	26.6	4.749426	0.89753	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77	5.54	5.54	0.83059	ABC transporter, transmembrane domain, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.91019	0.7175	N	0.12920	0.275	0.80722	D	1	B;D;D;B;D	0.71674	0.352;0.996;0.998;0.24;0.975	B;D;D;B;P	0.83275	0.169;0.996;0.996;0.081;0.901	D	0.92037	0.5638	10	0.45353	T	0.12	-26.8868	17.4036	0.87467	0.0:1.0:0.0:0.0	.	415;401;442;441;442	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	I	415;442;401;441;415	ENSP00000253577:M442I;ENSP00000343849:M401I;ENSP00000362492:M441I;ENSP00000436586:M415I	ENSP00000253577:M442I	M	-	3	0	ABCB7	74206967	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.485000	0.81204	2.324000	0.78689	0.597000	0.82753	ATG		0.358	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		17	224	0	0	0	0.00499	0	17	224				
ATRX	546	broad.mit.edu	37	X	76937081	76937081	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:76937081C>G	ENST00000373344.5	-	9	3881	c.3667G>C	c.(3667-3669)Gaa>Caa	p.E1223Q	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.E1185Q	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1223	Interaction with DAXX.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.E1223Q(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATTTTCTGTTCATCGCTGCTT	0.343			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		3	Substitution - Missense(2)|Unknown(1)		lung(2)|bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(3667-3669)GAA>CAA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						135.0	118.0	124.0					X																	76937081		2203	4296	6499	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76937081C>G	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3667G>C	X.37:g.76937081C>G	ENSP00000362441:p.Glu1223Gln		Somatic				ATRX_uc004ecq.3_Missense_Mutation_p.E1185Q|ATRX_uc004eco.3_Missense_Mutation_p.E1008Q|ATRX_uc004ecr.2_Missense_Mutation_p.E1155Q|ATRX_uc010nlx.1_Missense_Mutation_p.E1194Q|ATRX_uc010nly.1_Missense_Mutation_p.E1168Q	p.E1223Q	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			9	3899	-			1223					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.3667G>C	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732372	0.48939	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.93547	-3.24;-3.24	5.73	5.73	0.89815	.	0.357193	0.27064	N	0.021115	D	0.94611	0.8263	L	0.45581	1.43	0.80722	D	1	D;D;D;D	0.71674	0.979;0.996;0.998;0.979	P;P;D;P	0.80764	0.702;0.835;0.994;0.702	D	0.93671	0.6990	10	0.41790	T	0.15	-17.2197	11.3762	0.49730	0.0:0.9153:0.0:0.0847	.	1223;1155;1185;1223	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	Q	1223;1185;1150	ENSP00000362441:E1223Q;ENSP00000378967:E1185Q	ENSP00000362441:E1223Q	E	-	1	0	ATRX	76823737	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.599000	0.61076	2.397000	0.81536	0.513000	0.50165	GAA		0.343	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		14	182	0	0	0	0.00245	0	14	182				
ATP7A	538	broad.mit.edu	37	X	77266706	77266706	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:77266706G>T	ENST00000341514.6	+	8	2058	c.1903G>T	c.(1903-1905)Gat>Tat	p.D635Y	ATP7A_ENST00000343533.5_Missense_Mutation_p.D635Y|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	635					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.D635Y(2)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GGTCAAGAAGGATCGGTCAGC	0.303																																							uc004ecx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1903-1905)GAT>TAT		ATPase, Cu++ transporting, alpha polypeptide							102.0	97.0	99.0					X																	77266706		2203	4295	6498	SO:0001583	missense	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77266706G>T	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.1903G>T	X.37:g.77266706G>T	ENSP00000345728:p.Asp635Tyr		Somatic				ATP7A_uc004ecw.2_3'UTR	p.D635Y	NM_000052	NP_000043	WXS	Illumina HiSeq	Unspecified	Q04656	ATP7A_HUMAN			8	2063	+			635			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	c.1903G>T	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218122	0.79464	.	.	ENSG00000165240	ENST00000343533;ENST00000341514	D;D	0.96992	-4.2;-4.19	5.38	5.38	0.77491	Heavy metal-associated domain, HMA (1);	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	M	0.69358	2.11	0.80722	D	1	D	0.54601	0.967	P	0.56916	0.809	D	0.97868	1.0284	10	0.72032	D	0.01	-0.8312	18.2199	0.89898	0.0:0.0:1.0:0.0	.	635	Q04656	ATP7A_HUMAN	Y	635	ENSP00000343026:D635Y;ENSP00000345728:D635Y	ENSP00000345728:D635Y	D	+	1	0	ATP7A	77153362	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.209000	0.95087	2.240000	0.73641	0.506000	0.49869	GAT		0.303	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		7	121	1	0	0.00198382	0.001984	0.00216243	7	121				
BRWD3	254065	broad.mit.edu	37	X	79980529	79980529	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:79980529G>A	ENST00000373275.4	-	15	1640	c.1424C>T	c.(1423-1425)cCa>cTa	p.P475L	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	475					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.P475L(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTGATCAAATGGATGGGCTTC	0.358																																							uc004edt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1423-1425)CCA>CTA		bromodomain and WD repeat domain containing 3							95.0	82.0	86.0					X																	79980529		2203	4299	6502	SO:0001583	missense	254065							g.chrX:79980529G>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1424C>T	X.37:g.79980529G>A	ENSP00000362372:p.Pro475Leu		Somatic				BRWD3_uc004edo.2_Missense_Mutation_p.P71L|BRWD3_uc004edp.2_Missense_Mutation_p.P304L|BRWD3_uc004edq.2_Missense_Mutation_p.P71L|BRWD3_uc010nmj.1_Missense_Mutation_p.P71L|BRWD3_uc004edr.2_Missense_Mutation_p.P145L|BRWD3_uc004eds.2_Missense_Mutation_p.P71L|BRWD3_uc004edu.2_Missense_Mutation_p.P145L|BRWD3_uc004edv.2_Missense_Mutation_p.P71L|BRWD3_uc004edw.2_Missense_Mutation_p.P71L|BRWD3_uc004edx.2_Missense_Mutation_p.P71L|BRWD3_uc004edy.2_Missense_Mutation_p.P71L|BRWD3_uc004edz.2_Missense_Mutation_p.P145L|BRWD3_uc004eea.2_Missense_Mutation_p.P145L|BRWD3_uc004eeb.2_Missense_Mutation_p.P71L	p.P475L	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			15	1687	-			475			WD 8.		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.1424C>T	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026043	0.93518	.	.	ENSG00000165288	ENST00000373275	T	0.71222	-0.55	5.35	5.35	0.76521	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85548	0.5722	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86458	0.1777	9	.	.	.	-9.9013	18.1599	0.89705	0.0:0.0:1.0:0.0	.	475	Q6RI45	BRWD3_HUMAN	L	475	ENSP00000362372:P475L	.	P	-	2	0	BRWD3	79867185	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.263000	0.95617	2.481000	0.83766	0.600000	0.82982	CCA		0.358	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		3	46	0	0	0	0.004672	0	3	46				
POU3F4	5456	broad.mit.edu	37	X	82763626	82763626	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:82763626G>A	ENST00000373200.2	+	1	358	c.294G>A	c.(292-294)tcG>tcA	p.S98S	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	98					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S98S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						ATCACCGCTCGCCACACGTAG	0.672																																							uc004eeg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(292-294)TCG>TCA		POU domain, class 3, transcription factor 4							38.0	32.0	34.0					X																	82763626		2196	4297	6493	SO:0001819	synonymous_variant	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82763626G>A	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.294G>A	X.37:g.82763626G>A			Somatic					p.S98S	NM_000307	NP_000298	WXS	Illumina HiSeq	Unspecified	P49335	PO3F4_HUMAN			1	358	+			98					B2RC71|Q5H9G9|Q99410	Silent	SNP	ENST00000373200.2	37	c.294G>A	CCDS14450.1																																																																																				0.672	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		7	11	0	0	0	0.001984	0	7	11				
POU3F4	5456	broad.mit.edu	37	X	82763897	82763897	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:82763897C>A	ENST00000373200.2	+	1	629	c.565C>A	c.(565-567)Cca>Aca	p.P189T	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	189	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P189T(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CGAGGAGACGCCAACCTCTGA	0.602																																							uc004eeg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(565-567)CCA>ACA		POU domain, class 3, transcription factor 4							39.0	36.0	37.0					X																	82763897		2203	4300	6503	SO:0001583	missense	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82763897C>A	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.565C>A	X.37:g.82763897C>A	ENSP00000362296:p.Pro189Thr		Somatic					p.P189T	NM_000307	NP_000298	WXS	Illumina HiSeq	Unspecified	P49335	PO3F4_HUMAN			1	629	+			189			POU-specific.		B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	c.565C>A	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904520	0.72868	.	.	ENSG00000196767	ENST00000373200	D	0.82255	-1.59	5.31	5.31	0.75309	POU-specific (3);	0.000000	0.85682	D	0.000000	D	0.87509	0.6195	L	0.46885	1.475	0.80722	D	1	P	0.45474	0.859	P	0.58620	0.842	D	0.87949	0.2722	10	0.56958	D	0.05	.	17.9142	0.88944	0.0:1.0:0.0:0.0	.	189	P49335	PO3F4_HUMAN	T	189	ENSP00000362296:P189T	ENSP00000362296:P189T	P	+	1	0	POU3F4	82650553	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.248000	0.78268	2.357000	0.79964	0.525000	0.51046	CCA		0.602	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		22	13	1	0	3.62473e-10	0.012319	4.96478e-10	22	13				
CPXCR1	53336	broad.mit.edu	37	X	88009014	88009014	+	Nonsense_Mutation	SNP	C	C	A	rs375625114		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:88009014C>A	ENST00000276127.4	+	3	858	c.599C>A	c.(598-600)tCg>tAg	p.S200*	CPXCR1_ENST00000373111.1_Nonsense_Mutation_p.S200*	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	200							metal ion binding (GO:0046872)	p.S200*(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AGAAGGCCTTCGAGGGTGCAC	0.418																																							uc004efd.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(598-600)TCG>TAG		CPX chromosome region, candidate 1							71.0	57.0	62.0					X																	88009014		2203	4300	6503	SO:0001587	stop_gained	53336					intracellular	zinc ion binding	g.chrX:88009014C>A	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.599C>A	X.37:g.88009014C>A	ENSP00000276127:p.Ser200*		Somatic				CPXCR1_uc004efc.3_Nonsense_Mutation_p.S200*	p.S200*	NM_033048	NP_149037	WXS	Illumina HiSeq	Unspecified	Q8N123	CPXCR_HUMAN			3	858	+			200					B2R9F9|D3DTE7|Q96RS3	Nonsense_Mutation	SNP	ENST00000276127.4	37	c.599C>A	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.088235	0.55968	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	.	.	.	3.06	-0.911	0.10507	.	1.033420	0.07805	N	0.957132	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.3241	5.9567	0.19277	0.0:0.3056:0.0:0.6944	.	.	.	.	X	200	.	.	S	+	2	0	CPXCR1	87895670	0.044000	0.20184	0.011000	0.14972	0.004000	0.04260	-0.106000	0.10890	-0.249000	0.09569	-1.190000	0.01697	TCG		0.418	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		16	26	1	0	6.31663e-08	0.003163	8.15747e-08	16	26				
TGIF2LX	90316	broad.mit.edu	37	X	89177192	89177192	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:89177192T>A	ENST00000561129.2	+	1	238	c.108T>A	c.(106-108)aaT>aaA	p.N36K	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.N36K			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	36					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.N36K(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						TGTCGAGAAATAACGCAGATA	0.572																																							uc004efe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(106-108)AAT>AAA		TGFB-induced factor homeobox 2-like, X-linked							23.0	27.0	25.0					X																	89177192		2201	4271	6472	SO:0001583	missense	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177192T>A	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.108T>A	X.37:g.89177192T>A	ENSP00000453704:p.Asn36Lys		Somatic					p.N36K	NM_138960	NP_620410	WXS	Illumina HiSeq	Unspecified	Q8IUE1	TF2LX_HUMAN			2	157	+			36					Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	c.108T>A	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	T	9.024	0.985565	0.18889	.	.	ENSG00000153779	ENST00000283891	T	0.63913	-0.07	1.76	0.499	0.16914	.	.	.	.	.	T	0.49626	0.1568	L	0.55481	1.735	0.09310	N	1	B	0.32573	0.376	B	0.30401	0.115	T	0.35025	-0.9805	8	.	.	.	0.0242	4.3321	0.11069	0.0:0.0:0.3544:0.6456	.	36	Q8IUE1	TF2LX_HUMAN	K	36	ENSP00000355119:N36K	.	N	+	3	2	TGIF2LX	89063848	0.022000	0.18835	0.000000	0.03702	0.002000	0.02628	0.702000	0.25631	0.074000	0.16767	0.417000	0.27973	AAT		0.572	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		18	26	0	0	0	0.004289	0	18	26				
TGIF2LX	90316	broad.mit.edu	37	X	89177194	89177194	+	Missense_Mutation	SNP	A	A	G	rs540837899		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:89177194A>G	ENST00000561129.2	+	1	240	c.110A>G	c.(109-111)aAc>aGc	p.N37S	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.N37S			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.N37S(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						TCGAGAAATAACGCAGATACA	0.562																																							uc004efe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(109-111)AAC>AGC		TGFB-induced factor homeobox 2-like, X-linked							23.0	26.0	25.0					X																	89177194		2201	4271	6472	SO:0001583	missense	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177194A>G	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.110A>G	X.37:g.89177194A>G	ENSP00000453704:p.Asn37Ser		Somatic					p.N37S	NM_138960	NP_620410	WXS	Illumina HiSeq	Unspecified	Q8IUE1	TF2LX_HUMAN			2	159	+			37					Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	c.110A>G	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	A	1.994	-0.431164	0.04669	.	.	ENSG00000153779	ENST00000283891	T	0.65178	-0.14	1.76	0.57	0.17347	.	.	.	.	.	T	0.40040	0.1101	N	0.21097	0.63	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18085	-1.0348	8	.	.	.	-2.9783	3.3283	0.07075	0.7658:0.0:0.2342:0.0	.	37	Q8IUE1	TF2LX_HUMAN	S	37	ENSP00000355119:N37S	.	N	+	2	0	TGIF2LX	89063850	0.025000	0.19082	0.000000	0.03702	0.003000	0.03518	0.894000	0.28350	0.096000	0.17463	0.417000	0.27973	AAC		0.562	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		17	25	0	0	0	0.003755	0	17	25				
XKRX	402415	broad.mit.edu	37	X	100183084	100183084	+	Silent	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:100183084G>C	ENST00000372956.2	-	1	814	c.210C>G	c.(208-210)acC>acG	p.T70T	XKRX_ENST00000328526.5_Silent_p.T83T|XKRX_ENST00000468904.1_Silent_p.T70T			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T83T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						AGAAAGAAAAGGTGTATGTCA	0.383																																							uc004egn.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(208-210)ACC>ACG		XK, Kell blood group complex subunit-related,							143.0	134.0	137.0					X																	100183084		2203	4300	6503	SO:0001819	synonymous_variant	402415					integral to membrane|plasma membrane		g.chrX:100183084G>C	AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.210C>G	X.37:g.100183084G>C			Somatic				XKRX_uc011mre.1_5'UTR	p.T70T	NM_212559	NP_997724	WXS	Illumina HiSeq	Unspecified	Q6PP77	XKR2_HUMAN			1	815	-			70			Helical; (Potential).		B2RNN6|B4DKU2|Q5H9J6	Silent	SNP	ENST00000372956.2	37	c.210C>G	CCDS14476.2																																																																																				0.383	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057501.3	NM_212559		52	66	0	0	0	0.01441	0	52	66				
ARMCX5	64860	broad.mit.edu	37	X	101857749	101857749	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:101857749C>A	ENST00000604957.1	+	1	3302	c.680C>A	c.(679-681)gCc>gAc	p.A227D	ARMCX5_ENST00000246174.2_Missense_Mutation_p.A227D|ARMCX5_ENST00000372742.1_Missense_Mutation_p.A227D|RP4-769N13.7_ENST00000602441.1_RNA|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000537008.1_Missense_Mutation_p.A227D|ARMCX5_ENST00000536530.1_Missense_Mutation_p.A227D|ARMCX5_ENST00000541409.1_Missense_Mutation_p.A227D	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	227								p.A227D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TGGTCAAGGGCCAGGTATATT	0.473																																							uc004ejg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(679-681)GCC>GAC		armadillo repeat containing, X-linked 5							120.0	112.0	115.0					X																	101857749		2203	4300	6503	SO:0001583	missense	64860						binding	g.chrX:101857749C>A		CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.680C>A	X.37:g.101857749C>A	ENSP00000474720:p.Ala227Asp		Somatic				ARMCX5_uc004ejh.2_Missense_Mutation_p.A227D	p.A227D	NM_022838	NP_073749	WXS	Illumina HiSeq	Unspecified	Q6P1M9	ARMX5_HUMAN			6	1561	+			227					B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	ENST00000604957.1	37	c.680C>A	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818675	0.16607	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	3.7	-0.415	0.12355	.	0.369708	0.19961	N	0.102202	T	0.08358	0.0208	N	0.14661	0.345	0.24894	N	0.992141	P	0.48911	0.917	B	0.38655	0.278	T	0.26155	-1.0111	10	0.66056	D	0.02	-0.1671	2.2107	0.03947	0.1795:0.3413:0.3599:0.1193	.	227	Q6P1M9	ARMX5_HUMAN	D	227	ENSP00000246174:A227D;ENSP00000439001:A227D;ENSP00000446385:A227D;ENSP00000445851:A227D;ENSP00000361827:A227D	ENSP00000246174:A227D	A	+	2	0	ARMCX5	101744405	0.685000	0.27652	0.907000	0.35723	0.344000	0.29017	-0.322000	0.08007	-0.208000	0.10171	-0.191000	0.12829	GCC		0.473	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838		9	120	1	0	2.17888e-05	0.006214	2.52959e-05	9	120				
BHLHB9	80823	broad.mit.edu	37	X	102004609	102004609	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:102004609C>G	ENST00000372735.1	+	4	1271	c.686C>G	c.(685-687)gCt>gGt	p.A229G	BHLHB9_ENST00000457056.1_Missense_Mutation_p.A229G|BHLHB9_ENST00000447531.1_Missense_Mutation_p.A229G|BHLHB9_ENST00000448867.1_Missense_Mutation_p.A229G|BHLHB9_ENST00000361229.4_Missense_Mutation_p.A229G			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	229					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.A229G(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GTAACTCCAGCTGTGTTAGGA	0.473																																							uc010nog.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(685-687)GCT>GGT		basic helix-loop-helix domain containing, class							90.0	87.0	88.0					X																	102004609		2203	4300	6503	SO:0001583	missense	80823					cytoplasm|nucleus	binding	g.chrX:102004609C>G	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.686C>G	X.37:g.102004609C>G	ENSP00000361820:p.Ala229Gly		Somatic				BHLHB9_uc011mrq.1_Missense_Mutation_p.A229G|BHLHB9_uc011mrr.1_Missense_Mutation_p.A229G|BHLHB9_uc011mrs.1_Missense_Mutation_p.A229G|BHLHB9_uc011mrt.1_Missense_Mutation_p.A229G|BHLHB9_uc004ejo.2_Missense_Mutation_p.A229G|BHLHB9_uc011mru.1_Missense_Mutation_p.A229G|BHLHB9_uc011mrv.1_Missense_Mutation_p.A229G	p.A229G	NM_001142526	NP_001135998	WXS	Illumina HiSeq	Unspecified	Q6PI77	BHLH9_HUMAN			4	1257	+			229					Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	c.686C>G	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062368	0.55432	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	4.59	4.59	0.56863	.	0.000000	0.44902	D	0.000417	T	0.28665	0.0710	L	0.51422	1.61	0.26264	N	0.978532	D	0.76494	0.999	D	0.78314	0.991	T	0.02161	-1.1203	9	.	.	.	-15.1302	11.6852	0.51481	0.0:1.0:0.0:0.0	.	229	Q6PI77	BHLH9_HUMAN	G	229	ENSP00000403226:A229G;ENSP00000354675:A229G;ENSP00000405893:A229G;ENSP00000391722:A229G;ENSP00000361820:A229G	.	A	+	2	0	BHLHB9	101891265	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.589000	0.36644	2.534000	0.85438	0.597000	0.82753	GCT		0.473	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		36	167	0	0	0	0.004878	0	36	167				
TCEAL5	340543	broad.mit.edu	37	X	102529194	102529194	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:102529194G>T	ENST00000372680.1	-	3	592	c.298C>A	c.(298-300)Ccg>Acg	p.P100T		NM_001012979.2	NP_001012997.1	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P100T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						GCGGCCCGCGGCTGGCTCTCT	0.592																																							uc004ejz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(298-300)CCG>ACG		transcription elongation factor A (SII)-like 5							87.0	90.0	89.0					X																	102529194		2202	4300	6502	SO:0001583	missense	340543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chrX:102529194G>T		CCDS35356.1	Xq22.2	2014-03-21			ENSG00000204065	ENSG00000204065			22282	protein-coding gene	gene with protein product						16221301	Standard	NM_001012979		Approved	WEX4	uc004ejz.2	Q5H9L2	OTTHUMG00000022092	ENST00000372680.1:c.298C>A	X.37:g.102529194G>T	ENSP00000361765:p.Pro100Thr		Somatic					p.P100T	NM_001012979	NP_001012997	WXS	Illumina HiSeq	Unspecified	Q5H9L2	TCAL5_HUMAN			3	593	-			100					A2RUJ4	Missense_Mutation	SNP	ENST00000372680.1	37	c.298C>A	CCDS35356.1	.	.	.	.	.	.	.	.	.	.	G	9.683	1.149867	0.21371	.	.	ENSG00000204065	ENST00000372680	T	0.22539	1.95	2.93	-1.23	0.09465	.	1.298000	0.05703	N	0.594409	T	0.12092	0.0294	L	0.31065	0.9	0.09310	N	1	P	0.37594	0.601	B	0.36608	0.229	T	0.15407	-1.0438	10	0.23891	T	0.37	.	0.3417	0.00335	0.2845:0.2055:0.3118:0.1982	.	100	Q5H9L2	TCAL5_HUMAN	T	100	ENSP00000361765:P100T	ENSP00000361765:P100T	P	-	1	0	TCEAL5	102415850	0.004000	0.15560	0.000000	0.03702	0.849000	0.48306	0.169000	0.16641	-0.447000	0.07138	0.292000	0.19580	CCG		0.592	TCEAL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057696.1	XM_291334		17	139	1	0	3.52763e-06	0.00499	4.24066e-06	17	139				
RAB9B	51209	broad.mit.edu	37	X	103080375	103080375	+	Missense_Mutation	SNP	G	G	A	rs372221720		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:103080375G>A	ENST00000243298.2	-	3	624	c.340C>T	c.(340-342)Cct>Tct	p.P114S		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	114					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)	p.P114S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						AAATGCTCAGGGTCCTTCACA	0.483																																							uc004ell.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)	3						c.(340-342)CCT>TCT		RAB9B, member RAS oncogene family							166.0	165.0	165.0					X																	103080375		2203	4300	6503	SO:0001583	missense	51209				Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding	g.chrX:103080375G>A	AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.340C>T	X.37:g.103080375G>A	ENSP00000243298:p.Pro114Ser		Somatic				RAB9B_uc004eli.1_Intron	p.P114S	NM_016370	NP_057454	WXS	Illumina HiSeq	Unspecified	Q9NP90	RAB9B_HUMAN			3	625	-			114					B2R8M0|Q52LX2	Missense_Mutation	SNP	ENST00000243298.2	37	c.340C>T	CCDS14515.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.531972	0.45073	.	.	ENSG00000123570	ENST00000243298	T	0.69306	-0.39	5.67	5.67	0.87782	Small GTP-binding protein domain (1);	0.048543	0.85682	D	0.000000	T	0.61123	0.2322	L	0.42529	1.33	0.80722	D	1	B	0.24426	0.103	B	0.21360	0.034	T	0.60151	-0.7319	10	0.62326	D	0.03	-28.3281	16.0063	0.80363	0.0:0.0:1.0:0.0	.	114	Q9NP90	RAB9B_HUMAN	S	114	ENSP00000243298:P114S	ENSP00000243298:P114S	P	-	1	0	RAB9B	102967031	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.899000	0.87370	2.381000	0.81170	0.600000	0.82982	CCT		0.483	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057746.1			165	179	0	0	0	0.01441	0	165	179				
IRS4	8471	broad.mit.edu	37	X	107978507	107978507	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:107978507G>T	ENST00000372129.2	-	1	1144	c.1068C>A	c.(1066-1068)tcC>tcA	p.S356S	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	356					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.S356S(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCCTCCTAGCGGACAGCAGGG	0.622																																							uc004eoc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1066-1068)TCC>TCA		insulin receptor substrate 4							103.0	109.0	107.0					X																	107978507		2203	4300	6503	SO:0001819	synonymous_variant	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978507G>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1068C>A	X.37:g.107978507G>T			Somatic					p.S356S	NM_003604	NP_003595	WXS	Illumina HiSeq	Unspecified	O14654	IRS4_HUMAN			1	1101	-			356						Silent	SNP	ENST00000372129.2	37	c.1068C>A	CCDS14544.1																																																																																				0.622	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		16	199	1	0	2.31682e-05	0.003163	2.68056e-05	16	199				
ACSL4	2182	broad.mit.edu	37	X	108911376	108911376	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:108911376C>A	ENST00000469796.2	-	11	1788	c.1392G>T	c.(1390-1392)caG>caT	p.Q464H	ACSL4_ENST00000340800.2_Missense_Mutation_p.Q464H|ACSL4_ENST00000348502.6_Missense_Mutation_p.Q423H			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	464					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.Q464H(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	GTCCATAACCCTGGCCAATTG	0.473																																					Pancreas(188;358 2127 38547 41466 45492)	Pancreas(188;358 2127 38547 41466 45492)	uc004eoi.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)	3						c.(1390-1392)CAG>CAT		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Troglitazone(DB00197)						151.0	128.0	136.0					X																	108911376		2203	4300	6503	SO:0001583	missense	2182				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chrX:108911376C>A	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1392G>T	X.37:g.108911376C>A	ENSP00000419171:p.Gln464His		Somatic				ACSL4_uc004eoj.2_Missense_Mutation_p.Q423H|ACSL4_uc004eok.2_Missense_Mutation_p.Q423H|ACSL4_uc010npp.1_Missense_Mutation_p.Q464H	p.Q464H	NM_022977	NP_075266	WXS	Illumina HiSeq	Unspecified	O60488	ACSL4_HUMAN			12	1897	-			464			Cytoplasmic (Potential).		D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	c.1392G>T	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565486	0.65651	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.11495	2.77;2.77;2.77	5.5	3.74	0.42951	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.44221	-0.9342	10	0.87932	D	0	-10.5757	9.6743	0.40032	0.0:0.707:0.0:0.293	.	464	O60488	ACSL4_HUMAN	H	423;464;464	ENSP00000262835:Q423H;ENSP00000419171:Q464H;ENSP00000339787:Q464H	ENSP00000339787:Q464H	Q	-	3	2	ACSL4	108798032	0.995000	0.38212	0.998000	0.56505	0.895000	0.52256	0.504000	0.22626	0.518000	0.28383	0.600000	0.82982	CAG		0.473	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458		6	114	1	0	8.12818e-05	0.001984	9.26203e-05	6	114				
C1GALT1C1	29071	broad.mit.edu	37	X	119760065	119760065	+	Nonstop_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:119760065T>A	ENST00000304661.5	-	2	1195	c.957A>T	c.(955-957)tgA>tgT	p.*319C	C1GALT1C1_ENST00000371313.2_Nonstop_Mutation_p.*319C	NM_001011551.2	NP_001011551.1	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	0					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.*319C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	11						CTACCACTTCTCAGTCATTGT	0.373																																							uc004esy.2		NA																	1	Nonstop extension(1)		lung(1)		0						c.(955-957)TGA>TGT		C1GALT1-specific chaperone 1							88.0	72.0	77.0					X																	119760065		2202	4300	6502	SO:0001578	stop_lost	29071					integral to membrane		g.chrX:119760065T>A	AJ238398	CCDS14602.1	Xq24	2008-02-05			ENSG00000171155	ENSG00000171155			24338	protein-coding gene	gene with protein product		300611				11042152, 12361956	Standard	NM_152692		Approved	COSMC, C1GALT2	uc004esz.3	Q96EU7	OTTHUMG00000022305	ENST00000304661.5:c.957A>T	X.37:g.119760065T>A			Somatic				C1GALT1C1_uc004esz.2_Nonstop_Mutation_p.*319C	p.*319C	NM_152692	NP_689905	WXS	Illumina HiSeq	Unspecified	Q96EU7	C1GLC_HUMAN			3	1304	-			319					A8K246|Q8WWS3|Q9NZX1	Nonstop_Mutation	SNP	ENST00000304661.5	37	c.957A>T	CCDS14602.1	.	.	.	.	.	.	.	.	.	.	T	9.626	1.135192	0.21123	.	.	ENSG00000171155	ENST00000304661;ENST00000371313	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7974	0.63180	0.0:0.0:0.0:1.0	.	.	.	.	C	319	.	.	X	-	3	0	C1GALT1C1	119644093	1.000000	0.71417	0.742000	0.31022	0.497000	0.33675	5.533000	0.67160	1.923000	0.55706	0.441000	0.28932	TGA		0.373	C1GALT1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058117.1	NM_152692		39	44	0	0	0	0.00874	0	39	44				
STAG2	10735	broad.mit.edu	37	X	123210221	123210221	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:123210221T>C	ENST00000371160.1	+	26	2863	c.2573T>C	c.(2572-2574)cTg>cCg	p.L858P	STAG2_ENST00000354548.5_Missense_Mutation_p.L789P|STAG2_ENST00000371157.3_Missense_Mutation_p.L858P|STAG2_ENST00000371144.3_Missense_Mutation_p.L858P|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.L858P|STAG2_ENST00000371145.3_Missense_Mutation_p.L858P	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	858					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.L858P(2)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						ATTGAAGCTCTGCACAAGAGA	0.343																																							uc004etz.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(2572-2574)CTG>CCG		stromal antigen 2 isoform b							102.0	105.0	104.0					X																	123210221		2203	4299	6502	SO:0001583	missense	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123210221T>C	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2573T>C	X.37:g.123210221T>C	ENSP00000360202:p.Leu858Pro		Somatic				STAG2_uc004eua.2_Missense_Mutation_p.L858P|STAG2_uc004eub.2_Missense_Mutation_p.L858P|STAG2_uc004euc.2_Missense_Mutation_p.L858P|STAG2_uc004eud.2_Missense_Mutation_p.L858P|STAG2_uc004eue.2_Missense_Mutation_p.L858P	p.L858P	NM_006603	NP_006594	WXS	Illumina HiSeq	Unspecified	Q8N3U4	STAG2_HUMAN			25	2912	+			858					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	c.2573T>C	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.251759	0.80135	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.45276	1.26;0.92;0.9;0.9;1.26;0.9	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.69124	0.3076	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.75783	-0.3196	10	0.87932	D	0	-1.4522	14.7501	0.69519	0.0:0.0:0.0:1.0	.	858;858	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	P	858;789;858;858;858;858	ENSP00000218089:L858P;ENSP00000346555:L789P;ENSP00000360202:L858P;ENSP00000360199:L858P;ENSP00000360187:L858P;ENSP00000360186:L858P	ENSP00000218089:L858P	L	+	2	0	STAG2	123037902	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	1.933000	0.56026	0.441000	0.28932	CTG		0.343	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		12	152	0	0	0	0.013537	0	12	152				
TENM1	10178	broad.mit.edu	37	X	123515010	123515010	+	Silent	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:123515010G>C	ENST00000371130.3	-	31	7617	c.7554C>G	c.(7552-7554)gtC>gtG	p.V2518V	TENM1_ENST00000422452.2_Silent_p.V2525V|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2518					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V2520V(1)									AAACAGAAGGGACAGCAGCAA	0.458																																							uc004euj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(7552-7554)GTC>GTG		odz, odd Oz/ten-m homolog 1 isoform 3							108.0	103.0	105.0					X																	123515010		2202	4300	6502	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123515010G>C	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7554C>G	X.37:g.123515010G>C			Somatic				ODZ1_uc011muj.1_Silent_p.V2524V|ODZ1_uc010nqy.2_Silent_p.V2525V	p.V2518V	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			31	7618	-			2518			Extracellular (Potential).		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.7554C>G	CCDS14609.1																																																																																				0.458	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		15	146	0	0	0	0.003163	0	15	146				
DCAF12L2	340578	broad.mit.edu	37	X	125299761	125299761	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:125299761G>A	ENST00000360028.2	-	1	173	c.147C>T	c.(145-147)cgC>cgT	p.R49R	DCAF12L2_ENST00000538699.1_Silent_p.R49R			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	49								p.R49R(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCACCAGCCTGCGACGCGTCG	0.726																																							uc004euk.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(145-147)CGC>CGT		DDB1 and CUL4 associated factor 12-like 2							13.0	16.0	15.0					X																	125299761		1859	3763	5622	SO:0001819	synonymous_variant	340578							g.chrX:125299761G>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.147C>T	X.37:g.125299761G>A			Somatic					p.R49R	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	174	-			49					B2RN42	Silent	SNP	ENST00000360028.2	37	c.147C>T	CCDS43991.1																																																																																				0.726	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		26	27	0	0	0	0.00632	0	26	27				
XPNPEP2	7512	broad.mit.edu	37	X	128881584	128881584	+	Splice_Site	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:128881584C>A	ENST00000371106.3	+	7	684	c.492C>A	c.(490-492)gaC>gaA	p.D164E		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	164						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.D164E(1)		endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TCTCTGCAGACACCTGGGAGA	0.512																																							uc004eut.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(490-492)GAC>GAA		X-prolyl aminopeptidase 2, membrane-bound							101.0	79.0	87.0					X																	128881584		2203	4299	6502	SO:0001630	splice_region_variant	7512				cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity	g.chrX:128881584C>A	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.491-1C>A	X.37:g.128881584C>A			Somatic				XPNPEP2_uc011mum.1_Missense_Mutation_p.D164E	p.D164E	NM_003399	NP_003390	WXS	Illumina HiSeq	Unspecified	O43895	XPP2_HUMAN			7	736	+			164					A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	c.492C>A	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	C	6.561	0.471861	0.12461	.	.	ENSG00000122121	ENST00000371106	T	0.73363	-0.74	4.82	-0.0814	0.13702	Creatinase (1);	0.544768	0.20625	N	0.088693	T	0.53769	0.1817	N	0.21324	0.655	0.09310	N	1	B;B	0.22480	0.07;0.018	B;B	0.17098	0.017;0.016	T	0.33979	-0.9847	10	0.25106	T	0.35	.	7.7579	0.28936	0.0:0.4788:0.0:0.5212	.	164;164	B4DV70;O43895	.;XPP2_HUMAN	E	164	ENSP00000360147:D164E	ENSP00000360147:D164E	D	+	3	2	XPNPEP2	128709265	0.003000	0.15002	0.039000	0.18376	0.491000	0.33493	-0.075000	0.11431	-0.180000	0.10637	0.513000	0.50165	GAC		0.512	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	Missense_Mutation	47	47	1	0	7.88023e-25	0.01441	1.37701e-24	47	47				
ARHGAP36	158763	broad.mit.edu	37	X	130217848	130217848	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:130217848G>A	ENST00000276211.5	+	4	805	c.460G>A	c.(460-462)Gtg>Atg	p.V154M	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.V18M|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.V142M	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	154	Arg-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.V154M(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						TCGGGGAAACGTGGTGCGAAG	0.632																																							uc004evz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(460-462)GTG>ATG		hypothetical protein LOC158763 precursor							85.0	81.0	82.0					X																	130217848		2203	4300	6503	SO:0001583	missense	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130217848G>A		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.460G>A	X.37:g.130217848G>A	ENSP00000276211:p.Val154Met		Somatic				ARHGAP36_uc004ewa.2_Missense_Mutation_p.V142M|ARHGAP36_uc004ewb.2_Missense_Mutation_p.V123M|ARHGAP36_uc004ewc.2_Missense_Mutation_p.V18M	p.V154M	NM_144967	NP_659404	WXS	Illumina HiSeq	Unspecified	Q6ZRI8	RHG36_HUMAN			4	805	+			154			Arg-rich.		B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	c.460G>A	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495127	0.26774	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T	0.13778	2.8;2.8;2.82;2.56	4.3	2.52	0.30459	.	0.364125	0.20535	N	0.090426	T	0.08714	0.0216	N	0.14661	0.345	0.24550	N	0.994027	P;P;P	0.46656	0.882;0.882;0.813	B;P;B	0.46299	0.388;0.511;0.313	T	0.16012	-1.0417	10	0.33141	T	0.24	.	4.9962	0.14240	0.1182:0.2107:0.6711:0.0	.	123;142;154	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	M	154;142;106;123;18	ENSP00000276211:V154M;ENSP00000359960:V142M;ENSP00000408515:V123M;ENSP00000359959:V18M	ENSP00000276211:V154M	V	+	1	0	ARHGAP36	130045529	1.000000	0.71417	0.999000	0.59377	0.427000	0.31564	0.951000	0.29135	0.553000	0.29044	0.600000	0.82982	GTG		0.632	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		9	128	0	0	0	0.008291	0	9	128				
IGSF1	3547	broad.mit.edu	37	X	130416645	130416645	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:130416645C>A	ENST00000361420.3	-	7	1098	c.1019G>T	c.(1018-1020)aGc>aTc	p.S340I	IGSF1_ENST00000370910.1_Missense_Mutation_p.S331I|IGSF1_ENST00000370904.1_Missense_Mutation_p.S331I|IGSF1_ENST00000370903.3_Missense_Mutation_p.S340I			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	340	Ig-like C2-type 4.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.S340I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ACACCGTAGGCTCACATTCTG	0.498																																							uc004ewd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(1018-1020)AGC>ATC		immunoglobulin superfamily, member 1 isoform 1							126.0	107.0	113.0					X																	130416645		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130416645C>A	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1019G>T	X.37:g.130416645C>A	ENSP00000355010:p.Ser340Ile		Somatic				IGSF1_uc004ewe.3_Missense_Mutation_p.S329I|IGSF1_uc004ewf.2_Missense_Mutation_p.S320I	p.S340I	NM_001555	NP_001546	WXS	Illumina HiSeq	Unspecified	Q8N6C5	IGSF1_HUMAN			7	1257	-			340			Ig-like C2-type 4.|Extracellular (Potential).		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.1019G>T	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	9.731	1.162216	0.21538	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	4.78	1.82	0.25136	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.207655	0.34777	N	0.003697	T	0.19846	0.0477	L	0.33245	0.995	0.09310	N	0.99999	D;D	0.76494	0.999;0.996	D;D	0.77557	0.975;0.99	T	0.03008	-1.1083	10	0.45353	T	0.12	.	5.724	0.18002	0.0:0.5097:0.3801:0.1102	.	331;340	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	I	331;340;331;340	ENSP00000359947:S331I;ENSP00000355010:S340I;ENSP00000359941:S331I;ENSP00000359940:S340I	ENSP00000355010:S340I	S	-	2	0	IGSF1	130244326	0.998000	0.40836	0.194000	0.23346	0.061000	0.15899	0.749000	0.26320	0.540000	0.28808	0.594000	0.82650	AGC		0.498	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			8	109	1	0	5.18039e-06	0.00308	6.17277e-06	8	109				
DDX26B	203522	broad.mit.edu	37	X	134680668	134680668	+	Silent	SNP	A	A	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:134680668A>T	ENST00000370752.4	+	5	805	c.471A>T	c.(469-471)ctA>ctT	p.L157L	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	157	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.							p.L157L(2)		large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGTGAACTAACCAAAGAAC	0.433																																							uc004eyw.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(469-471)CTA>CTT		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							165.0	141.0	149.0					X																	134680668		2203	4300	6503	SO:0001819	synonymous_variant	203522							g.chrX:134680668A>T	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.471A>T	X.37:g.134680668A>T			Somatic					p.L157L	NM_182540	NP_872346	WXS	Illumina HiSeq	Unspecified	Q5JSJ4	DX26B_HUMAN			5	834	+	Acute lymphoblastic leukemia(192;6.56e-05)		157			VWFA.		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Silent	SNP	ENST00000370752.4	37	c.471A>T	CCDS35401.1																																																																																				0.433	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		90	96	0	0	0	0.01441	0	90	96				
GPR112	139378	broad.mit.edu	37	X	135428834	135428834	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:135428834T>C	ENST00000394143.1	+	6	3260	c.2969T>C	c.(2968-2970)tTg>tCg	p.L990S	GPR112_ENST00000394141.1_Missense_Mutation_p.L785S|GPR112_ENST00000412101.1_Missense_Mutation_p.L785S|GPR112_ENST00000287534.4_Missense_Mutation_p.L927S|GPR112_ENST00000370652.1_Missense_Mutation_p.L990S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	990					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L990S(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GCTACGTCCTTGTCTGATGGT	0.493																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(2968-2970)TTG>TCG		G-protein coupled receptor 112							175.0	152.0	160.0					X																	135428834		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135428834T>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2969T>C	X.37:g.135428834T>C	ENSP00000377699:p.Leu990Ser		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.L785S|GPR112_uc010nsc.1_Missense_Mutation_p.L757S	p.L990S	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	3260	+	Acute lymphoblastic leukemia(192;0.000127)		990			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.2969T>C	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.164319	0.38217	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.48201	0.86;0.86;0.82;0.92;0.82	2.53	2.53	0.30540	.	.	.	.	.	T	0.52629	0.1746	L	0.32530	0.975	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.80764	0.994;0.994;0.986	T	0.30909	-0.9962	9	0.87932	D	0	.	6.2409	0.20789	0.0:0.0:0.0:1.0	.	927;785;990	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	990;990;785;927;785	ENSP00000377699:L990S;ENSP00000359686:L990S;ENSP00000416526:L785S;ENSP00000287534:L927S;ENSP00000377697:L785S	ENSP00000287534:L927S	L	+	2	0	GPR112	135256500	0.000000	0.05858	0.021000	0.16686	0.083000	0.17756	-0.144000	0.10280	1.266000	0.44231	0.235000	0.17854	TTG		0.493	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			20	256	0	0	0	0.008871	0	20	256				
GPR101	83550	broad.mit.edu	37	X	136112696	136112696	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:136112696G>T	ENST00000298110.1	-	1	1137	c.1138C>A	c.(1138-1140)Cgt>Agt	p.R380S		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	380						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.R380S(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTGTTACGACGACTGGGTGGG	0.512																																							uc011mwh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(1138-1140)CGT>AGT		G protein-coupled receptor 101							193.0	160.0	171.0					X																	136112696		2203	4300	6503	SO:0001583	missense	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136112696G>T	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1138C>A	X.37:g.136112696G>T	ENSP00000298110:p.Arg380Ser		Somatic					p.R380S	NM_054021	NP_473362	WXS	Illumina HiSeq	Unspecified	Q96P66	GP101_HUMAN			1	1138	-	Acute lymphoblastic leukemia(192;0.000127)		380			Cytoplasmic (Potential).		Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	c.1138C>A	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.361742	0.41801	.	.	ENSG00000165370	ENST00000298110	T	0.38401	1.14	5.37	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34067	N	0.004299	T	0.18045	0.0433	L	0.29908	0.895	0.09310	N	1	B	0.29988	0.264	B	0.30179	0.112	T	0.15178	-1.0446	10	0.07175	T	0.84	-5.5728	3.3319	0.07087	0.2165:0.0:0.5763:0.2071	.	380	Q96P66	GP101_HUMAN	S	380	ENSP00000298110:R380S	ENSP00000298110:R380S	R	-	1	0	GPR101	135940362	0.990000	0.36364	0.108000	0.21378	0.901000	0.52897	2.050000	0.41297	1.173000	0.42796	0.529000	0.55759	CGT		0.512	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			6	161	1	0	0.00116845	0.001168	0.00128189	6	161				
F9	2158	broad.mit.edu	37	X	138643882	138643882	+	Silent	SNP	C	C	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:138643882C>G	ENST00000218099.2	+	8	1045	c.1038C>G	c.(1036-1038)ctC>ctG	p.L346L	F9_ENST00000394090.2_Silent_p.L308L	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	346	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.L346L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	ACATCTTCCTCAAATTTGGAT	0.453																																							uc004fas.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)	3						c.(1036-1038)CTC>CTG		coagulation factor IX preproprotein	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)						181.0	150.0	160.0					X																	138643882		2203	4300	6503	SO:0001819	synonymous_variant	2158				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity	g.chrX:138643882C>G	M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.1038C>G	X.37:g.138643882C>G			Somatic				F9_uc004fat.1_Silent_p.L308L	p.L346L	NM_000133	NP_000124	WXS	Illumina HiSeq	Unspecified	P00740	FA9_HUMAN			8	1067	+	Acute lymphoblastic leukemia(192;0.000127)		346			Peptidase S1.		A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Silent	SNP	ENST00000218099.2	37	c.1038C>G	CCDS14666.1																																																																																				0.453	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1			65	154	0	0	0	0.01441	0	65	154				
MAGEC2	51438	broad.mit.edu	37	X	141291679	141291679	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:141291679G>T	ENST00000247452.3	-	3	442	c.95C>A	c.(94-96)aCa>aAa	p.T32K		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	32					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.T32K(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTCATCTGTGGGATGCTG	0.522										HNSCC(46;0.14)																													uc004fbu.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(94-96)ACA>AAA		melanoma antigen family C, 2							121.0	119.0	119.0					X																	141291679		2203	4300	6503	SO:0001583	missense	51438					cytoplasm|nucleus		g.chrX:141291679G>T	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.95C>A	X.37:g.141291679G>T	ENSP00000354660:p.Thr32Lys	HNSCC(46;0.14)	Somatic					p.T32K	NM_016249	NP_057333	WXS	Illumina HiSeq	Unspecified	Q9UBF1	MAGC2_HUMAN			3	443	-	Acute lymphoblastic leukemia(192;6.56e-05)		32					Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	c.95C>A	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	12.69	2.013255	0.35511	.	.	ENSG00000046774	ENST00000247452	T	0.02121	4.44	0.896	0.896	0.19253	.	1.011210	0.07950	N	0.980762	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.31931	0.347	B	0.20955	0.032	T	0.37337	-0.9710	9	0.06236	T	0.91	.	.	.	.	.	32	Q9UBF1	MAGC2_HUMAN	K	32	ENSP00000354660:T32K	ENSP00000354660:T32K	T	-	2	0	MAGEC2	141119345	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.483000	0.06536	0.707000	0.31934	0.411000	0.27672	ACA		0.522	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		107	139	1	0	5.67068e-62	0.01441	1.06208e-61	107	139				
AFF2	2334	broad.mit.edu	37	X	147743758	147743758	+	Silent	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:147743758G>T	ENST00000370460.2	+	3	989	c.510G>T	c.(508-510)ctG>ctT	p.L170L	AFF2_ENST00000370458.1_Silent_p.L166L|AFF2_ENST00000370457.5_Silent_p.L166L|AFF2_ENST00000342251.3_Silent_p.L166L	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	170					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.L170L(2)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCACTGTACTGGCAAGCCAGG	0.468																																							uc004fcp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|pancreas(2)	5						c.(508-510)CTG>CTT		fragile X mental retardation 2							120.0	115.0	117.0					X																	147743758		2203	4300	6503	SO:0001819	synonymous_variant	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147743758G>T	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.510G>T	X.37:g.147743758G>T			Somatic				AFF2_uc004fco.2_Silent_p.L166L|AFF2_uc004fcq.2_Silent_p.L166L|AFF2_uc004fcr.2_Silent_p.L166L|AFF2_uc011mxb.1_Silent_p.L170L|AFF2_uc004fcs.2_Silent_p.L166L	p.L170L	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			3	989	+	Acute lymphoblastic leukemia(192;6.56e-05)		170					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	c.510G>T	CCDS14684.1																																																																																				0.468	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		17	188	1	0	4.75885e-15	0.00499	7.4515e-15	17	188				
AFF2	2334	broad.mit.edu	37	X	148059973	148059973	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:148059973G>T	ENST00000370460.2	+	18	4037	c.3558G>T	c.(3556-3558)atG>atT	p.M1186I	AFF2_ENST00000286437.5_Missense_Mutation_p.M827I|AFF2_ENST00000370457.5_Missense_Mutation_p.M1151I|AFF2_ENST00000342251.3_Missense_Mutation_p.M1153I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1186					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GATCACTGATGGAATATTTTA	0.363																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(3556-3558)ATG>ATT		fragile X mental retardation 2							163.0	150.0	154.0					X																	148059973		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148059973G>T	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3558G>T	X.37:g.148059973G>T	ENSP00000359489:p.Met1186Ile		Somatic				AFF2_uc004fcq.2_Missense_Mutation_p.M1176I|AFF2_uc004fcr.2_Missense_Mutation_p.M1147I|AFF2_uc011mxb.1_Missense_Mutation_p.M1151I|AFF2_uc004fcs.2_Missense_Mutation_p.M1151I|AFF2_uc011mxc.1_Missense_Mutation_p.M827I	p.M1186I	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			18	4037	+	Acute lymphoblastic leukemia(192;6.56e-05)		1186					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.3558G>T	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563632	0.45694	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	L	0.32530	0.975	0.58432	D	0.999991	B;P;B;D;D;D	0.57257	0.012;0.947;0.126;0.974;0.974;0.979	B;P;B;P;P;P	0.62885	0.023;0.908;0.192;0.731;0.731;0.825	T	0.69049	-0.5248	10	0.42905	T	0.14	.	19.3431	0.94352	0.0:0.0:1.0:0.0	.	827;1151;1151;1147;1176;1186	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	I	1186;1151;1153;827	ENSP00000359489:M1186I;ENSP00000359486:M1151I;ENSP00000345459:M1153I;ENSP00000286437:M827I	ENSP00000286437:M827I	M	+	3	0	AFF2	147867657	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.608000	0.67654	2.521000	0.84997	0.544000	0.68410	ATG		0.363	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		54	64	1	0	5.22555e-25	0.01441	9.15485e-25	54	64				
CD99L2	83692	broad.mit.edu	37	X	149945946	149945946	+	Missense_Mutation	SNP	C	C	G	rs143706982		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:149945946C>G	ENST00000370377.3	-	8	623	c.506G>C	c.(505-507)cGg>cCg	p.R169P	CD99L2_ENST00000466436.1_Missense_Mutation_p.R120P|CD99L2_ENST00000437787.2_Missense_Mutation_p.R96P|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000355149.3_Missense_Mutation_p.R97P	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	169					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R169P(1)		endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGCCGTACCGGCCATCACC	0.567																																							uc004fel.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(505-507)CGG>CCG		CD99 antigen-like 2 isoform E3'-E4'-E3-E4							80.0	73.0	76.0					X																	149945946		2203	4300	6503	SO:0001583	missense	83692				cell adhesion	cell junction|integral to membrane		g.chrX:149945946C>G	BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.506G>C	X.37:g.149945946C>G	ENSP00000359403:p.Arg169Pro		Somatic				CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Missense_Mutation_p.R120P|CD99L2_uc004fen.2_Missense_Mutation_p.R97P|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Missense_Mutation_p.R96P	p.R169P	NM_031462	NP_113650	WXS	Illumina HiSeq	Unspecified	Q8TCZ2	C99L2_HUMAN			8	624	-	Acute lymphoblastic leukemia(192;6.56e-05)		169			Extracellular (Potential).		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	ENST00000370377.3	37	c.506G>C	CCDS35427.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878291	0.33162	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000437787;ENST00000466436;ENST00000418547	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	4.31	-2.64	0.06114	.	6.057390	0.00792	N	0.001344	T	0.15955	0.0384	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.12630	0.001;0.001;0.005;0.006	B;B;B;B	0.15870	0.004;0.001;0.003;0.014	T	0.11817	-1.0572	9	.	.	.	0.9556	4.7181	0.12904	0.0:0.211:0.3101:0.4789	.	96;97;120;169	E9PD27;Q8TCZ2-3;Q8TCZ2-2;Q8TCZ2	.;.;.;C99L2_HUMAN	P	169;173;97;96;120;132	ENSP00000359403:R169P;ENSP00000347275:R97P;ENSP00000394858:R96P;ENSP00000417697:R120P;ENSP00000391821:R132P	.	R	-	2	0	CD99L2	149696604	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.381000	0.07417	-0.750000	0.04740	0.513000	0.50165	CGG		0.567	CD99L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061199.1	NM_031462		11	92	0	0	0	0.001855	0	11	92				
CD99L2	83692	broad.mit.edu	37	X	149962192	149962192	+	Silent	SNP	A	A	G			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:149962192A>G	ENST00000370377.3	-	7	585	c.468T>C	c.(466-468)ggT>ggC	p.G156G	CD99L2_ENST00000466436.1_Silent_p.G107G|CD99L2_ENST00000355149.3_Silent_p.G84G|CD99L2_ENST00000437787.2_Intron|CD99L2_ENST00000346693.4_5'UTR	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	156					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G156G(1)		endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TGTATTCTCCACCCCCTACTA	0.373																																							uc004fel.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(466-468)GGT>GGC		CD99 antigen-like 2 isoform E3'-E4'-E3-E4							166.0	138.0	147.0					X																	149962192		2203	4300	6503	SO:0001819	synonymous_variant	83692				cell adhesion	cell junction|integral to membrane		g.chrX:149962192A>G	BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.468T>C	X.37:g.149962192A>G			Somatic				CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Silent_p.G107G|CD99L2_uc004fen.2_Silent_p.G84G|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Intron	p.G156G	NM_031462	NP_113650	WXS	Illumina HiSeq	Unspecified	Q8TCZ2	C99L2_HUMAN			7	586	-	Acute lymphoblastic leukemia(192;6.56e-05)		156			Extracellular (Potential).		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Silent	SNP	ENST00000370377.3	37	c.468T>C	CCDS35427.1																																																																																				0.373	CD99L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061199.1	NM_031462		3	51	0	0	0	0.009096	0	3	51				
GABRE	2564	broad.mit.edu	37	X	151123293	151123293	+	Silent	SNP	G	G	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:151123293G>A	ENST00000370328.3	-	9	1454	c.1401C>T	c.(1399-1401)acC>acT	p.T467T	GABRE_ENST00000483564.1_5'UTR|GABRE_ENST00000370325.1_3'UTR|AF274855.1_ENST00000582865.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	467					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T354T(1)|p.T467T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCTGCTGCCAGGTACTGCCCT	0.552																																							uc004ffi.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1399-1401)ACC>ACT		gamma-aminobutyric acid (GABA) A receptor,							44.0	44.0	44.0					X																	151123293		2203	4300	6503	SO:0001819	synonymous_variant	2564				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chrX:151123293G>A	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1401C>T	X.37:g.151123293G>A			Somatic				GABRE_uc011myd.1_RNA	p.T467T	NM_004961	NP_004952	WXS	Illumina HiSeq	Unspecified	P78334	GBRE_HUMAN			9	1455	-	Acute lymphoblastic leukemia(192;6.56e-05)		467			Cytoplasmic (Probable).		E7ET93|O15345|O15346|Q6PCD2|Q99520	Silent	SNP	ENST00000370328.3	37	c.1401C>T	CCDS14703.1																																																																																				0.552	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984		6	67	0	0	0	0.001984	0	6	67				
PLXNB3	5365	broad.mit.edu	37	X	153039434	153039434	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:153039434G>C	ENST00000361971.5	+	20	3514	c.3400G>C	c.(3400-3402)Gcc>Ccc	p.A1134P	PLXNB3_ENST00000538282.1_Missense_Mutation_p.A744P|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538776.1_Missense_Mutation_p.A787P|PLXNB3_ENST00000538966.1_Missense_Mutation_p.A1157P	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1134	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTGGACTTCGCCAGTGCCAG	0.687																																							uc004fii.2		NA																	0				lung(1)	1						c.(3400-3402)GCC>CCC		plexin B3 isoform 1							43.0	44.0	43.0					X																	153039434		2200	4296	6496	SO:0001583	missense	5365				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity	g.chrX:153039434G>C	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3400G>C	X.37:g.153039434G>C	ENSP00000355378:p.Ala1134Pro		Somatic				PLXNB3_uc010nuk.2_Missense_Mutation_p.A1157P|PLXNB3_uc011mzd.1_Missense_Mutation_p.A773P|PLXNB3_uc004fij.1_5'Flank|SRPK3_uc004fik.2_5'Flank	p.A1134P	NM_005393	NP_005384	WXS	Illumina HiSeq	Unspecified	Q9ULL4	PLXB3_HUMAN			20	3574	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		1134			IPT/TIG 3.|Extracellular (Potential).		B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	c.3400G>C	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913776	0.33815	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.69040	5.19;5.15;4.57;-0.37	5.28	-0.981	0.10269	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.803297	0.11786	N	0.529709	T	0.68504	0.3008	M	0.65498	2.005	0.09310	N	1	P;D;P	0.56521	0.785;0.976;0.785	B;P;P	0.60286	0.425;0.872;0.544	T	0.56300	-0.8002	10	0.29301	T	0.29	.	1.3041	0.02085	0.3953:0.1408:0.3182:0.1456	.	787;1157;1134	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	P	1157;1134;787;744	ENSP00000442736:A1157P;ENSP00000355378:A1134P;ENSP00000445569:A787P;ENSP00000441919:A744P	ENSP00000355378:A1134P	A	+	1	0	PLXNB3	152692628	0.005000	0.15991	0.001000	0.08648	0.129000	0.20672	0.453000	0.21811	-0.149000	0.11215	-0.344000	0.07964	GCC		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1			44	76	0	0	0	0.01441	0	44	76				
SRPK3	26576	broad.mit.edu	37	X	153048509	153048509	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:153048509G>T	ENST00000370101.3	+	7	730	c.684G>T	c.(682-684)agG>agT	p.R228S	SRPK3_ENST00000370100.1_Missense_Mutation_p.R186S|SRPK3_ENST00000370104.1_Missense_Mutation_p.R228S|SRPK3_ENST00000370108.3_Missense_Mutation_p.R228S|SRPK3_ENST00000489426.1_Missense_Mutation_p.R295S|SRPK3_ENST00000393786.3_Missense_Mutation_p.R228S	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R228S(1)|p.R295S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTTACATCAGGCGCCTGGCTG	0.657																																					Esophageal Squamous(167;766 3400 32156)	Esophageal Squamous(167;766 3400 32156)	uc004fil.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|lung(1)	3						c.(682-684)AGG>AGT		serine arginine rich protein-specific kinase 3							54.0	47.0	49.0					X																	153048509		2202	4298	6500	SO:0001583	missense	26576				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity	g.chrX:153048509G>T	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.684G>T	X.37:g.153048509G>T	ENSP00000359119:p.Arg228Ser		Somatic				SRPK3_uc004fik.2_Missense_Mutation_p.R294S|SRPK3_uc010nul.2_Missense_Mutation_p.R186S|SRPK3_uc004fin.2_Missense_Mutation_p.R228S|SRPK3_uc004fim.2_Missense_Mutation_p.R228S	p.R228S	NM_014370	NP_055185	WXS	Illumina HiSeq	Unspecified	Q9UPE1	SRPK3_HUMAN			7	716	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		228			Protein kinase.		Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	ENST00000370101.3	37	c.684G>T	CCDS35441.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595242	0.46318	.	.	ENSG00000184343	ENST00000489426;ENST00000393786;ENST00000370104;ENST00000370108;ENST00000370101;ENST00000370100	T;T;T;T;T;T	0.56275	0.47;0.52;0.47;0.51;0.48;0.5	6.07	2.87	0.33458	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000118	T	0.51227	0.1662	L	0.34521	1.04	0.58432	D	0.999999	B;D;P;P;B	0.76494	0.111;0.999;0.939;0.93;0.072	B;P;P;P;B	0.61328	0.062;0.887;0.791;0.593;0.129	T	0.41662	-0.9496	10	0.25106	T	0.35	-32.9992	6.7151	0.23298	0.2339:0.145:0.621:0.0	.	186;228;228;228;295	Q9UPE1-2;Q9UPE1-4;Q9UPE1-3;Q9UPE1;E7ETV6	.;.;.;SRPK3_HUMAN;.	S	295;228;228;228;228;186	ENSP00000420058:R295S;ENSP00000377376:R228S;ENSP00000359122:R228S;ENSP00000359126:R228S;ENSP00000359119:R228S;ENSP00000359118:R186S	ENSP00000359118:R186S	R	+	3	2	SRPK3	152701703	0.990000	0.36364	0.998000	0.56505	0.007000	0.05969	0.236000	0.17967	0.652000	0.30806	0.600000	0.82982	AGG		0.657	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370		4	127	1	0	8.12818e-05	0.001984	9.26203e-05	4	127				
PLXNA3	55558	broad.mit.edu	37	X	153694838	153694838	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:153694838C>A	ENST00000369682.3	+	16	3094	c.2919C>A	c.(2917-2919)agC>agA	p.S973R		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	973	IPT/TIG 2.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.S973R(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGAGGGACAGCGAGTGCCAGT	0.692																																							uc004flm.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(2917-2919)AGC>AGA		plexin A3 precursor							49.0	55.0	53.0					X																	153694838		2203	4299	6502	SO:0001583	missense	55558				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chrX:153694838C>A	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2919C>A	X.37:g.153694838C>A	ENSP00000358696:p.Ser973Arg		Somatic					p.S973R	NM_017514	NP_059984	WXS	Illumina HiSeq	Unspecified	P51805	PLXA3_HUMAN			16	3092	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		973			IPT/TIG 2.|Extracellular (Potential).		Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	c.2919C>A	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	C	0.251	-1.006674	0.02112	.	.	ENSG00000130827	ENST00000369682	T	0.76709	-1.04	5.24	-0.392	0.12442	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.578200	0.18141	N	0.150407	T	0.44685	0.1305	N	0.01505	-0.83	0.19300	N	0.999974	B	0.02656	0.0	B	0.09377	0.004	T	0.38929	-0.9638	10	0.10111	T	0.7	.	9.6474	0.39877	0.5364:0.36:0.1036:0.0	.	973	P51805	PLXA3_HUMAN	R	973	ENSP00000358696:S973R	ENSP00000358696:S973R	S	+	3	2	PLXNA3	153348032	0.626000	0.27120	0.993000	0.49108	0.723000	0.41478	0.609000	0.24238	0.057000	0.16193	-0.229000	0.12294	AGC		0.692	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		10	119	1	0	0.000442599	0.006214	0.000492746	10	119				
FUNDC2	65991	broad.mit.edu	37	X	154261737	154261737	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chrX:154261737T>A	ENST00000369498.3	+	2	447	c.193T>A	c.(193-195)Tgg>Agg	p.W65R	FUNDC2_ENST00000484175.1_3'UTR	NM_023934.3	NP_076423.2	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	65						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.W65R(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAAGCAGCCATGGTGGCGTAA	0.428																																							uc004fmw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)TGG>AGG		FUN14 domain containing 2							107.0	97.0	101.0					X																	154261737		2203	4300	6503	SO:0001583	missense	65991					mitochondrion		g.chrX:154261737T>A	AF267862	CCDS14763.1	Xq28	2010-03-12			ENSG00000165775	ENSG00000165775			24925	protein-coding gene	gene with protein product						12477932	Standard	NM_023934		Approved	HCBP6, DC44	uc004fmw.3	Q9BWH2	OTTHUMG00000013504	ENST00000369498.3:c.193T>A	X.37:g.154261737T>A	ENSP00000358510:p.Trp65Arg		Somatic					p.W65R	NM_023934	NP_076423	WXS	Illumina HiSeq	Unspecified	Q9BWH2	FUND2_HUMAN			2	343	+	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		65					B2R7W5|D3DWY5|Q8NHX8|Q9H2I6	Missense_Mutation	SNP	ENST00000369498.3	37	c.193T>A	CCDS14763.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.996957	0.74818	.	.	ENSG00000165775	ENST00000369498	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.75961	0.3921	M	0.67397	2.05	0.48452	D	0.999659	D	0.89917	1.0	D	0.75484	0.986	T	0.78523	-0.2171	9	0.72032	D	0.01	.	12.2575	0.54631	0.0:0.0:0.0:1.0	.	65	Q9BWH2	FUND2_HUMAN	R	65	.	ENSP00000358510:W65R	W	+	1	0	FUNDC2	153914931	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.548000	0.67255	1.869000	0.54173	0.481000	0.45027	TGG		0.428	FUNDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037641.3	NM_023934		6	165	0	0	0	0.001984	0	6	165				
HRNR	388697	broad.mit.edu	37	1	152187509	152187509	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr1:152187509delC	ENST00000368801.2	-	3	6671	c.6596delG	c.(6595-6597)ggcfs	p.G2199fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2199					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCATGTTGGCCGTGGCTGGA	0.627																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(6595-6597)GGCfs		hornerin							48.0	66.0	60.0					1																	152187509		2172	4285	6457	SO:0001589	frameshift_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152187509delC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6596delG	1.37:g.152187509delC	ENSP00000357791:p.Gly2199fs		Somatic					p.G2199fs	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6672	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2199			24.		Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	37	c.6596delG	CCDS30859.1																																																																																				0.627	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		22	1146	NA	NA	NA	NA	NA	22	1146	---	---	---	---
B4GALNT1	2583	broad.mit.edu	37	12	58020563	58020563	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr12:58020563delG	ENST00000341156.4	-	11	2150	c.1566delC	c.(1564-1566)ttcfs	p.F523fs	B4GALNT1_ENST00000418555.2_Frame_Shift_Del_p.F468fs	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	523					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGTGTTTGAAGAAGAGCAGCC	0.597																																							uc001spg.1		NA																	0					0						c.(1564-1566)TTCfs		beta-1,4-N-acetyl-galactosaminyl transferase 1							170.0	143.0	152.0					12																	58020563		2203	4300	6503	SO:0001589	frameshift_variant	2583				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity	g.chr12:58020563delG	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1566delC	12.37:g.58020563delG	ENSP00000341562:p.Phe523fs		Somatic				B4GALNT1_uc010sru.1_Frame_Shift_Del_p.F467fs	p.F522fs	NM_001478	NP_001469	WXS	Illumina HiSeq	Unspecified	Q00973	B4GN1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)		11	1998	-	Melanoma(17;0.122)		522			Lumenal (Potential).		B4DE26|Q8N636	Frame_Shift_Del	DEL	ENST00000341156.4	37	c.1566delC	CCDS8950.1																																																																																				0.597	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478		53	145	NA	NA	NA	NA	NA	53	145	---	---	---	---
NEK3	4752	broad.mit.edu	37	13	52728029	52728029	+	Splice_Site	DEL	C	C	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr13:52728029delC	ENST00000400357.2	-	3	1603		c.e3+1		NEK3_ENST00000452082.2_Splice_Site|NEK3_ENST00000378101.2_Splice_Site|NEK3_ENST00000339406.3_Splice_Site			P51956	NEK3_HUMAN	NIMA-related kinase 3						mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		CAATCTCTTACCATGTCTTCA	0.333																																							uc001vgi.2		NA																	0				ovary(1)|stomach(1)	2						c.e4+1		NIMA-related kinase 3 isoform a							121.0	117.0	118.0					13																	52728029		1824	4087	5911	SO:0001630	splice_region_variant	4752				cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr13:52728029delC	AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.309+1G>-	13.37:g.52728029delC			Somatic				NEK3_uc001vgg.2_Splice_Site_p.M97_splice|NEK3_uc001vgh.2_Splice_Site_p.M124_splice|NEK3_uc010tgx.1_Splice_Site|NEK3_uc010tgy.1_Splice_Site_p.M103_splice	p.M103_splice	NM_152720	NP_689933	WXS	Illumina HiSeq	Unspecified	P51956	NEK3_HUMAN		GBM - Glioblastoma multiforme(99;2.81e-08)	4	544	-		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)						A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Splice_Site	DEL	ENST00000400357.2	37	c.309_splice	CCDS53871.1																																																																																				0.333	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3		Intron	13	111	NA	NA	NA	NA	NA	13	111	---	---	---	---
MYO15A	51168	broad.mit.edu	37	17	18044107	18044107	+	Frame_Shift_Del	DEL	C	C	-	rs374957026		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:18044107delC	ENST00000205890.5	+	21	5705	c.5367delC	c.(5365-5367)aacfs	p.N1789fs	MYO15A_ENST00000412324.1_3'UTR	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1789	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCAGGTGCAACCCCTTGTTCA	0.562											OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010vxh.1		NA																	0				skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(5365-5367)AACfs		myosin XV							101.0	106.0	105.0					17																	18044107		2059	4198	6257	SO:0001589	frameshift_variant	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18044107delC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.5367delC	17.37:g.18044107delC	ENSP00000205890:p.Asn1789fs		Somatic	OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	722		p.N1789fs	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			20	5705	+	all_neural(463;0.228)		1789			Myosin head-like.		B4DFC7	Frame_Shift_Del	DEL	ENST00000205890.5	37	c.5367delC	CCDS42271.1																																																																																				0.562	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		22	66	NA	NA	NA	NA	NA	22	66	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29654741	29654742	+	Frame_Shift_Ins	INS	-	-	T			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr17:29654741_29654742insT	ENST00000358273.4	+	38	5876_5877	c.5493_5494insT	c.(5494-5496)gaafs	p.E1832fs	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Frame_Shift_Ins_p.E1811fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1832	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGACCCGCTGGGAACTGTCACA	0.51			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		11	Whole gene deletion(8)|Unknown(3)		soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(5491-5496)TGGGAAfs		neurofibromin isoform 1																																				SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29654741_29654742insT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	Exception_encountered	17.37:g.29654741_29654742insT	ENSP00000351015:p.Glu1832fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Frame_Shift_Ins_p.W1810fs|NF1_uc002hgi.1_Frame_Shift_Ins_p.W843fs|NF1_uc010cso.2_Frame_Shift_Ins_p.W19fs	p.W1831fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	38	5826_5827	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	1831_1832					O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	ENST00000358273.4	37	c.5493_5494insT	CCDS42292.1																																																																																				0.510	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		29	124	NA	NA	NA	NA	NA	29	124	---	---	---	---
EHD2	30846	broad.mit.edu	37	19	48239761	48239761	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr19:48239761delG	ENST00000263277.3	+	5	1302	c.1051delG	c.(1051-1053)gggfs	p.G351fs	EHD2_ENST00000540884.1_3'UTR|EHD2_ENST00000538399.1_Frame_Shift_Del_p.G215fs	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	351					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CATCTCCCCTGGGGACTTTCC	0.527																																							uc002phj.3		NA																	0				ovary(1)|skin(1)	2						c.(1051-1053)GGGfs		EH-domain containing 2							100.0	93.0	95.0					19																	48239761		2203	4300	6503	SO:0001589	frameshift_variant	30846				blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding	g.chr19:48239761delG	AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.1051delG	19.37:g.48239761delG	ENSP00000263277:p.Gly351fs		Somatic				EHD2_uc010xyu.1_Frame_Shift_Del_p.G215fs|EHD2_uc010xyv.1_Frame_Shift_Del_p.G34fs	p.G351fs	NM_014601	NP_055416	WXS	Illumina HiSeq	Unspecified	Q9NZN4	EHD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)	5	1301	+		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)	351					B2RDH9|B4DNU6|Q96CB6	Frame_Shift_Del	DEL	ENST00000263277.3	37	c.1051delG	CCDS12704.1																																																																																				0.527	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1			27	41	NA	NA	NA	NA	NA	27	41	---	---	---	---
MROH8	140699	broad.mit.edu	37	20	35766357	35766357	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr20:35766357delC	ENST00000400441.3	-	13	1504	c.1505delG	c.(1504-1506)ggafs	p.G502fs	MROH8_ENST00000217333.8_Frame_Shift_Del_p.G331fs|MROH8_ENST00000441008.2_Frame_Shift_Del_p.G488fs			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	387																	ACAGATAACTCCCATAATTTC	0.408																																							uc010zvu.1		NA																	0					0						c.(1534-1536)GGAfs		hypothetical protein LOC140699 isoform 1							88.0	79.0	82.0					20																	35766357		1852	4098	5950	SO:0001589	frameshift_variant	140699							g.chr20:35766357delC	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1505delG	20.37:g.35766357delC	ENSP00000383291:p.Gly502fs		Somatic				C20orf132_uc002xgk.2_Frame_Shift_Del_p.G134fs|C20orf132_uc002xgm.2_Frame_Shift_Del_p.G512fs|C20orf132_uc002xgn.2_Frame_Shift_Del_p.G477fs	p.G512fs	NM_152503	NP_689716	WXS	Illumina HiSeq	Unspecified	Q9H579	CT132_HUMAN			15	1626	-		Myeloproliferative disorder(115;0.00878)	387					Q5JYQ6	Frame_Shift_Del	DEL	ENST00000400441.3	37	c.1535delG																																																																																					0.408	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503		12	16	NA	NA	NA	NA	NA	12	16	---	---	---	---
GNAZ	2781	broad.mit.edu	37	22	23438319	23438319	+	Frame_Shift_Del	DEL	A	A	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:23438319delA	ENST00000248996.4	+	2	1103	c.437delA	c.(436-438)gagfs	p.E146fs	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	146					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CGCTCCAGCGAGTACCACCTG	0.662																																							uc002zwu.1		NA																	0				kidney(1)|skin(1)	2						c.(436-438)GAGfs		guanine nucleotide binding protein, alpha z							72.0	59.0	64.0					22																	23438319		2203	4300	6503	SO:0001589	frameshift_variant	2781					endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity	g.chr22:23438319delA		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.437delA	22.37:g.23438319delA	ENSP00000248996:p.Glu146fs		Somatic				RTDR1_uc002zwt.2_Intron	p.E146fs	NM_002073	NP_002064	WXS	Illumina HiSeq	Unspecified	P19086	GNAZ_HUMAN		READ - Rectum adenocarcinoma(21;0.166)	2	974	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		146					B2R6C1|Q4QRJ6	Frame_Shift_Del	DEL	ENST00000248996.4	37	c.437delA	CCDS13804.1																																																																																				0.662	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073		7	54	NA	NA	NA	NA	NA	7	54	---	---	---	---
AP1B1	162	broad.mit.edu	37	22	29745310	29745311	+	Frame_Shift_Ins	INS	-	-	G	rs376948907		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr22:29745310_29745311insG	ENST00000405198.1	-	10	1364_1365	c.1333_1334insC	c.(1333-1335)cggfs	p.R445fs	AP1B1_ENST00000402502.1_Frame_Shift_Ins_p.R445fs|AP1B1_ENST00000432560.2_Frame_Shift_Ins_p.R445fs|AP1B1_ENST00000357586.2_Frame_Shift_Ins_p.R445fs|AP1B1_ENST00000415447.1_Frame_Shift_Ins_p.R445fs|AP1B1_ENST00000317368.7_Frame_Shift_Ins_p.R445fs|AP1B1_ENST00000356015.2_Frame_Shift_Ins_p.R445fs			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	445					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CATGGCAGCCCGGGCCTCAGGC	0.584																																							uc003afj.2		NA																	0				ovary(1)|skin(1)	2						c.(1333-1335)CGGfs		adaptor-related protein complex 1 beta 1 subunit																																				SO:0001589	frameshift_variant	162				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity	g.chr22:29745310_29745311insG	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1334dupC	22.37:g.29745313_29745313dupG	ENSP00000384194:p.Arg445fs		Somatic				AP1B1_uc003afi.2_Frame_Shift_Ins_p.R445fs|AP1B1_uc003afk.2_Frame_Shift_Ins_p.R445fs|AP1B1_uc003afl.2_Frame_Shift_Ins_p.R445fs|AP1B1_uc011ako.1_5'UTR	p.R445fs	NM_001127	NP_001118	WXS	Illumina HiSeq	Unspecified	Q10567	AP1B1_HUMAN			11	1517_1518	-			445					C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Frame_Shift_Ins	INS	ENST00000405198.1	37	c.1333_1334insC	CCDS13855.1																																																																																				0.584	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127		52	68	NA	NA	NA	NA	NA	52	68	---	---	---	---
OTOP1	133060	broad.mit.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	TTGAG	-	rs369956607		TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	TTGAG	TTGAG	-	-	TTGAG	TTGAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:4204225_4204229delTTGAG	ENST00000296358.4	-	4	700_704	c.676_680delCTCAA	c.(676-681)ctcaatfs	p.LN226fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L226fs*1(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502																																							uc003ghp.1		NA																	1	Deletion - Frameshift(1)		liver(1)	ovary(2)|central_nervous_system(1)	3						c.(676-681)CTCAATfs		otopetrin 1																																				SO:0001589	frameshift_variant	133060				biomineral tissue development	extracellular space|integral to membrane		g.chr4:4204225_4204229delTTGAG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.676_680delCTCAA	4.37:g.4204225_4204229delTTGAG	ENSP00000296358:p.Leu226fs		Somatic					p.L226fs	NM_177998	NP_819056	WXS	Illumina HiSeq	Unspecified	Q7RTM1	OTOP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	4	706_710	-			226_227					A1L476	Frame_Shift_Del	DEL	ENST00000296358.4	37	c.676_680delCTCAA	CCDS3372.1																																																																																				0.502	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998		7	170	NA	NA	NA	NA	NA	7	170	---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96090406	96090407	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr4:96090406_96090407insCC	ENST00000453304.1	-	16	3122_3123	c.2774_2775insGG	c.(2773-2775)ttafs	p.L925fs		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	925	Death.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTTCTGCTGCTAAGGACACCAC	0.51																																							uc003htp.1		NA																	0				ovary(3)|pancreas(1)	4						c.(2773-2775)TTAfs		unc5C precursor																																				SO:0001589	frameshift_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96090406_96090407insCC	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2774_2775insGG	4.37:g.96090406_96090407insCC	ENSP00000406022:p.Leu925fs		Somatic				uc003hto.2_5'Flank	p.L925fs	NM_003728	NP_003719	WXS	Illumina HiSeq	Unspecified	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	16	2928_2929	-		Hepatocellular(203;0.114)	925			Cytoplasmic (Potential).|Death.		Q8IUT0	Frame_Shift_Ins	INS	ENST00000453304.1	37	c.2774_2775insGG	CCDS3643.1																																																																																				0.510	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		42	122	NA	NA	NA	NA	NA	42	122	---	---	---	---
DST	667	broad.mit.edu	37	6	56510720	56510720	+	Frame_Shift_Del	DEL	C	C	-	rs549595253	byFrequency	TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr6:56510720delC	ENST00000361203.3	-	11	1096	c.1089delG	c.(1087-1089)gggfs	p.G363fs	DST_ENST00000421834.2_Frame_Shift_Del_p.G363fs|DST_ENST00000244364.6_5'Flank|DST_ENST00000370769.4_Frame_Shift_Del_p.G363fs|DST_ENST00000370754.5_Frame_Shift_Del_p.G541fs|DST_ENST00000312431.6_Frame_Shift_Del_p.G363fs|DST_ENST00000370788.2_Frame_Shift_Del_p.G363fs			Q03001	DYST_HUMAN	dystonin	363					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TAATGAGTTTCCCCCACTCTT	0.418																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(1621-1623)GGGfs		dystonin isoform 2							111.0	103.0	105.0					6																	56510720		1830	4088	5918	SO:0001589	frameshift_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56510720delC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1089delG	6.37:g.56510720delC	ENSP00000354508:p.Gly363fs		Somatic				DST_uc003pcz.3_Frame_Shift_Del_p.G363fs|DST_uc011dxj.1_Frame_Shift_Del_p.G392fs|DST_uc011dxk.1_Frame_Shift_Del_p.G403fs|DST_uc011dxl.1_Frame_Shift_Del_p.G392fs|DST_uc003pde.2_Frame_Shift_Del_p.G479fs	p.G541fs	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		14	1651	-	Lung NSC(77;0.103)		363					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Del	DEL	ENST00000361203.3	37	c.1623delG																																																																																					0.418	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		37	121	NA	NA	NA	NA	NA	37	121	---	---	---	---
STEAP2	261729	broad.mit.edu	37	7	89859319	89859319	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr7:89859319delC	ENST00000287908.3	+	4	1547	c.1154delC	c.(1153-1155)gctfs	p.A385fs	STEAP2_ENST00000394622.2_Frame_Shift_Del_p.A385fs|STEAP2_ENST00000394626.1_Frame_Shift_Del_p.A385fs|STEAP2_ENST00000394629.2_Frame_Shift_Del_p.A385fs|STEAP2_ENST00000402625.2_Frame_Shift_Del_p.A385fs|STEAP2_ENST00000394621.2_Frame_Shift_Del_p.A385fs|STEAP2_ENST00000394632.1_Frame_Shift_Del_p.A385fs	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	385	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					GTGAGCAATGCTTTAAACTGG	0.398																																							uc003ujz.2		NA																	0				ovary(2)	2						c.(1153-1155)GCTfs		six transmembrane epithelial antigen of the							189.0	195.0	193.0					7																	89859319		2203	4300	6503	SO:0001589	frameshift_variant	261729				electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity	g.chr7:89859319delC	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.1154delC	7.37:g.89859319delC	ENSP00000287908:p.Ala385fs		Somatic				STEAP2_uc010len.2_Frame_Shift_Del_p.A385fs|STEAP2_uc003uka.2_Frame_Shift_Del_p.A385fs|STEAP2_uc003ukb.2_Frame_Shift_Del_p.A385fs|STEAP2_uc003ukc.2_Frame_Shift_Del_p.A385fs|STEAP2_uc003ukd.2_Frame_Shift_Del_p.A385fs	p.A385fs	NM_152999	NP_694544	WXS	Illumina HiSeq	Unspecified	Q8NFT2	STEA2_HUMAN			4	1547	+	all_hematologic(106;0.112)		385			Ferric oxidoreductase.		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Frame_Shift_Del	DEL	ENST00000287908.3	37	c.1154delC	CCDS5615.1																																																																																				0.398	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999		53	331	NA	NA	NA	NA	NA	53	331	---	---	---	---
CEL	1056	broad.mit.edu	37	9	135947097	135947098	+	Frame_Shift_Ins	INS	-	-	C			TCGA-49-6767-01A-11D-1855-08	TCGA-49-6767-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9f82f494-042a-4f00-954c-4761fa25b298	25c0da49-0dd3-4eac-a262-756b8e3870dc	g.chr9:135947097_135947098insC	ENST00000372080.4	+	11	2233_2234	c.2217_2218insC	c.(2218-2220)cccfs	p.P740fs	CEL_ENST00000351304.7_Frame_Shift_Ins_p.P671fs	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	737	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CTGCCCCTGTGCCCCCCACAGA	0.658																																							uc010naa.1		NA																	0				pancreas(1)	1						c.(2215-2220)GTGCCCfs		carboxyl ester lipase precursor																																				SO:0001589	frameshift_variant	1056				cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity	g.chr9:135947097_135947098insC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2223dupC	9.37:g.135947103_135947103dupC	ENSP00000361151:p.Pro740fs		Somatic					p.V739fs	NM_001807	NP_001798	WXS	Illumina HiSeq	Unspecified	P19835	CEL_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)	11	2233_2234	+			736_737			17.|17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Frame_Shift_Ins	INS	ENST00000372080.4	37	c.2217_2218insC	CCDS43896.1																																																																																				0.658	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1			8	20	NA	NA	NA	NA	NA	8	20	---	---	---	---
