#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SLC2A7	155184	broad.mit.edu	37	1	9064913	9064913	+	Silent	SNP	G	G	T	rs139989195	byFrequency	TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:9064913G>T	ENST00000400906.1	-	11	1217	c.1218C>A	c.(1216-1218)acC>acA	p.T406T		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	406					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.T406T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GGAAGATCTCGGTCCTCACCA	0.657																																							uc009vmo.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1216-1218)ACC>ACA		intestinal facilitative glucose transporter 7							57.0	48.0	51.0					1																	9064913		2203	4300	6503	SO:0001819	synonymous_variant	155184					integral to membrane|plasma membrane	sugar transmembrane transporter activity	g.chr1:9064913G>T	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1218C>A	1.37:g.9064913G>T			Somatic					p.T406T	NM_207420	NP_997303	WXS	Illumina HiSeq	Unspecified	Q6PXP3	GTR7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)	11	1218	-	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	406			Cytoplasmic (Potential).		A2A333	Silent	SNP	ENST00000400906.1	37	c.1218C>A	CCDS98.2																																																																																				0.657	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420		5	18	1	0	0.000602214	0.000602	0.000666385	5	18				
AADACL3	126767	broad.mit.edu	37	1	12785337	12785337	+	Missense_Mutation	SNP	G	G	A	rs200064385	byFrequency	TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:12785337G>A	ENST00000359318.5	+	4	632	c.427G>A	c.(427-429)Gca>Aca	p.A143T	AADACL3_ENST00000332530.3_Missense_Mutation_p.A73T	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	143							hydrolase activity (GO:0016787)	p.A73T(1)|p.A143T(1)		breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAATAGCCGCAGTGGTTTG	0.567													G|||	3	0.000599042	0.0008	0.0	5008	,	,		17112	0.0		0.0	False		,,,				2504	0.002						uc009vnn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(427-429)GCA>ACA		arylacetamide deacetylase-like 3 isoform 1		G	THR/ALA,THR/ALA	21,3837		0,21,1908	93.0	96.0	95.0		217,427	-9.4	0.0	1		95	0,8268		0,0,4134	yes	missense,missense	AADACL3	NM_001103169.1,NM_001103170.1	58,58	0,21,6042	AA,AG,GG		0.0,0.5443,0.1732	benign,benign	73/281,143/351	12785337	21,12105	1929	4134	6063	SO:0001583	missense	126767						hydrolase activity	g.chr1:12785337G>A		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.427G>A	1.37:g.12785337G>A	ENSP00000352268:p.Ala143Thr		Somatic				AADACL3_uc001aug.1_Missense_Mutation_p.A73T	p.A143T	NM_001103170	NP_001096640	WXS	Illumina HiSeq	Unspecified	Q5VUY0	ADCL3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	4	660	+	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	143					B3KXR9|Q5VUY1	Missense_Mutation	SNP	ENST00000359318.5	37	c.427G>A	CCDS41253.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595976	0.28445	0.005443	0.0	ENSG00000188984	ENST00000332530;ENST00000359318	T;T	0.10860	2.83;2.83	5.2	-9.4	0.00616	Alpha/beta hydrolase fold-3 (1);	0.634496	0.16546	N	0.209698	T	0.04543	0.0124	L	0.31294	0.92	0.09310	N	1	B;B	0.24368	0.07;0.102	B;B	0.23716	0.048;0.047	T	0.07539	-1.0767	10	0.39692	T	0.17	-1.1602	15.9065	0.79433	0.5552:0.0:0.4448:0.0	.	143;73	Q5VUY0;Q5VUY0-2	ADCL3_HUMAN;.	T	73;143	ENSP00000333352:A73T;ENSP00000352268:A143T	ENSP00000333352:A73T	A	+	1	0	AADACL3	12707924	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.016000	0.12613	-1.834000	0.01193	-1.277000	0.01392	GCA		0.567	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	NM_001103170		9	88	0	0	0	0.006214	0	9	88				
HNRNPCL1	343069	broad.mit.edu	37	1	12907473	12907473	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:12907473G>C	ENST00000317869.6	-	2	895	c.670C>G	c.(670-672)Cag>Gag	p.Q224E		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	224						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q224E(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CTACTGCTCTGCTCCTCTTCT	0.463																																							uc009vno.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(670-672)CAG>GAG		heterogeneous nuclear ribonucleoprotein C-like							104.0	107.0	106.0					1																	12907473		2203	4296	6499	SO:0001583	missense	649330						nucleic acid binding|nucleotide binding	g.chr1:12907473G>C	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.670C>G	1.37:g.12907473G>C	ENSP00000365370:p.Gln224Glu		Somatic				HNRNPCL1_uc010obf.1_Missense_Mutation_p.Q224E	p.Q224E	NM_001146181	NP_001139653	WXS	Illumina HiSeq	Unspecified	B7ZW38	B7ZW38_HUMAN			1	765	-			224					B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	c.670C>G	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	5.939	0.357283	0.11239	.	.	ENSG00000179172	ENST00000317869	T	0.08634	3.07	1.09	1.09	0.20402	.	0.593085	0.13678	U	0.370398	T	0.07908	0.0198	L	0.45698	1.435	0.28998	N	0.887645	B	0.18863	0.031	B	0.21360	0.034	T	0.19877	-1.0292	10	0.30078	T	0.28	.	8.1133	0.30928	0.0:0.0:1.0:0.0	.	224	O60812	HNRCL_HUMAN	E	224	ENSP00000365370:Q224E	ENSP00000365370:Q224E	Q	-	1	0	HNRNPCL1	12830060	0.999000	0.42202	0.977000	0.42913	0.477000	0.33069	0.867000	0.27968	0.916000	0.36871	0.416000	0.27883	CAG		0.463	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631		17	140	0	0	0	0.010504	0	17	140				
CASP9	842	broad.mit.edu	37	1	15834374	15834374	+	Silent	SNP	T	T	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:15834374T>A	ENST00000333868.5	-	3	541	c.447A>T	c.(445-447)gcA>gcT	p.A149A	CASP9_ENST00000348549.5_Intron|CASP9_ENST00000546424.1_Silent_p.A149A|CASP9_ENST00000375890.4_Silent_p.A66A	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	149					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)	p.A149A(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		TCACCAAATCTGCATTTCCCC	0.562																																							uc001awn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|kidney(1)	2						c.(445-447)GCA>GCT		caspase 9 isoform alpha preproprotein							94.0	95.0	94.0					1																	15834374		2203	4300	6503	SO:0001819	synonymous_variant	842				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding	g.chr1:15834374T>A	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.447A>T	1.37:g.15834374T>A			Somatic				CASP9_uc001awm.1_Silent_p.A149A|CASP9_uc001awo.2_Intron|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_5'UTR|CASP9_uc010obm.1_Silent_p.A66A|CASP9_uc001awq.2_Silent_p.A66A	p.A149A	NM_001229	NP_001220	WXS	Illumina HiSeq	Unspecified	P55211	CASP9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)	3	542	-		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	149					B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Silent	SNP	ENST00000333868.5	37	c.447A>T	CCDS158.1																																																																																				0.562	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996		6	68	0	0	0	0.00308	0	6	68				
EPHB2	2048	broad.mit.edu	37	1	23219500	23219500	+	Missense_Mutation	SNP	C	C	T	rs369387828		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:23219500C>T	ENST00000400191.3	+	7	1570	c.1552C>T	c.(1552-1554)Cgc>Tgc	p.R518C	EPHB2_ENST00000465676.1_3'UTR|EPHB2_ENST00000374632.3_Missense_Mutation_p.R518C|EPHB2_ENST00000374627.1_Missense_Mutation_p.R513C|EPHB2_ENST00000374630.3_Missense_Mutation_p.R518C	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	518	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.R518C(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AGGTTACGGGCGCTACAGCGG	0.587																																							uc009vqj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|pancreas(1)	5						c.(1552-1554)CGC>TGC		ephrin receptor EphB2 isoform 1 precursor		C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	66.0	66.0	66.0		1552,1552	5.2	1.0	1		66	0,8600		0,0,4300	no	missense,missense	EPHB2	NM_004442.6,NM_017449.3	180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	518/988,518/987	23219500	1,13005	2203	4300	6503	SO:0001583	missense	2048	Hereditary_Prostate_Cancer			axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity	g.chr1:23219500C>T	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1552C>T	1.37:g.23219500C>T	ENSP00000383053:p.Arg518Cys		Somatic				EPHB2_uc001bge.2_Missense_Mutation_p.R518C|EPHB2_uc001bgf.2_Missense_Mutation_p.R518C|EPHB2_uc010odu.1_Missense_Mutation_p.R518C	p.R518C	NM_017449	NP_059145	WXS	Illumina HiSeq	Unspecified	P29323	EPHB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)	7	1697	+		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)	518			Fibronectin type-III 2.|Extracellular (Potential).		O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37	c.1552C>T		.	.	.	.	.	.	.	.	.	.	C	27.6	4.845807	0.91197	2.27E-4	0.0	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.23	5.23	0.72850	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.064442	0.64402	D	0.000005	T	0.68531	0.3011	M	0.80847	2.515	0.80722	D	1	B;D;D;D	0.69078	0.029;0.997;0.995;0.98	B;P;P;P	0.58970	0.004;0.849;0.849;0.764	T	0.71626	-0.4536	10	0.56958	D	0.05	.	12.6042	0.56514	0.1658:0.8342:0.0:0.0	.	518;518;536;518	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	C	518;518;518;518;513	ENSP00000363761:R518C;ENSP00000383053:R518C;ENSP00000363763:R518C;ENSP00000363758:R513C	ENSP00000363755:R518C	R	+	1	0	EPHB2	23092087	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.576000	0.60915	2.723000	0.93209	0.655000	0.94253	CGC		0.587	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449		13	45	0	0	0	0.00245	0	13	45				
EIF3I	8668	broad.mit.edu	37	1	32694336	32694336	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:32694336C>T	ENST00000373586.1	+	8	720	c.648C>T	c.(646-648)gaC>gaT	p.D216D	EIF3I_ENST00000471486.1_3'UTR|MTMR9LP_ENST00000441044.1_RNA	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I									p.D216D(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				AGCTTTTTGACTCCACAACTC	0.562																																					Colon(102;1138 2140 2180 17876)	Colon(102;1138 2140 2180 17876)	uc001bur.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(646-648)GAC>GAT		eukaryotic translation initiation factor 3,							257.0	282.0	273.0					1																	32694336		2203	4300	6503	SO:0001819	synonymous_variant	8668					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr1:32694336C>T	U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.648C>T	1.37:g.32694336C>T			Somatic				EIF3I_uc009vuc.2_Silent_p.D216D|EIF3I_uc001bus.2_Silent_p.D168D	p.D216D	NM_003757	NP_003748	WXS	Illumina HiSeq	Unspecified	Q13347	EIF3I_HUMAN			9	1181	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)	216			WD 4.			Silent	SNP	ENST00000373586.1	37	c.648C>T	CCDS357.1																																																																																				0.562	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019282.2	NM_003757		14	321	0	0	0	0.004007	0	14	321				
DOCK7	85440	broad.mit.edu	37	1	62941485	62941485	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:62941485G>A	ENST00000340370.5	-	45	5778	c.5761C>T	c.(5761-5763)Cgt>Tgt	p.R1921C	DOCK7_ENST00000251157.5_Missense_Mutation_p.R1941C|DOCK7_ENST00000489185.1_5'UTR	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1952	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R1921C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CCATGGGCACGGCCATCTAAA	0.383																																							uc001daq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(5821-5823)CGT>TGT		dedicator of cytokinesis 7							166.0	160.0	162.0					1																	62941485		2203	4300	6503	SO:0001583	missense	85440				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding	g.chr1:62941485G>A		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5761C>T	1.37:g.62941485G>A	ENSP00000340742:p.Arg1921Cys		Somatic				DOCK7_uc001dan.2_Missense_Mutation_p.R1804C|DOCK7_uc001dao.2_Missense_Mutation_p.R1802C|DOCK7_uc001dap.2_Missense_Mutation_p.R1921C|DOCK7_uc001dam.2_Missense_Mutation_p.R1123C|DOCK7_uc010oov.1_Missense_Mutation_p.R682C|DOCK7_uc001dar.1_Missense_Mutation_p.R115C	p.R1941C	NM_033407	NP_212132	WXS	Illumina HiSeq	Unspecified	Q96N67	DOCK7_HUMAN			45	5855	-			1952			DHR-2.		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	c.5821C>T	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.134579|4.134579	0.77662|0.77662	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.19394	.|2.15;2.15	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52419|0.52419	0.1733|0.1733	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|0.999;0.998;0.999;0.999;1.0;0.997	T|T	0.59182|0.59182	-0.7502|-0.7502	5|10	.|0.87932	.|D	.|0	.|.	13.3684|13.3684	0.60698|0.60698	0.0:0.0:0.7248:0.2752|0.0:0.0:0.7248:0.2752	.|.	.|1952;1941;1921;1910;1912;1943	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	L|C	1114|1952;1941;1921;682	.|ENSP00000251157:R1941C;ENSP00000340742:R1921C	.|ENSP00000251157:R1941C	P|R	-|-	2|1	0|0	DOCK7|DOCK7	62714073|62714073	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.991000|0.991000	0.79684|0.79684	5.437000|5.437000	0.66544|0.66544	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	CCG|CGT		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407		25	108	0	0	0	0.005443	0	25	108				
ST6GALNAC5	81849	broad.mit.edu	37	1	77510030	77510030	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:77510030G>A	ENST00000477717.1	+	3	638	c.403G>A	c.(403-405)Gtg>Atg	p.V135M		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	135					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.V135M(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						TGGGCGTGACGTGGGCAATCG	0.617																																							uc001dhi.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(403-405)GTG>ATG		sialyltransferase 7E							74.0	66.0	68.0					1																	77510030		2203	4300	6503	SO:0001583	missense	81849				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77510030G>A		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.403G>A	1.37:g.77510030G>A	ENSP00000417583:p.Val135Met		Somatic				ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	p.V135M	NM_030965	NP_112227	WXS	Illumina HiSeq	Unspecified	Q9BVH7	SIA7E_HUMAN			3	578	+			135			Lumenal (Potential).		B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	c.403G>A	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	31	5.100435	0.94245	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.58652	0.32	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.82972	0.5153	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87947	0.2721	10	0.87932	D	0	-26.813	19.6806	0.95962	0.0:0.0:1.0:0.0	.	135	Q9BVH7	SIA7E_HUMAN	M	135;45	ENSP00000417583:V135M	ENSP00000436263:V135M	V	+	1	0	ST6GALNAC5	77282618	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.327000	0.96396	2.645000	0.89757	0.591000	0.81541	GTG		0.617	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965		10	62	0	0	0	0.001855	0	10	62				
BCL9	607	broad.mit.edu	37	1	147096156	147096156	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:147096156C>A	ENST00000234739.3	+	10	4417	c.3677C>A	c.(3676-3678)cCt>cAt	p.P1226H		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1226	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.P1226H(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GTCATCCGACCTGGAGCCACC	0.572			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(3676-3678)CCT>CAT		B-cell CLL/lymphoma 9							66.0	70.0	69.0					1																	147096156		2203	4300	6503	SO:0001583	missense	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147096156C>A	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3677C>A	1.37:g.147096156C>A	ENSP00000234739:p.Pro1226His		Somatic				BCL9_uc010ozr.1_Missense_Mutation_p.P1140H	p.P1226H	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			10	4417	+	all_hematologic(923;0.115)		1226			Pro-rich.		Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	c.3677C>A	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771503	0.69992	.	.	ENSG00000116128	ENST00000234739	T	0.69926	-0.44	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.75547	0.3864	L	0.55990	1.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.78427	-0.2208	10	0.87932	D	0	-7.1131	18.49	0.90843	0.0:1.0:0.0:0.0	.	1226;1226	Q1JQ81;O00512	.;BCL9_HUMAN	H	1226	ENSP00000234739:P1226H	ENSP00000234739:P1226H	P	+	2	0	BCL9	145562780	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.437000	0.82529	0.655000	0.94253	CCT		0.572	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		9	83	1	0	1.08611e-07	0.010729	1.35763e-07	9	83				
RXRG	6258	broad.mit.edu	37	1	165389184	165389184	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:165389184C>T	ENST00000359842.5	-	3	667	c.365G>A	c.(364-366)gGa>gAa	p.G122E	RXRG_ENST00000470566.1_5'UTR	NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	122	Modulating. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G122E(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	GTTCATGTTTCCAATCCCGGG	0.493																																							uc001gda.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(364-366)GGA>GAA		retinoid X receptor, gamma isoform a	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)						133.0	127.0	129.0					1																	165389184		2203	4300	6503	SO:0001583	missense	6258				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr1:165389184C>T	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.365G>A	1.37:g.165389184C>T	ENSP00000352900:p.Gly122Glu		Somatic					p.G122E	NM_006917	NP_008848	WXS	Illumina HiSeq	Unspecified	P48443	RXRG_HUMAN			3	665	-	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		122			Modulating (By similarity).		A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	c.365G>A	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965656	0.53507	.	.	ENSG00000143171	ENST00000359842	D	0.91945	-2.94	5.09	5.09	0.68999	.	0.176513	0.39834	N	0.001245	D	0.91680	0.7370	M	0.63843	1.955	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.89847	0.4007	9	0.06625	T	0.88	.	12.9097	0.58173	0.0:0.8366:0.1634:0.0	.	122	P48443	RXRG_HUMAN	E	122	ENSP00000352900:G122E	ENSP00000352900:G122E	G	-	2	0	RXRG	163655808	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.211000	0.51137	2.359000	0.80004	0.563000	0.77884	GGA		0.493	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917		16	45	0	0	0	0.004007	0	16	45				
TBX19	9095	broad.mit.edu	37	1	168260408	168260408	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:168260408C>T	ENST00000367821.3	+	2	265	c.214C>T	c.(214-216)Cca>Tca	p.P72S		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	72					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P72S(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					ACGGATGTTTCCAGTCCTAAA	0.517																																							uc001gfl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(214-216)CCA>TCA		T-box 19							163.0	153.0	157.0					1																	168260408		2203	4300	6503	SO:0001583	missense	9095				anatomical structure morphogenesis	nucleus	DNA binding	g.chr1:168260408C>T	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.214C>T	1.37:g.168260408C>T	ENSP00000356795:p.Pro72Ser		Somatic				TBX19_uc001gfj.3_Missense_Mutation_p.P3S	p.P72S	NM_005149	NP_005140	WXS	Illumina HiSeq	Unspecified	O60806	TBX19_HUMAN			2	265	+	all_hematologic(923;0.215)		72			T-box.		Q52M53	Missense_Mutation	SNP	ENST00000367821.3	37	c.214C>T	CCDS1272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.376797|4.376797	0.82682|0.82682	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000367821;ENST00000367828|ENST00000431969	D|.	0.90732|.	-2.72|.	4.87|4.87	4.87|4.87	0.63330|0.63330	p53-like transcription factor, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90170|0.90170	0.6928|0.6928	H|H	0.98818|0.98818	4.34|4.34	.|.	.|.	.|.	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	D|D	0.94005|0.94005	0.7279|0.7279	9|4	0.87932|.	D|.	0|.	.|.	17.8078|17.8078	0.88607|0.88607	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	72;3|.	O60806;B3KRD9|.	TBX19_HUMAN;.|.	S|F	72;12|4	ENSP00000356795:P72S|.	ENSP00000356795:P72S|.	P|S	+|+	1|2	0|0	TBX19|TBX19	166527032|166527032	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.977000|0.977000	0.68977|0.68977	7.209000|7.209000	0.77916|0.77916	2.529000|2.529000	0.85273|0.85273	0.655000|0.655000	0.94253|0.94253	CCA|TCC		0.517	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149		30	152	0	0	0	0.013726	0	30	152				
METTL13	51603	broad.mit.edu	37	1	171753362	171753362	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:171753362C>T	ENST00000361735.3	+	2	902	c.636C>T	c.(634-636)ttC>ttT	p.F212F	METTL13_ENST00000362019.3_Silent_p.F126F|METTL13_ENST00000458517.1_Silent_p.F211F|METTL13_ENST00000367737.5_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	212							methyltransferase activity (GO:0008168)	p.F212F(1)		breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TGACCAAGTTCAGGCCAGTCC	0.612																																							uc001ghz.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(1)	1						c.(634-636)TTC>TTT		CGI-01 protein isoform 1							73.0	76.0	75.0					1																	171753362		2203	4300	6503	SO:0001819	synonymous_variant	51603						methyltransferase activity|protein binding	g.chr1:171753362C>T	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.636C>T	1.37:g.171753362C>T			Somatic				METTL13_uc001gia.2_Silent_p.F126F|METTL13_uc001gib.2_Intron|METTL13_uc010pml.1_Silent_p.F211F	p.F212F	NM_015935	NP_057019	WXS	Illumina HiSeq	Unspecified	Q8N6R0	MTL13_HUMAN			2	983	+			212					A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	ENST00000361735.3	37	c.636C>T	CCDS1299.1																																																																																				0.612	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955		21	80	0	0	0	0.012319	0	21	80				
KLHL20	27252	broad.mit.edu	37	1	173751319	173751319	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:173751319A>G	ENST00000209884.4	+	11	1832	c.1696A>G	c.(1696-1698)Aca>Gca	p.T566A	KLHL20_ENST00000546011.1_Missense_Mutation_p.T377A	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	566					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						TGATGGCACAACATACTTGAA	0.413																																					GBM(159;862 2695 6559 23041)	GBM(159;862 2695 6559 23041)	uc001gjc.2		NA																	0				ovary(1)	1						c.(1696-1698)ACA>GCA		kelch-like 20							215.0	202.0	206.0					1																	173751319		2203	4300	6503	SO:0001583	missense	27252				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity	g.chr1:173751319A>G	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1696A>G	1.37:g.173751319A>G	ENSP00000209884:p.Thr566Ala		Somatic				KLHL20_uc010pmr.1_Missense_Mutation_p.T377A|KLHL20_uc009wwf.2_Missense_Mutation_p.T548A	p.T566A	NM_014458	NP_055273	WXS	Illumina HiSeq	Unspecified	Q9Y2M5	KLH20_HUMAN			11	1875	+			566			Kelch 6.		B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	c.1696A>G	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.327146	0.41197	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.78364	-1.17;-1.17	4.97	4.97	0.65823	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.55065	0.1897	L	0.31120	0.905	0.80722	D	1	B;B	0.14805	0.011;0.011	B;B	0.23150	0.02;0.044	T	0.56757	-0.7926	10	0.37606	T	0.19	.	13.6529	0.62320	1.0:0.0:0.0:0.0	.	377;566	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	A	377;566	ENSP00000443121:T377A;ENSP00000209884:T566A	ENSP00000209884:T566A	T	+	1	0	KLHL20	172017942	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	9.128000	0.94424	1.870000	0.54199	0.528000	0.53228	ACA		0.413	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458		4	114	0	0	0	0.009096	0	4	114				
RC3H1	149041	broad.mit.edu	37	1	173931109	173931109	+	Silent	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:173931109G>A	ENST00000367696.2	-	12	2307	c.1956C>T	c.(1954-1956)aaC>aaT	p.N652N	RC3H1_ENST00000367694.2_Silent_p.N652N|RC3H1_ENST00000258349.4_Silent_p.N652N			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	652	Pro-rich.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N652N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						CATACTGAGAGTTTACAACAC	0.512																																							uc001gju.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1954-1956)AAC>AAT		roquin							225.0	209.0	215.0					1																	173931109		2203	4300	6503	SO:0001819	synonymous_variant	149041				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:173931109G>A	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.1956C>T	1.37:g.173931109G>A			Somatic				RC3H1_uc010pms.1_Silent_p.N652N|RC3H1_uc001gjv.2_Silent_p.N652N|RC3H1_uc010pmt.1_Silent_p.N652N	p.N652N	NM_172071	NP_742068	WXS	Illumina HiSeq	Unspecified	Q5TC82	RC3H1_HUMAN			11	2043	-			652			Pro-rich.		B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Silent	SNP	ENST00000367696.2	37	c.1956C>T	CCDS30940.1																																																																																				0.512	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		5	81	0	0	0	0.000602	0	5	81				
PPP1R15B	84919	broad.mit.edu	37	1	204379080	204379080	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:204379080T>C	ENST00000367188.4	-	1	1839	c.1460A>G	c.(1459-1461)tAt>tGt	p.Y487C	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	487					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.Y487C(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CTGGGGATTATAAGGATCTAC	0.438																																							uc001hav.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1459-1461)TAT>TGT		protein phosphatase 1, regulatory subunit 15B							87.0	93.0	91.0					1																	204379080		2203	4300	6503	SO:0001583	missense	84919				regulation of translation			g.chr1:204379080T>C	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1460A>G	1.37:g.204379080T>C	ENSP00000356156:p.Tyr487Cys		Somatic					p.Y487C	NM_032833	NP_116222	WXS	Illumina HiSeq	Unspecified	Q5SWA1	PR15B_HUMAN	all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)		1	1865	-	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		487					Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	c.1460A>G	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081458	0.76528	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.27402	1.67	5.38	5.38	0.77491	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.065393	0.64402	D	0.000005	T	0.56601	0.1996	M	0.77616	2.38	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	T	0.62044	-0.6937	10	0.87932	D	0	-16.2458	13.6468	0.62286	0.0:0.0:0.0:1.0	.	487	Q5SWA1	PR15B_HUMAN	C	487;397	ENSP00000356156:Y487C	ENSP00000356156:Y487C	Y	-	2	0	PPP1R15B	202645703	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	6.720000	0.74723	2.031000	0.59945	0.533000	0.62120	TAT		0.438	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833		22	80	0	0	0	0.010504	0	22	80				
KCNK2	3776	broad.mit.edu	37	1	215259895	215259895	+	Silent	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:215259895C>A	ENST00000444842.2	+	2	381	c.231C>A	c.(229-231)gcC>gcA	p.A77A	KCNK2_ENST00000391895.2_Silent_p.A73A|KCNK2_ENST00000391894.2_Silent_p.A62A	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	77					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.A77A(1)|p.A62A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TCATCGGAGCCACCGTGTTCA	0.468																																							uc001hkq.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(229-231)GCC>GCA		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						112.0	98.0	103.0					1																	215259895		2203	4300	6503	SO:0001819	synonymous_variant	3776						outward rectifier potassium channel activity	g.chr1:215259895C>A	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.231C>A	1.37:g.215259895C>A			Somatic				KCNK2_uc001hko.2_Silent_p.A73A|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Silent_p.A62A	p.A77A	NM_001017425	NP_001017425	WXS	Illumina HiSeq	Unspecified	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	2	400	+			77			Helical; (Potential).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	ENST00000444842.2	37	c.231C>A	CCDS41467.1																																																																																				0.468	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		12	69	1	0	6.40141e-05	0.010729	7.2621e-05	12	69				
CAPN9	10753	broad.mit.edu	37	1	230895275	230895275	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:230895275G>A	ENST00000271971.2	+	3	414	c.301G>A	c.(301-303)Gcc>Acc	p.A101T	CAPN9_ENST00000354537.1_Missense_Mutation_p.A101T|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000366666.2_Intron	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	101	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.A101T(2)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CTGGCTATTAGCCGCCATCGC	0.478																																							uc001htz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(301-303)GCC>ACC		calpain 9 isoform 1							69.0	67.0	68.0					1																	230895275		2203	4300	6503	SO:0001583	missense	10753				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity	g.chr1:230895275G>A	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.301G>A	1.37:g.230895275G>A	ENSP00000271971:p.Ala101Thr		Somatic				CAPN9_uc009xfg.1_Intron|CAPN9_uc001hua.1_Missense_Mutation_p.A101T	p.A101T	NM_006615	NP_006606	WXS	Illumina HiSeq	Unspecified	O14815	CAN9_HUMAN			3	414	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	101			Calpain catalytic.		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	c.301G>A	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	G	32	5.126511	0.94429	.	.	ENSG00000135773	ENST00000271971;ENST00000354537	T;T	0.33216	1.42;1.42	5.32	5.32	0.75619	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76258	-0.3025	10	0.87932	D	0	.	18.9884	0.92782	0.0:0.0:1.0:0.0	.	101;101	O14815-2;O14815	.;CAN9_HUMAN	T	101	ENSP00000271971:A101T;ENSP00000346538:A101T	ENSP00000271971:A101T	A	+	1	0	CAPN9	228961898	1.000000	0.71417	0.456000	0.27044	0.917000	0.54804	9.434000	0.97515	2.490000	0.84030	0.655000	0.94253	GCC		0.478	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615		7	45	0	0	0	0.001984	0	7	45				
RBM34	23029	broad.mit.edu	37	1	235295187	235295187	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:235295187C>A	ENST00000408888.3	-	11	1364	c.1134G>T	c.(1132-1134)aaG>aaT	p.K378N	TOMM20_ENST00000366607.4_5'Flank|RBM34_ENST00000495224.1_5'UTR|RBM34_ENST00000366606.3_Missense_Mutation_p.K373N			P42696	RBM34_HUMAN	RNA binding motif protein 34	378						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K378N(1)		central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			TACTGACATTCTTCAATCGTG	0.318																																							uc001hwn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1132-1134)AAG>AAT		RNA binding motif protein 34 isoform 1							99.0	92.0	94.0					1																	235295187		1818	4074	5892	SO:0001583	missense	23029					nucleolus	nucleotide binding|RNA binding	g.chr1:235295187C>A		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.1134G>T	1.37:g.235295187C>A	ENSP00000386226:p.Lys378Asn		Somatic				TOMM20_uc001hwl.2_5'Flank|RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA	p.K378N	NM_015014	NP_055829	WXS	Illumina HiSeq	Unspecified	P42696	RBM34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)		11	1164	-	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	378					A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	c.1134G>T	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	8.820	0.937258	0.18206	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000447801	T;T;T	0.16897	2.31;2.31;2.43	5.64	2.74	0.32292	.	0.277073	0.41194	D	0.000922	T	0.16938	0.0407	M	0.76838	2.35	0.21020	N	0.99981	B	0.30146	0.27	B	0.31495	0.131	T	0.19128	-1.0315	10	0.30078	T	0.28	-18.2572	1.894	0.03254	0.1291:0.4572:0.1255:0.2882	.	378	P42696	RBM34_HUMAN	N	378;373;356	ENSP00000386226:K378N;ENSP00000355565:K373N;ENSP00000400000:K356N	ENSP00000355565:K373N	K	-	3	2	RBM34	233361810	0.054000	0.20591	0.932000	0.37286	0.218000	0.24690	-0.346000	0.07760	0.746000	0.32786	0.563000	0.77884	AAG		0.318	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		14	59	1	0	7.93312e-07	0.00245	9.7361e-07	14	59				
NLRP3	114548	broad.mit.edu	37	1	247588207	247588207	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr1:247588207G>A	ENST00000336119.3	+	3	2208	c.1462G>A	c.(1462-1464)Gac>Aac	p.D488N	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.D488N|NLRP3_ENST00000391828.3_Missense_Mutation_p.D488N|NLRP3_ENST00000391827.2_Missense_Mutation_p.D488N|NLRP3_ENST00000366497.2_Missense_Mutation_p.D488N|NLRP3_ENST00000348069.2_Missense_Mutation_p.D488N	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	488	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.D488N(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGAGGAGTCCGACCTCAGGAA	0.552																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1462-1464)GAC>AAC		NLR family, pyrin domain containing 3 isoform a							42.0	42.0	42.0					1																	247588207		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588207G>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1462G>A	1.37:g.247588207G>A	ENSP00000337383:p.Asp488Asn		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.D488N|NLRP3_uc001icu.2_Missense_Mutation_p.D488N|NLRP3_uc001icw.2_Missense_Mutation_p.D488N|NLRP3_uc001icv.2_Missense_Mutation_p.D488N|NLRP3_uc010pyw.1_Missense_Mutation_p.D486N|NLRP3_uc001ict.1_Missense_Mutation_p.D486N	p.D488N	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1600	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	488			NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.1462G>A	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610598	0.28712	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	4.17	3.24	0.37175	NACHT nucleoside triphosphatase (1);	0.225617	0.31648	N	0.007291	D	0.94430	0.8208	M	0.83953	2.67	0.39423	D	0.966954	P;D;D;D;D	0.89917	0.953;1.0;1.0;0.987;0.977	B;D;D;P;P	0.78314	0.361;0.918;0.991;0.885;0.707	D	0.94182	0.7433	10	0.51188	T	0.08	.	10.0919	0.42451	0.0:0.2036:0.7964:0.0	.	488;488;488;488;488	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	488	ENSP00000375704:D488N;ENSP00000355453:D488N;ENSP00000337383:D488N;ENSP00000294752:D488N;ENSP00000355452:D488N;ENSP00000375703:D488N	ENSP00000337383:D488N	D	+	1	0	NLRP3	245654830	1.000000	0.71417	0.288000	0.24862	0.018000	0.09664	8.259000	0.89855	1.327000	0.45338	-0.176000	0.13171	GAC		0.552	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		5	25	0	0	0	0.001168	0	5	25				
ATP5C1	509	broad.mit.edu	37	10	7842009	7842009	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:7842009A>T	ENST00000356708.7	+	6	671	c.592A>T	c.(592-594)Aca>Tca	p.T198S	ATP5C1_ENST00000335698.4_Missense_Mutation_p.T198S|ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000541227.1_Missense_Mutation_p.T151S	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	198					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)	p.T198S(1)		breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						CTCCTATAAGACAGAAGAAAA	0.299																																					Melanoma(143;1012 1820 16249 30920 33158)	Melanoma(143;1012 1820 16249 30920 33158)	uc001iju.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(592-594)ACA>TCA		ATP synthase, H+ transporting, mitochondrial F1							110.0	117.0	114.0					10																	7842009		2203	4300	6503	SO:0001583	missense	509				oxidative phosphorylation|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr10:7842009A>T	D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.592A>T	10.37:g.7842009A>T	ENSP00000349142:p.Thr198Ser		Somatic				ATP5C1_uc009xiq.1_Missense_Mutation_p.T198S|ATP5C1_uc010qbc.1_Missense_Mutation_p.T149S|ATP5C1_uc001ijv.2_Missense_Mutation_p.T198S	p.T198S	NM_001001973	NP_001001973	WXS	Illumina HiSeq	Unspecified	P36542	ATPG_HUMAN			6	670	+			198					A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Missense_Mutation	SNP	ENST00000356708.7	37	c.592A>T	CCDS31142.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001554	0.54254	.	.	ENSG00000165629	ENST00000356708;ENST00000335698;ENST00000541227	.	.	.	5.61	5.61	0.85477	ATPase, F1 complex, gamma subunit domain (1);	0.091062	0.85682	D	0.000000	T	0.63165	0.2488	M	0.71581	2.175	0.58432	D	0.999999	B	0.33413	0.411	B	0.36534	0.227	T	0.64441	-0.6407	9	0.44086	T	0.13	-15.3249	12.3613	0.55205	0.8739:0.0:0.0:0.1261	.	198	P36542	ATPG_HUMAN	S	198;198;151	.	ENSP00000338568:T198S	T	+	1	0	ATP5C1	7882015	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.238000	0.78173	2.261000	0.74972	0.533000	0.62120	ACA		0.299	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046708.1	NM_005174		28	131	0	0	0	0.008361	0	28	131				
ITGA8	8516	broad.mit.edu	37	10	15714661	15714661	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:15714661G>T	ENST00000378076.3	-	7	1117	c.764C>A	c.(763-765)aCg>aAg	p.T255K		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	255			T -> M (in RHDA1; unknown pathological significance). {ECO:0000269|PubMed:24439109}.		brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.T255K(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AGCCACTTCCGTCTGCTTTTC	0.418																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(763-765)ACG>AAG		integrin, alpha 8 precursor							145.0	138.0	141.0					10																	15714661		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15714661G>T	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.764C>A	10.37:g.15714661G>T	ENSP00000367316:p.Thr255Lys		Somatic				ITGA8_uc010qcb.1_Missense_Mutation_p.T255K	p.T255K	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			7	764	-			255			Extracellular (Potential).|FG-GAP 4.		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.764C>A	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641115	0.87859	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.22539	1.95	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.60687	-0.7214	10	0.49607	T	0.09	.	19.375	0.94505	0.0:0.0:1.0:0.0	.	255;255	F5H818;P53708	.;ITA8_HUMAN	K	255	ENSP00000367316:T255K	ENSP00000367316:T255K	T	-	2	0	ITGA8	15754667	1.000000	0.71417	0.985000	0.45067	0.963000	0.63663	7.754000	0.85163	2.648000	0.89879	0.591000	0.81541	ACG		0.418	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		24	112	1	0	1.39806e-14	0.008361	1.90644e-14	24	112				
CCDC7	79741	broad.mit.edu	37	10	33015700	33015700	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:33015700G>T	ENST00000375030.2	+	11	1171	c.553G>T	c.(553-555)Gtg>Ttg	p.V185L	C10orf68_ENST00000375025.4_Missense_Mutation_p.V177L|C10orf68_ENST00000375028.3_Missense_Mutation_p.V153L			Q9H943	CJ068_HUMAN		177								p.V177L(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TCAAGATTCAGTGTCAAAACT	0.284																																							uc001iwn.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(529-531)GTG>TTG		chromosome 10 open reading frame 68							51.0	55.0	54.0					10																	33015700		2203	4284	6487	SO:0001583	missense	79741							g.chr10:33015700G>T																												ENST00000375030.2:c.553G>T	10.37:g.33015700G>T	ENSP00000364170:p.Val185Leu		Somatic				C10orf68_uc001iwl.1_Missense_Mutation_p.V185L|C10orf68_uc001iwm.1_Missense_Mutation_p.V153L|C10orf68_uc010qei.1_Missense_Mutation_p.V104L|C10orf68_uc001iwo.3_5'Flank	p.V177L	NM_024688	NP_078964	WXS	Illumina HiSeq	Unspecified	Q9H943	CJ068_HUMAN			8	1002	+			177					B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	ENST00000375030.2	37	c.529G>T		.	.	.	.	.	.	.	.	.	.	.	10.84	1.463822	0.26335	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.29655	1.6;1.56;1.59;1.58	2.58	0.686	0.18015	.	.	.	.	.	T	0.26268	0.0641	L	0.44542	1.39	0.09310	N	1	D;P;P;D	0.56035	0.974;0.928;0.794;0.974	P;P;B;P	0.47981	0.563;0.563;0.444;0.563	T	0.12708	-1.0537	9	0.27082	T	0.32	.	4.5528	0.12123	0.3248:0.0:0.6752:0.0	.	109;177;153;185	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	L	177;185;153;177;125	ENSP00000303710:V177L;ENSP00000364170:V185L;ENSP00000364168:V153L;ENSP00000364165:V177L	ENSP00000303710:V177L	V	+	1	0	C10orf68	33055706	0.000000	0.05858	0.002000	0.10522	0.121000	0.20230	-0.541000	0.06099	0.168000	0.19655	-0.266000	0.10368	GTG		0.284	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2			6	14	1	0	0.00198382	0.001984	0.00214252	6	14				
ANKRD30A	91074	broad.mit.edu	37	10	37438705	37438705	+	Splice_Site	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:37438705C>A	ENST00000602533.1	+	11	1504	c.1405C>A	c.(1405-1407)Cct>Act	p.P469T	ANKRD30A_ENST00000361713.1_Splice_Site_p.P469T|ANKRD30A_ENST00000374660.1_Splice_Site_p.P469T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	525					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P469T(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCCCATTTAGCCTGCCATTGA	0.279																																							uc001iza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(1405-1407)CCT>ACT		ankyrin repeat domain 30A							105.0	97.0	100.0					10																	37438705		1799	4062	5861	SO:0001630	splice_region_variant	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37438705C>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1405-1C>A	10.37:g.37438705C>A			Somatic					p.P469T	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			11	1504	+			525					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.1405C>A		.	.	.	.	.	.	.	.	.	.	.	8.656	0.899440	0.17686	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.08546	3.08;3.08	1.28	1.28	0.21552	.	.	.	.	.	T	0.13670	0.0331	L	0.29908	0.895	0.09310	N	1	D	0.64830	0.994	D	0.73708	0.981	T	0.20974	-1.0259	8	.	.	.	.	6.0084	0.19559	0.0:1.0:0.0:0.0	.	525	Q9BXX3	AN30A_HUMAN	T	469	ENSP00000354432:P469T;ENSP00000363792:P469T	.	P	+	1	0	ANKRD30A	37478711	0.418000	0.25440	0.013000	0.15412	0.002000	0.02628	0.102000	0.15272	1.008000	0.39264	0.409000	0.27619	CCT		0.279	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	Missense_Mutation	10	65	1	0	2.17888e-05	0.006214	2.55781e-05	10	65				
P4HA1	5033	broad.mit.edu	37	10	74810876	74810876	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:74810876C>A	ENST00000307116.2	-	7	951	c.835G>T	c.(835-837)Gct>Tct	p.A279S	P4HA1_ENST00000440381.1_Missense_Mutation_p.A279S|P4HA1_ENST00000263556.3_Missense_Mutation_p.A279S|P4HA1_ENST00000394890.2_Missense_Mutation_p.A279S|P4HA1_ENST00000412021.2_Missense_Mutation_p.A279S|P4HA1_ENST00000373008.2_Missense_Mutation_p.A279S			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	279					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)	p.A279S(3)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TAATCCACAGCAACCCCTTTT	0.388																																					Colon(147;367 2405 2662 52127)	Colon(147;367 2405 2662 52127)	uc010qka.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(835-837)GCT>TCT		prolyl 4-hydroxylase, alpha I subunit isoform 2	Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						279.0	268.0	272.0					10																	74810876		2203	4300	6503	SO:0001583	missense	5033					endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity	g.chr10:74810876C>A		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.835G>T	10.37:g.74810876C>A	ENSP00000307318:p.Ala279Ser		Somatic				P4HA1_uc001jtg.2_Missense_Mutation_p.A279S|P4HA1_uc001jth.2_Missense_Mutation_p.A279S|P4HA1_uc010qkb.1_Missense_Mutation_p.A279S|P4HA1_uc001jti.2_RNA	p.A279S	NM_001142595	NP_001136067	WXS	Illumina HiSeq	Unspecified	P13674	P4HA1_HUMAN			8	1169	-	Prostate(51;0.0198)		279					C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	ENST00000307116.2	37	c.835G>T		.	.	.	.	.	.	.	.	.	.	C	10.34	1.324092	0.24080	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.42131	0.99;0.99;0.99;0.99;0.99;0.98	5.67	4.75	0.60458	.	0.715254	0.13795	N	0.362237	T	0.25531	0.0621	N	0.11560	0.145	0.30135	N	0.804484	B;B;B	0.12013	0.001;0.005;0.005	B;B;B	0.14023	0.001;0.006;0.01	T	0.12578	-1.0542	10	0.15066	T	0.55	-4.3989	14.3709	0.66838	0.0:0.8508:0.1492:0.0	.	279;279;279	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	S	279	ENSP00000307318:A279S;ENSP00000362099:A279S;ENSP00000411688:A279S;ENSP00000378353:A279S;ENSP00000263556:A279S;ENSP00000414464:A279S	ENSP00000263556:A279S	A	-	1	0	P4HA1	74480882	0.837000	0.29446	1.000000	0.80357	0.961000	0.63080	1.337000	0.33862	1.373000	0.46208	0.557000	0.71058	GCT		0.388	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	NM_000917		34	184	1	0	4.92203e-23	0.00623	6.9216e-23	34	184				
LRIT1	26103	broad.mit.edu	37	10	85993891	85993891	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:85993891G>A	ENST00000372105.3	-	3	854	c.833C>T	c.(832-834)aCt>aTt	p.T278I		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	278	Ig-like C2-type.					integral component of endoplasmic reticulum membrane (GO:0030176)		p.T278I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AGGGACTCCAGTAGCTCCACA	0.592																																							uc001kcz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(832-834)ACT>ATT		retina specific protein PAL							62.0	61.0	61.0					10																	85993891		2203	4300	6503	SO:0001583	missense	26103					integral to endoplasmic reticulum membrane		g.chr10:85993891G>A	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.833C>T	10.37:g.85993891G>A	ENSP00000361177:p.Thr278Ile		Somatic					p.T278I	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			3	855	-			278			Lumenal (Potential).|Ig-like C2-type.		Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	c.833C>T	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386860	0.25031	.	.	ENSG00000148602	ENST00000372105	T	0.68025	-0.3	5.91	5.0	0.66597	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.264552	0.43579	D	0.000541	T	0.68751	0.3035	L	0.59436	1.845	0.38229	D	0.940997	P	0.46859	0.885	P	0.51297	0.665	T	0.69639	-0.5091	10	0.30854	T	0.27	.	9.5437	0.39268	0.0748:0.1446:0.7806:0.0	.	278	Q9P2V4	LRIT1_HUMAN	I	278	ENSP00000361177:T278I	ENSP00000361177:T278I	T	-	2	0	LRIT1	85983871	1.000000	0.71417	0.728000	0.30774	0.114000	0.19823	5.287000	0.65645	1.481000	0.48307	-0.176000	0.13171	ACT		0.592	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		12	69	0	0	0	0.010729	0	12	69				
CALHM1	255022	broad.mit.edu	37	10	105218098	105218098	+	Silent	SNP	T	T	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:105218098T>G	ENST00000329905.5	-	1	547	c.411A>C	c.(409-411)gcA>gcC	p.A137A	RP11-225H22.4_ENST00000411906.1_RNA	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	137					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)	p.A137A(1)		large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						CGTTGCCCAGTGCGCTCACGG	0.701																																							uc001kxe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(409-411)GCA>GCC		calcium homeostasis modulator 1							23.0	23.0	23.0					10																	105218098		2197	4295	6492	SO:0001819	synonymous_variant	255022					endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel activity|identical protein binding	g.chr10:105218098T>G	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.411A>C	10.37:g.105218098T>G			Somatic					p.A137A	NM_001001412	NP_001001412	WXS	Illumina HiSeq	Unspecified	Q8IU99	CAHM1_HUMAN			1	551	-			137					Q5W091	Silent	SNP	ENST00000329905.5	37	c.411A>C	CCDS7550.1																																																																																				0.701	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412		9	23	0	0	0	0.006214	0	9	23				
CFAP43	80217	broad.mit.edu	37	10	105890011	105890011	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:105890011C>T	ENST00000357060.3	-	38	4999	c.4884G>A	c.(4882-4884)atG>atA	p.M1628I	WDR96_ENST00000428666.1_Missense_Mutation_p.M1600I	NM_025145.5	NP_079421.5												p.M1628I(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCTGCTGTTGCATCATGTTTT	0.313																																							uc001kxw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4882-4884)ATG>ATA		hypothetical protein LOC80217							168.0	156.0	160.0					10																	105890011		2203	4298	6501	SO:0001583	missense	80217							g.chr10:105890011C>T																												ENST00000357060.3:c.4884G>A	10.37:g.105890011C>T	ENSP00000349568:p.Met1628Ile		Somatic				C10orf79_uc009xxq.2_Missense_Mutation_p.M907I	p.M1628I	NM_025145	NP_079421	WXS	Illumina HiSeq	Unspecified	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	38	5000	-		Colorectal(252;0.178)	1628						Missense_Mutation	SNP	ENST00000357060.3	37	c.4884G>A	CCDS31281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.72|12.72	2.022803|2.022803	0.35701|0.35701	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000457071;ENST00000434629|ENST00000357060;ENST00000428666	.|T;T	.|0.13657	.|2.57;2.59	5.91|5.91	4.02|4.02	0.46733|0.46733	.|.	.|0.229541	.|0.43260	.|N	.|0.000585	T|T	0.11196|0.11196	0.0273|0.0273	L|L	0.44542|0.44542	1.39|1.39	0.25147|0.25147	N|N	0.990459|0.990459	.|B;B	.|0.09022	.|0.002;0.0	.|B;B	.|0.10450	.|0.005;0.002	T|T	0.29427|0.29427	-1.0012|-1.0012	5|10	.|0.21540	.|T	.|0.41	.|.	8.3091|8.3091	0.32060|0.32060	0.2981:0.6307:0.0:0.0712|0.2981:0.6307:0.0:0.0712	.|.	.|1600;1628	.|G5E9L1;Q8NDM7	.|.;WDR96_HUMAN	Y|I	477;960|1628;1600	.|ENSP00000349568:M1628I;ENSP00000400289:M1600I	.|ENSP00000349568:M1628I	C|M	-|-	2|3	0|0	WDR96|WDR96	105880001|105880001	0.999000|0.999000	0.42202|0.42202	0.904000|0.904000	0.35570|0.35570	0.991000|0.991000	0.79684|0.79684	1.432000|1.432000	0.34936|0.34936	0.779000|0.779000	0.33543|0.33543	0.655000|0.655000	0.94253|0.94253	TGC|ATG		0.313	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				11	48	0	0	0	0.010729	0	11	48				
ATRNL1	26033	broad.mit.edu	37	10	117093795	117093795	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr10:117093795G>C	ENST00000355044.3	+	19	3167	c.3041G>C	c.(3040-3042)tGc>tCc	p.C1014S	ATRNL1_ENST00000423111.2_Intron|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1014	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.C1014S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCTTTAGCTTGCCAGTGTAAT	0.328																																							uc001lcg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(1)|central_nervous_system(1)	7						c.(3040-3042)TGC>TCC		attractin-like 1 precursor							88.0	80.0	82.0					10																	117093795		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:117093795G>C	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3041G>C	10.37:g.117093795G>C	ENSP00000347152:p.Cys1014Ser		Somatic				ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	p.C1014S	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	19	3427	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	1014			Laminin EGF-like 1.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.3041G>C	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665392	0.88251	.	.	ENSG00000107518	ENST00000355044	D	0.95949	-3.86	5.45	5.45	0.79879	EGF-like, laminin (2);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	H	0.98849	4.35	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	D	0.99229	1.0881	10	0.87932	D	0	-14.3794	19.638	0.95744	0.0:0.0:1.0:0.0	.	1014	Q5VV63	ATRN1_HUMAN	S	1014	ENSP00000347152:C1014S	ENSP00000347152:C1014S	C	+	2	0	ATRNL1	117083785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.707000	0.92482	0.591000	0.81541	TGC		0.328	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		3	42	0	0	0	0.004672	0	3	42				
OR52N2	390077	broad.mit.edu	37	11	5842280	5842280	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:5842280G>A	ENST00000317037.2	+	1	737	c.715G>A	c.(715-717)Gcc>Acc	p.A239T	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A239T(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCGTCACAAAGCCTTCAGCAC	0.423																																							uc010qzp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(715-717)GCC>ACC		olfactory receptor, family 52, subfamily N,							269.0	215.0	233.0					11																	5842280		2201	4296	6497	SO:0001583	missense	390077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5842280G>A	AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.715G>A	11.37:g.5842280G>A	ENSP00000322801:p.Ala239Thr		Somatic				TRIM5_uc001mbq.1_Intron	p.A239T	NM_001005174	NP_001005174	WXS	Illumina HiSeq	Unspecified	Q8NGI0	O52N2_HUMAN		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	715	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	239			Cytoplasmic (Potential).		Q6IFF9	Missense_Mutation	SNP	ENST00000317037.2	37	c.715G>A	CCDS31399.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593584	0.66219	.	.	ENSG00000180988	ENST00000317037	T	0.00357	7.89	6.11	6.11	0.99139	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.00724	0.0024	M	0.79475	2.455	0.42886	D	0.994188	P	0.49185	0.92	P	0.54924	0.764	T	0.78455	-0.2197	10	0.52906	T	0.07	.	19.298	0.94131	0.0:0.0:1.0:0.0	.	239	Q8NGI0	O52N2_HUMAN	T	239	ENSP00000322801:A239T	ENSP00000322801:A239T	A	+	1	0	OR52N2	5798856	1.000000	0.71417	0.978000	0.43139	0.045000	0.14185	5.431000	0.66507	2.906000	0.99361	0.655000	0.94253	GCC		0.423	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174		10	124	0	0	0	0.006214	0	10	124				
CNGA4	1262	broad.mit.edu	37	11	6262815	6262815	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:6262815G>T	ENST00000379936.2	+	5	1187	c.1072G>T	c.(1072-1074)Gag>Tag	p.E358*	CNGA4_ENST00000533426.1_Nonsense_Mutation_p.E127*	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	358					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.E358*(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGCCTGCTGGAGGAGCTGGT	0.582																																							uc001mco.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(1072-1074)GAG>TAG		cyclic nucleotide gated channel alpha 4							122.0	114.0	117.0					11																	6262815		2201	4296	6497	SO:0001587	stop_gained	1262				response to stimulus|sensory perception of smell		cAMP binding	g.chr11:6262815G>T	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1072G>T	11.37:g.6262815G>T	ENSP00000369268:p.Glu358*		Somatic				CNGA4_uc010raa.1_Nonsense_Mutation_p.E127*|CNGA4_uc001mcn.2_Nonsense_Mutation_p.E318*	p.E358*	NM_001037329	NP_001032406	WXS	Illumina HiSeq	Unspecified	Q8IV77	CNGA4_HUMAN		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	5	1179	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	358			cNMP.|Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000379936.2	37	c.1072G>T	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	G	37	6.549260	0.97654	.	.	ENSG00000132259	ENST00000533426;ENST00000379936	.	.	.	5.19	5.19	0.71726	.	0.051319	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	17.4408	0.87564	0.0:0.0:1.0:0.0	.	.	.	.	X	127;358	.	ENSP00000369268:E358X	E	+	1	0	CNGA4	6219391	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.169000	0.50809	2.691000	0.91804	0.655000	0.94253	GAG		0.582	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329		10	68	1	0	0.00829132	0.008291	0.00867696	10	68				
ACCSL	390110	broad.mit.edu	37	11	44080129	44080129	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:44080129C>T	ENST00000378832.1	+	13	1560	c.1504C>T	c.(1504-1506)Ctc>Ttc	p.L502F		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	502					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)	p.L502F(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						AGAAGAACGGCTCCTCTATTG	0.522																																							uc001mxw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1504-1506)CTC>TTC		1-aminocyclopropane-1-carboxylate synthase							118.0	118.0	118.0					11																	44080129		1894	4127	6021	SO:0001583	missense	390110						1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups	g.chr11:44080129C>T		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1504C>T	11.37:g.44080129C>T	ENSP00000368109:p.Leu502Phe		Somatic				ACCSL_uc009ykr.2_Missense_Mutation_p.L321F	p.L502F	NM_001031854	NP_001027025	WXS	Illumina HiSeq	Unspecified	Q4AC99	1A1L2_HUMAN			13	1560	+			502						Missense_Mutation	SNP	ENST00000378832.1	37	c.1504C>T	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.273511	0.59649	.	.	ENSG00000205126	ENST00000378832	D	0.90504	-2.68	5.61	-2.54	0.06307	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	1.176760	0.06060	N	0.658185	D	0.91334	0.7267	M	0.63428	1.95	0.09310	N	1	P	0.52463	0.953	P	0.57425	0.82	T	0.81426	-0.0938	10	0.56958	D	0.05	-0.8861	4.0163	0.09646	0.3896:0.2868:0.2522:0.0715	.	502	Q4AC99	1A1L2_HUMAN	F	502	ENSP00000368109:L502F	ENSP00000368109:L502F	L	+	1	0	ACCSL	44036705	0.001000	0.12720	0.000000	0.03702	0.280000	0.26924	-0.386000	0.07370	-0.366000	0.08064	0.655000	0.94253	CTC		0.522	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854		19	109	0	0	0	0.007413	0	19	109				
PRDM11	56981	broad.mit.edu	37	11	45246107	45246107	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:45246107G>T	ENST00000530656.1	+	7	1184	c.1184G>T	c.(1183-1185)gGg>gTg	p.G395V	PRDM11_ENST00000263765.4_Missense_Mutation_p.G395V|CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000424263.2_Missense_Mutation_p.G361V|PRDM11_ENST00000528980.1_Intron			Q9NQV5	PRD11_HUMAN	PR domain containing 11	395							methyltransferase activity (GO:0008168)	p.G395V(1)		endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						CAGACCCAGGGGGAGGGGGAC	0.562																																					NSCLC(118;1511 1736 6472 36603 43224)	NSCLC(118;1511 1736 6472 36603 43224)	uc001myo.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1183-1185)GGG>GTG		PR domain containing 11							67.0	78.0	74.0					11																	45246107		2203	4299	6502	SO:0001583	missense	56981							g.chr11:45246107G>T	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1184G>T	11.37:g.45246107G>T	ENSP00000435976:p.Gly395Val		Somatic					p.G395V	NM_020229	NP_064614	WXS	Illumina HiSeq	Unspecified	Q9NQV5	PRD11_HUMAN			8	1433	+			395					Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	37	c.1184G>T		.	.	.	.	.	.	.	.	.	.	G	15.92	2.975452	0.53720	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000424263	T;T;T	0.25579	1.79;1.79;1.8	5.51	4.6	0.57074	.	0.337332	0.26019	N	0.026827	T	0.20901	0.0503	N	0.19112	0.55	0.49915	D	0.999836	P	0.42203	0.773	P	0.45712	0.491	T	0.02942	-1.1091	10	0.56958	D	0.05	-22.2288	8.968	0.35887	0.2219:0.0:0.7781:0.0	.	395	Q9NQV5	PRD11_HUMAN	V	395;395;361	ENSP00000263765:G395V;ENSP00000435976:G395V;ENSP00000394314:G361V	ENSP00000263765:G395V	G	+	2	0	PRDM11	45202683	0.998000	0.40836	1.000000	0.80357	0.940000	0.58332	2.284000	0.43478	1.347000	0.45714	0.558000	0.71614	GGG		0.562	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229		25	110	1	0	4.72057e-08	0.003954	5.95586e-08	25	110				
MYRF	745	broad.mit.edu	37	11	61548502	61548502	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:61548502C>A	ENST00000278836.5	+	20	2653	c.2557C>A	c.(2557-2559)Ccc>Acc	p.P853T	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Missense_Mutation_p.P818T|MYRF_ENST00000389602.4_Missense_Mutation_p.P244T	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	853					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P818T(1)									AGGCATACAGCCCTCTTTGCT	0.617																																							uc001nsc.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(2557-2559)CCC>ACC		myelin gene regulatory factor isoform 2							77.0	73.0	75.0					11																	61548502		2202	4299	6501	SO:0001583	missense	745				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:61548502C>A		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.2557C>A	11.37:g.61548502C>A	ENSP00000278836:p.Pro853Thr		Somatic				C11orf9_uc001nse.1_Missense_Mutation_p.P818T|C11orf9_uc010rll.1_Missense_Mutation_p.P244T	p.P853T	NM_001127392	NP_001120864	WXS	Illumina HiSeq	Unspecified	Q9Y2G1	MRF_HUMAN			20	2653	+			853					O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	c.2557C>A	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.779100	0.31502	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000389602	T;T;T	0.30981	1.54;1.56;1.51	4.79	1.42	0.22433	.	0.542643	0.19984	N	0.101713	T	0.36386	0.0965	L	0.51422	1.61	0.09310	N	1	B;D;P	0.71674	0.11;0.998;0.78	B;D;B	0.66351	0.03;0.943;0.335	T	0.17319	-1.0373	10	0.37606	T	0.19	-15.1445	0.6604	0.00842	0.2165:0.3666:0.2116:0.2052	.	244;818;853	B4DHB2;Q9Y2G1-2;Q9Y2G1	.;.;MRF_HUMAN	T	853;818;244	ENSP00000278836:P853T;ENSP00000265460:P818T;ENSP00000374253:P244T	ENSP00000265460:P818T	P	+	1	0	C11orf9	61305078	0.001000	0.12720	0.055000	0.19348	0.883000	0.51084	0.120000	0.15647	0.178000	0.19917	-0.122000	0.15005	CCC		0.617	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279		14	37	1	0	1.49906e-05	0.00245	1.7752e-05	14	37				
FOLR1	2348	broad.mit.edu	37	11	71906939	71906939	+	Splice_Site	SNP	A	A	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:71906939A>C	ENST00000393679.1	+	5	929		c.e5-1		RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000312293.4_Splice_Site|FOLR1_ENST00000393676.3_Splice_Site|FOLR1_ENST00000393681.2_Splice_Site			P15328	FOLR1_HUMAN	folate receptor 1 (adult)						cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.?(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	TCCTCTCTACAGGGTTTAACA	0.517																																							uc001orz.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e6-2		folate receptor 1 precursor							89.0	88.0	88.0					11																	71906939		2200	4293	6493	SO:0001630	splice_region_variant	2348				cell death|folic acid transport|receptor-mediated endocytosis	anchored to membrane|extracellular region|integral to plasma membrane|membrane fraction	folic acid binding|receptor activity	g.chr11:71906939A>C	J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.494-1A>C	11.37:g.71906939A>C			Somatic				FOLR1_uc001osa.1_Splice_Site_p.G165_splice|FOLR1_uc001osb.1_Splice_Site_p.G165_splice|FOLR1_uc001osc.1_Splice_Site_p.G165_splice|FOLR1_uc001osd.1_Splice_Site_p.G165_splice	p.G165_splice	NM_016724	NP_057936	WXS	Illumina HiSeq	Unspecified	P15328	FOLR1_HUMAN			6	632	+								Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Splice_Site	SNP	ENST00000393679.1	37	c.494_splice	CCDS8211.1	.	.	.	.	.	.	.	.	.	.	a	13.11	2.139184	0.37728	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	.	.	.	4.11	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3769	0.49733	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FOLR1	71584587	1.000000	0.71417	0.415000	0.26534	0.008000	0.06430	4.757000	0.62213	1.839000	0.53478	0.460000	0.39030	.		0.517	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725	Intron	17	73	0	0	0	0.007413	0	17	73				
ME3	10873	broad.mit.edu	37	11	86267641	86267641	+	Missense_Mutation	SNP	C	C	T	rs150824447	byFrequency	TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr11:86267641C>T	ENST00000393324.3	-	3	674	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	ME3_ENST00000323418.6_Missense_Mutation_p.V79M|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.V141M|ME3_ENST00000543262.1_Missense_Mutation_p.V141M	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	141					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.V141M(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GCCAGCCCCACGGTAGGCGTG	0.592																																							uc001pbz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(421-423)GTG>ATG		mitochondrial malic enzyme 3 precursor	NADH(DB00157)	C	MET/VAL,MET/VAL,MET/VAL	2,4402	4.2+/-10.8	0,2,2200	79.0	63.0	69.0		421,421,421	6.0	1.0	11	dbSNP_134	69	0,8598		0,0,4299	no	missense,missense,missense	ME3	NM_001014811.1,NM_001161586.1,NM_006680.2	21,21,21	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging	141/605,141/605,141/605	86267641	2,13000	2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86267641C>T	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.421G>A	11.37:g.86267641C>T	ENSP00000376998:p.Val141Met		Somatic				ME3_uc001pca.2_Missense_Mutation_p.V141M|ME3_uc009yvk.2_Missense_Mutation_p.V141M|ME3_uc010rtr.1_RNA	p.V141M	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			3	675	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	141					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.421G>A	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206990	0.95033	4.54E-4	0.0	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418;ENST00000530335	T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2	5.96	5.96	0.96718	Malic enzyme, N-terminal (2);	0.053585	0.85682	N	0.000000	D	0.86764	0.6011	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91054	0.4880	9	.	.	.	-20.4398	20.422	0.99049	0.0:1.0:0.0:0.0	.	141	Q16798	MAON_HUMAN	M	141;141;141;141;79;79;141	ENSP00000352657:V141M;ENSP00000440246:V141M;ENSP00000376998:V141M;ENSP00000431182:V141M;ENSP00000315255:V79M;ENSP00000434690:V141M	.	V	-	1	0	ME3	85945289	1.000000	0.71417	0.970000	0.41538	0.783000	0.44284	7.726000	0.84824	2.832000	0.97577	0.655000	0.94253	GTG		0.592	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			5	29	0	0	0	0.000602	0	5	29				
KCNA1	3736	broad.mit.edu	37	12	5021088	5021088	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:5021088G>A	ENST00000382545.3	+	2	1651	c.544G>A	c.(544-546)Gtc>Atc	p.V182I	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	182					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.V182I(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CATCTCCATCGTCATCTTTTG	0.597																																							uc001qnh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(544-546)GTC>ATC		potassium voltage-gated channel subfamily A	Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						90.0	85.0	87.0					12																	5021088		2203	4300	6503	SO:0001583	missense	3736				synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity	g.chr12:5021088G>A	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.544G>A	12.37:g.5021088G>A	ENSP00000371985:p.Val182Ile		Somatic					p.V182I	NM_000217	NP_000208	WXS	Illumina HiSeq	Unspecified	Q09470	KCNA1_HUMAN			2	1649	+			182			Helical; Name=Segment S1; (Potential).		A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	c.544G>A	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133981	0.37630	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.68025	-0.3	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	L	0.52126	1.63	0.80722	D	1	B	0.14012	0.009	B	0.08055	0.003	T	0.55604	-0.8115	10	0.11182	T	0.66	.	17.1898	0.86876	0.0:0.0:1.0:0.0	.	182	Q09470	KCNA1_HUMAN	I	182	ENSP00000371985:V182I	ENSP00000228858:V182I	V	+	1	0	KCNA1	4891349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.739000	0.84976	2.606000	0.88127	0.655000	0.94253	GTC		0.597	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217		10	46	0	0	0	0.008291	0	10	46				
OVCH1	341350	broad.mit.edu	37	12	29624866	29624866	+	Silent	SNP	G	G	T	rs559859426		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:29624866G>T	ENST00000318184.5	-	16	1724	c.1725C>A	c.(1723-1725)atC>atA	p.I575I	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	575	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.I575I(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CCCCTCCTGCGATTCTTCTGG	0.502																																							uc001rix.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(1723-1725)ATC>ATA		ovochymase 1 precursor							54.0	55.0	54.0					12																	29624866		1935	4131	6066	SO:0001819	synonymous_variant	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29624866G>T	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1725C>A	12.37:g.29624866G>T			Somatic					p.I575I	NM_183378	NP_899234	WXS	Illumina HiSeq	Unspecified	Q7RTY7	OVCH1_HUMAN			16	1725	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		575			Peptidase S1 2.			Silent	SNP	ENST00000318184.5	37	c.1725C>A																																																																																					0.502	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		6	7	1	0	0.00198382	0.001984	0.00214252	6	7				
KRT80	144501	broad.mit.edu	37	12	52567409	52567409	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:52567409T>G	ENST00000394815.2	-	5	903	c.806A>C	c.(805-807)gAg>gCg	p.E269A	KRT80_ENST00000313234.5_Missense_Mutation_p.E269A	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	269	Coil 2.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E304A(1)|p.E269A(1)		endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		TGCCTCGGCCTCCTCCAGGCT	0.657																																					GBM(178;2309 2916 15678 35873)	GBM(178;2309 2916 15678 35873)	uc001rzx.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(805-807)GAG>GCG		keratin 80 isoform a							71.0	69.0	70.0					12																	52567409		2203	4300	6503	SO:0001583	missense	144501					keratin filament	structural molecule activity	g.chr12:52567409T>G	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.806A>C	12.37:g.52567409T>G	ENSP00000378292:p.Glu269Ala		Somatic				KRT80_uc001rzw.2_Missense_Mutation_p.E304A|KRT80_uc001rzy.2_Missense_Mutation_p.E269A	p.E269A	NM_182507	NP_872313	WXS	Illumina HiSeq	Unspecified	Q6KB66	K2C80_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.108)	5	904	-			269			Rod.|Coil 2.		Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	37	c.806A>C	CCDS8821.2	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462098	0.84425	.	.	ENSG00000167767	ENST00000313234;ENST00000394815	D;D	0.90676	-2.71;-2.71	4.23	4.23	0.50019	Filament (1);	0.000000	0.38381	N	0.001701	D	0.96648	0.8906	H	0.96365	3.81	0.53688	D	0.999976	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.97737	1.0206	10	0.87932	D	0	.	13.8071	0.63238	0.0:0.0:0.0:1.0	.	269;269;304	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	A	269	ENSP00000369361:E269A;ENSP00000378292:E269A	ENSP00000369361:E269A	E	-	2	0	KRT80	50853676	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	7.774000	0.85478	1.925000	0.55765	0.459000	0.35465	GAG		0.657	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507		12	51	0	0	0	0.013537	0	12	51				
KCNC2	3747	broad.mit.edu	37	12	75444672	75444672	+	Silent	SNP	A	A	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:75444672A>C	ENST00000549446.1	-	3	1793	c.1113T>G	c.(1111-1113)ctT>ctG	p.L371L	KCNC2_ENST00000298972.1_Silent_p.L371L|KCNC2_ENST00000550433.1_Silent_p.L371L|KCNC2_ENST00000341669.3_Silent_p.L371L|KCNC2_ENST00000548513.1_Silent_p.L371L|KCNC2_ENST00000350228.2_Silent_p.L371L|KCNC2_ENST00000548243.1_5'UTR|KCNC2_ENST00000540018.1_Silent_p.L371L|KCNC2_ENST00000393288.2_Silent_p.L371L	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	371					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L371L(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GAGTATGTCCAAGCACCCTCA	0.438																																							uc001sxg.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(1111-1113)CTT>CTG		Shaw-related voltage-gated potassium channel							53.0	49.0	50.0					12																	75444672		2203	4300	6503	SO:0001819	synonymous_variant	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75444672A>C	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1113T>G	12.37:g.75444672A>C			Somatic				KCNC2_uc009zry.2_Silent_p.L371L|KCNC2_uc001sxe.2_Silent_p.L371L|KCNC2_uc001sxf.2_Silent_p.L371L|KCNC2_uc010stw.1_Silent_p.L371L	p.L371L	NM_139137	NP_631875	WXS	Illumina HiSeq	Unspecified	Q96PR1	KCNC2_HUMAN			3	1657	-			371			Cytoplasmic (Potential).		B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	37	c.1113T>G	CCDS9007.1																																																																																				0.438	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		8	32	0	0	0	0.010729	0	8	32				
NAV3	89795	broad.mit.edu	37	12	78513025	78513025	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:78513025G>A	ENST00000397909.2	+	15	3222	c.3049G>A	c.(3049-3051)Gat>Aat	p.D1017N	NAV3_ENST00000228327.6_Missense_Mutation_p.D1017N|NAV3_ENST00000536525.2_Missense_Mutation_p.D1017N|NAV3_ENST00000266692.7_Missense_Mutation_p.D1017N			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1017						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.D1017N(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGGGAAAACCGATGATGCCAA	0.388										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(3049-3051)GAT>AAT		neuron navigator 3							118.0	112.0	114.0					12																	78513025		1855	4097	5952	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78513025G>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3049G>A	12.37:g.78513025G>A	ENSP00000381007:p.Asp1017Asn	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.D1017N|NAV3_uc010sub.1_Missense_Mutation_p.D517N|NAV3_uc009zsf.2_Missense_Mutation_p.D25N	p.D1017N	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			15	3222	+			1017					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.3049G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.522427|4.522427	0.85600|0.85600	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54|.	6.0|6.0	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.41396|.	U|.	0.000892|.	T|T	0.68540|0.68540	0.3012|0.3012	L|L	0.52759|0.52759	1.655|1.655	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.988;0.999;0.998;0.928|.	T|T	0.66594|0.66594	-0.5884|-0.5884	10|5	0.59425|.	D|.	0.04|.	-21.6374|-21.6374	16.5122|16.5122	0.84288|0.84288	0.0:0.0:0.868:0.132|0.0:0.0:0.868:0.132	.|.	1017;1017;1017;1017|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	N|Q	1017|88	ENSP00000446132:D1017N;ENSP00000381007:D1017N;ENSP00000228327:D1017N;ENSP00000266692:D1017N|.	ENSP00000228327:D1017N|.	D|R	+|+	1|2	0|0	NAV3|NAV3	77037156|77037156	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.932000|0.932000	0.56968|0.56968	9.577000|9.577000	0.98196|0.98196	1.499000|1.499000	0.48617|0.48617	0.655000|0.655000	0.94253|0.94253	GAT|CGA		0.388	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		27	88	0	0	0	0.007291	0	27	88				
LUM	4060	broad.mit.edu	37	12	91502247	91502247	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:91502247C>T	ENST00000266718.4	-	2	964	c.510G>A	c.(508-510)cgG>cgA	p.R170R	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	170					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.R170R(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						CCTCTTTCAGCCGATTGTGCT	0.448																																							uc001tbm.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(508-510)CGG>CGA		lumican precursor							98.0	99.0	99.0					12																	91502247		2203	4300	6503	SO:0001819	synonymous_variant	4060				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	g.chr12:91502247C>T	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.510G>A	12.37:g.91502247C>T			Somatic				LUM_uc001tbn.2_Intron	p.R170R	NM_002345	NP_002336	WXS	Illumina HiSeq	Unspecified	P51884	LUM_HUMAN			2	899	-			170			LRR 5.		B2R6R5|Q96QM7	Silent	SNP	ENST00000266718.4	37	c.510G>A	CCDS9038.1																																																																																				0.448	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345		5	76	0	0	0	0.000602	0	5	76				
SBNO1	55206	broad.mit.edu	37	12	123801796	123801796	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:123801796C>G	ENST00000602398.1	-	21	3034	c.2907G>C	c.(2905-2907)tgG>tgC	p.W969C	SBNO1_ENST00000420886.2_Missense_Mutation_p.W969C|SBNO1_ENST00000267176.4_Missense_Mutation_p.W968C|SBNO1_ENST00000602750.1_Missense_Mutation_p.W968C			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	969					regulation of transcription, DNA-templated (GO:0006355)			p.W968C(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TATCAGCGCTCCAAGGTAATT	0.403																																							uc010tap.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|skin(2)|ovary(1)|kidney(1)	9						c.(2905-2907)TGG>TGC		sno, strawberry notch homolog 1							151.0	139.0	143.0					12																	123801796		2203	4300	6503	SO:0001583	missense	55206						ATP binding|DNA binding|hydrolase activity	g.chr12:123801796C>G	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2907G>C	12.37:g.123801796C>G	ENSP00000473665:p.Trp969Cys		Somatic				SBNO1_uc010tao.1_Missense_Mutation_p.W968C|SBNO1_uc010taq.1_Intron|SBNO1_uc001ues.1_5'Flank	p.W969C	NM_018183	NP_060653	WXS	Illumina HiSeq	Unspecified	A3KN83	SBNO1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)	20	2907	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		969					Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	c.2907G>C	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444684	0.63178	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.79749	-1.3;-1.3	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.93380	0.7889	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94557	0.7759	10	0.87932	D	0	-9.7971	20.139	0.98050	0.0:1.0:0.0:0.0	.	969;968	A3KN83;A3KN83-2	SBNO1_HUMAN;.	C	969;968	ENSP00000387361:W969C;ENSP00000267176:W968C	ENSP00000267176:W968C	W	-	3	0	SBNO1	122367749	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	7.760000	0.85248	2.764000	0.94973	0.655000	0.94253	TGG		0.403	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183		15	58	0	0	0	0.00245	0	15	58				
POTEG	404785	broad.mit.edu	37	14	19553826	19553826	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr14:19553826G>A	ENST00000409832.3	+	1	462	c.410G>A	c.(409-411)cGa>cAa	p.R137Q		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	137										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CACGTCCGTCGAGAAGATCTG	0.577																																							uc001vuz.1		NA																	0				ovary(1)	1						c.(409-411)CGA>CAA		POTE ankyrin domain family, member G							65.0	71.0	69.0					14																	19553826		1618	3388	5006	SO:0001583	missense	404785							g.chr14:19553826G>A		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.410G>A	14.37:g.19553826G>A	ENSP00000386971:p.Arg137Gln		Somatic				POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.R137Q	NM_001005356	NP_001005356	WXS	Illumina HiSeq	Unspecified	Q6S5H5	POTEG_HUMAN			1	462	+			137					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.410G>A	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	5.677	0.309483	0.10733	.	.	ENSG00000222036	ENST00000409832	T	0.52983	0.64	1.31	0.0956	0.14486	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.27454	0.0674	L	0.34521	1.04	0.09310	N	1	B	0.21905	0.062	B	0.09377	0.004	T	0.20438	-1.0275	9	0.13470	T	0.59	.	3.0801	0.06259	0.7125:0.0:0.2875:0.0	.	137	Q6S5H5	POTEG_HUMAN	Q	137	ENSP00000386971:R137Q	ENSP00000386971:R137Q	R	+	2	0	POTEG	18623826	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.641000	0.24720	0.009000	0.14813	0.174000	0.16983	CGA		0.577	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		4	105	0	0	0	0.001168	0	4	105				
ACTR10	55860	broad.mit.edu	37	14	58701086	58701086	+	Splice_Site	SNP	A	A	T	rs35928266		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr14:58701086A>T	ENST00000254286.4	+	13	1152		c.e13-1			NM_018477.2	NP_060947.1	Q9NZ32	ARP10_HUMAN	actin-related protein 10 homolog (S. cerevisiae)						microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|dynactin complex (GO:0005869)		p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	13						TTTGTCACACAGGGGCTATTT	0.353																																							uc001xdf.2		NA																	1	Unknown(1)		lung(1)	central_nervous_system(1)	1						c.e13-2		uncharacterized hypothalamus protein HARP11							80.0	86.0	84.0					14																	58701086		2203	4300	6503	SO:0001630	splice_region_variant	55860					cytoplasm		g.chr14:58701086A>T	AF220190	CCDS32090.1	14q23.1	2014-08-08			ENSG00000131966	ENSG00000131966			17372	protein-coding gene	gene with protein product						12857853	Standard	NM_018477		Approved	HARP11, ACTR11, Arp11	uc001xdf.3	Q9NZ32	OTTHUMG00000171049	ENST00000254286.4:c.1073-1A>T	14.37:g.58701086A>T			Somatic				C14orf37_uc010tro.1_Intron|ACTR10_uc001xdg.2_Splice_Site_p.G160_splice|ACTR10_uc001xdh.2_Splice_Site_p.G160_splice|ACTR10_uc010trp.1_Splice_Site|ACTR10_uc010apc.2_Splice_Site_p.G148_splice	p.G358_splice	NM_018477	NP_060947	WXS	Illumina HiSeq	Unspecified	Q9NZ32	ARP10_HUMAN			13	1176	+								Q9H9Y5|Q9NWY2	Splice_Site	SNP	ENST00000254286.4	37	c.1073_splice	CCDS32090.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.509303	0.85282	.	.	ENSG00000131966	ENST00000254286;ENST00000554642	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5785	0.76414	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTR10	57770839	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.287000	0.95975	2.333000	0.79357	0.533000	0.62120	.		0.353	ACTR10-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411405.1		Intron	3	69	0	0	0	0.004672	0	3	69				
SERPINA5	5104	broad.mit.edu	37	14	95056618	95056618	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr14:95056618T>A	ENST00000554866.1	+	3	974	c.860T>A	c.(859-861)cTg>cAg	p.L287Q	RP11-986E7.7_ENST00000553947.1_5'Flank|SERPINA5_ENST00000553780.1_Missense_Mutation_p.L287Q|SERPINA5_ENST00000554276.1_Missense_Mutation_p.L287Q|SERPINA5_ENST00000329597.7_Missense_Mutation_p.L287Q			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	287					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L287Q(1)		endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GAGAAAACGCTGAGGAAGTGG	0.552																																							uc001ydm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(859-861)CTG>CAG		serine (or cysteine) proteinase inhibitor, clade	Drotrecogin alfa(DB00055)|Urokinase(DB00013)						77.0	79.0	78.0					14																	95056618		2203	4300	6503	SO:0001583	missense	5104				fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity	g.chr14:95056618T>A	M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.860T>A	14.37:g.95056618T>A	ENSP00000451126:p.Leu287Gln		Somatic				SERPINA5_uc010ave.2_Missense_Mutation_p.L287Q|SERPINA3_uc001ydo.3_5'Flank	p.L287Q	NM_000624	NP_000615	WXS	Illumina HiSeq	Unspecified	P05154	IPSP_HUMAN		COAD - Colon adenocarcinoma(157;0.21)	4	1070	+			287					Q07616|Q9UG30	Missense_Mutation	SNP	ENST00000554866.1	37	c.860T>A	CCDS9928.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184563	0.38609	.	.	ENSG00000188488	ENST00000553780;ENST00000554760;ENST00000554866;ENST00000329597;ENST00000554506;ENST00000537685;ENST00000438291;ENST00000554276	D;D;D;D;D	0.90844	-2.07;-2.74;-2.07;-2.07;-2.07	4.81	4.81	0.61882	Serpin domain (3);	0.314440	0.23007	N	0.053003	D	0.96599	0.8890	H	0.95504	3.68	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91438	0.5171	10	0.87932	D	0	.	13.8668	0.63594	0.0:0.0:0.0:1.0	.	287;287	G3V5Q9;P05154	.;IPSP_HUMAN	Q	287;287;287;287;63;139;211;287	ENSP00000450837:L287Q;ENSP00000452469:L287Q;ENSP00000451126:L287Q;ENSP00000333203:L287Q;ENSP00000451610:L287Q	ENSP00000333203:L287Q	L	+	2	0	SERPINA5	94126371	0.388000	0.25197	0.033000	0.17914	0.079000	0.17450	4.447000	0.60020	1.935000	0.56089	0.459000	0.35465	CTG		0.552	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624		6	9	0	0	0	0.001984	0	6	9				
SPPL2A	84888	broad.mit.edu	37	15	51040396	51040396	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr15:51040396G>C	ENST00000261854.5	-	4	638	c.364C>G	c.(364-366)Cct>Gct	p.P122A	RP11-507J18.2_ENST00000558317.1_RNA	NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	122	PA.				membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)	p.P122A(2)		endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		CCTGAGGGAGGAAACTAAAAA	0.249																																					Melanoma(50;790 1209 4069 22965 33125)	Melanoma(50;790 1209 4069 22965 33125)	uc001zyv.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(364-366)CCT>GCT		signal peptide peptidase-like 2A							24.0	23.0	23.0					15																	51040396		2187	4261	6448	SO:0001583	missense	84888					integral to membrane	aspartic-type endopeptidase activity	g.chr15:51040396G>C		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.364C>G	15.37:g.51040396G>C	ENSP00000261854:p.Pro122Ala		Somatic					p.P122A	NM_032802	NP_116191	WXS	Illumina HiSeq	Unspecified	Q8TCT8	PSL2_HUMAN		all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)	4	544	-			122			Cytoplasmic (Potential).|PA.		B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	37	c.364C>G	CCDS10138.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944953	0.34283	.	.	ENSG00000138600	ENST00000261854	T	0.06768	3.26	6.07	-0.436	0.12275	Protease-associated domain, PA (1);	0.610069	0.18860	N	0.129177	T	0.05227	0.0139	L	0.46670	1.46	0.30535	N	0.766998	B	0.16802	0.019	B	0.18871	0.023	T	0.39881	-0.9592	10	0.08837	T	0.75	-0.093	2.2413	0.04020	0.2978:0.2917:0.3105:0.0999	.	122	Q8TCT8	PSL2_HUMAN	A	122	ENSP00000261854:P122A	ENSP00000261854:P122A	P	-	1	0	AC012100.1	48827688	0.664000	0.27457	0.987000	0.45799	0.987000	0.75469	-0.384000	0.07389	-0.049000	0.13379	0.655000	0.94253	CCT		0.249	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	NM_032802		3	9	0	0	0	0.004672	0	3	9				
RASGRF1	5923	broad.mit.edu	37	15	79288097	79288097	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr15:79288097C>A	ENST00000419573.3	-	21	3334	c.3060G>T	c.(3058-3060)gaG>gaT	p.E1020D	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000394745.3_Missense_Mutation_p.E236D|RASGRF1_ENST00000558480.2_Missense_Mutation_p.E1004D	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1020					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E1020D(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCGTGATCTCCTCCAGCGTGA	0.627																																							uc002beq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)|central_nervous_system(1)	6						c.(3058-3060)GAG>GAT		Ras protein-specific guanine							171.0	130.0	144.0					15																	79288097		2196	4293	6489	SO:0001583	missense	5923				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity	g.chr15:79288097C>A	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3060G>T	15.37:g.79288097C>A	ENSP00000405963:p.Glu1020Asp		Somatic				RASGRF1_uc002bep.2_Missense_Mutation_p.E1004D|RASGRF1_uc010blm.1_Missense_Mutation_p.E929D|RASGRF1_uc002ber.3_Missense_Mutation_p.E1004D|RASGRF1_uc010unh.1_Missense_Mutation_p.E415D|RASGRF1_uc002beo.2_Missense_Mutation_p.E236D	p.E1020D	NM_002891	NP_002882	WXS	Illumina HiSeq	Unspecified	Q13972	RGRF1_HUMAN			21	3435	-			1022					F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	c.3060G>T	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.769079	0.31320	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.31247	1.5;1.5	4.01	0.926	0.19430	Ras guanine nucleotide exchange factor, domain (1);	0.146674	0.44688	N	0.000435	T	0.20129	0.0484	L	0.43152	1.355	0.51012	D	0.999902	B;B;B;B	0.22851	0.076;0.001;0.006;0.002	B;B;B;B	0.23852	0.049;0.003;0.011;0.007	T	0.06127	-1.0844	10	0.33141	T	0.24	.	3.3468	0.07139	0.1834:0.5099:0.0:0.3067	.	416;1004;1022;1004	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	D	1020;1004;236	ENSP00000405963:E1020D;ENSP00000378228:E236D	ENSP00000378224:E1004D	E	-	3	2	RASGRF1	77075152	0.989000	0.36119	0.992000	0.48379	0.944000	0.59088	0.308000	0.19314	-0.030000	0.13804	0.484000	0.47621	GAG		0.627	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891		4	77	1	0	0.00909568	0.009096	0.00944551	4	77				
FAM154B	283726	broad.mit.edu	37	15	82574861	82574861	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr15:82574861C>A	ENST00000339465.5	+	3	724	c.655C>A	c.(655-657)Cgt>Agt	p.R219S	FAM154B_ENST00000565501.1_3'UTR|FAM154B_ENST00000427381.2_Missense_Mutation_p.R204S	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	219								p.R219S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						CACTGAATTCCGTGAAAGTTT	0.473																																							uc002bgv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(655-657)CGT>AGT		hypothetical protein LOC283726							78.0	77.0	77.0					15																	82574861		2203	4300	6503	SO:0001583	missense	283726							g.chr15:82574861C>A	AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.655C>A	15.37:g.82574861C>A	ENSP00000340445:p.Arg219Ser		Somatic				FAM154B_uc010unr.1_Missense_Mutation_p.R204S|FAM154B_uc010uns.1_RNA	p.R219S	NM_001008226	NP_001008227	WXS	Illumina HiSeq	Unspecified	Q658L1	F154B_HUMAN			3	724	+			219					B4E2M2	Missense_Mutation	SNP	ENST00000339465.5	37	c.655C>A	CCDS32310.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397728	0.62177	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.18502	2.21;2.21	3.9	3.9	0.45041	.	0.314503	0.25777	N	0.028367	T	0.40909	0.1136	M	0.81497	2.545	0.43667	D	0.996096	D;D	0.67145	0.996;0.983	P;P	0.62184	0.899;0.844	T	0.41574	-0.9501	10	0.40728	T	0.16	-7.0405	16.4015	0.83642	0.0:1.0:0.0:0.0	.	204;219	B4E2M2;Q658L1	.;F154B_HUMAN	S	219;204	ENSP00000340445:R219S;ENSP00000403743:R204S	ENSP00000340445:R219S	R	+	1	0	FAM154B	80361916	0.994000	0.37717	0.938000	0.37757	0.596000	0.36781	3.360000	0.52299	2.158000	0.67659	0.536000	0.68110	CGT		0.473	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226		8	32	1	0	0.00448238	0.004482	0.00472751	8	32				
SLC5A2	6524	broad.mit.edu	37	16	31500054	31500054	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr16:31500054G>A	ENST00000330498.3	+	10	1260	c.1241G>A	c.(1240-1242)cGg>cAg	p.R414Q	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	414					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.R414Q(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	ACGCGCCTGCGGCCACGCGCC	0.701																																							uc002ecf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1240-1242)CGG>CAG		solute carrier family 5 (sodium/glucose							18.0	16.0	17.0					16																	31500054		2192	4297	6489	SO:0001583	missense	6524				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity	g.chr16:31500054G>A		CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1241G>A	16.37:g.31500054G>A	ENSP00000327943:p.Arg414Gln		Somatic				SLC5A2_uc010car.2_Intron|C16orf58_uc002ecg.2_RNA	p.R414Q	NM_003041	NP_003032	WXS	Illumina HiSeq	Unspecified	P31639	SC5A2_HUMAN			10	1260	+			414			Extracellular (Potential).		A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	c.1241G>A	CCDS10714.1	.	.	.	.	.	.	.	.	.	.	G	34	5.298866	0.95574	.	.	ENSG00000140675	ENST00000330498	D	0.89050	-2.46	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.95149	0.8428	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95963	0.8963	10	0.87932	D	0	.	14.6838	0.69035	0.0:0.0:1.0:0.0	.	414	P31639	SC5A2_HUMAN	Q	414	ENSP00000327943:R414Q	ENSP00000327943:R414Q	R	+	2	0	SLC5A2	31407555	1.000000	0.71417	0.993000	0.49108	0.729000	0.41735	9.221000	0.95188	2.337000	0.79520	0.561000	0.74099	CGG		0.701	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2			6	10	0	0	0	0.001984	0	6	10				
TUBB8P7	197331	broad.mit.edu	37	16	90161578	90161578	+	RNA	SNP	G	G	A	rs13337896	byFrequency	TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr16:90161578G>A	ENST00000564451.1	+	0	931				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.R105H(3)									GCCAAGGGACGCTACACCGAA	0.587													.|||	668	0.133387	0.0386	0.1499	5008	,	,		18807	0.4087		0.0537	False		,,,				2504	0.0481						uc002fqp.2		NA																	3	Substitution - Missense(3)		urinary_tract(1)|prostate(1)|kidney(1)		NA						c.(451-453)ACG>ACA		Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																																						0							g.chr16:90161578G>A			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161578G>A			Somatic				uc002fqq.2_Silent_p.T168T	p.T151T			WXS	Illumina HiSeq	Unspecified					3	931	+									Silent	SNP	ENST00000564451.1	37	c.453G>A																																																																																					0.587	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000420856.1	NG_002334		3	26	0	0	0	0.004672	0	3	26				
TP53	7157	broad.mit.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000455263.2_Missense_Mutation_p.V216M|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M|TP53_ENST00000420246.2_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	p.V216M(49)|p.V216del(8)|p.0?(7)|p.V216L(7)|p.V216E(4)|p.V216G(3)|p.V216A(3)|p.V216fs*6(2)|p.V216fs*31(2)|p.H214fs*5(2)|p.K164_P219del(1)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CX952222	TP53	X		c.(646-648)GTG>ATG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							123.0	111.0	115.0					17																	7578203		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578203C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.V216M|TP53_uc002gih.2_Missense_Mutation_p.V216M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V84M|TP53_uc010cng.1_Missense_Mutation_p.V84M|TP53_uc002gii.1_Missense_Mutation_p.V84M|TP53_uc010cnh.1_Missense_Mutation_p.V216M|TP53_uc010cni.1_Missense_Mutation_p.V216M|TP53_uc002gij.2_Missense_Mutation_p.V216M|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.V123M|TP53_uc002gio.2_Missense_Mutation_p.V84M|TP53_uc010vug.1_Missense_Mutation_p.V177M	p.V216M	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	840	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	216		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|V -> M (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.646G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		3	16	0	0	0	0.009096	0	3	16				
MYH2	4620	broad.mit.edu	37	17	10428126	10428126	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr17:10428126C>A	ENST00000245503.5	-	34	5303	c.4919G>T	c.(4918-4920)cGc>cTc	p.R1640L	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.R1640L	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1640					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1640L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGCAGCCATGCGGTTGGCATG	0.512																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(4918-4920)CGC>CTC		myosin heavy chain IIa							200.0	176.0	184.0					17																	10428126		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10428126C>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4919G>T	17.37:g.10428126C>A	ENSP00000245503:p.Arg1640Leu		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1640L|MYH2_uc010coj.2_Intron	p.R1640L	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			34	5047	-			1640			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.4919G>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820746	0.71028	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.81908	-1.55;-1.55	5.44	5.44	0.79542	Myosin tail (1);	0.000000	0.40144	U	0.001162	D	0.90191	0.6934	H	0.95982	3.75	0.58432	D	0.999993	P	0.39576	0.679	B	0.40602	0.334	D	0.92551	0.6050	10	0.87932	D	0	.	19.4557	0.94886	0.0:1.0:0.0:0.0	.	1640	Q9UKX2	MYH2_HUMAN	L	1640	ENSP00000245503:R1640L;ENSP00000380367:R1640L	ENSP00000245503:R1640L	R	-	2	0	MYH2	10368851	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.563000	0.82314	2.823000	0.97156	0.591000	0.81541	CGC		0.512	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		18	73	1	0	1.45105e-14	0.006122	1.95892e-14	18	73				
ENPP7	339221	broad.mit.edu	37	17	77709193	77709193	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr17:77709193A>T	ENST00000328313.5	+	3	972	c.751A>T	c.(751-753)Acc>Tcc	p.T251S		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.T251S(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CGGCATGACGACCGTGGACAA	0.607																																							uc002jxa.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(751-753)ACC>TCC		ectonucleotide pyrophosphatase/phosphodiesterase							114.0	92.0	100.0					17																	77709193		2203	4300	6503	SO:0001583	missense	339221				negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity	g.chr17:77709193A>T	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.751A>T	17.37:g.77709193A>T	ENSP00000332656:p.Thr251Ser		Somatic					p.T251S	NM_178543	NP_848638	WXS	Illumina HiSeq	Unspecified	Q6UWV6	ENPP7_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		3	771	+			251						Missense_Mutation	SNP	ENST00000328313.5	37	c.751A>T	CCDS11763.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.838609	0.51057	.	.	ENSG00000182156	ENST00000328313	T	0.72725	-0.68	5.39	3.19	0.36642	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.106561	0.64402	N	0.000005	T	0.72614	0.3482	L	0.52823	1.66	0.42842	D	0.99405	P	0.44281	0.831	P	0.53722	0.733	T	0.66736	-0.5848	10	0.29301	T	0.29	-34.0719	9.4514	0.38727	0.8561:0.0:0.1439:0.0	.	251	Q6UWV6	ENPP7_HUMAN	S	251	ENSP00000332656:T251S	ENSP00000332656:T251S	T	+	1	0	ENPP7	75323788	0.990000	0.36364	0.001000	0.08648	0.320000	0.28249	4.166000	0.58203	0.366000	0.24427	0.533000	0.62120	ACC		0.607	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		34	50	0	0	0	0.004289	0	34	50				
DSG2	1829	broad.mit.edu	37	18	29126289	29126289	+	Silent	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr18:29126289T>C	ENST00000261590.8	+	15	3149	c.2940T>C	c.(2938-2940)gcT>gcC	p.A980A	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	980					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A980A(1)		breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			AGCCTTATGCTAATGAAGGTA	0.498																																							uc002kwu.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9						c.(2938-2940)GCT>GCC		desmoglein 2 preproprotein							99.0	100.0	99.0					18																	29126289		1968	4157	6125	SO:0001819	synonymous_variant	1829				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:29126289T>C	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2940T>C	18.37:g.29126289T>C			Somatic				uc002kwv.3_Intron	p.A980A	NM_001943	NP_001934	WXS	Illumina HiSeq	Unspecified	Q14126	DSG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0068)		15	3128	+			980			Desmoglein repeat 4.|Cytoplasmic (Potential).		Q4KKU6	Silent	SNP	ENST00000261590.8	37	c.2940T>C	CCDS42423.1																																																																																				0.498	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943		18	36	0	0	0	0.00499	0	18	36				
NETO1	81832	broad.mit.edu	37	18	70461611	70461611	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr18:70461611C>G	ENST00000327305.6	-	5	1155	c.498G>C	c.(496-498)ttG>ttC	p.L166F	NETO1_ENST00000299430.2_Missense_Mutation_p.L165F|NETO1_ENST00000583169.1_Missense_Mutation_p.L166F	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	166					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.L166F(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GTAATGGTTTCAAAGCTCCAA	0.303																																							uc002lkw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(496-498)TTG>TTC		neuropilin- and tolloid-like protein 1 isoform 3							86.0	94.0	92.0					18																	70461611		2203	4299	6502	SO:0001583	missense	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70461611C>G	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.498G>C	18.37:g.70461611C>G	ENSP00000313088:p.Leu166Phe		Somatic				NETO1_uc002lkx.1_Missense_Mutation_p.L165F|NETO1_uc002lky.1_Missense_Mutation_p.L166F	p.L166F	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	5	782	-		Esophageal squamous(42;0.129)	166			Extracellular (Potential).		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	c.498G>C	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673190	0.29693	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.35973	1.28;1.28	5.6	4.73	0.59995	CUB (1);	0.000000	0.47852	D	0.000218	T	0.42108	0.1188	L	0.52573	1.65	0.80722	D	1	P;P	0.52061	0.95;0.737	P;B	0.51355	0.667;0.319	T	0.31613	-0.9937	10	0.54805	T	0.06	-4.7461	10.4121	0.44301	0.0:0.8515:0.0:0.1485	.	165;166	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	F	166;165	ENSP00000313088:L166F;ENSP00000299430:L165F	ENSP00000299430:L165F	L	-	3	2	NETO1	68612591	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.676000	0.37565	1.353000	0.45828	0.655000	0.94253	TTG		0.303	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		16	82	0	0	0	0.004007	0	16	82				
ZNF709	163051	broad.mit.edu	37	19	12575444	12575444	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:12575444C>A	ENST00000397732.3	-	4	1463	c.1292G>T	c.(1291-1293)tGt>tTt	p.C431F	ZNF709_ENST00000428311.1_Missense_Mutation_p.C431F|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C431F(1)		large_intestine(3)|upper_aerodigestive_tract(3)	6						AGAACTGGAACAACTGAAGGC	0.423																																					GBM(33;565 669 12371 29134 51667)	GBM(33;565 669 12371 29134 51667)	uc002mtv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1291-1293)TGT>TTT		zinc finger protein 709 isoform a							112.0	117.0	115.0					19																	12575444		2202	4299	6501	SO:0001583	missense	163051				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12575444C>A	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1292G>T	19.37:g.12575444C>A	ENSP00000380840:p.Cys431Phe		Somatic				ZNF709_uc002mtw.3_Missense_Mutation_p.C399F|ZNF709_uc002mtx.3_Missense_Mutation_p.C431F	p.C431F	NM_152601	NP_689814	WXS	Illumina HiSeq	Unspecified	Q8N972	ZN709_HUMAN			4	1453	-			431			C2H2-type 12.		A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	c.1292G>T	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	C	5.639	0.302585	0.10678	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.03496	3.91;3.91	3.05	-6.1	0.02138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.982055	0.08269	N	0.971845	T	0.01800	0.0057	N	0.17800	0.525	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.47995	-0.9073	10	0.11794	T	0.64	.	2.1575	0.03816	0.108:0.1987:0.2929:0.4004	.	431	Q8N972	ZN709_HUMAN	F	431	ENSP00000380840:C431F;ENSP00000404127:C431F	ENSP00000404127:C431F	C	-	2	0	ZNF709;CTD-2192J16.17	12436444	0.000000	0.05858	0.000000	0.03702	0.997000	0.91878	-3.215000	0.00554	-2.129000	0.00817	0.591000	0.81541	TGT		0.423	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601		18	150	1	0	9.16793e-09	0.00499	1.17873e-08	18	150				
FFAR3	2865	broad.mit.edu	37	19	35849909	35849909	+	Silent	SNP	C	C	T	rs148149328		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:35849909C>T	ENST00000327809.4	+	2	318	c.117C>T	c.(115-117)ttC>ttT	p.F39F	FFAR3_ENST00000594310.1_Silent_p.F39F	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	39					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.F39F(1)		endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGGTGGTCTTCGTGGGCAAGC	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		25120	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(185;1742 2042 21963 24215 27871)	Esophageal Squamous(185;1742 2042 21963 24215 27871)	uc002nzd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(115-117)TTC>TTT		free fatty acid receptor 3							148.0	136.0	140.0					19																	35849909		2199	4295	6494	SO:0001819	synonymous_variant	2865					integral to plasma membrane	G-protein coupled receptor activity|lipid binding	g.chr19:35849909C>T	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.117C>T	19.37:g.35849909C>T			Somatic				FFAR3_uc010xsu.1_RNA	p.F39F	NM_005304	NP_005295	WXS	Illumina HiSeq	Unspecified	O14843	FFAR3_HUMAN	Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)		2	192	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		39			Helical; Name=1; (Potential).		B2RWM8|Q14CM7	Silent	SNP	ENST00000327809.4	37	c.117C>T	CCDS12459.1																																																																																				0.637	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	NM_005304		9	96	0	0	0	0.013537	0	9	96				
RYR1	6261	broad.mit.edu	37	19	38934235	38934235	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:38934235G>A	ENST00000359596.3	+	4	308	c.308G>A	c.(307-309)gGc>gAc	p.G103D	RYR1_ENST00000360985.3_Missense_Mutation_p.G103D|RYR1_ENST00000355481.4_Missense_Mutation_p.G103D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	103	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.G103D(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTCCTGTATGGCCATGCCATC	0.652																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(307-309)GGC>GAC		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						54.0	50.0	51.0					19																	38934235		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38934235G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.308G>A	19.37:g.38934235G>A	ENSP00000352608:p.Gly103Asp		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.G103D	p.G103D	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		4	438	+	all_cancers(60;7.91e-06)		103			Cytoplasmic.|MIR 1.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.308G>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372429	0.61624	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.99405	-5.84;-5.84;-5.84	4.08	4.08	0.47627	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.000000	0.64402	U	0.000002	D	0.99501	0.9822	M	0.87682	2.9	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98109	1.0419	10	0.87932	D	0	.	13.8285	0.63366	0.0:0.0:1.0:0.0	.	103;103	P21817-2;P21817	.;RYR1_HUMAN	D	103	ENSP00000352608:G103D;ENSP00000347667:G103D;ENSP00000354254:G103D	ENSP00000347667:G103D	G	+	2	0	RYR1	43626075	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	9.229000	0.95273	2.108000	0.64289	0.563000	0.77884	GGC		0.652	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			5	31	0	0	0	0.000602	0	5	31				
PSG8	440533	broad.mit.edu	37	19	43268074	43268074	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:43268074A>T	ENST00000306511.4	-	2	521	c.424T>A	c.(424-426)Tta>Ata	p.L142I	PSG8_ENST00000401467.2_Missense_Mutation_p.L142I|PSG8_ENST00000404209.4_Missense_Mutation_p.L142I|PSG8_ENST00000406636.3_Intron	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	142	Ig-like V-type.					extracellular region (GO:0005576)		p.L142I(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				TCACGATATAAGGTGAAGGTG	0.493																																							uc002ouo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(424-426)TTA>ATA		pregnancy specific beta-1-glycoprotein 8 isoform							288.0	284.0	285.0					19																	43268074		2203	4299	6502	SO:0001583	missense	440533					extracellular region		g.chr19:43268074A>T	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.424T>A	19.37:g.43268074A>T	ENSP00000305005:p.Leu142Ile		Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc002oui.2_Intron|PSG8_uc002ouh.2_Missense_Mutation_p.L142I|PSG8_uc010ein.2_Intron|PSG8_uc002ouj.3_Missense_Mutation_p.L17I|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Missense_Mutation_p.L142I|PSG8_uc002oum.3_Missense_Mutation_p.L142I|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.L142I	p.L142I	NM_182707	NP_874366	WXS	Illumina HiSeq	Unspecified	Q9UQ74	PSG8_HUMAN			2	522	-		Prostate(69;0.00899)	142			Ig-like V-type.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	c.424T>A	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	a	5.842	0.339632	0.11069	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.20881	2.04;3.19;2.04	.	.	.	Immunoglobulin subtype (1);	.	.	.	.	T	0.35278	0.0926	M	0.65975	2.015	0.09310	N	1	P;B;D;P;P	0.56287	0.592;0.413;0.975;0.725;0.604	B;B;P;P;B	0.60541	0.241;0.21;0.876;0.482;0.288	T	0.13072	-1.0523	7	0.62326	D	0.03	.	.	.	.	.	142;142;142;142;142	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	I	142;17;142;142;142	ENSP00000385869:L142I;ENSP00000386090:L142I;ENSP00000305005:L142I	ENSP00000292109:L17I	L	-	1	2	PSG8	47959914	0.008000	0.16893	0.008000	0.14137	0.041000	0.13682	0.413000	0.21148	0.103000	0.17682	0.102000	0.15555	TTA		0.493	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1			6	210	0	0	0	0.001984	0	6	210				
KLK12	43849	broad.mit.edu	37	19	51532662	51532662	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:51532662A>G	ENST00000525263.1	-	5	762	c.643T>C	c.(643-645)Tcc>Ccc	p.S215P	KLK11_ENST00000319720.7_5'Flank|KLK11_ENST00000391804.3_5'Flank|KLK11_ENST00000600362.1_5'Flank|KLK12_ENST00000319590.4_Missense_Mutation_p.S215P|KLK12_ENST00000529888.1_3'UTR|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000594458.1_5'Flank|KLK12_ENST00000250351.4_Missense_Mutation_p.S215P|KLK11_ENST00000453757.3_5'Flank|KLK12_ENST00000250352.11_Missense_Mutation_p.S105P|KLK11_ENST00000594768.1_5'Flank			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	215	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S215P(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		GACCCCCAGGACACCAGACCT	0.532																																							uc002pvg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(643-645)TCC>CCC		kallikrein 12 isoform 2							77.0	80.0	79.0					19																	51532662		2203	4300	6503	SO:0001583	missense	43849				proteolysis	extracellular region|soluble fraction	serine-type endopeptidase activity	g.chr19:51532662A>G		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.643T>C	19.37:g.51532662A>G	ENSP00000436458:p.Ser215Pro		Somatic				KLK11_uc002pvd.1_5'Flank|KLK11_uc002pve.1_5'Flank|KLK11_uc002pvf.1_5'Flank|KLK11_uc002pvc.3_5'Flank|KLK11_uc010eom.2_5'Flank|KLK12_uc010ycp.1_RNA|KLK12_uc010ycq.1_Missense_Mutation_p.S105P|KLK12_uc010ycr.1_Missense_Mutation_p.S105P|KLK12_uc010ycs.1_Missense_Mutation_p.S105P|KLK12_uc002pvh.1_Missense_Mutation_p.S215P|KLK12_uc002pvi.1_Missense_Mutation_p.S215P|KLK12_uc002pvj.1_3'UTR	p.S215P	NM_145894	NP_665901	WXS	Illumina HiSeq	Unspecified	Q9UKR0	KLK12_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)	5	763	-		all_neural(266;0.026)	215			Peptidase S1.		Q9UKR1|Q9UKR2	Missense_Mutation	SNP	ENST00000525263.1	37	c.643T>C	CCDS12821.1	.	.	.	.	.	.	.	.	.	.	a	21.7	4.182569	0.78677	.	.	ENSG00000186474	ENST00000525263;ENST00000319590;ENST00000250352;ENST00000250351	D;D;T;D	0.96300	-3.97;-3.97;0.63;-3.97	4.33	4.33	0.51752	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.547984	0.14133	N	0.339211	D	0.98695	0.9562	H	0.96633	3.855	0.40210	D	0.977611	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	D	0.99449	1.0940	10	0.87932	D	0	.	11.7599	0.51896	1.0:0.0:0.0:0.0	.	105;105;215;215	B9EGA9;Q49AM7;Q9UKR0-2;Q9UKR0	.;.;.;KLK12_HUMAN	P	215;215;105;215	ENSP00000436458:S215P;ENSP00000324181:S215P;ENSP00000250352:S105P;ENSP00000250351:S215P	ENSP00000250351:S215P	S	-	1	0	KLK12	56224474	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.103000	0.77014	1.964000	0.57103	0.448000	0.29417	TCC		0.532	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598		6	58	0	0	0	0.001168	0	6	58				
ZNF813	126017	broad.mit.edu	37	19	53994017	53994017	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:53994017C>T	ENST00000396403.4	+	4	659	c.531C>T	c.(529-531)tcC>tcT	p.S177S	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	177					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S177S(1)		large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TTTCAACATCCCAAAGAATTT	0.393																																							uc002qbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(529-531)TCC>TCT		zinc finger protein 813							101.0	111.0	108.0					19																	53994017		2187	4292	6479	SO:0001819	synonymous_variant	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53994017C>T	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.531C>T	19.37:g.53994017C>T			Somatic				ZNF813_uc010eqq.1_Intron	p.S177S	NM_001004301	NP_001004301	WXS	Illumina HiSeq	Unspecified	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	4	659	+			177						Silent	SNP	ENST00000396403.4	37	c.531C>T	CCDS46172.1																																																																																				0.393	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		26	116	0	0	0	0.00333	0	26	116				
ZIM2	23619	broad.mit.edu	37	19	57286129	57286129	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:57286129C>A	ENST00000391708.3	-	12	2053	c.1511G>T	c.(1510-1512)gGc>gTc	p.G504V	AC006115.3_ENST00000594400.1_RNA|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Missense_Mutation_p.G504V|AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000593711.1_Missense_Mutation_p.G504V|ZIM2_ENST00000599935.1_Missense_Mutation_p.G504V|ZIM2_ENST00000221722.5_Missense_Mutation_p.G504V	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G504V(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TGAGGGTCGGCCGAAACATTT	0.438																																							uc002qnr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1510-1512)GGC>GTC		zinc finger, imprinted 2							111.0	104.0	106.0					19																	57286129		2203	4300	6503	SO:0001583	missense	23619				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57286129C>A	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.1511G>T	19.37:g.57286129C>A	ENSP00000375589:p.Gly504Val		Somatic				uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.G300V|ZIM2_uc010ygr.1_Missense_Mutation_p.G300V|ZIM2_uc002qnq.2_Missense_Mutation_p.G504V|ZIM2_uc010etp.2_Missense_Mutation_p.G504V|ZIM2_uc010ygs.1_Missense_Mutation_p.G504V	p.G504V	NM_015363	NP_056178	WXS	Illumina HiSeq	Unspecified	Q9NZV7	ZIM2_HUMAN		GBM - Glioblastoma multiforme(193;0.0314)	11	1893	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	504			C2H2-type 5.		Q2M3K1	Missense_Mutation	SNP	ENST00000391708.3	37	c.1511G>T	CCDS33123.1	.	.	.	.	.	.	.	.	.	.	C	3.044	-0.196768	0.06259	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.16457	2.34;2.34	4.96	3.93	0.45458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06508	0.0167	N	0.05306	-0.075	.	.	.	P	0.38677	0.642	B	0.28011	0.085	T	0.08973	-1.0696	8	0.40728	T	0.16	.	6.873	0.24131	0.0:0.7307:0.1767:0.0925	.	504	Q9NZV7	ZIM2_HUMAN	V	504	ENSP00000375589:G504V;ENSP00000221722:G504V	ENSP00000221722:G504V	G	-	2	0	ZIM2	61977941	0.000000	0.05858	0.117000	0.21633	0.018000	0.09664	-0.197000	0.09518	1.325000	0.45301	-0.136000	0.14681	GGC		0.438	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2			8	46	1	0	0.000157383	0.00308	0.000175593	8	46				
KIDINS220	57498	broad.mit.edu	37	2	8890421	8890421	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:8890421A>T	ENST00000256707.3	-	24	3416	c.3235T>A	c.(3235-3237)Tac>Aac	p.Y1079N	KIDINS220_ENST00000427284.1_Missense_Mutation_p.Y1079N|KIDINS220_ENST00000418530.1_Missense_Mutation_p.Y1037N|KIDINS220_ENST00000473731.1_Missense_Mutation_p.Y1079N	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1079					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.Y1079N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGCGGGGGGTACGCCAGTCCT	0.562																																							uc002qzc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3235-3237)TAC>AAC		kinase D-interacting substrate of 220 kDa							42.0	46.0	44.0					2																	8890421		1959	4134	6093	SO:0001583	missense	57498				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane		g.chr2:8890421A>T	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3235T>A	2.37:g.8890421A>T	ENSP00000256707:p.Tyr1079Asn		Somatic				KIDINS220_uc010yiv.1_Missense_Mutation_p.Y845N|KIDINS220_uc002qzd.2_Missense_Mutation_p.Y1037N|KIDINS220_uc010yiw.1_Missense_Mutation_p.Y1080N|KIDINS220_uc002qzb.2_5'UTR|KIDINS220_uc002qze.2_Missense_Mutation_p.Y84N	p.Y1079N	NM_020738	NP_065789	WXS	Illumina HiSeq	Unspecified	Q9ULH0	KDIS_HUMAN			24	3417	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		1079			Cytoplasmic (Potential).		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	37	c.3235T>A	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.252409	0.59212	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000459813	T;T;T;T;T;T	0.67345	0.9;-0.26;-0.23;-0.13;-0.23;-0.16	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.79323	0.4426	M	0.63428	1.95	0.58432	D	0.999997	D;P;D;D;D	0.76494	0.976;0.955;0.997;0.999;0.999	B;P;D;D;D	0.70716	0.361;0.616;0.934;0.97;0.934	T	0.79386	-0.1825	10	0.46703	T	0.11	.	16.1354	0.81481	1.0:0.0:0.0:0.0	.	1080;1080;763;1037;1079	B4DK94;E9PH70;B4DGY1;Q9ULH0-2;Q9ULH0	.;.;.;.;KDIS_HUMAN	N	826;763;1079;1079;1037;1079;1080;88	ENSP00000420364:Y826N;ENSP00000256707:Y1079N;ENSP00000411849:Y1079N;ENSP00000414923:Y1037N;ENSP00000418974:Y1079N;ENSP00000419964:Y1080N	ENSP00000256707:Y1079N	Y	-	1	0	KIDINS220	8807872	1.000000	0.71417	0.049000	0.19019	0.016000	0.09150	8.962000	0.93254	2.207000	0.71202	0.533000	0.62120	TAC		0.562	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738		13	43	0	0	0	0.00245	0	13	43				
LTBP1	4052	broad.mit.edu	37	2	33246130	33246130	+	Silent	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:33246130C>A	ENST00000404816.2	+	3	1073	c.720C>A	c.(718-720)tcC>tcA	p.S240S	LTBP1_ENST00000354476.3_Silent_p.S240S			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	240					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.S240S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GGGCTGCTTCCTCGTGGGGCC	0.557																																							uc002ros.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(718-720)TCC>TCA		latent transforming growth factor beta binding							109.0	112.0	111.0					2																	33246130		2203	4300	6503	SO:0001819	synonymous_variant	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33246130C>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.720C>A	2.37:g.33246130C>A			Somatic					p.S240S	NM_206943	NP_996826	WXS	Illumina HiSeq	Unspecified	Q14766	LTBP1_HUMAN			3	720	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	240					A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	c.720C>A	CCDS33177.2																																																																																				0.557	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		16	149	1	0	1.5739e-10	0.004007	2.0831e-10	16	149				
SOS1	6654	broad.mit.edu	37	2	39281778	39281778	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:39281778T>A	ENST00000426016.1	-	6	783	c.697A>T	c.(697-699)Aat>Tat	p.N233Y	SOS1_ENST00000402219.2_Missense_Mutation_p.N233Y|SOS1_ENST00000395038.2_Missense_Mutation_p.N233Y|SOS1_ENST00000428721.2_Missense_Mutation_p.N176Y			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	233	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N233Y(5)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				AATTTTGAATTGGAGACAAAG	0.299									Noonan syndrome																														uc002rrk.3		NA																	5	Substitution - Missense(5)	p.N233Y(1)	endometrium(3)|lung(2)	ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10						c.(697-699)AAT>TAT		son of sevenless homolog 1							43.0	46.0	45.0					2																	39281778		2202	4288	6490	SO:0001583	missense	6654	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr2:39281778T>A	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.697A>T	2.37:g.39281778T>A	ENSP00000387784:p.Asn233Tyr		Somatic				SOS1_uc010ynr.1_RNA|SOS1_uc002rrl.2_5'Flank	p.N233Y	NM_005633	NP_005624	WXS	Illumina HiSeq	Unspecified	Q07889	SOS1_HUMAN			5	738	-		all_hematologic(82;0.21)	233			DH.		A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	c.697A>T	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.275752	0.59649	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.88	5.88	0.94601	Dbl homology (DH) domain (5);	0.215296	0.48767	D	0.000180	D	0.94169	0.8129	L	0.54323	1.7	0.46336	D	0.998998	P	0.52577	0.954	P	0.53450	0.726	D	0.93644	0.6967	10	0.41790	T	0.15	.	16.2792	0.82664	0.0:0.0:0.0:1.0	.	233	Q07889	SOS1_HUMAN	Y	233;233;233;233;176	ENSP00000387784:N233Y;ENSP00000384675:N233Y;ENSP00000378479:N233Y;ENSP00000399992:N176Y	ENSP00000263879:N233Y	N	-	1	0	SOS1	39135282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.589000	0.61006	2.243000	0.73865	0.533000	0.62120	AAT		0.299	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		4	52	0	0	0	0.009096	0	4	52				
IL18RAP	8807	broad.mit.edu	37	2	103061650	103061650	+	Splice_Site	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:103061650A>G	ENST00000264260.2	+	9	1511	c.922A>G	c.(922-924)Att>Gtt	p.I308V	IL18RAP_ENST00000409369.1_Splice_Site_p.I166V	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	308	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.I308V(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CTTTCTCAGTATTAAATCCAC	0.378																																							uc002tbx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(922-924)ATT>GTT		interleukin 18 receptor accessory protein							68.0	64.0	65.0					2																	103061650		2203	4300	6503	SO:0001630	splice_region_variant	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103061650A>G	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.921-1A>G	2.37:g.103061650A>G			Somatic				IL18RAP_uc010fiz.2_Missense_Mutation_p.I166V	p.I308V	NM_003853	NP_003844	WXS	Illumina HiSeq	Unspecified	O95256	I18RA_HUMAN			9	1406	+			308			Ig-like C2-type 2.|Extracellular (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.922A>G	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	0.089	-1.169864	0.01660	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.13420	2.59;2.59	5.63	0.891	0.19224	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.969175	0.08496	N	0.937169	T	0.06554	0.0168	N	0.05124	-0.11	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.45026	-0.9289	10	0.17369	T	0.5	.	9.2812	0.37729	0.4797:0.0:0.5203:0.0	.	308	O95256	I18RA_HUMAN	V	308;166	ENSP00000264260:I308V;ENSP00000387201:I166V	ENSP00000264260:I308V	I	+	1	0	IL18RAP	102428082	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.173000	0.09854	-0.062000	0.13088	0.533000	0.62120	ATT		0.378	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	Missense_Mutation	6	30	0	0	0	0.00308	0	6	30				
RGPD4	285190	broad.mit.edu	37	2	108488193	108488193	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:108488193C>A	ENST00000408999.3	+	20	3810	c.3733C>A	c.(3733-3735)Ccc>Acc	p.P1245T	RGPD4_ENST00000354986.4_Missense_Mutation_p.P1245T	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1245					protein targeting to Golgi (GO:0000042)			p.P1245T(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAACACTGGGCCCACATTAGA	0.448																																							uc010ywk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(3733-3735)CCC>ACC		RANBP2-like and GRIP domain containing 4							58.0	45.0	49.0					2																	108488193		692	1590	2282	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108488193C>A	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3733C>A	2.37:g.108488193C>A	ENSP00000386810:p.Pro1245Thr		Somatic				RGPD4_uc002tdu.2_Missense_Mutation_p.P432T|RGPD4_uc010ywl.1_Intron	p.P1245T	NM_182588	NP_872394	WXS	Illumina HiSeq	Unspecified	Q7Z3J3	RGPD4_HUMAN			20	3815	+			1245					B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.3733C>A	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	9.690	1.151557	0.21371	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.56103	0.48;0.49	2.33	2.33	0.28932	.	.	.	.	.	T	0.58395	0.2119	L	0.34521	1.04	0.30684	N	0.752011	D	0.89917	1.0	D	0.78314	0.991	T	0.56300	-0.8002	9	0.31617	T	0.26	-3.4708	11.5771	0.50869	0.0:1.0:0.0:0.0	.	1245	Q7Z3J3	RGPD4_HUMAN	T	1245	ENSP00000347081:P1245T;ENSP00000386810:P1245T	ENSP00000347081:P1245T	P	+	1	0	RGPD4	107854625	1.000000	0.71417	0.091000	0.20842	0.394000	0.30568	4.515000	0.60489	1.303000	0.44873	0.162000	0.16502	CCC		0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		14	291	1	0	2.31682e-05	0.003163	2.6963e-05	14	291				
CKAP2L	150468	broad.mit.edu	37	2	113500284	113500284	+	Splice_Site	SNP	T	T	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:113500284T>A	ENST00000302450.6	-	7	1899	c.1821A>T	c.(1819-1821)gaA>gaT	p.E607D	CKAP2L_ENST00000541405.1_Splice_Site_p.E442D|NT5DC4_ENST00000327581.4_3'UTR	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	607						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E607D(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						TAATAGTACCTTCTGTGGTTC	0.333																																							uc002tie.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1819-1821)GAA>GAT		cytoskeleton associated protein 2-like							97.0	103.0	101.0					2																	113500284		2203	4300	6503	SO:0001630	splice_region_variant	150468					centrosome		g.chr2:113500284T>A	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1822+1A>T	2.37:g.113500284T>A			Somatic				CKAP2L_uc002tif.2_Missense_Mutation_p.E196D|CKAP2L_uc010yxp.1_Missense_Mutation_p.E442D|uc002tid.2_3'UTR	p.E607D	NM_152515	NP_689728	WXS	Illumina HiSeq	Unspecified	Q8IYA6	CKP2L_HUMAN			7	1900	-			607					A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	c.1821A>T	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.966288	0.53507	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.23950	1.88;1.88	5.93	3.55	0.40652	.	0.412478	0.26812	N	0.022368	T	0.26268	0.0641	M	0.68317	2.08	0.30915	N	0.728657	B;B	0.24186	0.033;0.099	B;B	0.26202	0.027;0.067	T	0.22521	-1.0214	10	0.59425	D	0.04	-5.601	6.7158	0.23302	0.1519:0.0:0.1594:0.6887	.	196;607	Q8IYA6-2;Q8IYA6	.;CKP2L_HUMAN	D	442;607	ENSP00000438763:E442D;ENSP00000305204:E607D	ENSP00000305204:E607D	E	-	3	2	CKAP2L	113216755	0.999000	0.42202	0.995000	0.50966	0.894000	0.52154	1.286000	0.33273	0.486000	0.27676	0.533000	0.62120	GAA		0.333	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515	Missense_Mutation	13	26	0	0	0	0.001855	0	13	26				
AMER3	205147	broad.mit.edu	37	2	131520541	131520541	+	Missense_Mutation	SNP	C	C	T	rs181225754		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:131520541C>T	ENST00000423981.1	+	2	1006	c.896C>T	c.(895-897)gCc>gTc	p.A299V	AMER3_ENST00000321420.4_Missense_Mutation_p.A299V	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	299					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.A299V(1)									GCCTCGCCCGCCCAGAATGAA	0.662													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17771	0.0		0.0	False		,,,				2504	0.0						uc002trw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(895-897)GCC>GTC		hypothetical protein LOC205147							27.0	32.0	30.0					2																	131520541		2200	4295	6495	SO:0001583	missense	205147							g.chr2:131520541C>T	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.896C>T	2.37:g.131520541C>T	ENSP00000392700:p.Ala299Val		Somatic				FAM123C_uc010fmv.2_Missense_Mutation_p.A299V|FAM123C_uc010fms.1_Missense_Mutation_p.A299V|FAM123C_uc010fmt.1_Missense_Mutation_p.A299V|FAM123C_uc010fmu.1_Missense_Mutation_p.A299V	p.A299V	NM_152698	NP_689911	WXS	Illumina HiSeq	Unspecified	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	1086	+	Colorectal(110;0.1)		299					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.896C>T	CCDS2164.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	14.95	2.688458	0.48097	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.19105	2.17;2.17	5.21	5.21	0.72293	.	0.288597	0.33792	N	0.004549	T	0.40932	0.1137	M	0.63428	1.95	0.35051	D	0.760593	D	0.60575	0.988	P	0.59761	0.863	T	0.52601	-0.8554	10	0.62326	D	0.03	.	16.6282	0.84992	0.0:1.0:0.0:0.0	.	299	Q8N944	F123C_HUMAN	V	299	ENSP00000314914:A299V;ENSP00000392700:A299V	ENSP00000314914:A299V	A	+	2	0	FAM123C	131237011	0.999000	0.42202	0.106000	0.21319	0.028000	0.11728	4.381000	0.59587	2.597000	0.87782	0.561000	0.74099	GCC		0.662	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		10	43	0	0	0	0.006214	0	10	43				
THSD7B	80731	broad.mit.edu	37	2	138414680	138414680	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:138414680A>G	ENST00000409968.1	+	24	4503	c.4325A>G	c.(4324-4326)aAt>aGt	p.N1442S	THSD7B_ENST00000543459.1_Missense_Mutation_p.I277V|THSD7B_ENST00000272643.3_Missense_Mutation_p.N1445S|THSD7B_ENST00000413152.2_Missense_Mutation_p.N1414S			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1444						integral component of membrane (GO:0016021)		p.N1445S(1)|p.N1414S(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTTTGGAACAATAACGAACGA	0.413																																							uc002tva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(4237-4239)AAT>AGT		thrombospondin, type I, domain containing 7B							123.0	120.0	121.0					2																	138414680		1944	4161	6105	SO:0001583	missense	80731							g.chr2:138414680A>G			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4325A>G	2.37:g.138414680A>G	ENSP00000387145:p.Asn1442Ser		Somatic				THSD7B_uc010zbj.1_RNA	p.N1413S	NM_001080427	NP_001073896	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(221;0.19)	23	4238	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.4238A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.03|10.03	1.239514|1.239514	0.22711|0.22711	.|.	.|.	ENSG00000144229|ENSG00000144229	ENST00000543459|ENST00000409968;ENST00000272643;ENST00000413152	T|T;T;T	0.21361|0.22539	2.01|2.46;2.34;1.95	6.13|6.13	4.95|4.95	0.65309|0.65309	.|.	.|0.141030	.|0.64402	.|D	.|0.000004	T|T	0.11196|0.11196	0.0273|0.0273	N|N	0.19112|0.19112	0.55|0.55	0.19575|0.19575	N|N	0.999963|0.999963	.|P	.|0.42203	.|0.773	.|B	.|0.32980	.|0.156	T|T	0.16748|0.16748	-1.0392|-1.0392	7|10	0.34782|0.11182	T|T	0.22|0.66	.|.	13.5814|13.5814	0.61905|0.61905	0.8704:0.1296:0.0:0.0|0.8704:0.1296:0.0:0.0	.|.	.|1414	.|C9JKN6	.|.	V|S	277|1442;1445;1414	ENSP00000443370:I277V|ENSP00000387145:N1442S;ENSP00000272643:N1445S;ENSP00000413841:N1414S	ENSP00000443370:I277V|ENSP00000272643:N1445S	I|N	+|+	1|2	0|0	THSD7B|THSD7B	138131150|138131150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.783000|5.783000	0.68982|0.68982	1.107000|1.107000	0.41642|0.41642	0.529000|0.529000	0.55759|0.55759	ATA|AAT		0.413	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		8	49	0	0	0	0.006214	0	8	49				
XIRP2	129446	broad.mit.edu	37	2	168103381	168103381	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:168103381A>G	ENST00000409195.1	+	9	5568	c.5479A>G	c.(5479-5481)Aca>Gca	p.T1827A	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.T1605A|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.T1827A	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1652					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.T1827A(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCCTCAGAGTACATTTGGTAA	0.408																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(5479-5481)ACA>GCA		xin actin-binding repeat containing 2 isoform 1							103.0	92.0	95.0					2																	168103381		1864	4107	5971	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168103381A>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5479A>G	2.37:g.168103381A>G	ENSP00000386840:p.Thr1827Ala		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T1652A|XIRP2_uc010fpq.2_Missense_Mutation_p.T1605A|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.T1827A	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	5497	+			1652					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.5479A>G	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	3.356	-0.131447	0.06753	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02631	4.22;4.22;4.22	5.59	-6.56	0.01848	.	0.386401	0.29956	N	0.010778	T	0.02047	0.0064	L	0.60455	1.87	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.10450	0.002;0.005;0.005	T	0.45469	-0.9259	10	0.23302	T	0.38	-4.3598	0.7204	0.00939	0.4032:0.1057:0.1882:0.3028	.	1652;1652;1605	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	A	1827;1827;1605	ENSP00000386840:T1827A;ENSP00000295237:T1827A;ENSP00000387255:T1605A	ENSP00000295237:T1827A	T	+	1	0	XIRP2	167811627	0.000000	0.05858	0.094000	0.20943	0.356000	0.29392	-0.173000	0.09854	-0.935000	0.03728	-0.280000	0.10049	ACA		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		5	63	0	0	0	0.001168	0	5	63				
XIRP2	129446	broad.mit.edu	37	2	168104724	168104724	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:168104724C>G	ENST00000409195.1	+	9	6911	c.6822C>G	c.(6820-6822)atC>atG	p.I2274M	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.I2052M|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.I2274M	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2099					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.I2274M(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAATCCAATCAACTTTAACC	0.418																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(6820-6822)ATC>ATG		xin actin-binding repeat containing 2 isoform 1							69.0	66.0	67.0					2																	168104724		1890	4091	5981	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168104724C>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6822C>G	2.37:g.168104724C>G	ENSP00000386840:p.Ile2274Met		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.I2099M|XIRP2_uc010fpq.2_Missense_Mutation_p.I2052M|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	p.I2274M	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	6840	+			2099					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.6822C>G	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384883	0.42308	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02631	4.22;4.22;4.22	6.17	5.29	0.74685	.	1.205210	0.05534	N	0.564445	T	0.06005	0.0156	L	0.51422	1.61	0.80722	D	1	P;B;B	0.45283	0.855;0.114;0.114	B;B;B	0.39027	0.288;0.022;0.022	T	0.43458	-0.9390	10	0.52906	T	0.07	1.2581	14.911	0.70758	0.0:0.857:0.143:0.0	.	2099;2099;2052	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	M	2274;2274;2052	ENSP00000386840:I2274M;ENSP00000295237:I2274M;ENSP00000387255:I2052M	ENSP00000295237:I2274M	I	+	3	3	XIRP2	167812970	0.296000	0.24398	0.183000	0.23137	0.991000	0.79684	2.756000	0.47549	1.615000	0.50252	0.655000	0.94253	ATC		0.418	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		10	38	0	0	0	0.008291	0	10	38				
PLCL1	5334	broad.mit.edu	37	2	198948501	198948501	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:198948501G>A	ENST00000428675.1	+	2	658	c.260G>A	c.(259-261)tGt>tAt	p.C87Y	PLCL1_ENST00000437704.2_5'Flank	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	87	Interaction with PPP1C.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.C87Y(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	AACCAAAAATGTGGTGGAAGA	0.373																																							uc010fsp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(259-261)TGT>TAT		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						53.0	53.0	53.0					2																	198948501		2202	4300	6502	SO:0001583	missense	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198948501G>A	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.260G>A	2.37:g.198948501G>A	ENSP00000402861:p.Cys87Tyr		Somatic				PLCL1_uc002uuv.3_Missense_Mutation_p.C8Y	p.C87Y	NM_001114661	NP_001108133	WXS	Illumina HiSeq	Unspecified	Q15111	PLCL1_HUMAN			2	551	+			87			Interaction with PPP1C.		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	c.260G>A	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685526	0.47991	.	.	ENSG00000115896	ENST00000428675	T	0.16196	2.36	5.67	5.67	0.87782	.	0.703710	0.11609	U	0.546928	T	0.11110	0.0271	N	0.08118	0	0.80722	D	1	P;B	0.34462	0.454;0.128	B;B	0.34722	0.188;0.012	T	0.38457	-0.9660	9	.	.	.	.	15.6065	0.76676	0.0:0.1369:0.8631:0.0	.	87;13	Q15111;B4DYZ4	PLCL1_HUMAN;.	Y	87	ENSP00000402861:C87Y	.	C	+	2	0	PLCL1	198656746	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.094000	0.57721	2.836000	0.97738	0.655000	0.94253	TGT		0.373	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		4	28	0	0	0	0.009096	0	4	28				
EPHA4	2043	broad.mit.edu	37	2	222307631	222307631	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:222307631C>A	ENST00000281821.2	-	11	2033	c.1992G>T	c.(1990-1992)agG>agT	p.R664S	EPHA4_ENST00000392071.4_Missense_Mutation_p.R613S|EPHA4_ENST00000409938.1_Missense_Mutation_p.R664S|EPHA4_ENST00000409854.1_Missense_Mutation_p.R664S	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	664	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.R664S(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGAAGTCTCTCCTCTGTTTGT	0.498																																							uc002vmq.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12						c.(1990-1992)AGG>AGT		ephrin receptor EphA4 precursor							139.0	126.0	131.0					2																	222307631		2203	4300	6503	SO:0001583	missense	2043					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr2:222307631C>A	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1992G>T	2.37:g.222307631C>A	ENSP00000281821:p.Arg664Ser		Somatic				EPHA4_uc002vmr.2_Missense_Mutation_p.R664S|EPHA4_uc010zlm.1_Missense_Mutation_p.R605S|EPHA4_uc010zln.1_Missense_Mutation_p.R664S	p.R664S	NM_004438	NP_004429	WXS	Illumina HiSeq	Unspecified	P54764	EPHA4_HUMAN		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)	11	2034	-		Renal(207;0.0183)	664			Protein kinase.|Cytoplasmic (Potential).		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	c.1992G>T	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665398	0.67700	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	6.06	2.31	0.28768	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88366	0.6417	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86747	0.1958	10	0.87932	D	0	.	10.2012	0.43084	0.0:0.6795:0.0:0.3205	.	664	P54764	EPHA4_HUMAN	S	664;664;664;613	ENSP00000281821:R664S;ENSP00000386276:R664S;ENSP00000386829:R664S;ENSP00000375923:R613S	ENSP00000281821:R664S	R	-	3	2	EPHA4	222015875	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	1.640000	0.37186	0.156000	0.19299	0.655000	0.94253	AGG		0.498	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3			7	98	1	0	0.00307968	0.00308	0.00327367	7	98				
C20orf196	149840	broad.mit.edu	37	20	5843983	5843983	+	Silent	SNP	C	C	A	rs138963473	byFrequency	TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:5843983C>A	ENST00000303142.6	+	3	579	c.492C>A	c.(490-492)tcC>tcA	p.S164S		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	164								p.S164S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						AGAGGCATTCCAGGGACACCC	0.507																																							uc002wmf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(490-492)TCC>TCA		hypothetical protein LOC149840							77.0	74.0	75.0					20																	5843983		2203	4300	6503	SO:0001819	synonymous_variant	149840							g.chr20:5843983C>A	AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.492C>A	20.37:g.5843983C>A			Somatic					p.S164S	NM_152504	NP_689717	WXS	Illumina HiSeq	Unspecified	Q8IYI0	CT196_HUMAN			3	579	+			164					A8K9J3|Q5TGA9|Q96LU1	Silent	SNP	ENST00000303142.6	37	c.492C>A	CCDS13091.1																																																																																				0.507	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077882.2	NM_152504		12	65	1	0	1.61879e-10	0.013537	2.12172e-10	12	65				
FRG1B	284802	broad.mit.edu	37	20	29625892	29625892	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:29625892T>C	ENST00000278882.3	+	5	516	c.136T>C	c.(136-138)Tat>Cat	p.Y46H	FRG1B_ENST00000439954.2_Missense_Mutation_p.Y51H|FRG1B_ENST00000358464.4_Missense_Mutation_p.Y46H			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	46										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GAAATCTGGCTATGGAAAATA	0.348																																							uc010ztl.1		NA																	0					0						c.(46-48)TAT>CAT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29625892T>C			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.136T>C	20.37:g.29625892T>C	ENSP00000278882:p.Tyr46His		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron	p.Y16H			WXS	Illumina HiSeq	Unspecified					2	78	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.46T>C		.	.	.	.	.	.	.	.	.	.	t	11.71	1.718965	0.30503	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50548	0.74	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	.	.	.	0.48341	D	0.999631	P	0.36837	0.571	P	0.54499	0.754	T	0.46176	-0.9210	9	0.28530	T	0.3	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	51	F5H5R5	.	H	46;51;46	ENSP00000408863:Y51H	ENSP00000278882:Y46H	Y	+	1	0	FRG1B	28239553	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	TAT		0.348	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	73	0	0	0	0.00308	0	3	73				
DEFB123	245936	broad.mit.edu	37	20	30037860	30037860	+	Silent	SNP	T	T	C	rs377702716		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:30037860T>C	ENST00000376309.3	+	2	267	c.87T>C	c.(85-87)taT>taC	p.Y29Y		NM_153324.2	NP_697019.1	Q8N688	DB123_HUMAN	defensin, beta 123	29					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.Y29*(1)|p.Y29Y(1)		kidney(1)|lung(2)	3	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGAATCTTTATGGCAAATGCC	0.428																																							uc002wvy.2		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		lung(1)|kidney(1)		0						c.(85-87)TAT>TAC		defensin, beta 123 precursor		T		1,4405	2.1+/-5.4	0,1,2202	152.0	150.0	151.0		87	-2.0	0.6	20		151	0,8600		0,0,4300	no	coding-synonymous	DEFB123	NM_153324.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		29/68	30037860	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	245936				defense response to bacterium	extracellular region		g.chr20:30037860T>C	AA933749	CCDS13180.1	20q11.1	2008-07-17			ENSG00000180424	ENSG00000180424		"""Defensins, beta"""	18103	protein-coding gene	gene with protein product	"""beta defensin 23"""					11854508	Standard	NM_153324		Approved	DEFB-23	uc002wvy.3	Q8N688	OTTHUMG00000032170	ENST00000376309.3:c.87T>C	20.37:g.30037860T>C			Somatic					p.Y29Y	NM_153324	NP_697019	WXS	Illumina HiSeq	Unspecified	Q8N688	DB123_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		2	178	+	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		29						Silent	SNP	ENST00000376309.3	37	c.87T>C	CCDS13180.1																																																																																				0.428	DEFB123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078510.2	NM_153324		14	92	0	0	0	0.004007	0	14	92				
TOP1	7150	broad.mit.edu	37	20	39741460	39741460	+	Silent	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:39741460G>A	ENST00000361337.2	+	14	1597	c.1347G>A	c.(1345-1347)cgG>cgA	p.R449R	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	449					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)	p.R449R(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	CTGCTCGGCGGCTGAAAAAAT	0.473			T	NUP98	AML*																																		uc002xjl.2		NA		Dom	yes		20	20q12-q13.1	7150	T	topoisomerase (DNA) I			L	NUP98		AML*		1	Substitution - coding silent(1)	p.R449W(1)	lung(1)	breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7						c.(1345-1347)CGG>CGA		DNA topoisomerase I	Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)						84.0	78.0	80.0					20																	39741460		2203	4300	6503	SO:0001819	synonymous_variant	7150				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding	g.chr20:39741460G>A		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.1347G>A	20.37:g.39741460G>A			Somatic				uc002xjn.1_Intron	p.R449R	NM_003286	NP_003277	WXS	Illumina HiSeq	Unspecified	P11387	TOP1_HUMAN			14	1593	+		Myeloproliferative disorder(115;0.00878)	449					A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Silent	SNP	ENST00000361337.2	37	c.1347G>A	CCDS13312.1																																																																																				0.473	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			3	16	0	0	0	0.004672	0	3	16				
SULF2	55959	broad.mit.edu	37	20	46307439	46307439	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:46307439T>G	ENST00000359930.4	-	8	2025	c.1174A>C	c.(1174-1176)Acg>Ccg	p.T392P	CTD-2653D5.1_ENST00000526566.2_RNA|SULF2_ENST00000361612.4_Missense_Mutation_p.T392P|SULF2_ENST00000484875.1_Missense_Mutation_p.T392P|SULF2_ENST00000467815.1_Missense_Mutation_p.T392P	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	392					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.T392P(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GGCCGCTCCGTGTCCAGCAGC	0.602																																							uc002xto.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(1174-1176)ACG>CCG		sulfatase 2 isoform a precursor							136.0	128.0	131.0					20																	46307439		2203	4300	6503	SO:0001583	missense	55959				bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr20:46307439T>G	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1174A>C	20.37:g.46307439T>G	ENSP00000353007:p.Thr392Pro		Somatic				SULF2_uc002xtr.2_Missense_Mutation_p.T392P|SULF2_uc002xtq.2_Missense_Mutation_p.T392P	p.T392P	NM_018837	NP_061325	WXS	Illumina HiSeq	Unspecified	Q8IWU5	SULF2_HUMAN			8	1504	-			392					E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	c.1174A>C	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	t	10.37	1.331516	0.24167	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95	5.37	3.03	0.35002	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.097323	0.64402	D	0.000001	D	0.94729	0.8299	L	0.31371	0.925	0.23030	N	0.998406	P;P	0.51147	0.942;0.83	P;P	0.58210	0.686;0.835	D	0.88234	0.2905	10	0.21540	T	0.41	-4.9667	10.3828	0.44121	0.4674:0.0:0.0:0.5326	.	392;392	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	P	392	ENSP00000353007:T392P;ENSP00000418290:T392P;ENSP00000354662:T392P;ENSP00000418442:T392P	ENSP00000353007:T392P	T	-	1	0	SULF2	45740846	0.820000	0.29190	0.759000	0.31340	0.472000	0.32918	0.486000	0.22340	0.312000	0.23038	-0.752000	0.03492	ACG		0.602	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837		24	126	0	0	0	0.005443	0	24	126				
ZNF831	128611	broad.mit.edu	37	20	57771017	57771017	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:57771017C>T	ENST00000371030.2	+	2	3832	c.3832C>T	c.(3832-3834)Cgt>Tgt	p.R1278C		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1278							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R1278C(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AAAGATGTCTCGTGGGAACAG	0.498																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(3832-3834)CGT>TGT		zinc finger protein 831							161.0	161.0	161.0					20																	57771017		1954	4159	6113	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57771017C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3832C>T	20.37:g.57771017C>T	ENSP00000360069:p.Arg1278Cys		Somatic					p.R1278C	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			2	3832	+	all_lung(29;0.0085)		1278					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.3832C>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	9.830	1.188161	0.21954	.	.	ENSG00000124203	ENST00000371030	T	0.04862	3.54	5.21	3.17	0.36434	.	0.877848	0.09903	N	0.740757	T	0.08492	0.0211	L	0.50333	1.59	0.09310	N	1	D	0.60575	0.988	B	0.44108	0.441	T	0.26744	-1.0094	10	0.87932	D	0	-7.9756	7.5172	0.27608	0.1859:0.6346:0.1796:0.0	.	1278	Q5JPB2	ZN831_HUMAN	C	1278	ENSP00000360069:R1278C	ENSP00000360069:R1278C	R	+	1	0	ZNF831	57204412	0.001000	0.12720	0.011000	0.14972	0.002000	0.02628	0.004000	0.13106	2.586000	0.87340	0.650000	0.86243	CGT		0.498	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		14	104	0	0	0	0.00245	0	14	104				
ZNF512B	57473	broad.mit.edu	37	20	62664298	62664298	+	Intron	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:62664298C>T	ENST00000450537.1	-	1	56				LINC00176_ENST00000444463.1_lincRNA|ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Silent_p.I886I			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I926I(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AGAAGAAGATCGGGGACATCC	0.632																																							uc002yho.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2776-2778)ATC>ATT		PRP6 pre-mRNA processing factor 6 homolog							92.0	73.0	79.0					20																	62664298		2203	4300	6503	SO:0001627	intron_variant	24148				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity	g.chr20:62664298C>T	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+15759G>A	20.37:g.62664298C>T			Somatic				PRPF6_uc002yhp.2_Silent_p.I886I|NCRNA00176_uc002yhq.2_5'Flank|NCRNA00176_uc011abq.1_5'Flank	p.I926I	NM_012469	NP_036601	WXS	Illumina HiSeq	Unspecified	O94906	PRP6_HUMAN			21	2946	+	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)		926					Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	c.2778C>T	CCDS13548.1																																																																																				0.632	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		4	44	0	0	0	0.001168	0	4	44				
USP25	29761	broad.mit.edu	37	21	17205774	17205774	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr21:17205774G>C	ENST00000285679.6	+	17	2470	c.2101G>C	c.(2101-2103)Gaa>Caa	p.E701Q	USP25_ENST00000400183.2_Missense_Mutation_p.E701Q|USP25_ENST00000351097.5_Intron|USP25_ENST00000285681.2_Missense_Mutation_p.E701Q	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	701					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.E701Q(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		AAAAGAACTAGAAGAATGGGA	0.413																																							uc002yjy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(2)	5						c.(2101-2103)GAA>CAA		ubiquitin specific peptidase 25							68.0	70.0	70.0					21																	17205774		2203	4300	6503	SO:0001583	missense	29761				protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr21:17205774G>C	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2101G>C	21.37:g.17205774G>C	ENSP00000285679:p.Glu701Gln		Somatic				USP25_uc011aby.1_Missense_Mutation_p.E701Q|USP25_uc002yjz.1_Missense_Mutation_p.E701Q|USP25_uc010gla.1_Intron	p.E701Q	NM_013396	NP_037528	WXS	Illumina HiSeq	Unspecified	Q9UHP3	UBP25_HUMAN		Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)	17	2318	+			701			Potential.		C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	c.2101G>C	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824093	0.50739	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	T;T;T	0.26660	1.76;1.72;1.73	5.24	4.29	0.51040	.	0.213668	0.46758	D	0.000280	T	0.31199	0.0789	M	0.69823	2.125	0.38071	D	0.936386	B;B;B	0.30104	0.268;0.1;0.003	B;B;B	0.30401	0.115;0.115;0.005	T	0.35276	-0.9795	10	0.56958	D	0.05	.	14.9235	0.70859	0.0:0.0:0.8562:0.1437	.	701;701;701	Q9UHP3-3;Q9UHP3-1;Q9UHP3	.;.;UBP25_HUMAN	Q	701	ENSP00000285681:E701Q;ENSP00000285679:E701Q;ENSP00000383044:E701Q	ENSP00000285679:E701Q	E	+	1	0	USP25	16127645	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.334000	0.59291	2.615000	0.88500	0.591000	0.81541	GAA		0.413	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			8	43	0	0	0	0.00308	0	8	43				
CECR2	27443	broad.mit.edu	37	22	18022446	18022446	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr22:18022446G>T	ENST00000400585.2	+	16	2563	c.2125G>T	c.(2125-2127)Ggg>Tgg	p.G709W	CECR2_ENST00000400573.5_Missense_Mutation_p.G850W|CECR2_ENST00000262608.8_Missense_Mutation_p.G851W			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	892					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.G850W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GGCTCTTCGGGGGGTGCAGGG	0.632																																							uc010gqw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2548-2550)GGG>TGG		cat eye syndrome chromosome region, candidate 2							45.0	52.0	50.0					22																	18022446		2005	4163	6168	SO:0001583	missense	27443				chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding	g.chr22:18022446G>T	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.2125G>T	22.37:g.18022446G>T	ENSP00000383428:p.Gly709Trp		Somatic				CECR2_uc010gqv.1_Missense_Mutation_p.G709W|CECR2_uc002zml.2_Missense_Mutation_p.G709W	p.G850W	NM_031413	NP_113601	WXS	Illumina HiSeq	Unspecified	Q9BXF3	CECR2_HUMAN		Lung(27;0.146)	15	2674	+		all_epithelial(15;0.139)	892					A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	37	c.2548G>T		.	.	.	.	.	.	.	.	.	.	G	20.2	3.958136	0.73902	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.53206	0.7;0.67;0.63	5.11	5.11	0.69529	.	0.000000	0.53938	D	0.000045	T	0.68540	0.3012	M	0.67953	2.075	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.70718	-0.4795	10	0.66056	D	0.02	-24.0406	18.7183	0.91684	0.0:0.0:1.0:0.0	.	892;709;850	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	W	709;850;851	ENSP00000383428:G709W;ENSP00000383417:G850W;ENSP00000262608:G851W	ENSP00000262608:G851W	G	+	1	0	CECR2	16402446	1.000000	0.71417	0.576000	0.28549	0.856000	0.48823	7.470000	0.80973	2.654000	0.90174	0.561000	0.74099	GGG		0.632	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		11	41	1	0	4.68919e-08	0.008291	5.95586e-08	11	41				
CNTN4	152330	broad.mit.edu	37	3	2908581	2908581	+	Silent	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr3:2908581G>T	ENST00000397461.1	+	7	984	c.600G>T	c.(598-600)gtG>gtT	p.V200V	CNTN4_ENST00000358480.3_5'UTR|CNTN4_ENST00000427331.1_Silent_p.V200V|CNTN4_ENST00000418658.1_Silent_p.V200V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	200	Ig-like C2-type 2.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.V200V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CCAATACCGTGACAAACCACA	0.388																																							uc003bpc.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(598-600)GTG>GTT		contactin 4 isoform a precursor							108.0	101.0	103.0					3																	2908581		1847	4092	5939	SO:0001819	synonymous_variant	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2908581G>T	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.600G>T	3.37:g.2908581G>T			Somatic				CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Silent_p.V200V	p.V200V	NM_175607	NP_783200	WXS	Illumina HiSeq	Unspecified	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	7	821	+		Ovarian(110;0.156)	200			Ig-like C2-type 2.		B2RAX3|Q8IX14|Q8TC35	Silent	SNP	ENST00000397461.1	37	c.600G>T	CCDS43041.1																																																																																				0.388	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			7	60	1	0	0.00198382	0.001984	0.00214252	7	60				
RBM5	10181	broad.mit.edu	37	3	50145581	50145581	+	Splice_Site	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr3:50145581G>A	ENST00000347869.3	+	13	1294		c.e13+1		RBM5_ENST00000441812.2_Splice_Site	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.?(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ATATGCTCAGGTAGGTAGATT	0.418																																							uc003cyg.2		NA																	1	Unknown(1)		lung(1)	lung(1)	1						c.e13+1		RNA binding motif protein 5							209.0	178.0	189.0					3																	50145581		2203	4300	6503	SO:0001630	splice_region_variant	10181				apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding	g.chr3:50145581G>A	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1119+1G>A	3.37:g.50145581G>A			Somatic				RBM5_uc011bdj.1_Splice_Site_p.Q317_splice|RBM5_uc011bdk.1_Splice_Site_p.Q201_splice	p.Q373_splice	NM_005778	NP_005769	WXS	Illumina HiSeq	Unspecified	P52756	RBM5_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	13	1267	+								B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Splice_Site	SNP	ENST00000347869.3	37	c.1119_splice	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425170	0.43020	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9804	0.89139	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM5	50120585	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	6.181000	0.71988	2.691000	0.91804	0.561000	0.74099	.		0.418	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	Intron	9	54	0	0	0	0.006214	0	9	54				
RBM5	10181	broad.mit.edu	37	3	50154766	50154766	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr3:50154766G>T	ENST00000347869.3	+	24	2451	c.2276G>T	c.(2275-2277)gGc>gTc	p.G759V	RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	759	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.|Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G759V(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGCGGGAAGGCTCTGGCTTG	0.547																																							uc003cyg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(2275-2277)GGC>GTC		RNA binding motif protein 5							159.0	153.0	155.0					3																	50154766		2203	4300	6503	SO:0001583	missense	10181				apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding	g.chr3:50154766G>T	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.2276G>T	3.37:g.50154766G>T	ENSP00000343054:p.Gly759Val		Somatic				RBM5_uc011bdj.1_Missense_Mutation_p.G703V|RBM5_uc011bdk.1_Missense_Mutation_p.G587V|RBM5_uc003cyh.2_Missense_Mutation_p.G216V|uc003cyi.1_RNA	p.G759V	NM_005778	NP_005769	WXS	Illumina HiSeq	Unspecified	P52756	RBM5_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	24	2424	+			759			G-patch.|Required for interaction with U2AF2.		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	c.2276G>T	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340663	0.81911	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.68479	-0.33	5.48	4.6	0.57074	D111/G-patch (3);	0.000000	0.85682	D	0.000000	D	0.90147	0.6921	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94502	0.7710	10	0.87932	D	0	-13.7693	15.6177	0.76780	0.0:0.0:0.8612:0.1388	.	449;759	Q59HE6;P52756	.;RBM5_HUMAN	V	759;758;449	ENSP00000343054:G759V	ENSP00000343054:G759V	G	+	2	0	RBM5	50129770	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.532000	0.98057	1.290000	0.44636	-0.188000	0.12872	GGC		0.547	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778		6	84	1	0	8.12818e-05	0.001984	9.14421e-05	6	84				
AMBN	258	broad.mit.edu	37	4	71464085	71464085	+	Silent	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr4:71464085T>C	ENST00000322937.6	+	4	251	c.148T>C	c.(148-150)Ttg>Ctg	p.L50L	AMBN_ENST00000449493.2_Silent_p.L50L	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	50					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.L50L(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			AATGAGACAGTTGGGAAGTCT	0.348																																							uc003hfl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(148-150)TTG>CTG		ameloblastin precursor							152.0	146.0	148.0					4																	71464085		2203	4299	6502	SO:0001819	synonymous_variant	258				bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel	g.chr4:71464085T>C	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.148T>C	4.37:g.71464085T>C			Somatic					p.L50L	NM_016519	NP_057603	WXS	Illumina HiSeq	Unspecified	Q9NP70	AMBN_HUMAN	Lung(101;0.235)		4	223	+			50					Q3B862|Q9H2X1|Q9H4L1	Silent	SNP	ENST00000322937.6	37	c.148T>C	CCDS3543.1																																																																																				0.348	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519		5	60	0	0	0	0.001168	0	5	60				
GUCY1A3	2982	broad.mit.edu	37	4	156631937	156631937	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr4:156631937C>T	ENST00000296518.7	+	6	829	c.620C>T	c.(619-621)cCt>cTt	p.P207L	GUCY1A3_ENST00000506455.1_Missense_Mutation_p.P207L|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.P207L|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.P207L|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.P207L|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.P207L			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	207					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.P207L(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TACTTCTTCCCTAAGAGAACC	0.478																																							uc003iov.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(619-621)CCT>CTT		guanylate cyclase 1, soluble, alpha 3 isoform A							77.0	82.0	80.0					4																	156631937		2203	4300	6503	SO:0001583	missense	2982				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity	g.chr4:156631937C>T		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.620C>T	4.37:g.156631937C>T	ENSP00000296518:p.Pro207Leu		Somatic				GUCY1A3_uc003iou.2_Missense_Mutation_p.P207L|GUCY1A3_uc010iqc.2_Missense_Mutation_p.P207L|GUCY1A3_uc003iow.2_Missense_Mutation_p.P207L|GUCY1A3_uc010iqd.2_Missense_Mutation_p.P206L|GUCY1A3_uc003iox.2_Missense_Mutation_p.P207L|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Missense_Mutation_p.P207L|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.P207L	p.P207L	NM_000856	NP_000847	WXS	Illumina HiSeq	Unspecified	Q02108	GCYA3_HUMAN		COAD - Colon adenocarcinoma(41;0.17)	7	1156	+	all_hematologic(180;0.24)	Renal(120;0.0854)	207					D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	c.620C>T	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399758	0.83120	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000296518;ENST00000513574	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.64	5.64	0.86602	Heme-NO binding (1);	0.090923	0.48767	D	0.000174	T	0.60728	0.2291	M	0.62723	1.935	0.80722	D	1	D;D;D	0.60160	0.987;0.987;0.987	D;D;D	0.63381	0.914;0.914;0.914	T	0.51228	-0.8732	10	0.25751	T	0.34	.	20.0554	0.97650	0.0:1.0:0.0:0.0	.	207;207;207	B3KU69;Q02108;D6RDW3	.;GCYA3_HUMAN;.	L	207	ENSP00000424361:P207L;ENSP00000421493:P207L;ENSP00000426968:P207L;ENSP00000412201:P207L;ENSP00000296518:P207L;ENSP00000426040:P207L	ENSP00000296518:P207L	P	+	2	0	GUCY1A3	156851387	1.000000	0.71417	0.962000	0.40283	0.850000	0.48378	7.210000	0.77924	2.804000	0.96469	0.643000	0.83706	CCT		0.478	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			5	58	0	0	0	0.001168	0	5	58				
ADCY2	108	broad.mit.edu	37	5	7520955	7520955	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr5:7520955C>T	ENST00000338316.4	+	3	602	c.513C>T	c.(511-513)atC>atT	p.I171I		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	171					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.I171I(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCCACACCATCGTGCTTAGCG	0.572																																							uc003jdz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(1)|skin(1)	7						c.(511-513)ATC>ATT		adenylate cyclase 2							196.0	128.0	151.0					5																	7520955		2203	4300	6503	SO:0001819	synonymous_variant	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7520955C>T	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.513C>T	5.37:g.7520955C>T			Somatic					p.I171I	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			3	580	+			171			Helical; (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	c.513C>T	CCDS3872.2																																																																																				0.572	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		7	87	0	0	0	0.001984	0	7	87				
CDH10	1008	broad.mit.edu	37	5	24491685	24491685	+	Splice_Site	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr5:24491685C>A	ENST00000264463.4	-	11	2383	c.1876G>T	c.(1876-1878)Gtt>Ttt	p.V626F	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	626					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V626F(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GGTTTCTTACCCAGTAGAATG	0.483										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1876-1878)GTT>TTT		cadherin 10, type 2 preproprotein							68.0	68.0	68.0					5																	24491685		2203	4300	6503	SO:0001630	splice_region_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24491685C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1876+1G>T	5.37:g.24491685C>A		HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.V626F	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	11	2208	-			626			Helical; (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1876G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598119	0.66332	.	.	ENSG00000040731	ENST00000264463	T	0.59906	0.23	5.79	5.79	0.91817	.	0.159001	0.53938	D	0.000047	T	0.63581	0.2523	M	0.87827	2.91	0.49582	D	0.999808	B	0.21753	0.06	B	0.23574	0.047	T	0.61257	-0.7099	9	.	.	.	.	13.926	0.63964	0.1518:0.8481:0.0:0.0	.	626	Q9Y6N8	CAD10_HUMAN	F	626	ENSP00000264463:V626F	.	V	-	1	0	CDH10	24527442	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.705000	0.54823	2.732000	0.93576	0.557000	0.71058	GTT		0.483	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	Missense_Mutation	17	59	1	0	1.99824e-07	0.00499	2.47488e-07	17	59				
HCN1	348980	broad.mit.edu	37	5	45396782	45396782	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr5:45396782C>T	ENST00000303230.4	-	4	1099	c.1042G>A	c.(1042-1044)Gca>Aca	p.A348T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	348					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.A348T(2)|p.A348P(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TTGAAGAGTGCGTATGAATAC	0.448																																							uc003jok.2		NA																	3	Substitution - Missense(3)		lung(2)|endometrium(1)	ovary(1)	1						c.(1042-1044)GCA>ACA		hyperpolarization activated cyclic							101.0	91.0	94.0					5																	45396782		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45396782C>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1042G>A	5.37:g.45396782C>T	ENSP00000307342:p.Ala348Thr		Somatic					p.A348T	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			4	1067	-			348						Missense_Mutation	SNP	ENST00000303230.4	37	c.1042G>A	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	33	5.285172	0.95517	.	.	ENSG00000164588	ENST00000303230	D	0.98876	-5.2	5.18	5.18	0.71444	Ion transport (1);	0.093561	0.44688	D	0.000433	D	0.99093	0.9688	M	0.88450	2.955	0.80722	D	1	D	0.65815	0.995	P	0.58077	0.832	D	0.99690	1.1001	10	0.87932	D	0	.	18.8829	0.92364	0.0:1.0:0.0:0.0	.	348	O60741	HCN1_HUMAN	T	348	ENSP00000307342:A348T	ENSP00000307342:A348T	A	-	1	0	HCN1	45432539	1.000000	0.71417	0.907000	0.35723	0.983000	0.72400	7.651000	0.83577	2.705000	0.92388	0.650000	0.86243	GCA		0.448	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		11	73	0	0	0	0.001855	0	11	73				
VCAN	1462	broad.mit.edu	37	5	82835757	82835757	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr5:82835757G>T	ENST00000265077.3	+	8	7500	c.6935G>T	c.(6934-6936)gGa>gTa	p.G2312V	VCAN-AS1_ENST00000512090.1_RNA|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Missense_Mutation_p.G1325V	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2312	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.G2312V(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAAGAAGTTGGACCACTCGTA	0.393																																							uc003kii.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(6934-6936)GGA>GTA		versican isoform 1 precursor							115.0	111.0	113.0					5																	82835757		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82835757G>T	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6935G>T	5.37:g.82835757G>T	ENSP00000265077:p.Gly2312Val		Somatic				VCAN_uc003kij.3_Missense_Mutation_p.G1325V|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.G976V	p.G2312V	NM_004385	NP_004376	WXS	Illumina HiSeq	Unspecified	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	8	7291	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	2312			GAG-beta.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.6935G>T	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	4.285	0.052097	0.08291	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.32515	1.45;1.45	6.07	-0.0118	0.13991	.	1.286440	0.04968	N	0.463245	T	0.27663	0.0680	L	0.40543	1.245	0.09310	N	1	P;D	0.54397	0.617;0.966	B;P	0.44860	0.165;0.462	T	0.21861	-1.0233	10	0.40728	T	0.16	.	5.9997	0.19513	0.271:0.3539:0.375:0.0	.	1325;2312	P13611-2;P13611	.;CSPG2_HUMAN	V	2312;1325	ENSP00000265077:G2312V;ENSP00000340062:G1325V	ENSP00000265077:G2312V	G	+	2	0	VCAN	82871513	0.001000	0.12720	0.000000	0.03702	0.204000	0.24138	0.628000	0.24522	-0.304000	0.08843	-0.172000	0.13284	GGA		0.393	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		11	48	1	0	9.70103e-10	0.008291	1.25927e-09	11	48				
PGK2	5232	broad.mit.edu	37	6	49754110	49754110	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr6:49754110T>G	ENST00000304801.3	-	1	943	c.791A>C	c.(790-792)aAg>aCg	p.K264T		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	264					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.K264T(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					TTTAACGATCTTGGCTCCCTC	0.418																																							uc003ozu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(790-792)AAG>ACG		phosphoglycerate kinase 2							136.0	127.0	130.0					6																	49754110		2203	4300	6503	SO:0001583	missense	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754110T>G	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.791A>C	6.37:g.49754110T>G	ENSP00000305995:p.Lys264Thr		Somatic					p.K264T	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	898	-	Lung NSC(77;0.0402)		264					B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	c.791A>C	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	2.400	-0.337798	0.05278	.	.	ENSG00000170950	ENST00000304801	D	0.92199	-2.99	4.09	2.9	0.33743	Phosphoglycerate kinase, C-terminal (1);	0.406252	0.29775	N	0.011237	D	0.86785	0.6016	M	0.80982	2.52	0.36253	D	0.854044	B	0.06786	0.001	B	0.19946	0.027	D	0.84729	0.0744	10	0.59425	D	0.04	-5.4838	9.2187	0.37364	0.0:0.0:0.1832:0.8168	.	264	P07205	PGK2_HUMAN	T	264	ENSP00000305995:K264T	ENSP00000305995:K264T	K	-	2	0	PGK2	49862069	0.997000	0.39634	1.000000	0.80357	0.012000	0.07955	0.870000	0.28010	0.880000	0.35969	-0.446000	0.05623	AAG		0.418	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			6	110	0	0	0	0.001168	0	6	110				
COL19A1	1310	broad.mit.edu	37	6	70881870	70881870	+	Silent	SNP	A	A	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr6:70881870A>C	ENST00000322773.4	+	41	2685	c.2583A>C	c.(2581-2583)gcA>gcC	p.A861A	COL19A1_ENST00000393344.1_Silent_p.A483A	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	861	Collagen-like 9.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.A861A(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AGCCTGGTGCAATGGGGTTGC	0.353																																							uc003pfc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)	4						c.(2581-2583)GCA>GCC		alpha 1 type XIX collagen precursor							104.0	105.0	105.0					6																	70881870		2203	4300	6503	SO:0001819	synonymous_variant	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70881870A>C		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2583A>C	6.37:g.70881870A>C			Somatic					p.A861A	NM_001858	NP_001849	WXS	Illumina HiSeq	Unspecified	Q14993	COJA1_HUMAN			41	2700	+			861			Triple-helical region 5 (COL5).		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	c.2583A>C	CCDS4970.1																																																																																				0.353	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			8	28	0	0	0	0.010729	0	8	28				
SYNE1	23345	broad.mit.edu	37	6	152615182	152615182	+	Silent	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr6:152615182G>C	ENST00000367255.5	-	94	18364	c.17763C>G	c.(17761-17763)tcC>tcG	p.S5921S	SYNE1_ENST00000423061.1_Silent_p.S5850S|SYNE1_ENST00000356820.4_Silent_p.S445S|SYNE1_ENST00000265368.4_Silent_p.S5921S|SYNE1_ENST00000341594.5_Silent_p.S5533S|SYNE1_ENST00000448038.1_Silent_p.S5850S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5921					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S5921S(2)|p.S5850S(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGAACTCCTGGGATGCGGATG	0.488										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(17761-17763)TCC>TCG		spectrin repeat containing, nuclear envelope 1							104.0	94.0	97.0					6																	152615182		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152615182G>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.17763C>G	6.37:g.152615182G>C		HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Silent_p.S445S|SYNE1_uc003qos.3_Silent_p.S445S|SYNE1_uc003qot.3_Silent_p.S5850S|SYNE1_uc003qou.3_Silent_p.S5921S|SYNE1_uc010kiy.1_Silent_p.S96S	p.S5921S	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	94	18365	-		Ovarian(120;0.0955)	5921			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.17763C>G	CCDS5236.2																																																																																				0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		14	37	0	0	0	0.00245	0	14	37				
PKD1L1	168507	broad.mit.edu	37	7	47942012	47942012	+	Silent	SNP	T	T	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:47942012T>G	ENST00000289672.2	-	13	2078	c.2028A>C	c.(2026-2028)ccA>ccC	p.P676P		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	676	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.P676P(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TCACCAGGGGTGGCTGGCAGG	0.552																																							uc003tny.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(2026-2028)CCA>CCC		polycystin-1L1							53.0	53.0	53.0					7																	47942012		2203	4300	6503	SO:0001819	synonymous_variant	168507				cell-cell adhesion	integral to membrane		g.chr7:47942012T>G	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2028A>C	7.37:g.47942012T>G			Somatic					p.P676P	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			13	2028	-			676			Extracellular (Potential).|REJ.		Q6UWK1	Silent	SNP	ENST00000289672.2	37	c.2028A>C	CCDS34633.1																																																																																				0.552	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		5	26	0	0	0	0.000602	0	5	26				
MUC17	140453	broad.mit.edu	37	7	100680433	100680433	+	Silent	SNP	C	C	T	rs575805315		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:100680433C>T	ENST00000306151.4	+	3	5800	c.5736C>T	c.(5734-5736)gaC>gaT	p.D1912D		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1912	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.D1912D(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACTGCTGACGGTAGCAGCA	0.507													-|||	1	0.000199681	0.0008	0.0	5008	,	,		25322	0.0		0.0	False		,,,				2504	0.0						uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(5734-5736)GAC>GAT		mucin 17 precursor							247.0	251.0	249.0					7																	100680433		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100680433C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5736C>T	7.37:g.100680433C>T			Somatic				MUC17_uc010lho.1_RNA	p.D1912D	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	5789	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1912			Extracellular (Potential).|30.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.5736C>T	CCDS34711.1																																																																																				0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		10	201	0	0	0	0.013537	0	10	201				
PIK3CG	5294	broad.mit.edu	37	7	106508507	106508507	+	Silent	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:106508507C>T	ENST00000359195.3	+	2	811	c.501C>T	c.(499-501)aaC>aaT	p.N167N	PIK3CG_ENST00000440650.2_Silent_p.N167N|PIK3CG_ENST00000496166.1_Silent_p.N167N	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	167					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N167N(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						ACGTCAGCAACGTGCACGACG	0.667																																							uc003vdv.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						c.(499-501)AAC>AAT		phosphoinositide-3-kinase, catalytic, gamma							29.0	33.0	32.0					7																	106508507		2203	4298	6501	SO:0001819	synonymous_variant	5294				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	g.chr7:106508507C>T		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.501C>T	7.37:g.106508507C>T			Somatic				PIK3CG_uc003vdu.2_Silent_p.N167N|PIK3CG_uc003vdw.2_Silent_p.N167N	p.N167N	NM_002649	NP_002640	WXS	Illumina HiSeq	Unspecified	P48736	PK3CG_HUMAN			2	586	+			167					A4D0Q6|Q8IV23|Q9BZC8	Silent	SNP	ENST00000359195.3	37	c.501C>T	CCDS5739.1																																																																																				0.667	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			4	29	0	0	0	0.000602	0	4	29				
RNF148	378925	broad.mit.edu	37	7	122342159	122342159	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:122342159T>A	ENST00000434824.1	-	1	862	c.646A>T	c.(646-648)Aga>Tga	p.R216*	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000449022.2_Intron|RNF133_ENST00000340112.2_5'Flank|CADPS2_ENST00000412584.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	216						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.R216*(2)		endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TTGGGCACTCTAGGTGTAAGT	0.448																																							uc003vkk.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(646-648)AGA>TGA		ring finger protein 148 precursor							89.0	84.0	86.0					7																	122342159		1943	4144	6087	SO:0001587	stop_gained	378925					integral to membrane	zinc ion binding	g.chr7:122342159T>A	BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.646A>T	7.37:g.122342159T>A	ENSP00000388207:p.Arg216*		Somatic				CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF133_uc003vkj.1_5'Flank|RNF148_uc010lkr.1_Intron	p.R216*	NM_198085	NP_932351	WXS	Illumina HiSeq	Unspecified	Q8N7C7	RN148_HUMAN			1	863	-			216					A4D0X4|Q8N308	Nonsense_Mutation	SNP	ENST00000434824.1	37	c.646A>T	CCDS47692.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.130433	0.77549	.	.	ENSG00000235631	ENST00000434824	.	.	.	5.36	-6.32	0.01995	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9802	0.53115	0.0:0.0687:0.6144:0.3169	.	.	.	.	X	216	.	ENSP00000388207:R216X	R	-	1	2	RNF148	122129395	0.000000	0.05858	0.000000	0.03702	0.815000	0.46073	-1.079000	0.03410	-0.990000	0.03481	0.454000	0.30748	AGA		0.448	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085		4	76	0	0	0	0.000602	0	4	76				
MGAM	8972	broad.mit.edu	37	7	141740570	141740570	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:141740570G>A	ENST00000549489.2	+	21	2517	c.2422G>A	c.(2422-2424)Gga>Aga	p.G808R	MGAM_ENST00000475668.2_Missense_Mutation_p.G808R	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	808	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.G808R(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGAACTTCCTGGAGACAAAAT	0.488																																							uc003vwy.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(2422-2424)GGA>AGA		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						116.0	118.0	117.0					7																	141740570		1992	4169	6161	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141740570G>A	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2422G>A	7.37:g.141740570G>A	ENSP00000447378:p.Gly808Arg		Somatic					p.G808R	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			21	2476	+	Melanoma(164;0.0272)		808			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.2422G>A	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.028570	0.54790	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.91124	-2.79	5.48	2.07	0.26955	.	1.428110	0.04617	N	0.401267	D	0.84529	0.5492	N	0.13272	0.32	0.26968	N	0.965641	B	0.20164	0.042	B	0.33750	0.169	T	0.71533	-0.4564	10	0.20519	T	0.43	.	8.4536	0.32886	0.1946:0.1332:0.6721:0.0	.	808	O43451	MGA_HUMAN	R	808;808;685	ENSP00000447378:G808R	ENSP00000316431:G685R	G	+	1	0	MGAM	141387039	0.429000	0.25530	0.994000	0.49952	0.998000	0.95712	2.909000	0.48758	0.512000	0.28257	0.650000	0.86243	GGA		0.488	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			6	30	0	0	0	0.001168	0	6	30				
OR9A2	135924	broad.mit.edu	37	7	142723355	142723355	+	Missense_Mutation	SNP	G	G	A	rs374520156		TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr7:142723355G>A	ENST00000350513.2	-	1	927	c.865C>T	c.(865-867)Cgg>Tgg	p.R289W		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R289W(2)		central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					TTGTCATTCCGAAGAGTAAAG	0.448																																							uc003wcc.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(865-867)CGG>TGG		olfactory receptor, family 9, subfamily A,		G	TRP/ARG	0,4406		0,0,2203	86.0	92.0	90.0		865	-9.2	0.0	7		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR9A2	NM_001001658.1	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	289/311	142723355	1,13005	2203	4300	6503	SO:0001583	missense	135924				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:142723355G>A		CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.865C>T	7.37:g.142723355G>A	ENSP00000316518:p.Arg289Trp		Somatic					p.R289W	NM_001001658	NP_001001658	WXS	Illumina HiSeq	Unspecified	Q8NGT5	OR9A2_HUMAN			1	865	-	Melanoma(164;0.059)		289			Cytoplasmic (Potential).		B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	ENST00000350513.2	37	c.865C>T	CCDS34767.1	.	.	.	.	.	.	.	.	.	.	G	8.097	0.775817	0.16051	0.0	1.16E-4	ENSG00000179468	ENST00000350513	T	0.41065	1.01	4.59	-9.18	0.00688	.	0.000000	0.37219	U	0.002186	T	0.55593	0.1930	M	0.89414	3.03	0.18873	N	0.999982	D	0.89917	1.0	D	0.72338	0.977	T	0.61691	-0.7011	10	0.87932	D	0	-10.0995	5.8484	0.18679	0.3195:0.0:0.2482:0.4322	.	289	Q8NGT5	OR9A2_HUMAN	W	289	ENSP00000316518:R289W	ENSP00000316518:R289W	R	-	1	2	OR9A2	142433477	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-1.808000	0.01732	-2.930000	0.00301	-1.267000	0.01435	CGG		0.448	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350862.1			10	40	0	0	0	0.006214	0	10	40				
EXTL3	2137	broad.mit.edu	37	8	28574075	28574075	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr8:28574075G>A	ENST00000220562.4	+	3	1401	c.499G>A	c.(499-501)Ggc>Agc	p.G167S	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	167					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.G167S(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GGACGATGCCGGCCTCCCTCC	0.602																																							uc003xgz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(499-501)GGC>AGC		exostoses-like 3							60.0	61.0	61.0					8																	28574075		2203	4300	6503	SO:0001583	missense	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28574075G>A	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.499G>A	8.37:g.28574075G>A	ENSP00000220562:p.Gly167Ser		Somatic					p.G167S	NM_001440	NP_001431	WXS	Illumina HiSeq	Unspecified	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	3	1092	+		Ovarian(32;0.069)	167			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	c.499G>A	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	G	2.276	-0.365826	0.05069	.	.	ENSG00000012232	ENST00000220562	D	0.95103	-3.61	5.02	5.02	0.67125	.	0.219040	0.47852	D	0.000213	D	0.86719	0.6000	N	0.22421	0.69	0.40196	D	0.977461	B	0.26708	0.157	B	0.18871	0.023	T	0.81701	-0.0813	9	.	.	.	-21.3635	6.5562	0.22462	0.2256:0.0:0.7744:0.0	.	167	O43909	EXTL3_HUMAN	S	167	ENSP00000220562:G167S	.	G	+	1	0	EXTL3	28629994	1.000000	0.71417	0.961000	0.40146	0.544000	0.35116	5.655000	0.67981	2.348000	0.79779	0.485000	0.47835	GGC		0.602	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		13	47	0	0	0	0.013537	0	13	47				
CSMD3	114788	broad.mit.edu	37	8	114326834	114326834	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr8:114326834C>T	ENST00000297405.5	-	2	611	c.367G>A	c.(367-369)Gat>Aat	p.D123N	CSMD3_ENST00000455883.2_Missense_Mutation_p.D123N|CSMD3_ENST00000352409.3_Missense_Mutation_p.D123N|CSMD3_ENST00000343508.3_Missense_Mutation_p.D83N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	123	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D83N(1)|p.D123N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGATGTCCATCATATAATGAT	0.328										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(367-369)GAT>AAT		CUB and Sushi multiple domains 3 isoform 1							128.0	122.0	124.0					8																	114326834		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:114326834C>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.367G>A	8.37:g.114326834C>T	ENSP00000297405:p.Asp123Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Missense_Mutation_p.D83N|CSMD3_uc011lhx.1_Missense_Mutation_p.D123N|CSMD3_uc010mcx.1_Missense_Mutation_p.D123N|CSMD3_uc003ynx.3_Missense_Mutation_p.D123N	p.D123N	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			2	526	-			123			Extracellular (Potential).|CUB 1.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.367G>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318361	0.81469	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.72	5.72	0.89469	CUB (5);	0.000000	0.64402	D	0.000007	T	0.61236	0.2331	M	0.72894	2.215	0.45676	D	0.99859	D;D;D;D;P	0.89917	0.996;1.0;1.0;0.997;0.566	D;D;D;D;P	0.97110	0.993;0.998;1.0;0.992;0.562	T	0.57183	-0.7855	10	0.39692	T	0.17	.	18.8756	0.92334	0.0:1.0:0.0:0.0	.	123;123;123;123;83	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	N	83;123;123;123	ENSP00000345799:D83N;ENSP00000297405:D123N;ENSP00000412263:D123N;ENSP00000343124:D123N	ENSP00000297405:D123N	D	-	1	0	CSMD3	114396010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.811000	0.86092	2.697000	0.92050	0.557000	0.71058	GAT		0.328	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		11	54	0	0	0	0.010729	0	11	54				
CSMD3	114788	broad.mit.edu	37	8	114326898	114326898	+	Silent	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr8:114326898A>G	ENST00000297405.5	-	2	547	c.303T>C	c.(301-303)aaT>aaC	p.N101N	CSMD3_ENST00000455883.2_Silent_p.N101N|CSMD3_ENST00000352409.3_Silent_p.N101N|CSMD3_ENST00000343508.3_Silent_p.N61N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	101	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N101N(1)|p.N61N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTGTATTCTATTTCGTTCTT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(301-303)AAT>AAC		CUB and Sushi multiple domains 3 isoform 1							171.0	162.0	165.0					8																	114326898		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:114326898A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.303T>C	8.37:g.114326898A>G		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Silent_p.N61N|CSMD3_uc011lhx.1_Silent_p.N101N|CSMD3_uc010mcx.1_Silent_p.N101N|CSMD3_uc003ynx.3_Silent_p.N101N	p.N101N	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			2	462	-			101			Extracellular (Potential).|CUB 1.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.303T>C	CCDS6315.1																																																																																				0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		16	104	0	0	0	0.004007	0	16	104				
FER1L6	654463	broad.mit.edu	37	8	124998366	124998366	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr8:124998366T>C	ENST00000522917.1	+	12	1675	c.1469T>C	c.(1468-1470)aTg>aCg	p.M490T	FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.M490T	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	490						integral component of membrane (GO:0016021)		p.M490T(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAAGCTACCATGATTGACCGG	0.358																																							uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(1468-1470)ATG>ACG		fer-1-like 6							114.0	106.0	108.0					8																	124998366		1818	4071	5889	SO:0001583	missense	654463					integral to membrane		g.chr8:124998366T>C	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1469T>C	8.37:g.124998366T>C	ENSP00000428280:p.Met490Thr		Somatic				uc003yqx.1_Intron	p.M490T	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		12	1675	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		490			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.1469T>C	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171746	0.78452	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.91407	-2.84;-2.84	5.46	5.46	0.80206	.	0.000000	0.85682	U	0.000000	D	0.94833	0.8331	M	0.88105	2.93	0.80722	D	1	D	0.63880	0.993	P	0.55455	0.776	D	0.95690	0.8739	10	0.87932	D	0	.	15.534	0.75986	0.0:0.0:0.0:1.0	.	490	Q2WGJ9	FR1L6_HUMAN	T	490	ENSP00000428280:M490T;ENSP00000381982:M490T	ENSP00000381982:M490T	M	+	2	0	FER1L6	125067547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.944000	0.87722	2.076000	0.62316	0.528000	0.53228	ATG		0.358	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		12	65	0	0	0	0.001855	0	12	65				
TLR4	7099	broad.mit.edu	37	9	120476501	120476501	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr9:120476501G>C	ENST00000355622.6	+	3	2196	c.2095G>C	c.(2095-2097)Ggg>Cgg	p.G699R	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.G659R	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	699	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.G699R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TTTAGAAGAAGGGGTGCCTCC	0.438																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2095-2097)GGG>CGG		toll-like receptor 4 precursor							109.0	102.0	105.0					9																	120476501		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476501G>C	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2095G>C	9.37:g.120476501G>C	ENSP00000363089:p.Gly699Arg		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.G659R|TLR4_uc004bkb.2_Missense_Mutation_p.G499R	p.G699R	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	2386	+			699			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.2095G>C	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070353	0.76301	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.08193	3.12;3.12	6.03	6.03	0.97812	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.64402	D	0.000001	T	0.27765	0.0683	L	0.54323	1.7	0.54753	D	0.999985	D	0.76494	0.999	D	0.79784	0.993	T	0.00018	-1.2366	10	0.52906	T	0.07	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	699	O00206	TLR4_HUMAN	R	659;699	ENSP00000377997:G659R;ENSP00000363089:G699R	ENSP00000363089:G699R	G	+	1	0	TLR4	119516322	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.610000	0.54125	2.861000	0.98227	0.655000	0.94253	GGG		0.438	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		9	44	0	0	0	0.006214	0	9	44				
OR1L8	138881	broad.mit.edu	37	9	125330105	125330105	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr9:125330105A>G	ENST00000304865.2	-	1	733	c.652T>C	c.(652-654)Tct>Cct	p.S218P		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S218P(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CGTATATAAGAGAAAGCAATG	0.433																																							uc004bmp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(652-654)TCT>CCT		olfactory receptor, family 1, subfamily L,							76.0	65.0	69.0					9																	125330105		2203	4300	6503	SO:0001583	missense	138881				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125330105A>G		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.652T>C	9.37:g.125330105A>G	ENSP00000306607:p.Ser218Pro		Somatic					p.S218P	NM_001004454	NP_001004454	WXS	Illumina HiSeq	Unspecified	Q8NGR8	OR1L8_HUMAN			1	652	-			218			Helical; Name=5; (Potential).		A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	c.652T>C	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.949972	0.34377	.	.	ENSG00000171496	ENST00000304865	T	0.46819	0.86	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000361	T	0.77329	0.4114	H	0.96269	3.795	0.32581	N	0.528412	D	0.89917	1.0	D	0.97110	1.0	D	0.86814	0.2000	10	0.87932	D	0	-20.769	13.3253	0.60457	1.0:0.0:0.0:0.0	.	218	Q8NGR8	OR1L8_HUMAN	P	218	ENSP00000306607:S218P	ENSP00000306607:S218P	S	-	1	0	OR1L8	124369926	0.987000	0.35691	0.967000	0.41034	0.081000	0.17604	2.764000	0.47613	2.047000	0.60756	0.369000	0.22263	TCT		0.433	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1			5	14	0	0	0	0.000602	0	5	14				
FRMPD4	9758	broad.mit.edu	37	X	12736241	12736241	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chrX:12736241G>T	ENST00000380682.1	+	16	3802	c.3296G>T	c.(3295-3297)gGt>gTt	p.G1099V		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1099					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G1089V(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCCACTGAAGGTGGGATGGCT	0.498																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(3295-3297)GGT>GTT		FERM and PDZ domain containing 4							138.0	137.0	138.0					X																	12736241		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12736241G>T	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3296G>T	X.37:g.12736241G>T	ENSP00000370057:p.Gly1099Val		Somatic				FRMPD4_uc011mij.1_Missense_Mutation_p.G1091V	p.G1099V	NM_014728	NP_055543	WXS	Illumina HiSeq	Unspecified	Q14CM0	FRPD4_HUMAN			16	3802	+			1099					A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.3296G>T	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	2.045	-0.419003	0.04766	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06608	3.28	5.49	5.49	0.81192	.	0.108357	0.64402	D	0.000005	T	0.06371	0.0164	L	0.54323	1.7	0.32534	N	0.534547	P;P	0.40000	0.554;0.698	B;B	0.30105	0.111;0.111	T	0.13548	-1.0505	10	0.46703	T	0.11	-7.1661	9.3818	0.38318	0.1426:0.0:0.8574:0.0	.	1091;1099	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	V	1099;1090;1088	ENSP00000370057:G1099V	ENSP00000304583:G1088V	G	+	2	0	FRMPD4	12646162	1.000000	0.71417	0.127000	0.21898	0.013000	0.08279	3.492000	0.53259	2.301000	0.77427	0.600000	0.82982	GGT		0.498	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		18	84	1	0	2.35188e-11	0.006122	3.1436e-11	18	84				
ABCB7	22	broad.mit.edu	37	X	74288884	74288884	+	Silent	SNP	C	C	A			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chrX:74288884C>A	ENST00000373394.3	-	12	1624	c.1617G>T	c.(1615-1617)gtG>gtT	p.V539V	ABCB7_ENST00000339447.4_Silent_p.V499V|ABCB7_ENST00000253577.3_Silent_p.V540V|ABCB7_ENST00000534570.1_5'UTR			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	539	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)	p.V540V(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TTTCCAGGCTCACATCTTGTA	0.398																																							uc004eca.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1615-1617)GTG>GTT		ATP-binding cassette, sub-family B, member 7							142.0	127.0	132.0					X																	74288884		2203	4300	6503	SO:0001819	synonymous_variant	22				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity	g.chrX:74288884C>A	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1617G>T	X.37:g.74288884C>A			Somatic				ABCB7_uc004ebz.2_Silent_p.V540V|ABCB7_uc011mqn.1_Silent_p.V513V|ABCB7_uc010nls.2_Silent_p.V500V|ABCB7_uc010nlt.2_Silent_p.V499V	p.V539V	NM_004299	NP_004290	WXS	Illumina HiSeq	Unspecified	O75027	ABCB7_HUMAN			12	1642	-			539			ABC transporter.		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	ENST00000373394.3	37	c.1617G>T																																																																																					0.398	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		26	111	1	0	3.65163e-15	0.00632	5.0303e-15	26	111				
TIMM8A	1678	broad.mit.edu	37	X	100601582	100601582	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chrX:100601582C>T	ENST00000372902.3	-	2	730	c.199G>A	c.(199-201)Gtt>Att	p.V67I	TIMM8A_ENST00000480575.1_5'Flank	NM_004085.3	NP_004076.1	O60220	TIM8A_HUMAN	translocase of inner mitochondrial membrane 8 homolog A (yeast)	67					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|nervous system development (GO:0007399)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)	p.V67I(1)		endometrium(1)|lung(1)	2						AAGCGCTCAACGCAGTTCACA	0.483																																							uc004ehd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(199-201)GTT>ATT		translocase of inner mitochondrial membrane 8							144.0	140.0	141.0					X																	100601582		2203	4300	6503	SO:0001583	missense	1678				nervous system development|protein import into mitochondrial inner membrane|transmembrane transport	mitochondrial inner membrane|mitochondrial intermembrane space protein transporter complex	protein binding	g.chrX:100601582C>T	U66035	CCDS14481.1	Xq22	2008-02-05	2001-11-28		ENSG00000126953	ENSG00000126953			11817	protein-coding gene	gene with protein product		300356	"""translocase of inner mitochondrial membrane 8 (yeast) homolog A"""	DFN1		10552927, 8841189	Standard	NM_004085		Approved	DDP, MTS	uc004ehd.2	O60220	OTTHUMG00000022028	ENST00000372902.3:c.199G>A	X.37:g.100601582C>T	ENSP00000361993:p.Val67Ile		Somatic					p.V67I	NM_004085	NP_004076	WXS	Illumina HiSeq	Unspecified	O60220	TIM8A_HUMAN			2	504	-			67					B2R5A6|Q6IRW6	Missense_Mutation	SNP	ENST00000372902.3	37	c.199G>A	CCDS14481.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035489	0.75617	.	.	ENSG00000126953	ENST00000372902	T	0.70045	-0.45	5.33	5.33	0.75918	.	0.061097	0.64402	N	0.000003	T	0.64405	0.2595	.	.	.	0.58432	D	0.999999	B	0.34349	0.45	B	0.34931	0.192	T	0.66814	-0.5828	9	0.54805	T	0.06	.	17.7039	0.88303	0.0:1.0:0.0:0.0	.	67	O60220	TIM8A_HUMAN	I	67	ENSP00000361993:V67I	ENSP00000361993:V67I	V	-	1	0	TIMM8A	100488238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.670000	0.83925	2.210000	0.71456	0.600000	0.82982	GTT		0.483	TIMM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057554.1	NM_004085		31	123	0	0	0	0.013726	0	31	123				
USP26	83844	broad.mit.edu	37	X	132161641	132161641	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chrX:132161641T>C	ENST00000511190.1	-	6	1077	c.608A>G	c.(607-609)tAc>tGc	p.Y203C	USP26_ENST00000406273.1_Missense_Mutation_p.Y203C|USP26_ENST00000370832.1_Missense_Mutation_p.Y203C	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	203					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.Y203C(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					GGATTTCTTGTATTCTACAGA	0.343																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(607-609)TAC>TGC		ubiquitin-specific protease 26							73.0	62.0	66.0					X																	132161641		2202	4297	6499	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132161641T>C	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.608A>G	X.37:g.132161641T>C	ENSP00000423390:p.Tyr203Cys		Somatic				USP26_uc011mvf.1_Missense_Mutation_p.Y203C	p.Y203C	NM_031907	NP_114113	WXS	Illumina HiSeq	Unspecified	Q9BXU7	UBP26_HUMAN			6	1078	-	Acute lymphoblastic leukemia(192;0.000127)		203					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.608A>G	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848846	0.32699	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.53423	0.62;0.62;0.62	3.41	-0.511	0.11970	.	2.284030	0.02364	N	0.077159	T	0.29061	0.0722	N	0.22421	0.69	0.09310	N	1	P	0.49358	0.923	B	0.35931	0.214	T	0.27739	-1.0065	10	0.72032	D	0.01	5.407	3.0973	0.06314	0.1838:0.2308:0.0:0.5853	.	203	Q9BXU7	UBP26_HUMAN	C	203	ENSP00000359869:Y203C;ENSP00000423390:Y203C;ENSP00000384360:Y203C	ENSP00000359869:Y203C	Y	-	2	0	USP26	131989307	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.248000	0.18198	-0.188000	0.10499	0.417000	0.27973	TAC		0.343	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		17	55	0	0	0	0.00499	0	17	55				
NELL2	4753	broad.mit.edu	37	12	44917237	44917242	+	In_Frame_Del	DEL	CTGTGC	CTGTGC	-			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	CTGTGC	CTGTGC	-	-	CTGTGC	CTGTGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr12:44917237_44917242delCTGTGC	ENST00000429094.2	-	17	2334_2339	c.1830_1835delGCACAG	c.(1828-1836)aggcacagc>agc	p.RH610del	NELL2_ENST00000452445.2_In_Frame_Del_p.RH610del|NELL2_ENST00000333837.4_In_Frame_Del_p.RH633del|NELL2_ENST00000551601.1_In_Frame_Del_p.RH562del|NELL2_ENST00000437801.2_In_Frame_Del_p.RH660del|NELL2_ENST00000395487.2_In_Frame_Del_p.RH609del|NELL2_ENST00000549027.1_In_Frame_Del_p.RH609del	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	610	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ATTGGCACAGCTGTGCCTCCCGGTCC	0.442																																							uc001rog.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(1828-1836)AGGCACAGC>AGC		NEL-like protein 2 isoform b precursor																																				SO:0001651	inframe_deletion	4753				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity	g.chr12:44917237_44917242delCTGTGC	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1830_1835delGCACAG	12.37:g.44917237_44917242delCTGTGC	ENSP00000390680:p.Arg610_His611del		Somatic				NELL2_uc001rof.3_In_Frame_Del_p.RH609del|NELL2_uc001roh.2_In_Frame_Del_p.RH610del|NELL2_uc009zkd.2_In_Frame_Del_p.RH562del|NELL2_uc010skz.1_In_Frame_Del_p.RH660del|NELL2_uc010sla.1_In_Frame_Del_p.RH633del|NELL2_uc001roi.1_In_Frame_Del_p.RH610del	p.RH610del	NM_001145108	NP_001138580	WXS	Illumina HiSeq	Unspecified	Q99435	NELL2_HUMAN		GBM - Glioblastoma multiforme(48;0.092)	17	2425_2430	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	610_611			EGF-like 6; calcium-binding (Potential).		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	In_Frame_Del	DEL	ENST00000429094.2	37	c.1830_1835delGCACAG	CCDS8746.1																																																																																				0.442	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159		13	72	NA	NA	NA	NA	NA	13	72	---	---	---	---
PIGB	9488	broad.mit.edu	37	15	55631502	55631503	+	Frame_Shift_Ins	INS	-	-	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr15:55631502_55631503insT	ENST00000164305.5	+	7	1123_1124	c.832_833insT	c.(832-834)attfs	p.I278fs	PIGB_ENST00000539642.1_Frame_Shift_Ins_p.I83fs|CCPG1_ENST00000563294.1_5'Flank	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	278					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		GATTGATCGTATTTTTTTTGGC	0.282																																							uc002act.2		NA																	0					0						c.(832-834)ATTfs		phosphatidylinositol glycan, class B																																				SO:0001589	frameshift_variant	9488				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity	g.chr15:55631502_55631503insT	D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.840dupT	15.37:g.55631510_55631510dupT	ENSP00000164305:p.Ile278fs		Somatic				PIGB_uc010ugg.1_Frame_Shift_Ins_p.I83fs	p.I278fs	NM_004855	NP_004846	WXS	Illumina HiSeq	Unspecified	Q92521	PIGB_HUMAN		all cancers(107;0.0255)	7	1148_1149	+			278					Q53FF9|Q8WVN7	Frame_Shift_Ins	INS	ENST00000164305.5	37	c.832_833insT																																																																																					0.282	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29661894	29661894	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr17:29661894delC	ENST00000358273.4	+	40	6234	c.5851delC	c.(5851-5853)ccafs	p.P1951fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.P1930fs|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000581113.2_3'UTR|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1951			P -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.M1949fs*2(1)|p.P1951fs*6(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATACATGACTCCATGGCTGTC	0.338			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		13	Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)	p.P1951L(1)|p.P1951fs*6(1)	soft_tissue(8)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(5851-5853)CCAfs		neurofibromin isoform 1							120.0	113.0	115.0					17																	29661894		2203	4300	6503	SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29661894delC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5851delC	17.37:g.29661894delC	ENSP00000351015:p.Pro1951fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Frame_Shift_Del_p.P1930fs|NF1_uc010cso.2_Frame_Shift_Del_p.P139fs|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	p.P1951fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	40	6184	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	1951		P -> L (in a colorectal cancer sample; somatic mutation).			O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	c.5851delC	CCDS42292.1																																																																																				0.338	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		13	56	NA	NA	NA	NA	NA	13	56	---	---	---	---
NFKBIB	4793	broad.mit.edu	37	19	39390759	39390759	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr19:39390759delG	ENST00000313582.5	+	1	121	c.87delG	c.(85-87)gcgfs	p.A30fs	SIRT2_ENST00000249396.7_5'Flank|SIRT2_ENST00000481381.1_5'Flank|NFKBIB_ENST00000392079.3_Frame_Shift_Del_p.R16fs|SIRT2_ENST00000392081.2_5'Flank|SIRT2_ENST00000358931.5_5'Flank|NFKBIB_ENST00000572515.1_Frame_Shift_Del_p.A30fs	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	30					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CGGACGCAGCGGCCCCCGGAG	0.706											OREG0032100	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									Pancreas(165;1492 2005 6979 7739 34483)	Pancreas(165;1492 2005 6979 7739 34483)	uc002ojw.2		NA																	0				lung(1)|kidney(1)	2						c.(85-87)GCGfs		nuclear factor of kappa light polypeptide gene							11.0	15.0	13.0					19																	39390759		2191	4282	6473	SO:0001589	frameshift_variant	4793				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity	g.chr19:39390759delG	L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.87delG	19.37:g.39390759delG	ENSP00000312988:p.Ala30fs		Somatic	OREG0032100	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	885	SIRT2_uc002oju.1_5'Flank|SIRT2_uc010egj.1_5'Flank|SIRT2_uc002ojv.1_5'Flank|SIRT2_uc002ojt.1_5'Flank|NFKBIB_uc010egk.1_Intron|NFKBIB_uc002ojx.2_Frame_Shift_Del_p.R16fs|NFKBIB_uc002ojy.2_Frame_Shift_Del_p.A29fs	p.A29fs	NM_002503	NP_002494	WXS	Illumina HiSeq	Unspecified	Q15653	IKBB_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)		1	145	+	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		29					A8K3F4|Q96BJ7	Frame_Shift_Del	DEL	ENST00000313582.5	37	c.87delG	CCDS12524.1																																																																																				0.706	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438155.1	NM_002503		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179614019	179614020	+	Intron	INS	-	-	T			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr2:179614019_179614020insT	ENST00000591111.1	-	45	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000360870.5_Frame_Shift_Ins_p.S4370fs|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCAGCTTTGATTTTTCACTTA	0.376																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(13105-13110)AAATCAfs		titin isoform novex-3																																				SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179614019_179614020insT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3830->A	2.37:g.179614024_179614024dupT			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.K4369fs	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13331_13332	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Ins	INS	ENST00000591111.1	37	c.13107_13108insA																																																																																					0.376	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		34	97	NA	NA	NA	NA	NA	34	97	---	---	---	---
CD93	22918	broad.mit.edu	37	20	23064979	23064981	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	CTT	CTT	-	-	CTT	CTT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chr20:23064979_23064981delCTT	ENST00000246006.4	-	1	1996_1998	c.1849_1851delAAG	c.(1849-1851)aagdel	p.K617del		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	617					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCTTCTTCTCCTTCTTCTCCTCC	0.591																																							uc002wsv.2		NA																	0				large_intestine(2)	2						c.(1849-1851)AAGdel		CD93 antigen precursor																																				SO:0001651	inframe_deletion	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23064979_23064981delCTT	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1849_1851delAAG	20.37:g.23064982_23064984delCTT	ENSP00000246006:p.Lys617del		Somatic					p.K617del	NM_012072	NP_036204	WXS	Illumina HiSeq	Unspecified	Q9NPY3	C1QR1_HUMAN			1	1997_1999	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		617			Cytoplasmic (Potential).		O00274	In_Frame_Del	DEL	ENST00000246006.4	37	c.1849_1851delAAG	CCDS13149.1																																																																																				0.591	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		30	166	NA	NA	NA	NA	NA	30	166	---	---	---	---
FAM47C	442444	broad.mit.edu	37	X	37028222	37028222	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5068-01A-01D-1625-08	TCGA-50-5068-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c1efdc48-6ea5-45f0-9fa3-94c42ecf3ab4	c2c22c1c-6411-423f-8e81-819f49e60803	g.chrX:37028222delC	ENST00000358047.3	+	1	1791	c.1739delC	c.(1738-1740)tccfs	p.S580fs		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	580										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ACTGGAGTGTCCCATCTCTGC	0.657																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(1738-1740)TCCfs		hypothetical protein LOC442444							47.0	53.0	51.0					X																	37028222		2202	4300	6502	SO:0001589	frameshift_variant	442444							g.chrX:37028222delC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1739delC	X.37:g.37028222delC	ENSP00000367913:p.Ser580fs		Somatic					p.S580fs	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	1753	+			580					Q6ZU46	Frame_Shift_Del	DEL	ENST00000358047.3	37	c.1739delC	CCDS35227.1																																																																																				0.657	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		12	86	NA	NA	NA	NA	NA	12	86	---	---	---	---
